pawitan. - webicdn.com · pawitan. editorial 167 prospect of alternative therapies to kidney...

Pawitan.Editorial

167

Prospect of alternative therapies to kidney transplantation

Jeanne A. Pawitan1–3

1 Department of Histology, Faculty of Medicine Universitas Indonesia, Jakarta, Indonesia.2 Stem Cell Medical Technology Integrated Service Unit, Cipto Mangunkusumo Central Hospital - Faculty of Medicine

Universitas Indonesia, Jakarta, Indonesia.3 Stem Cell and Tissue Engineering Research Center, Indonesia Medical Education and Research Institute (IMERI), Faculty of

Medicine Universitas Indonesia, Jakarta, Indonesia

Editorial

Medical Journal of Indonesia

In this issue, Mochtar et al1 described the historical milestones of kidney transplantation as standard therapy of end-stage renal disease (ESRD) in Indonesia. Kidney transplantation started in 1977, and showed ups and downs, due to various causes. Though in recent years there is a growth spurt in kidney transplantation number, it is still regarded as stagnant, as the coverage is less that 3% of ESRD cases. For patients with ESRD, available alternative approaches are hemodialysis or peritoneal dialysis, which are a life-long treatment; therefore, alternative approaches, which show comparable results to kidney transplantation are very prospective.

In recent years, stem cell therapy begins to enter human studies in Indonesia and show promises in various conditions, especially in orthopaedic cases.2 In Cipto Mangunkusumo Hospital (RSCM), other studies, which are using stem cells are ongoing, such as studies on osteoarthritis, spinal cord injury, 3rd degree burn wound, and near blind glaucoma. For the future, stem cell therapy studies for other various conditions, which have been proven in animals, are being established; therefore, stem cell therapy and stem cell related products might become an option for ESRD in the future. A meta-analysis of the effect of stem cells on chronic kidney disease (CKD) showed beneficial effect, which might give hope to ESRD cases, as the CKD in the study had various grades and some of them represent chronic renal failure.3

In the beginning of stem cell therapy, it was postulated that the stem cells would home to the damaged area and differentiate into the needed

cells to replace the damaged cells. However, most tracing studies showed that most of the stem cells did not replace the damaged cells. Moreover, some studies showed that stem cells might not home to the site of injury, but still, there were beneficial effects due to stem cell therapy. The mechanism of cure due to stem cell therapy is mostly due to stem cell and injured cell communication, which lead to paracrine signaling. Paracrine signaling leads to secretion of various beneficial factors by the stem cells, also known a trophic factors, such as various kind of anti-inflammatory cytokines, growth factors, and various kinds of membrane bound structures in the form of microvesicles and exosomes, which contain small RNAs, in the form of micro or small interfering RNAs, beneficial peptides and proteins, and even mitochondria. Further, these factors facilitate the healing of the injured cells and tissues.4

As the mechanism of healing in most stem cell therapies is due to the stem cell secreted factors, attempts to use these stem cell secreted factors, which are known as stem cell conditioned media or secretomes or metabolites, in various studies on degenerative diseases were conducted, and a systematic review on various studies showed beneficial effects of stem cell secretomes on various conditions, including CKD.5 Stem cell secretome or metabolite has an advantage compared to the stem cell itself, as it can be stored and transported easily compared to stem cells that should be stored in a cryopreservation facility and have a limited life span in their transport medium. In the future, stem cell metabolite, which can be frozen and freeze dried without losing their growth factor content, has a great potential to be developed into drug.

168 Med J Indones, Vol. 26, No. 3September 2017

Moreover, stem cells of mesodermal lineage, the mesenchymal stem cells, have a unique additional property, i.e. immunomodulation property that is widely used to mitigate the effects of host versus graft disease, which can be advantageous in kidney or other organ transplantation. Mesenchymal stem cells are also immune tolerant, as they show low expression of MHC class I, and no expression of MHC class II, which make them to be able to evade immune surveillance, and together with their immunomodulation property render them to be safe, even though they are not HLA matched.6

In conclusion, in ESRD stem cells or their metabolites might become prospective alternative therapies to kidney transplantation, while mesenchymal stem cells might be used to mitigate the effect of host versus graft disease in kidney transplantation.

REFERENCES

1. Mochtar CA, Alfarissi F, Soeroto AA, Hamid ARAH, Wahyudi I, Marbun MBH, Rodjani A, Susalit E, Rasyid N. Milestones of kidney transplantation in Indonesia. Med J Indones. 2017;26:229–36.

2. Dilogo IH, Primaputra MRA, Pawitan JA, Liem IK. Modified Masquelet Technique using Allogeneic Umbilical Cord-Derived Mesenchymal Stem Cells For Infected Non-Union Femoral Shaft Fracture with a 12 cm Bone Defect: A Case Report. Int J Surg Case Report. 2017;34:11–6.

3. Papazova DA, Oosterhuis NR, Gremmels H, van Koppen A, Joles JA, Verhaar MC. Cell-based therapies for experimental chronic kidney disease: a systematic review and meta-analysis. Dis Model Mech. 2015;8:281–93.

4. Prockop DJ. The exciting prospects of new therapies with mesenchymal stromal cells. Cytotherapy. 2017;19:1–8.

5. Pawitan JA. Prospect of stem cell conditioned medium in regenerative medicine. BioMed Res Int. 2014;965849.

6. Faiella W, Atoui R. Immunotolerant Properties of Mesenchymal Stem Cells: Updated Review. Stem Cells Int. 2016;1859567.

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.2308 • Med J Indones. 2017;26:167–8

Corresponding author: Jeanne A. Pawitan, [email protected]

Copyright @ 2017 Authors. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are properly cited.

http://mji.ui.ac.id

http://dx.doi.org/10.13181/mji.v26i3.2308

Layal, et al.Quercetin on nephrectomized rats

169

The effects of quercetin on oxidative stress and fibrosis markers in chronic kidney disease rat model

Keywords: chronic kidney disease, nephrectomy, Nrf2, oxidative stress, quercetin

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1462 • Med J Indones. 2017;26:169–77• Received 30 May 2016 • Accepted 31 Aug 2017

Corresponding author: Vivian Soetikno, [email protected]


Kamalia Layal, Ika S. Perdhana, Melva Louisa, Ari Estuningtyas, Vivian SoetiknoDepartment of Pharmacology and Therapeutics, Faculty of Medicine, University of Indonesia, Jakarta, Indonesia

Basic Medical Research

ABSTRAK

Latar belakang: Stres oksidatif diduga berperan dalam patogenesis penyakit ginjal kronik (PGK). Nuclear factor erythroid 2-related factor 2 (Nrf2) merupakan salah satu faktor transkripsi yang terlibat dalam mekanisme pertahanan sel dalam mengatasi stres oksidatif. Penelitian ini bertujuan mengetahui aktivitas kuersetin, komponen antioksidan polifenol dari buah dan sayuran, dalam memperbaiki stres oksidatif dan kerusakan ginjal pada tikus PGK menggunakan model nefrektomi 5/6.

Metode: Tikus Sprague-Dawley jantan dikelompokkan secara acak yaitu kelompok kontrol normal (C), kontrol nefrektomi 5/6 (Nx), nefrektomi 5/6 yang diberi kuersetin 100 mg/kgBB/hari (NxQ), dan nefrektomi 5/6 yang diberi kaptopril 10 mg/kgBB/hari selama 8 minggu (NxK). Di akhir perlakuan, semua hewan percobaan diterminasi untuk diperiksa plasma (kreatinin, ureum plasma, dan malondialdehid {MDA}), urin (kreatinin urin dan protein urin), dan jaringan ginjalnya (kadar MDA jaringan, aktivitas glutation peroksidase, histopatologi dan ekspresi Nrf2 melalui pemeriksaan histokimia dan ekspresi gen). Setelah itu, dilakukan pemeriksaan ekspresi gen Keap1 dan HO-1 pada jaringan ginjal.

Hasil: Pemberian kuersetin selama 8 minggu tidak mampu memperbaiki proteinuria, ureum, dan kreatinin plasma. Namun, pemberian kuersetin mampu menurunkan kadar MDA dan meningkatkan aktivitas glutation peroksidase serta ekspresi Nrf2, Keap1, dan HO-1.

Kesimpulan: Pemberian kuersetin cenderung memperbaiki kadar MDA, aktivitas GPx, ekspresi Nrf2, Keap1 dan HO-1. Pemberian kuersertin juga cenderung memperbaiki derajat fibrosis ginjal pada tikus yang menjalani nefrektomi 5/6.

ABSTRACT

Background: Oxidative stress may play a role in the pathogenesis of (CKD), Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor involved in cell defense mechanism against oxidative stress. In this study, we examined the effect of quercetin, a polyphenplic antioxidant anti fibrosis compund in fruits and vegetables, on the 5/6 nephrectomy-induced CKD progression model rats through modulation of Nrf2 expression.

Methods: Male Sprague-Dawley rats were randomly divided into normal control group (C), untreated 5/6 nephrectomy (Nx), quercetin-treated 5/6 nephrectomy (100 mg/kgBW/day orally) (NxQ), and captopril-treated 5/6 nephrectomy (10 mg/kgBW/day orally) (NxK) for 8 weeks. At the end of study, all animals were sacrified. Urine, blood, and kidney tissues were taken for examination of proteinuria, plasma creatinine, urea, malondialdehyde (MDA), glutathione peroxidase (GPx) activity, Nrf2, Keap1, heme oxygenase-1 (HO-1) expressions, and renal fibrosis.

Results: Quercetin administration did not affect the level of protein in urine, plasma creatinine, and urea. However, it tended to reduce the level of MDA, increase GPx activity, Nrf2, Keap1, and HO-1 expression as well as the degree of fibrosis.

Conclusion: In 5/6 nephrectomized rats, quercetin tended to ameliorate the level of MDA, GPx activity, Nrf2, Keap1, and HO-1 expression. In addition, quercetin tended to decrease the degree of fibrosis in the remnant kidney.




http://mji.ui.ac.id

Chronic kidney disease (CKD) is a serious public health problem characterized by a progressive and irreversible kidney damage resulting in a relentless decrease of renal function.1,–3 According to data from the Health Research Association in 2013, Indonesia has a 0.2% increase of CKD prevalence.4 It has been shown that oxidative stress and inflammation play an important role in the pathogenesis of CKD by a variety of mechanisms including the activation of nuclear factor-kappa B and the production of reactive oxygen species (ROS), reactive nitrogen species, halogen by a leukocytes, and resident cells.5 In addition to oxidative stress and inflammatory process, recent study showed that next to the changes in the expression of coagulation factors and plasma kallikrein, protein related to blood coagulation and platelet activation were also played important roles in the progression of CKD.6

Inhibition of progression of CKD is important. Several animal studies used active compounds that acted as antioxidants, anti-inflammatory, or antifibrosis to inhibit the progression of CKD. It improved the structure and the function of kidney through the reduction of oxidative stress and inflammation. We have showed that curcumin, a powerful antioxidant, can attenuate oxidative stress, inflammatory response, and renal fibrosis in rats with 5/6 nephrectomy via activation of nuclear factor eryhtroid 2-related factor 2 (Nrf2).7 Nrf2, which binded to its inhibitor Kelch-like ECH-associated protein 1 (Keap1), was a transcription factor responsible for the induction of cytoprotective and antioxidant enzymes such as heme-oxygenase-1 (HO-1) and glutathione peroxidase (GPx).8 Therefore, compounds that act as antioxidants or induce Nrf2 may have a potential to be used as a therapy in CKD.

Quercetin is a polyphenolic compound found in common vegetables and fruits.9,10 It has many benefits for health such as an antioxidant, antifibrotic, anticancer11,12 and anti-inflamamation.13 In vitro study suggests that quercetin could be used againts oxidative stress caused by dimethoate in human blood lymphocyte.14 Quercetin increased the level of Nrf2 and stimulated gene expression of NADPH Quinones Oxireductase mediated by Nrf2-ARE in human hepatoma HepG2 cells.15 Moreover, in vivo study suggests that quercetin ameliorated kidney injury in diabetic nephropathy.16

We hypothesized that quercetin might ameliorate the progression of CKD through inhibition of oxidative stress and fibrosis. To elucidate this issue, weanalyzed the effects of quercetin on the progression of CKD using 5/6 nephrctomy model through Nrf2 pathway, a transcription factor responsible for cellular defense and survival pathway against oxidative stress.

METHODS

Animals Male Sprague Dawley rats (150–300 g) were obtained from the National Agency of Drug and Food, Republic of Indonesia. Animals were housed in constant temperature room, maintained in 12:12 light–dark cycle, and allowed free access to food and water. The experimental protocols were approved by the Health Research Ethics Committee, Faculty of Medicine, University of Indonesia (No. 190/H2.F1/ETIK/2014).

Experimental Protocol Animals were randomly divided into four groups (n=6 each), namely the normal control (C) group which underwent sham operation, untreated 5/6 nephrectomy (Nx) group, quercetin-treated 5/6 nephrectomy (NxQ) group, and captopril-treated 5/6 nephrectomy (NxK) group. Untreated 5/6 nephrectomy (Nx) group underwent 5/6 nephrectomy by surgical resection in the ventral abdomen to expose the left kidney, place a piece of suture in the upper and lower thirds of the left kidney, and ligate around each pole of the kidney at its one-third position. The one-third kidney on each pole was excised beyond the ligatures. This procedure was followed by a whole right kidney ablation seven days later. Furthermore, quercetin-treated 5/6 nephrectomy (NxQ) group underwent 5/6 nephrectomy, and one week after the second surgery, they received 100 mg/kg oral quercetin daily for eight weeks. Captopril-treated 5/6 nephrectomy (NxK) group underwent 5/6 nephrectomy, and one week after the second surgery, they received 10 mg/kg oral captopril daily for eight weeks.

Quercetin and captopril were dissolved in 0.5% carboxymethyl cellulose. The surgical procedures were carried out under general anesthesia (Ketalar 50 mg/kg i.p.) using an aseptic technique and given ampicillin 25 mg/kg for three days for


171

infection prophylaxis. During the study, the body weight was measured every week. Twenty four-hour urine samples collected in metabolic cages at baseline (t0), before oral therapy (t1), four week after oral therapy (t2), and 12 week after oral therapy (t3). At the end of study, the animals were decapitated. Blood samples and kidney tissues were collected for further analysis. We used 5/6 nephrectomy model as it mimicked the progressive chronic kidney disease after loss of renal mass in human. It was shown that the imbalance in redox status was evident at an early stage of CKD and became more profound with the progression of kidney diseases. Therefore, we used quercetin as a potent antioxidant to halt the progression of CKD in animal model.

Blood and urine chemistries Blood samples from decapitation were collected in heparin tubes and centrifuged at 3000 rpm (10 min, 4°C) for separation of plasma. The collected plasma was utilized for determination of creatinine and urea. Plasma creatinine level was determined by Jaffe method whereas urea level by urease and glutamate dehydrogenase enzymatic reaction method. The collected 24-hour urine was centrifuged at 3000 g (10 min, 23°C). Volume and protein content was measured, and protein in urine was determined by Bradford method.

Measurement of malondialdehyde (MDA) level Kidney tissues (100 mg) were rinsed and homogenized in 1 mL of 0.1 M phosphate buffer saline (pH 7.4). After centrifugation at 3000 rpm (10 min, 4°C), the supernatants were collected and analyzed by TBA colorimetric method. In addition, the level of MDA was measured spectrophotometrically on UV-VIS spectrophotometer at 535 nm. Measurement of GPx activityKidney tissues (100 mg) were homogenized in 1 mL of 0.1 M phosphate buffer saline (pH 7.4) and added 0.1% protein inhibitor cocktail. After centrifugation at 3000 rpm (10 min, 4°C), the supernatants were collected and analyzed. GPx activity was measured using spectrophotometer according to assay kit instructions (Randox). The oxidation of reduced nicotinamide adenine dinucleotide phosphate (NADPH) to nicotinamide adenine dinucleotide phosphate was measured by the decrease in absorbance at 340 nm.

Immunohistochemistry of Nrf2 Formalin-fixed, paraffin-embedded kidney tissue sections were used for immunohistochemistry staining. After deparafinization and hydration, the slides were washed in PBST. Immunohistochemistry staining was performed using NovolinkTM Polymer Detection System with the primary antibody (Nrf2) purchased from Santa Cruz (diluted 1:50). The procedures of staining were based on assay kit instruction. Microphotography analysis was determined using microscope photo-optilab (Optilab® Image Raster v.2.1). The number of positive cells (stained brown in nucleus) was counted on five large fields randomly at x400 magnification.

Histopathological analysisLight microscopy was performed in formalin-fixed sections (4 µm) with Masson’s Trichrome staining as indicator of fibrosis. Fibrosis was graded by two independent pathologists. To analyze renal fibrosis, we used analysis criteria by Chen et al12 and Gibson-Corley et al.17 The accumulation of collagen in the interstitial renal cortex was up to 5%, and the renal capsule was not thick. The slightly collagen accumulation (6–25%) accompanied by a thickening of the renal capsule, moderate accumulation of collagen (26–50%) accompanied by a thickening of the renal capsule, and severe collagen accumulation (>50%) accompanied by a thickening of the kidney capsule (sometimes with glomerulosclerosis) were graded as 0, 1, 2 and 3 respectively.

RNA extractionTotal RNA was extracted after kidney homogenization using Ultra TurraxT8 in TriPure isolation reagent (Roche Life Sciences) according to the standard protocol. cDNA was

Primer Primer sequence (5’-3’) forwardPrimer sequence (5’-3’) reverse

Nrf2 5’- AGC-ATG-ATG-GAC-TTG-GAA-TTG-3’5’-) CCT-CCA-AAG-GAT-GTC-AAT-CAA-3’

Keap 1 5’- CAG-CGT-GCT-CGG-GAG-TAT-3’5’- GTG-TGA-CAG-GTT-GAA-GAA-CTC-CT-3’

HO-1 5’- GTC-AAG-CAC-AGG-GTG-ACA-GA-3’5’- CTG-CAG-CTC-CTC-CTC-AAA-CAG-3’

Beta-actin 5’- CCC-GCG-AGT-ACA-ACC-TTC-3’5’- CGT-CAT-CCA-TGG-CGA-ACT-3’

Table 1. Primer sequences



http://mji.ui.ac.id

synthesized by using total RNA (2 mg) as a template and was synthesized according to Transcriptor first strand cDNA synthesis kit (Roche Life Sciences).

Gene expression analysis by real-time RT-PCRGene expression analysis was performed by real-time reverse transcription polymerase chain reaction (RT-PCR) using cDNA synthesized from the kidney specimen. Primer sequences were as follows: Relative quantification of real-time RT-PCR results were analyzed using Livak method.17

Statistical analysisAll analysis of the experiments were performed in duplicate. Data were expressed as mean ± SD and were analyzed statistically using one-way ANOVA followed by post-hoc (LSD) test. The results were considered statistically significant at p<0.05. If the data were not normal distribution and not homogenous, data were expressed as median, minimal and maximal value and were analyzed statistically by Kruskal-Wallis followed by Mann-Whitney test. The results were considered statistically significant at p<0.05.

RESULTS

Effect of quercetin and captopril on body weightThe survival rate after 5/6 nephrectomy surgery was 57%. After 5/6 nephrectomy, the body weight of all rats tended to decrease. The Nx group had more decreased of body weight compared to

Figure 1. A) Changes in body weight during the study. Neprectomized rats exhibited a reduced of body weight as compared to the other groups. C: normal control; Nx: untreated 5/6 nephrectomized rats; NxQ: nephrectomized rats + quercetin treatment; NxK: nephrectomized rats + captopril treatment; B) Proteinuria was elevated in the 5/6 nephrectomized rats in comparison with the normal control group. At the end of study (week-12), proteinuria significantly increased in Nx, NxQ, and NxK as compared to C (p<0.05). However, proteinuria in the NxQ group still increased as compared to that of the Nx group

the other groups throughout the study period although it was not statistically significant compared to the other groups.

Effect of quercetin and captopril on protein in urine, plasma creatinine, and plasma ureaAt the end of the study, the Nx group exhibited increased protein in urine, plasma creatinine, and urea as compared to that of the C group. As shown in Figure 2, the Nx group and the NxQ group showed increased protein in urine throughout the study period as compared to the C group while captopril treatment decreased the protein in urine significantly compared to the Nx group and the NxQ group.

Effect of quercetin and captopril on MDA level and GPx activityChronic kidney disease has been reported to be related with increased ROS generation and oxidative stress. Kidney lipid peroxidation was determined by MDA analysis. Increased level of MDA and GPx activity in the kidney tissues were found in the Nx group compared with the C group. Treatment with quercetin and captopril decreased the MDA levels. Quercetin treatment also slightly increased the GPx activity although it did not reach a statistically significant compared to that of the Nx group.

Effect of quercetin and captopril on renal expression of Nrf2, Keap1, and HO1Renal Nrf2 protein expression assessed by immunohistochemistry staining was decreased in the Nx group compared with those in the C group. On the other hand, quercetin and captopril

BA

Bod

y w

eigh

t (gr

am)

C

Nx

NxQ

NxK

0

20

40

60

80

100

120

t0 t1 t2 t3

Prot

einu

ria (m

g/24

h)

C

Nx

NxQ

NxK

A

B

Figure 1

Bod

y w

eigh

t (gr

am)

C

Nx

NxQ

NxK

0

20

40

60

80

100

120

t0 t1 t2 t3

Prot

einu

ria (m

g/24

h)

C

Nx

NxQ

NxK

A

B

Figure 1

Body

wei

ght (

gram

)

Prot

einu

ria

(mg/

24h)

450400300300250200150100

500

1 2 3 4 5 6 7 8 9 10 11 12Week Time

CC

NxNx

NxQNxQ

NxKNxK

120100

80604020

0T0 T1 T2 T3


173

treatment ameliorated these decreases in the Nx group although it did not reach a statistically significant result. In line with protein analysis, renal Nrf2 mRNA expression assessed by RT-PCR was also lower in the Nx group compared with those in the C group. Quercetin and captopril treatment increased the Nrf2 protein and mRNA

Figure 2. MDA level (A) and the activity of GPx (B) in kidney tissues of the Nx group increased as compared to that of the other groups, though not significantly different (p>0.05). C: normal control; Nx: untreated 5/6 nephrectomized rats; NxQ: nephrecto-mized rats + quercetin treatment; NxK: nephrectomized rats + captopril treatment; B) in kidney tissues were not different among groups based on ANOVA analysis (p>0.05). C: normal control; Nx: untreated 5/6 nephrectomized rats; NxQ: nephrectomized rats + quercetin treatment; NxK: nephrectomized rats + captopril treatment

Figure 3. A) Immunohistochemistry staining of Nrf2 in the remnant kidney rats in the Nx group exhibited decreased of Nrf2 positive cells in the nucleus of glomerulus. C: normal control; Nx: untreated 5/6 nephrectomized rats; NxQ: nephrectomized rats + quercetin treatment; NxK: nephrectomized rats + captopril treatment; B) Quantitatively analysis of Nrf2 of immunohistochem-istry staining showed that Nrf2 positive cells in the Nx group decreased as compared to the other groups, though not significantly different (p>0.05). C: normal control; Nx: untreated 5/6 nephrectomized rats; NxQ: nephrectomized rats + quercetin treatment; NxK: nephrectomized rats + captopril treatment

expression in the kidney tissues. We found that mRNA expression of Keap1 and HO1 were decreased in the Nx group compared with the C group. Treatment with quercetin and captopril increased the mRNA expression of Keap1 and HO1 as well even though it did not show a statistically significant.

median 0.0421 0.0467 0.0378 0.0452(min-max)

(0.0219-0.0501)

(0.0366-.0681)

(0.0268-0.0859)

(0.0428-0.0862)

0.00

0.40

0.80

1.20

1.60

C Nx NxQ NxK

GPx

act

ivity

(U/m

g pr

otei

n)

0.02

0.04

0.06

0.08

0.10

C Nx NxQ NxK

MD

A (n

mol

/mg

prot

ein)

mean 0.8397 0.9490 0.9631 0.8038

SD 0.1352 0.2547 0.4896 0.2160

Figure 2

A B

median 0.0421 0.0467 0.0378 0.0452(min-max)

(0.0219-0.0501)

(0.0366-.0681)

(0.0268-0.0859)

(0.0428-0.0862)

0.00

0.40

0.80

1.20

1.60

C Nx NxQ NxK

GPx

act

ivity

(U/m

g pr

otei

n)

0.02

0.04

0.06

0.08

0.10

C Nx NxQ NxK

MD

A (n

mol

/mg

prot

ein)

mean 0.8397 0.9490 0.9631 0.8038

SD 0.1352 0.2547 0.4896 0.2160

Figure 2

A B

A B

C

NxQNxK

Nx

A B

Figure 3

IHCNrf2

C

NxQNxK

Nx

A B

Figure 3

IHCNrf2 A B

Nrf

2 (c

ell/

HPF

)

9.00

8.007.006.005.004.003.002.001.000.00

C Nx NxQ NxK

Mean 4.1 3.27 3.7 4.93SD 2.23 1.65 2.82 3.46

MDA

(nm

ol/m

g pr

otei

n)

0.10

0.08

0.06

0.04

0.02C Nx NxQ NxK

Median 0.0421 0.0467 0.0378 0.0452(min-max) (0.0219-

0.0501)(0.0366-0.0681)

(0.0268-0.0859)

(0.0428-0.0862)

GPx

activ

ity (U

/mg

Prot

ein)

1.60

1.20

1.80

1.40

0.00C Nx NxQ NxK

Mean 0.8397 0.9490 0.9631 0.8038SD 0.1352 0.2547 1.4896 0.2160



http://mji.ui.ac.id

Effect of quercetin and captopril on histopathology findingsHistological examination of the kidney of the Nx group had marked histological changes such as sclerosis as shown in the glomerulus (Figure 5A). Figure 5B showed representative Masson’s

Figure 4. A) mRNA expression of Nrf2 in the Nx group decreased as compared to that of other groups based on Kruskal-Wallis analysis (p=0.039). C= normal control; Nx= untreated 5/6 nephrectomized rats; NxQ= nephrectomized rats + quercetin treatment; NxK= nephrectomized rats + captopril treatment; B) mRNA expression of Keap1 in the Nx group decreased as compared to that of other groups based on Kruskal-Wallis analysis (p=0.011); C) mRNA expression of HO-1 in the Nx group decreased though not significantly different as compared to that of other groups based on Krus-kal-Wallis analysis (p=0.413)

Figure 5. Hematoxyllin-eosin (H-E) staining of the remnant kidney of the Nx group showed glomerulosclerosis as com-pared to that of the other groups. Masson’s trichrome (MT) staining showed kidney structures in different groups. Fi-brosis is indicated by the blue area (magnification x100) in interstitial cortex

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Kea

p1/B

eta

actin

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Nrf

2/B

eta

actin

Figure 4

A B

C Nx NxK NxQ

mR

NA

expr

essi

on o

f HO

-1/B

eta

actin

C

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Kea

p1/B

eta

actin

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Nrf

2/B

eta

actin

Figure 4

A B

C Nx NxK NxQ

mR

NA

expr

essi

on o

f HO

-1/B

eta

actin

C

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Kea

p1/B

eta

actin

C Nx NxK NxQ

mR

NA

expr

essi

on o

f Nrf

2/B

eta

actin

Figure 4

A B

C Nx NxK NxQ

mR

NA

expr

essi

on o

f HO

-1/B

eta

actin

C

C

B

A C Nx

NxK NxQ

C Nx

NxQNxK

Figure 5

H-E

Masson’s trichrome

0

1

2

3

C Nx NxQ NxK

The

degr

ee o

f ren

al

fibro

sis

median 1 2 2 2(min-maks)

(0-1) (2-3) (1-3) (1-3)

A

B

C Nx

NxK NxQ

C Nx

NxQNxK

Figure 5

H-E

Masson’s trichrome

0

1

2

3

C Nx NxQ NxK

The

degr

ee o

f ren

al

fibro

sis

median 1 2 2 2(min-maks)

(0-1) (2-3) (1-3) (1-3)

A

BB

A

mRN

A ex

pres

sion

of N

rf2/

Beta

act

in

0

0

5

10

15

20

25

35

30

2

4

6

8

10

12

14

C Nx NxQNxK

mRN

A ex

pres

sion

of K

eap1

/Bet

a ac

tin

C

C

Nx

Nx

NxQ

NxQ

NxK

NxK

mRN

A ex

pres

sion

of H

O-1/

Beta

act

in

The

degr

ee o

f ren

al fi

bros

is

0

0

1

2

3

2468

1214161820

10

H-E

MT

C Nx NxQ NxK

Median 1 2 2 2(min-max) (0-1) (2-3) (1-3) (1-3)

{

{


175

trichrome staining of glomeruli and tubuli of all groups and the degree of the renal fibrosis. The kidney of the Nx group showed marked interstitial fibrosis. Quercetin and captopril treatment improved slightly the histological changes in the kidney of the Nx group.

DISCUSSION

Chronic kidney disease (CKD) is a progressive disease characterized by a loss of nephron. This condition is associated with a compensatory glomerular hyperfiltration, which increased intraglomerular and triggeredglomerular permeability barrier damage. This leads to protein leakage across glomerular capillaries into Bowman’s space. Protein loss will be reabsorbed by tubules, injured the interstitium tubules cells and finally induced inflammation. This was associated with the upregulation of oxidative stress.2,19

Our study demonstrated that 5/6 nephrectomy, a CKD model, in rats led to proteinuria and increased plasma levels of creatinine and urea. In the present study, we also observed that there was a structural damage of the remnant kidney. This impairment was associated with the increased of oxidative stress as shown by upregulation of MDA levels and slightly reduced GPx activity. Furthermore, it was associated with the decreased expression of Nrf2 and the decreased expression of Keap1 and HO1 which resulted in an increased of fibrotic tissues in the remnant kidney. To assess whether quercetin might have a beneficial role in CKD model, we compared it with captopril. We demonstrated that quercetin could not ameliorate the proteinuria as compared to that of captopril treatment. Quercetin and captopril treatment also could not decrease the plasma creatinine and urea in nephrectomized rats. However, both treatments were able to ameliorate the 5/6 nephrectomy-induced oxidative stress as shown by the decreased of MDA levels, the increased of GPx activity, and the increased of Nrf2, Keap1 and HO1 expression.

It has been shown that captopril could reduce proteinuria more effectively than other antihypertensive. In this study, we also showed that administration of captopril as a comparator to that of quercetin, could reduce proteinuria. Unfortunately, the administration of quercetin

was unable to reduce it. In fact, our finding was in agreement with the previous study by Rangan et al20 which showed that quercetin could not reduce protein urine excretion.

Levels of plasma urea and plasma creatinine were used for estimation of renal function. In this eight weeks study after 5/6 nephrectomy, we found that plasma creatinine was increased in the Nx group significantly compared to the C group. Both quercetin and captopril treatments tended to increase plasma creatinine instead of decreased plasma creatinine. This result was similar to the study by Amann et al21 which suggested that 5/6 nephrectomy only slightly increased plasma creatinine. Kim and Vaziri demonstrated that the longer the CKD occured, the worse the increase of serum creatinine.22 Ahmed et al23 demonstrated that the administration of angiotensin converting enzyme inhibitor (ACEI) in the early phase of CKD increased serum creatinine mildly to moderately in patients with deterioration of renal function due to the loss of renal mass which lead to perturbation in the autoregulatory mechanism of the remaining renal vasculature. Subsequently, renal function would either improve or resolve with long-term blood pressure control, reflecting restoration of renal autoregulation towards normal function. ACEI-induced efferent vasodilation also decreased intraglomerular pressure, thereby increased plasma creatinine level24 which might confirm that our 5/6 nephrectomy model was in the early phase of disease. Previous study also showed that ACEI was unable to overcome the uremia.21 Urea is the end product of protein catabolism and digestion. Uremic solutes may have certain characteristics such as large size, large volume of distribution, highly protein bound, able to form crystal deposits, and finally increase production in the uremic state.25 Consistent with the previous study, we demonstrated that both quercetin and captopril treatments were unable to decrease plasma urea.

Chronic conditions of kidney disease will increase reactive oxygen species (ROS) formation in cells. The increase of ROS formation will be balanced by the increase of endogenous antioxidant. Thus, oxidative stress, means imbalance between the prooxidant and antioxidant levels in favor of prooxidant, will not occur. However, long-term increase of ROS formation will impair the antioxidant activity against oxidative stress. In this



http://mji.ui.ac.id

study, we found that 5/6 nephrectomy increased the malondialdehyde (MDA) levels, products of lipid peroxidation, and the glutathione peroxidase (GPx) activity, an endogenous compound, compared to that of normal group. It suggested that the remnant kidney cells still have the ability to protect against the increased of ROS formation. We also found that quercetin treatment tended to reduce the MDA levels and increase the GPx activity compared to the captopril treatment. In fact, our findings were consistent with the previous study by Shindu et al26 who demonstrated that there were no significant changes of GPx activity in renal insufficiency.

It has been shown that the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element antioxidant pathway has a crucial role in the ability of renal cells to cope with CKD-induced oxidative stress.22 Under unstimulated conditions, Nrf2 is sequestered in the cytoplasma bound to its repressor molecule, Kelch-like ECH-associated protein 1 (Keap1). When exposed to oxidative stress derived from accumulation of ROS, Nrf2 is rapidly dissociated and translocated into the nucleus, inducing gene encoding antioxidant enzymes. In this study, despite oxidative stress which should lead to Nrf2 activation, 5/6 nephrectomy-induced CKD showed reduction of Nrf2 nuclear expression as shown in immunohistochemistry staining. This result confirmed that in 5/6 nephrectomy-induced CKD, some process may halt the translocation of Nrf2 into nucleus. Similar results were found by our group7 and Kim and Vaziri.22 We also have demonstrated that there was an increase of Keap1 and heme-oxygenase-1 (HO-1) gene expression in the Nx group as compared to the control group. Our results were consistent with other studies conducted by Aminzadeh et al, which was shown that the Nrf2 activation was impaired in rats undergoing CKD due to tubule-interstitial nephropathy, and it was accompanied by elevation of cytoplasmic Keap1.5 Interestingly, we demonstrated that both quercetin and captopril treatments increased the expression of Nrf2 in the nucleus and increased Keap1 and HO-1 gene expression.

CKD, oxidative stress, and inflammation were related to each other. Renal Fibrosis is the final manifestation of CKD, characterized by tubulointerstitial fibrosis and glomerulosclerosis

due to an excessive accumulation of extra-cellular matrix component.27 Our results showed that the degree of fibrosis significantly increased with 5/6 nephrectomy. Both quercetin and captopril treatment ameliorated the degree of fibrosis although the results did not reach statistically significant.

One of the limitations of our study is that the 5/6 nephrectomy surgery was difficult, and the exactly molecular mechanisms which involved in the development of chronic kidney disease was not thoroughly investigated in this study, such as coagulation factors and inflammatory process. Further study with a longer duration of study will elucidate the truly molecular mechanism of quercetin to halt the progression of CKD.

In conclusion, we have demonstrated that quercetin administration reduced oxidative stress and decreased the degree of fibrosis in the remnant kidney of animals with CKD induced by 5/6 nephrectomy, at least in part, through the increased of Nrf2 nuclear expression, Keap1, and HO-1 mRNA expression. However, quercetin could not ameliorate proteinuria and the increased of plasma creatinine and urea. It needs a further study to use queretin as a promising agent to ameliorate the progression of CKD in human.

Conflict of interestMelva Louisa and Vivian Soetikno are editorial board members but were not involved in the review or decision for the article.

AcknowledgmentThis research was supported by a grant from the Directorate of Research and Community Services, Indonesia. We thank dr. Tito and dr. Radiana for their assistance in this research work.

REFERENCES

1. Quiroz Y, Ferrebuz A, Vaziri ND, Iturbe BR. Effect of chronic antioxidant therapy with superoxide dismutase-mimetic drug, tempol, on progression of renal disease in rats with renal mass reduction. Nephron Exp Nephrol. 2009;112:e31–42.

2. K/DOQI [Internet]. Clinical practice guidelines for chronic kidney disease: evaluation, classification and stratification. New York: National Kidney Foundation. [updeted 2008; cited 2016]. Availabel from: https://www.kidney.org/sites/default/files/docs/ckd_evaluation_classification_stratification.pdf


177

3. Rivera JR, Ortiz A, Egido J. Antioxidant in kidney disease: the impact of bardoxolone methyl. Int J Nephrol. 2012.

4. Kementerian Kesehatan RI. Badan Penelitian dan Pengembangan. Riskesdas 2013. Jakarta. Indonesian.

5. Aminzadeh MA, Nicholas SB, Norris KC, Vaziri ND. Role of impaired Nrf2 activation in the pathogenesis of oxidative stress and inflammation in chronic tubule-interstitial nephropathy. Nephrol Dial Transpl. 2013.

6. Glorieux G, Mullen W, Duranton F, Filip S, Gayrard N, Husi H, Schepers E, et al. New insights in molecular mechanisms involved in chronic kidney disease using high-resolution plasma proteome analysis. Nephrol Dial Transplant. 2015; 30: 1842–52.

7. Soetikno V, Sari FR, Lakshmanan AP, Arumugam S, Harima M, Suzuki K, et al. Curcumin alleviate oxidative stress, inflammation, and renal fibrosis in remnant kidney through the Nrf2-keap1 pathway. Mol Nutr Food Res. 2013;57:1649–59.

8. Ma Q. Role of Nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013; 53:401–26.

9. Boots AW, Haenen GRMM, Bast A. Health effect of quercetin: from antioxidant to nutraceutical. Eur J Pharmacol. 2008;585:325–37.

10. Sriraksa N, Wattanathorn J, Muchimapura S, Tiamkao S, Brown K, Chaisiwamongkol K. Cognitive enhancing effect of quercetin in a rat model of parkinson’s disease induced by 6-hydroxydopamine. Evid Based Complement Med. 2012.

11. Lin SY, Wang YY, Chen YC, Chuang YH, Pan PH, Chen CJ. Beneficial effect of quercetin on cholestatic liver injury. J Nut Biochem. 2014.

12. Chen SF, Nien S, Wu CH, Liu CL, Chang YC, Lin YS. Reappraisal of the anticancer efficacy of quercetin in oral cancer cells. J Chin Med Assoc. 2013;76:146–52.

13. Kleemann R, Verschuren L, Morrison M, Zadelaar S, Erk MJV, Wielinga PY, Kooistra T. Anti-inflammatory, anti-proliverative and anti-atherosclerotic effect of quercetin in human in vitro and in vivo models. Atheroscler. 2011;218:44–52.

14. Gargouri B, Mansour RB, Abdallah FB, Elfekih A, Lassoued S, Khaled H. Protective effect of quercetin against oxidative stress caused by dimethoate in human peripheral blood lymphocytes. Lipids Health Dis. 2011.

15. Tanigawa S, Fujii M, Hou DX. Action of Nrf2 and keap 1 in ARE-medaited NQO1 expression by quercetin. Free Radic Biol Med. 2007;42:1690–703.

16. Wang C, Pan Y, Zhang QY, Wang FM, Kong LD. Quercetin and allopurinol ameliorate kidney injury in STZ-treated rats with regulation of renal NLRP3 inflammasome activation and lipid accumulation. PLoS One. 2012;7(6):e38285.

17. Gibson-Corley KN, Olivier AK, Meyerholz DK. Principles for valid histopathologic scoring in research. Vet Pathol. 2013 Nov;50(6):1007-15.

18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and 2-ΔΔC

T method. Methods. 2001;25:402–8.19. Fedorova LV, Tamirisa A, Kennedy DJ, Haller ST, Budnyy

G, Shapiro JI, et al. Mitochondrial impairment in the five-sixth nephrectomy model of chronic renal failure: proteomic approach. BMC Nephol. 2013;14:209.

20. Rangan GK, Wang Y, Harris DCH. Dietary quercetin augment activator protein-1 and doesn’t reduce NF-κB in the renal cortex of rats with established chronic glomerular disease. Nephron. 2002;90:313–9.

21. Amann K, Gassmann P, Buzello M, Orth SR, Tornig J, Gross ML, et al. Effect of ACE inhibition and bradykinin antagonism on cardiovascular changes in uremic rats. Kidney Int. 2000;58:153–61.

22. Kim HJ, Vaziri ND. Contribution of impaired Nrf2-Keap1 pathway to oxidative stress and inflammation in chronic renal failure. Am J Physiol Renal Physiol. 2010;298:F662–71.

23. Ahmed AK, Kamath NS, El Kossi M, El Nahas AM. The impact of stopping inhibitors of the renin-angiotensin system in patients with advanced chronic kidney disease. Nephrol Dial Transplant. 2010 Dec;25(12):3977-82.

24. Palmer BF. Angiotensin converting enzyme inhibitors and angiotensin receptor blockers: what to do if serum creatinine and or serum potassium concentration rises. Nephrol Dial Transplant. 2003;18:1973–5.

25. Meyer TW, Hostetter TH. Uremia. N Engl J Med. 2007;357:1316–25.

26. Sindhu RK, Ehdaie A, Farman F, Dhaliwal KK, Nguyen T, Zhan CD, et al. Expression of catalase and glutathione peroxidase in renal insufficiency. Biochim Biophys Acta. 2005:86–92.

27. Cho MH. Renal fibrosis. Korean J Pediatr. 2010;53(7):735–40.



Knock-out transmembrane prostate androgen-induced protein gene suppressed triple-negative breast cancer cell proliferation

Keywords: proliferation, TGF-β, TMEPAI, triple negative breast cancer

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1823 • Med J Indones. 2017;26:178–82• Received 07 Feb 2017 • Accepted 06 Sep 2017

Corresponding author: Melva Louisa, [email protected]


Bantari W.K. Wardhani,1 Meidi U. Puteri,2 Yukihide Watanabe,3 Melva Louisa,4 Rianto Setiabudy,4 Mitsuyasu Kato3

1 Doctoral Program in Biomedicine, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia2 Medical Science Master Program, Graduate School of Comprehensive Human Science, University of Tsukuba, Japan3 Departement of Experimental Pathology, Faculty of Medicine, University of Tsukuba, Japan 4 Departement of Pharmacology and Therapeutics, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia



ABSTRAK

Latar belakang: Kanker payudara triple negative (TNBC) cenderung tumbuh lebih cepat dan memiliki prognosis yang buruk dibanding sub-tipe lain. Ekspresi transmembrane prostate androgen-induced protein (TMEPAI) yang tinggi berhubungan dengan prognosis yang buruk pada pasien TNBC. Namun demikian, mekanisme TMEPAI pada proses tumoriogenik belum diketahui. Penelitian ini bertujuan mengetahui pengaruh TMEPAI terhadap proliferasi sel TNBC.

Metode: CRISPR-Cas9 telah digunakan sebelumnya sebagai teknik genome editing untuk membuat galur sel knock-out (KO) TMEPAI pada galur sel TNBC, Hs587T. Galur sel Hs587T wild-type (WT) dan Hs587T knock-out TMEPAI dikultur pada Dulbecco’s modified eagle medium (DMEM) yang disuplementasi dengan 10% fetal bovine serum, 1% penicillin-streptomycin, dan amfoterisin B. Kedua jenis sel dikultur pada 24-well plates dan dihitung setiap dua hari, kemudian dibuat plot kecepatan proliferasi sel. Setelah itu, total RNA dari kedua sel tersebut diisolasi untuk pemeriksaan tingkat ekspresi mRNA marker proliferasi, Ki-67 dan TGF-β.

Hasil: Laju proliferasi sel menunjukkan galur sel WT-TMEPAI tumbuh lebih cepat dibandingkan dengan KO-TMEPAI. Hasil ini didukung dengan penurunan tingkat ekspresi mRNA dari marker proliferasi, Ki-67 dan TGF-β galur sel KO-TMEPAI.

Kesimpulan: Knock-out TMEPAI menurunkan proliferasi sel pada kanker payudara triple negative.

ABSTRACT

Background: Triple negative breast cancer (TNBC) tends to grow more rapidly and has poorer prognosis compared to others. High expression of transmembrane prostate androgen-induced protein (TMEPAI) correlates with poor prognosis in TNBC patients. However, the mechanistic role of TMEPAI in tumorigenic remains unknown. This study aimed to knock-out TMEPAI in TNBC cell line to determine its function further in cells proliferation.

Methods: CRISPR-Cas9 has been used previously to knock-out TMEPAI in Hs857T TNBC cell line. Hs587T TNBC parental cell line (wild-type/WT) and TMEPAI knock out Hs 586T cell lines were cultured in Dulbecco’s modified eagle medium (DMEM) supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin and amphotericin B. Both cell lines were seeded in 24-well plates and counted every two days, then proliferation rates were plotted. Afterwards, total RNA were isolated from the cells and Ki-67, and TGF-β mRNA expression levels as proliferation markers were determined.

Results: Cell proliferation rates as displayed in growth curve plots showed that WT-TMEPAI cell line grew more rapidly than KO-TMEPAI. In accordance, mRNA expression levels of Ki-67 and TGF-β were significantly decreased in KO-TMEPAI cell line.

Conclusion: Knock-out of TMEPAI attenuates cell proliferation in TNBC.


Wardhani, et al.Knock-out TMEPAI supressed cell proliferation

179


Triple negative breast cancer (TNBC) presents in a small number of patients of 15–25% out of the total breast cancer patients.1,2 However, this type of breast cancer is related to shorter survival, poorer prognosis, and metastasize more frequently in lungs and brains compared to other breast cancer sub-types.1–3 Until now, there is no available targeted therapy indicated for TNBC due to lack expressions of estrogen, progesterone, and human epidermal receptors. The current modality of treatment is chemotherapy such as doxorubicin and paclitaxel, with no specific targets.3 Unfortunately, this type of breast cancer is more prone to develop resistance, either intrinsic or acquired to cytotoxic agents.4 Therefore, a deep and thorough understanding for the pathogenesis as well as chemo-resistance mechanism is urgent in order to determine a novel drug targets for TNBC patients.

Transmembrane prostate androgen-induced protein (TMEPAI) is remarkable in TNBC. It found highly expressed in 68,8% TNBC patients.2 Moreover, high expression of TMEPAI correlates to poorer prognosis and shorter relapse-free survival.5 The importance of TMEPAI in TNBC started when Singha et al suggested it as a responsible converter for TGF-β from tumor suppressor into promotor.6 Further study by Singha et al2 discussed about the mechanism of TMEPAI in TNBC. TMEPAI inhibits Smad-dependent pathways of TGF-β and instantly promotes non-Smad pathways via PI3K/Akt signaling. Previously, Watanabe at al proved how TMEPAI works in Smad-dependent pathways to inhibit TGF-β signaling. TMEPAI disrupts interaction between R-Smad and SARA through Smad interaction motif (SIM). Afterwards, TMEPAI traps phosphorylated Smad2 and Smad3 by preventing their translocation into the nucleus. Consequently, transcription and translation of TGF-β target genes will be stopped.7

In addition, TMEPAI promotes degradation of PTEN, thus promotes PI3K/Akt pathways to be activated. It resulted in an enhancement of cell growth.2 Furthermore, TMEPAI has been proven to increase tumorigenic properties in lung cancer.8 However, the mechanism of how TMEPAI enhances tumorigenic activities in cancer remains unknown. Hence, we aimed to investigate the role TMEPAI in TNBC to determine its function further in cell proliferation, using our previous knock out TMEPAI TNBC.

METHODS

Cell culture and cell proliferation rateTriple negative breast cancer cell line, Hs578T was obtained from the American Type Culture Collection (ATCC). Hs578T with TMEPAI knock-out (KO) cells was developed from HS578T wild-type (WT) previously using CRISPR-Cas9 system.9 Both of Hs578T, WT and KO, were cultured in Dulbecco’s modified essential medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (FBS, Gibco), 10 µg/mL insulin, and 100 units/mL of penicillin G and 0.1 mg/mL of streptomycin sulfate (Wako). Cells were maintained in 5% CO2 incubator at 37°C. Both cell lines were seeded in same number in 24-well plates and counted every two days using hemocytometer in 0.4% trypan blue cell suspension up to 8 days. Area under the curve (AUC) of cell proliferation was calculated by connecting the dots which represents number of cells in different time points. AUC were calculated automatically using GraphPad Prism v. 7.0 software (GraphPad Prism, USA). Doubling time for each cell line were also calculated using online doubling time calculator.10 All of the experiments were conducted three times and were duplicated.

RT-PCRWe isolated total RNA using Total RNA Mini Kit (Geneaid) for cultured cells, and afterwards, converted total RNA into cDNA using Transcriptor First Strand cDNA Synthesis Kit (Roche). RT-PCR were performed using FastStart Essential DNA Green Master (Roche). All primers were purchased from the Integrated DNA Technologies, Singapore. Primer sequences all of the mRNA evaluated were as below: Ki-67 Fwd: 5’-TCCTTTGGTGGGCACCTAAGACCTG-3’; Ki-67 Rev: 5’-TGATGGTTGAGGTCGTTCCTTGATG-3’; TGF-β Fwd: 5’-TGAACCGGCTTTTCCTGCTTCTCATG-3’; TGF-β Rev: 5’-GCGGAAGTCAATGTACAGCTGCCGC-3’. β-actin was used as a house-keeping gene with primer sequences: β-actin Fwd: 5’-GCTGGAAGGTGGACAGCGA-3’ and β-actin Rev: 5’-GGCATCGTGATGGACTCCG-3’.

Statistical analysisData were shown as mean ± standard deviation (SD). Statistical analysis was performed with independent t-test comparing area under


the curve (AUC) for proliferation rate, mRNA expressions of Ki-67, and TGF-β of knock-out cell line versus wild-type. Differences were considered statistically significant at p<0.05. All the statistical analysis and graphs presented were calculated and drawn using GraphPad Prism v 7.0 software (GraphPad Prism, USA).

RESULTS

Decreased cell proliferation rate in KO-TMEPAI versus WT-TMEPAI TNBCKO-TMEPAI (Figure 1A) had lower cell confluency

A B

C D

E

WT-TMEPAI KO-TMEPAI

Doubling time (days) 1.086 1.142

A B

C D

E

WT-TMEPAI KO-TMEPAI


A B

C D

E

WT-TMEPAI KO-TMEPAI


A B

C D

E

WT-TMEPAI KO-TMEPAI


BA

C D

E

Figure 1. WT-TMEPAI cells grew more rapidly than KO-TMEPAI Hs587T cells. A) TNBC cell line, Hs578T, with wild-type TMEPAI (WT-TMEPAI). B) TNBC cell line, Hs578T, with knock-out TMEPAI (KO-TMEPAI). Cells were taken picture under inverted micro-scope with 10x magnification. C) Cell proliferation rates of WT-TMEPAI and KO-TMEPAI Hs587T cells were determined using cell growth curve plot up to 8 days. D) Area under curve of WT-TMEPAI and KO-TMEPAI cells proliferation rate. E). Doubling time for KO-TMEPAI was longer compared with WT-TMEPAI Hs587T cells. All experiments were conducted three times in duplicate. WT: wild-type. KO: knock-out. *) p<0.05 after independent t-test comparing wild-type versus knock-out

compared to WT-TMEPAI Hs587T cells (Figure 1B). In accordance, cell proliferation rate of KO-TMEPAI was slower than those of WT-TMEPAI Hs587T cells (Figure 1C), along with lower area under curve (Figure 1D). Doubling time for KO-TMEPAI was longer than WT-TMEPAI cells as shown in (Figure 1E).

Proliferation marker and TGF-β were attenuated in the knock-out TMEPAI Hs587T cellsFigure 2A and 2B show alterations of mRNA expressions of Ki-67 and TGF-β. Proliferation marker, Ki-67 decreased remarkably in KO-TMEPAI Hs587T cells as well as TGF-β.

Num

ber o

f cel

ls

100000

0

0

200000

WT TMEPAI KO TMEPAI

400000

600000

800000

1000000

0Days

WT-TMEPAI

KO-TMEPAI

2 4 6 8 10

200000

300000

WT-TMEPAI KO-TMEPAIDoubling time (days) 1.086 1.142

http://mji.ui.ac.id

Wardhani, et al.Knock-out TMEPAI supressed cell proliferation

181


DISCUSSION

It is noteworthy that currently there is no targeted therapy registered for triple negative breast cancer (TNBC) worldwide. TNBC is counted due to its more aggressive behavior, and thus, resulted in poorer prognosis as compared to other types of breast cancer. Moreover, TNBC frequently occurs in young woman.3 Many researchers aimed to elucidate the signaling pathways which involved in TNBC as a target for novel therapy.

TMEPAI has been suggested to enhance tumorigenic activity in breast cancers. Previously, there were two reports from Singha2,6 which used knock-down TMEPAI TNBC cells to elucidate the role of TMEPAI in oncogenic and tumorigenic activities of TNBC. However, their model, that used shRNA, could not fully omitted TMEPAI in TNBC cells. Therefore, in this study we aimed to determine cell proliferation alteration in a fully knock-out TMEPAI TNBC cells.

We established knock-out TMEPAI cells in previous study using CRISPR-Cas9 systems in Hs578T wild-type, one of triple negative cell line.9 In this study, we showed that KO-TMEPAI cells had longer doubling time compared to WT-TMEPAI cells. KO-TMEPAI cells also showed a slower proliferation rate than that of wild-type TMEPAI cell line. This strongly indicated that TMEPAI had an important role in cell proliferations of triple negative breast cancer. In accordance, previous study by Singha et al2 reported that knock-down TMEPAI attenuated tumorigenic activity. TMEPAI was reported by Azami et al. as a pro-tumoriogenic factor in lung cancer induced by TGF-β signaling. It also dominantly depended on activated autocrine TGF-β signaling.11

Furthermore, we also evaluated mRNA expression levels of TGF-β. It was previously known that TGF-β induced TMEPAI expression in genomic transcript, as well as proteomic levels.2,6-8 Our study differed with previous study which were conducted by Singha et al2,6 and Ngunyen et al8 Those study used TGF-β induction in cell medium. In our study, we did not add TGF-β exogenously. This condition might be due to the basal conditions that corresponded to autocrine signaling of TGF-β in KO and WT-TMEPAI TNBC cells. Our results in KO-TMEPAI cells confirmed

Figure 2

B

A

Figure 2

B

A

A

B

Figure 2. Decreased mRNA expressions of A) Ki-67 (normal-ized to β-actin as housekeeping gene) and B) TGF-β (normal-ized to β-actin as housekeeping gene) in KO-TMEPAI as com-pared to WT-TMEPAI. All experiments were performed three times in duplicate. WT: wild-type. KO: knock-out. *) p<0,05 af-ter independent t-test comparing wild-type versus knock out

that mRNA expression levels of TGF-β was lower than that of wild-type cells. This indicated that the loss of TMEPAI resulted in decreased proliferation rates, followed by decreased mRNA expressions of TGF-β. The expression of TMEPAI was controlled by TGF-β constituvely. However, TMEPAI suppressed TGF-β signaling by binding to R-Smad competitively with SARA (Smad anchor for receptor activation), to refrain R-Smad binding and inhibit activation of TGF-β receptor kinase.7 It is remain unclear how TMEPAI affects cell proliferation.

Ki-6

7 m

RNAe

xpre

ssio

n le

vel

TGF-

beta

mRN

Aexp

ress

ion

leve

l

0.0

0.5

1.0

1.5

WT TMEPAI

KO TMEPAI

0.0

0.5

1.0

1.5

WT TMEPAI

KO TMEPAI


In this study, the decrease of T`GF-β mRNA expression levels was still inadequate to describe the activation of TGF-β that was related to cell proliferation signaling. Further studies on TMEPAI downstream targets are still needed. On the other hand, xenograft models from KO-TMEPAI triple negative breast cancer cells should be generated in order to determine the role of TMEPAI in TNBC.

Previous study by Singha et al2 reported that tumor volumes and weights of triple negative xenografts models were less in knock-down TMEPAI group compared to the wild-type group after 28 days. The result was followed by the decrease in proliferation marker, Ki67. In accordance with that finding, our KO-TMEPAI TNBC also showed a decrease in Ki-67 mRNA expressions compared to wild-type cells. Cell proliferation rate and confluency supported that finding. As indicated before, TMEPAI has pivotal role to alter cancer proliferation in triple negative breast cancer.

Therefore, we concluded that TMEPAI attenuates cell proliferation in TNBC cells. In support our finding, Singha et al2, Watanabe et al7 and Ngunyen et al8 already suggested role of TMEPAI in TGF-β signaling pathway through Smad-dependent and PI3K/Akt pathways. Although we have not investigated in xenograft models and determine downstream of TGF-β signaling due to the loss of TMEPAI, we suggest that TMEPAI has a potency to affect cancer progression in triple negative breast cancer, so that it potentially becomes a novel targeted therapy.

Conflict of interestMelva Louisa and Rianto Setiabudy are editorial board members but were not involved in the review or decision for the article.

AcknowledgementThis work was supported by a grant from PITTA (Publikasi Internasional Terindeks untuk Tugas Akhir Mahasiswa) 2016 from Research Institution of Universitas Indonesia (Direktorat

Riset dan Pengabdian Kepada Masyarakat, DRPM, Universitas Indonesia).

REFERENCES

1. Ng CH, Pathy NB, Taib NA, Teh YC, Mun KS, Amiruddin A, et al. Comparison of breast cancer in Indonesia and Malaysia-A Clinico-Pathological study between Dharmais Cancer Center Jakarta and University Malaya Medical Center, Kuala Lumpur. Asian Pacific J Cancer Prev. 2011;12:2943–6.

2. Singha PK, Pandeswara S, Geng H, Lan R, Venkatachalam MA, Saikumar P. TGF-β induced TMEPAI/PMEPA1 inhibits canonical Smad signaling through R-Smad Sequestration and promotes non-canonical PI3K/Akt signaling by reducing PTEN in triple negative breast cancer. Genes&Cancer. 2014;5(9-10):320–36.

3. Foulkes WD, Smith IE, Reis-Fielho JS. Triple negative breast cancer. N Eng J Med. 2010;363:1938–48.

4. O’Reilly EA, Gubbins L, Sharma S, Tully R, Guang MHZ, Weiner-Gorzel K, et al. The fate of chemoresistance in triple negative breast cancer (TNBC). BBA Clinical 3. 2015;3:257–75.

5. Gyorffy B, Lanczky A, Eklund AC, Denkert C, Budczies J, Li Q, Szallasi Z. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1809 patients. Breast Cancer Res Treat. 2010 Oct;123(3):725–31.

6. Singha PK, Yeh IT, Venkatachalam MA, Saikumar P. TGF-β-Inducible gene TMEPAI converts TGF- β from a tumor suppressor to a tumor promoter in breast cancer. Cancer Res. 2009;70:6377–83.

7. Watanabe Y, Itoh S, Goto T, Ohnishi E, Inamitsu M, Itoh F, et al. TMEPAI, a transmembrane TGF-β-inducible protein, sequesters Smad proteins from active participation in TGF-β signaling. Mol Cell. 2010;37:123–34.

8. Ngunyen TTV, Watanabe Y, Shiba A, Noguchi M, Itoh S, Kato M. TMEPAI⁄PMEPA1 enhances tumorigenic activities in lung cancer cells. Cancer Sci. 2014;105(3):334–41.

9. Wardhani BWK, Puteri MU, Watanabe Y, Louisa M, Setiabudy R, et al. TMEPAI genome editing in triple negative breast cancer cells. Med J Indones. 2016;26:14–8.

10. Roth V. 2006 Doubling Time Computing [Internet]. [cited 2016]. Available from: http://www.doubling-time.com/compute.php

11. Azami S, Vo Nguyen T, Watanabe Y, Kato M. Cooperative induction of transmembrane prostate androgen-induced protein TMEPAI/PMEPA1 by transforming growth factor-β and epidermal growth factor signaling. Biochem Biophy Res Commun. 2015;456:580–5.

http://mji.ui.ac.id

http://www.doubling-time.com/compute.php

http://www.doubling-time.com/compute.php

Ramli, et al.Permanent flame-blunted of middle cerebral artery occlusion

183

Permanent flame-blunted monofilament of middle cerebral artery occlusion technique for ischemia stroke induction in animal models

Keywords: middle cerebral artery occlusion, monofilament, rat

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1645 • Med J Indones. 2017;26:183–9• Received 07 Nov 2016 • Accepted 16 Jul 2017

Corresponding author: Ahmad S. Alwahdy, [email protected]


Yetty Ramli,1 Ahmad S. Alwahdy,1 Mohammad Kurniawan,1 Berry Juliandi,2 Puspita E. Wuyung,3 Yayi D.B. Susanto3

1 Department of Neurology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo National Hospital, Jakarta, Indonesia 2 Department of Biology, Institut Pertanian Bogor, Bogor, Indonesia3 Department of Pathology Anatomy, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo National Hospital,

Jakarta, Indonesia



ABSTRAK

Latar belakang: Tikus merupakan hewan coba yang paling sering digunakan untuk mempelajari strok iskemik. Oklusi arteri serebral media (OASM) menggunakan benang monofilamen secara intraluminal banyak digunakan, dengan keuntungan dan kerugian yang dimilikinya. Untuk oklusi permanen, kematian pada tikus lebih tinggi dibandingkan dengan oklusi sementara. Pada penelitian ini, kami menggunakan teknik oklusi permanen dengan monofilamen yang dimodifikasi dengan tujuan mengurangi angka kematian, sehingga dapat digunakan untuk memahami fase kronik strok iskemik.

Metode: Dilakukan OASM secara permanen pada tiga tikus jenis Sprague-Dawley. Monofilamen yang telah dipanaskan ujungnya dimasukkan melalui arteri karotis komunis. Konfirmasi infark dilakukan dengan pemeriksaan histopatologi dan pewarnaan hematoksilin eosin. Selanjutnya, dilakukan penilaian terhadap fungsi neurologis pasca-oklusi.

Hasil: Tiga tikus pasca-oklusi dievaluasi dengan waktu yang berbeda (48 jam, 72 jam, dan 3 minggu). Pada pemeriksaan histopatologi area infark dan peri-infark pada ketiga tikus menunjukkan gambaran red neurons, neutrofil spongiosis, dan edema perivaskular. Perubahan secara histopatologi menunjukkan spongiosis lebih dominan pada 3 minggu pasca-OASM. Di sisi lain, perubahan red neurons dan edema perivaskular pada tiga minggu pasca-OASM lebih sedikit dibandingkan pada 48 jam dan 72 jam pasca-OASM.

Kesimpulan: Monofilamen yang telah dimodifikasi dengan memanaskan bagian ujungnya memperlihatkan efikasi menghasilkan area infark. Keuntungan teknik ini adalah sangat mudah dimodifikasi dan tidak memerlukan biaya mahal. Keberhasilan membuat oklusi permanen tanpa angka mortalitas yang tinggi memberikan harapan untuk melakukan penelitian lebih lanjut dalam melihat efek terapi yang baru pada strok fase kronik.

ABSTRACT

Background: Rat is the most frequently used animal for ischemic stroke studies. Recently, middle cerebral artery occlusion (MCAO) by introducing various types of surgical monofilament intraluminally has been widely used, with their advantages and disadvantages. For permanent occlusion, problems with mortality in rats are higher than transient. In this study, we used permanent occlusion using modified monofilament by flaming on its tip which may reduce mortality rate, so that chronic phase of stroke can be learned extensively.

Methods: Three male Sprague-Dawley rats underwent permanent MCAO. The flame-blunted monofilament was introduced through common carotid artery. Hematoxylin eosin histopathology confirmation and functional assessment post-stroke induction were then evaluated.

Results: Evaluation was conducted on 3 rats in different time post-stroke induction (48 hours, 72 hours, and 3 weeks). Using histopathological examination, the infarction was proved in all 3 rats showing red neurons, perivascular edema and neutrophil spongiosis, in infarct and peri-infarct area. The changes in histopathology showed spongiosis were more dominant in 3 week-post-MCAO rats. On the other hand, red neurons and perivascular edema were less compared to 48 and 72-hour-post-MCAO rats.

Conclusion: Flame–blunted monofilament showed its efficacy in producing infarct area. The advantages of this technique are easy to perform with simple and less expensive modification of the monofilament. Conducting successful permanent occlusion with less mortality rate will give chances to do further research on stroke in chronic phase and its effect on novel treatment.



Rat is the most frequently used animal for ischemic stroke studies.1 A study of ischemic stroke with rat models showed a lot of data for understanding the process of cell or brain injury.2,3 However, the relevance of most of these results to human condition remains questionable.4 Translation of drugs from the result of rat study to human has been disappointing. Another treatment option for ischemic stroke is reperfusion. This therapy has become the most beneficial strategy for improving neurological outcomes after ischemic stroke.5 However, recent data showed the benefits of reperfusion therapy was the best in terms of time, from symptoms onset less than 2 hours and became insignificant after 7.3 hours.6 Future research may focus on a model of ischemic stroke that allows the researchers to assess the advantages and disadvantages of reperfusion for improving the neurological outcome after ischemic stroke1 and the window period of the treatment or reversible cell injury;7 allows to assess the role of comorbid i.e. hypertension or diabetes or atherosclerosis on outcomes;1,3 allows to assess the magnitude of injury (infarct size) and area of infarct location that induced by certain models.8

There have been many efforts to develop techniques on how to make infarct in animal models which mimic human infarct result and its pathogenesis. Recently, middle cerebral artery occlusion (MCAO) by introducing various types of surgical monofilament intraluminally has been widely used with inconsistent results.9 The technique can be used as the model of permanent or transient occlusion.10 Permanent occlusion can give more information to understand chronic phase of stroke, but with high mortality as its limitation. Guidelines for drug development recommend that once efficacy is established in rodents, studies are carried out in gyrencephalic species such as cats, pigs, and non-human primates before proceeding with the studies in man. It is generally considered ethically more acceptable to use rodents rather than higher mammals. The animal and maintenance costs are low, and the vascular anatomy is similar to man. Rodent neuroanatomy and the cascade of molecular mechanisms leading to ischemic cell death are well characterized.11

Unfortunately, in Indonesia, limitation of supporting tools is the major problem, as well as the cost. In this study, we used simple and less expensive modification of monofilament (flame-

blunted) with coating in length approximately 1–1,5 mm which inserted permanently to give a solution for producing reproducible stroke model in chronic phase.

METHODS

Three male Sprague-Dawley rats weighing 250–300 g at the beginning underwent permanent middle carotid artery occlusion (MCAO). All the surgical instruments and materials performed under sterile conditions, and a magnifying glass (five times magnification) was used to perform this technique to be more accurate and to reduce unwanted mistakes. The rats were anesthetized with ketamine (80 mg/kg) and xylazine (10 mg/kg) intraperitoneally. After that, they were turned to the supine position and fixed to the surgical table using an adhesive tape. A midline neck incision was performed, and the soft tissues over the trachea were retracted gently. The common carotid artery (CCA) was carefully isolated from the vagus nerve, and permanent knots were placed. The first bifurcation of CCA was identified, and then external carotid artery (ECA) was ligated. At the bifurcation, incision was done by using tip of the needle (30 gauge) to insert the monofilament, and permanent knots were placed just in front of the incision hole to avoid moving of the filament out of its track (figure 1). The flame-blunted monofilament (figure 2) was straightened and advanced carefully up to 17–20 mm.12

By flame-blunted monofilament, damaged of the blood vessels would be reduced along the insertion track due to blunted tips. Furthermore, tips of flame-blunted monofilament would be coated approximately 1–1,5 mm in length to prevent the occlusion of the hypothalamic artery and decrease the mortality rate.13 Pterygopalatine artery was identified to avoid misplacement of filament. Once filament insertion into the middle cerebral artery ( MCA) was confirmed, the midline neck incision was sewed using surgical suture. To relieve pain and discomfort in the postoperative period, paracetamol was given (15 mg/kg) orally as soon as the rats were conscious. Moreover, they received 1.0 ml saline intraperitoneally as volume replenishment after the surgery.

At the end point of the study, the animals were sacrificed 48 hours, 72 hours, and 3 weeks

http://mji.ui.ac.id


185(Figure 1.)

HTA

CCA

ECA

ICA

ECA

MCA ACA

PCA

CCA

Pcom

AchA

PPA

Flame-blunted monofilament

Figure 1. A) Permanent knots were placed in external carotid artery (ECA), and in common carotid artery (CCA) where the incision was made nearby the bifurcation of carotid; B) Illustration of flame-blunted monofilament in relation to cerebral vas-culature. Internal carotid artery (ICA), pterygopalatine artery (PPA), middle cerebral artery (MCA), hypothalamic artery (HTA), posterior cerebral artery (PPA), and anterior choroidal artery (AchA)

A

a) b)

Figure 2. A) Monofilament; B) Flame-blunted monofilament marked by black circle (left side)

after permanent MCAO. Magnifying glass was used, including insertion of monofilament into middle cerebral artery. Haematoxilyn eosin histopathology confirmation and functional assessment post stroke induction were evaluated. Cylinder test was used to evaluate sensoric motor function and latency to move test to evaluate cognitive function.14,15

Ethical issueThis research has been approved by the research ethics of medicine/health, Medical Faculty of Universitas Indonesia with ethical approval number 789/UN2.F1/ETIK/2016.

RESULTS

After the rats were sacrificed, their brains were cut into 2 mm thickness from the bregma to the anterior part and stained with hematoxylin eosin. Under the microscope, we found infarct area in three rats where 48-hour and 72-hour post occlusion showed more red neurons compared to 3-week-stroke rat. For spongiosis, it was more dominant in the 3 weeks post MCAO compared to other rats. Macrophages were also found in acute (48 hours and 72 hours) rats, but we could not find in the 3 week-stroke-rat. Perivascular

A B


ECA

ICA

CCA

ACA MCA

AchA

HTA PCA

Pcom

ECA

PPA

CCA

ICA

Flame-blunted filament

Permanent Ligature

B


edema was more prominant in acute phase than in chronic phase of stroke (Figure 3).

Similarly to the functional assessment post stroke, three week-stroke-rats showed better progression compared to the others. It was correlated to the number of dead cells (red neurons) in rats. In cylinder test to evaluate the sensoric motor function, it showed that three week-stroke-rats started using the limb almost symetrically in vertical way. The 48 and 72 hour-rats were still using the healthy limb more dominant compared to the affected side (Figure 4a).

a) 48 hours b) 72 hours c) 3 weeks

Infarcted area

Infarcted area

Infarcted area

Non-Infarcted

area

Non-Infarcted

area

Non-Infarcted

area


Infarcted area

Infarcted area

Infarcted area

Non-Infarcted

area

Non-Infarcted

area

Non-Infarcted

area


Infarcted area

Infarcted area

Infarcted area

Non-Infarcted

area

Non-Infarcted

area

Non-Infarcted

area

A

48 hours 72 hours 3 weeks

B C

3.a 3.b

3.a 3.b

3.a 3.b

3.a 3.b

3.a 3.b

3.a 3.b

A B

Figure 3. Histopathological changes in rats after MCAO induction. A) 48 hours after occlusion, showed dominant of red neurons (black arrow) using 10 times magnification; B) 72 hours after occlusion red neurons still dominant; C) Three weeks after occlu-sion, red neurons were decreased in number, but spongiosis (black circle) and perivascular edema (blue arrow) appeared more dominant using 20 times magnification. Interrupted line was the border area between infarct and non-infarct zone

Figure 3. A) Cylinder test. Control rat using both extremities almost equally. Usage of non-affected side was increasing along the course of time (48 and 72 hours) after occlusion. Gradually, the rat will be using the affected side more often (3 weeks); B) La-tency to move test. Control rat needs 2 secs to move. It reached its peaked after 48 hours (18 secs) after occlusion before gradually getting better afterward

During evaluation of the cognitive function using latency to move test or spontaneous activity, the result was also similar with the motoric function test, three week-stroke-rats showed better result compared to the others.

DISCUSSION

Since many pathological changes in stroke and many factors have contributed in developing changes especially microscopically and recovery in stroke, MCAO in animal models of focal

http://mji.ui.ac.id

Cont

rala

tera

lIp

sila

tera

l

Seco

nds

Cylinder test Latency to move test

Control

Control

48 hours72 hours3 weeks

0

0

5

10

15

20

25

0.2

-0.2

-0.4

-0.6

0.4

0.6

48 hours 72 hours 3 weeks


187

ischemia provide most evidence for cellular inflammatory responses in stroke.16 The obvious benefit for using this in vivo approach is that it allows for the study of ischemic insult on intact neuronal networks and the behavioral response post-insult, in addition to the neuroinflammatory processes that are present after ischemic damage. Therefore, this in vivo stroke model provides a critical complementary approach to in situ models that are used to mimic ischemia in cell culture.17

Moreover, it yields highly consistent results which minimize misleading interpretations, and hence, it is considered as a reliable stroke model to test a variety of neuroprotective drugs. Unfortunately, there are difficulties in determining border between acute and chronic stroke.16

Many techniques have been developed to produce brain infarct in animal models with their advantages and disadvantages. For the technique using craniectomy, it is associated with low or absent mortality since the craniectomy prevents increasing in intracranial pressure.11 Unfortunately, this technique needs surgical skill to reduce unsuccessful result. Tamura et al18 in 1981 performed an occlusion by using an electric current passed through the tips of fine diathermy forceps, with a good reproducibility in infarct size and functional deficit, low mortality, visual confirmation of successful MCAO.18 On the other hand, exposing the artery and applying electro-coagulation without rupturing the blood vessel or damaging the underlying cortex was rather difficult. Alternatively, by using micro-aneurysm clips to occlude the artery was introduced. However, micro-aneurysm clips were too small to apply by hand in rats, and removing the clips without damaging the artery was technically difficult.19 For technique using blood clot occlusion, the advantage is that it closely mimics human ischemic stroke and is suitable for thrombolysis studies, but it would be less reproducible than other techniques.11 Since the beginning, in vitro studies demonstrated that rat’s fibrinolytic system was 10-fold less sensitive to thrombolysis agent than the human system. The dosage of thrombolysis agent might need to be increased, and it can cause hemorrhagic transformation.20

MCAO by the intraluminal suture method is currently the most widely used model of focal ischemia in rats and mice and is used to induce

both permanent and transient ischemia. A flexible monofilament is introduced directly to the internal carotid artery (or with modification) and advanced until it blocks the origin of the MCA. Modifications were performed not only to improve reproducibility (include filament construction, coating and design of the tip), but also to reduce its complication. The advantages of this model are easier to master than the craniectomy models, and no craniectomy is required.11

Flame-blunted modification is the easiest way to modify the tip of the monofilament. By blunted the tips, damaged blood vessels would be reduced along the track of insertion. Furthermore, the relation between the length coating of the tip and the cerebral vasculature would influenced the result of infarction (Figure 1). Problems with morbidity and mortality are encountered when ischemia is permanent. This is manifested within the first 24–48 hours in animals with large MCA territory strokes due to brain swelling and increased intracranial pressure.11 If the infarct involves the hypothalamus, as seems to be frequently the case in animals subjected to permanent MCAO, hyperthermia may develop as a consequence of thermal dysregulation, leading to altered stroke outcome.21 Technical modifications and the use of standardized monofilaments can reduce the incidence of these complications.11

In this study, flame-blunted filaments have approximately 1–1,5 mm in length to coat the tip. Thus, it would occlude the MCA but not the AchA, PCA, and HTA totally. Furthermore, mortality can be reduced since HTA supply thalamus where thermoregulation are controlled.13 When the coating is more than 2 mm in length, blockage of HTA occurred and mortality is higher. Therefore, this method is suitable when permanent occlusion is needed for the study. Another advantage is that it gives hope to understand and to evaluate the effectiveness of the chronic stroke therapy in rats, where many experiments has failed due to higher mortality and complication in permanent occlusion.11,23

On the other hand, the disadvantages are mainly related to its complication since the size of the monofilament must be precise enough to block the blood flow, and it depends on rat’s weight, age, and strain. Every technique purposely done depends on the aim of the study, where this



technique it seems not suitable for thrombolysis rather than to study neuroprotective drugs and its mechanism. Nevertheless, the complication of this filament may have subarachnoid bleeding (40%)22 and infarct size is not as wide as where the coating length of filament’s tip more than 2 mm.13

Another disadvantage of this technique is that the confirmation of MCAO cannot be visualized. Successful occlusion is confirmed by the evidence of motor neurological deficit (supplementary video).24 Even though recently, MRI to assess the size of infarct is used world-wide, but the access to get MRI in Indonesia is still limited. Nevertheless, in this study we did not using immunohistochemistry staining nor angio and neurogenesis marker antibodies to evaluate histopathology changes for advance results.

We used a permanent MCAO technique where infarct area occurred more in the cortex area than striatum. On the other hand, if it was done by transient MCAO, the damage can reach the subcortical or striatum regions.12 Our study found similar results in which striatum in ipsilateral area was not affected; instead, it affected more in the cortical regions. It is very likely due to the transient cell damage caused by reperfusion.Therefore, it becomes more difficult to protect neuronal damage while in permanent delayed neuronal death occurred.12

Doing successful permanent occlusion provided knowledge about the opening and closing theory of blood-brain barrier in ischemic stroke which may occur up to 3–4 weeks.25 We demonstrated in this study that perivascular edema persisted at three-week post stroke, and that perivascular edema might be the evidence of disturbed blood brain barrier. Interestingly, functional recovery has achieved the improvement along time. This improvement correlated with reducing red neurons in infarct area, and it seems due to very well rats brain plasticity neurogenesis and angiogenesis had occurred. Good brain plasticity of rats will become a potential pitfall in evaluating the effectiveness of chronic stroke therapy in rats. The best time to give drugs based on this study is before the neurological deficits become recovered (<72 hours) to decrease the bias effect of the treatment.

In conclusion, flame-blunted monofilament showed its efficacy in producing infarct area and not inferior to other type of other technique. The advantages of this technique is easy to perform with simple and less expensive modification of the monofilament. Performed a successful permanent occlusion by this technique without mortality, give chances to do more research for stroke in chronic phase and its effect on novel treatment in the future.

Conflict of interestThe authors affirm no conflict of interest in this study.

AcknowledgmentThe first author acknowledges residency from the Department of Neurology, Universitas Indonesia. We thank to National Institute of Health Research and Development (litbangkes) Indonesia for providing animals laboratory and Department of Pathology Anatomy, Faculty of Medicine, Universitas Indonesia for assistance in histological analysis. This work has been funded by a grant from Universitas Indonesia “Hibah Publikasi Internasional Terindeks Untuk Tugas Akhir Mahasiswa UI 2016”.

REFERENCES

1. Bacigaluppi M, Comi G, Hermann DM. Animal models of ischemic stroke. Part two; modelling cerebral ischemia. Open Neurol J. 2010;4:34–8.

2. Park SY, Marasini S, Kim GH, Ku T, Choi C, Park MY, et al. A method for generate a mouse model of stroke: evaluation of parameters for blood flow, behavior, and survival. Exp Neurobiol. 2014;23(1):104–14.

3. Kaya AH, Erdogan H, Tasdemiroglu E. Searching evidences of stroke in animal models: a review of discrepancies. Turk Neurosurg. 2016;27(2):167–73.

4. Casals JB, Pieri NCG, Feitosa MLT, Ercolin ACM, Roballo KCS, Barreto RSN, et al. The use of animal models for stroke research: a review. Comp Med. 2011;61(4):305–13.

5. Molina CA, Saver JL. Extending reperfusion therapy for acute Ischemic stroke. Emerging pharmacological, mechanical, and imaging stategies. Stroke. 2005;36:2311–20.

6. Saver JL, Goyal M, vander Lugt A, Menon BK, Majole CBLM, Dippel DW, et al. Time to treatment with endovascular thrombectomy and outcomes from Ischemic stroke: a meta-analysis. JAMA. 2016;316:1279–88.

7. Fluri F, Schuhmann MK, Kleinschnitz C. Animal models of Ischemic stroke and their application in clinical research. Drug Des Devel Ther. 2015;9:3445–54.

8. Canazza A, Minati L, Boffano C, Parati E, Binks S. Experimental models of brain ischemia: a review

http://mji.ui.ac.id


189

of techniques, magnetic resonance imaging, and investigational cell-based therapies. Front Neurol. 2014;5:1–9.

9. Longa, EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke. 1989;20:84–91.

10. Chou WH., Choi DS, Zhang H, Mu D, McMahon T, Kharazia VN, et al. Neutrophil protein kinase Cdelta as a mediator of stroke-reperfusion injury. J Clin Invest. 2004;114:49–56.

11. Macrae IM. Preclinical stroke research-advantages and disadvantages of the most common rodent models of focal ischaemia. Br J Clin Pharmacol. 2011;164:1062–78.

12. Rupadevi M, Parasuraman S, Raveedran R. Protocol for middle cerebral artery occlusion by an intraluminal suture method. J Pharmacother. 2011;2:36–9.

13. Guan Y,Wang Y, Yuan F, Lu H, Ren Y, et al. Effect of Suture Properties on Stability of Middle Cerebral Artery Occlusion Evaluated by Synchrotron Radiation Angiography. Stroke. 2012;43:888–91.

14. Lubjuhn J, Gastens A, Von WG, Bargiotas P, Herrmann O, Murikinati S, et al. Functional testing in a mouse stroke model induced by occlusion of the distal middle cerebral artery. J Neurosci Methods. 2009;184:95–103.

15. Rosell A, Agin V, Rahman M, Morancho A, Ali C, Koistinaho J, et al. Distal occlusion of the middle cerebral artery in mice: Are we ready to assess long-term functional outcome? Transl Stroke Res. 2013;4:297–307.

16. Margatitescu O, Mogoanta L, Pirici I, Pirici D, Cernea D,l. Histopathological changes in acute ischemic stroke. Rom J Morphol Embryol. 2009;50:327–39.

17. Colak G, Fillano A J, Johnson GV. The application of permanent middle cerebral artery in the mouse. J Vis Exp. 2011;53:1–4.

18. Tamura A, Graham DI, McCulloch J, Teasdale GM . Focal cerebral ischemia in the rat: 1. Description of technique and early neuropathological consequences following middle cerebral artery occlusion. J Cereb Blood Flow Metab. 1981;1:53–60.

19. Van Bruggen N, Thibodeaux H, Palmer JT, Lee WP, Fu L, Cairns B et al. VEGF antagonism reduces edema formation and tissue damage after ischemia/reperfusion injury in the mouse brain. J Clin Invest. 1999;104:1613–20.

20. Kano T, Katayama Y, Tejima E, Lo EH. Hemorrhagic transformation after fibrinolytic therapy with tissue plasminogen activator in a rat thromboembolic model of stroke. Brain Res. 2000;854:245–8.

21. Li F, Omae F, Fisher M. Spontaneous hyperthermia and its mechanism in the intraluminal suture middle cerebral artery occlusion model of rats. Stroke. 1999;30:2464–70.

22. Herson PS., Traystman R. Animal model of stroke: translational potential at present and in 2050. Future Neurol. 2014;9:541–51.

23. Braeuninger S, Kleinschnitz C. Rodent models of focal cerebral ischemia: procedural pitfalls and translational problems. Exp Transl Stroke Med. 2009;1:8.

24. Guzel A, Rolz R, Nikkhah G, Kalert U.D, Maciaczyk J. A microsurgical procedure for middle cerebral artery occlusion by intraluminal monofilament insertion technique in the rat: a special emphasis on the methodology. Exp Transl Stroke Med. 2014;6:6.

25. Yi Yang, Gary A.R. Blood-brain barrier breakdown in acute and chronic cerebrovascular disease. Stroke. 2011;42:3323–8.



Cryptosporidium spp. and rotavirus gastroenteritis and change of incidence after rotavirus vaccination among children in Raparin Pediatrics Hospital, Erbil, Iraq

Keywords: cryptosporidiosis, gastroenteritis, rotavirus, vaccine

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1957 • Med J Indones. 2017;26:190–7• Received 20 Apr 2017 • Accepted 10 Aug 2017

Corresponding author: Hadi M. Alsakee, [email protected]


Sally S. Azeez,1 Hadi M. Alsakee2

1 Department of Medical Diagnostic Laboratory, Raparin Pediatrics Hospital, Erbil, Iraq 2 Department of Microbiology, College of Medicine, Hawler Medical University, Erbil, Iraq

Clinical Research

ABSTRAK

Latar belakang: Diare merupakan masalah kesehatan tersering pada bayi dan anak kecil yang disebabkan oleh berbagai mikroba seperti Cryptosporidium spp. dan rotavirus, yang biasanya salah terdiagnosis dengan tes feses konvensional. Penelitian ini untuk mengevaluasi insidens gastroenteritis pada anak akibat Cryptosporidium and rotavirus di Erbil dan mengevaluasi efikasi vaksinasi rotavirus.

Metode: Spesimen feses diambil dari 400 anak berusia 1 bulan sampai 5 tahun di Rumah Sakit Anak Raparin, Erbil yang mengalami diare dalam rentang waktu Januari–Agustus 2014. Pemeriksaan modifikasi Ziehl Neelsen dan nested PCR dilakukan untuk mendeteksi cryptosporidiosis, sedangkan pemeriksaan CerTest untuk infeksi rotavirus.

Hasil: Tingkat deteksi cryptosporodiosis dengan PCR jauh lebih tinggi dari pewarnaan Ziehl-Nielsen (0% vs 6%), dan infeksi sedikit lebih tinggi pada anak laki-laki (6,25% vs 5,55%) dan anak <2 tahun (11,7%). Puncak infeksi terjadi selama musim semi (Maret–April, 9,5%). Tingkat deteksi rotavirus (32,0%) sedikit lebih tinggi pada laki-laki (34,4% vs 30,0%) dan anak usia 1 sampai 3 tahun (39,3%). Tingkat deteksi tertinggi (38,6%) terjadi selama musim dingin (Januari dan Februari). Infeksi lebih tinggi bermakna pada anak yang tidak divaksin (65,9% vs 14,1%, p<0,05).

Kesimpulan: Insidens cryptosporidiosis mengalami penurunan tetapi gastroenteritis akibat rotavirus cukup banyak terjadi pada anak-anak di Erbil. Vaksin rotavirus menurunkan insidens infeksi akibat rotavirus secara bermakna.

ABSTRACT

Background: Watery diarrhea is the most common medical problem among infants and young children, caused by different microbial etiology including Cryptosporidium spp. and rotavirus, which are usually misdiagnosed in conventional stool test. This study aimed to investigate the incidence of Cryptosporidium and rotavirus gastroenteritis among children in Erbil as well as evaluate the efficacy of rotavirus vaccination procedure applied in Erbil.

Methods: Fecal specimens were collected from 400 children (boys and girls), aged one month to five years old, who attended Raparin Pediatrics Hospital in Erbil complaining from diarrhea, between January to August 2014. Modified Ziehl Neelsen technique and nested PCR were used for detection of cryptosporidiosis while rotavirus infection was detected by rapid CerTest.

Results: Rate of detection of cryptosporidiosis was remarkably higher using PCR than Ziehl-Neelsen stain (0% versus 6%), and the infection was slightly higher among boys (6.25% vs 5.55%) and children ≤2 years (11.7%). The peak of infection reached during spring season (March and April) (9.5%). The detection rate of rotavirus was 32.0%, which was slightly higher among males (34.4% vs 30.0%) and in children between one to three years old (39.3%). The highest detection rate (38.6%) was recorded during winter season (January and February). The infection was significantly higher among non-vaccinated children (65.9% vs 14.1%; p<0.05).

Conclusion: The incidence of cryptosporidiosis is declining. However, rotavirus gastroenteritis was relatively high among young children in Erbil. Rotateq vaccine significantly reduced the incidence of rotavirus infection.



Azeez and Alsakee.Cryptosporidium and rotavirus infections in Iraq

191


Acute gastroenteritis or diarrhea is defined as the excretion of liquid stools three or more times a day. According to studies conducted by World Health Organization (WHO), diarrhea is estimated to be the second highest cause of morbidity and mortality among children in developing countries,1 for which there are various etiological agents in endemic areas such as bacteria, viruses, and parasites. Cryptosporidiosis is an enteric parasitic infection affecting a wide range of hosts, including humans, domestic and wild animals. It is also the most common cause of waterborne disease around the world.2

Successful management and prevention of this emerging disease requires knowledge of the diversity of species causing human disease and their zoonotic source. It commonly appears as intestinal infection in acquired immune-deficiency syndrome (AIDS) patients causing fatal diarrheal illness. It may also infect biliary system and respiratory tract. Children younger than five years of age are more commonly infected mainly in developing countries due to their immunological immaturity and their unhygienic behavior.3 Epidemiological studies reported that cryptosporidiosis is more prevalent in developing countries (5%–10%) than in developed countries (1%–3%).4–6 Cryptosporidium spp. oocysts contain sporozoites which are the infectious forms excreted in feces of infected host. Humans acquire infections through direct contact with infected persons (anthroponotic transmission); animals (zoonotic transmission) or through ingestion of contaminated food or water.3

Rotaviruses are the most common cause of viral gastroenteritis in newborns and young children both in developing and developed countries. Studies have reported that each year rotavirus causes about 111 million episodes of diarrhea requiring only home care, two million hospitalizations and 400,000 deaths in children under five years of age; 82% of which occurs in children in the poorest countries.7 In Iraq, the mortality rate in children younger than five years of age was reported to be 130 per 1,000 for boys and 120 per 1,000 for girls in 2003.8 In Erbil governorate, very little information concerning rotavirus infection and Cryptosporidium gastroenteritis is available.

Both infections cause profuse watery diarrhea in young children and are usually misdiagnosed because they cannot be detected by conventional stool test.

In the current study, we intended to investigate the incidence of rotavirus and Cryptosporidium gastroenteritis among children in Erbil in relation to demographic parameters and seasonal distribution as well as to evaluate the efficacy of rotavirus vaccine and vaccination procedure applied in Erbil.

METHODS

Design, setting, and duration of the studyThis descriptive, cross sectional study was conducted in Erbil (capital city of Iraqi Kurdistan Region) with a population of around 1,370,000 inhabitants. The study population included 400 children complaining from sever watery diarrhea. The patients were from both genders, with ages ranging from one month to five years old. Patients (who passed watery or loose stools >3 times per day for >3 days) attending Raparin Pediatric Hospital in Erbil from January to August 2014, were included in this study.

This health service provider is a teaching hospital serves a population of ≈1.7 million (including refugees who dislocated from other Iraqi provinces). A careful history was obtained via a direct interview with the parents in which, basic demographic, epidemiologic, clinical information, and vaccination status were collected and stated in a closed-ended questionnaire sheet designed for such purpose. This project has been approved by the ethics committee in the College of Medicine, Hawler Medical University, and informed consent has already been obtained from their parents.

Collection and processing of fecal specimens Fecal specimens were collected from the patients in clean, sterile, tightly covered wide mouth, disposable plastic containers. Each container was labeled with a number, date, and name of each subject. Furthermore, each fecal sample was divided into two parts by a clean and sterile wooden application. One used directly for macroscopic examination,


direct wet mount preparation, modified Ziehl-Neelson technique (for detection of excreted Cryptosporidium spp. oocysts) and certest for detection of rotavirus infection whereas the second sample was kept frozen for molecular detection of cryptosporidiosis. Modified Ziehl-Neelsen staining technique was performed in accordance of Casemore.9 The CerTest rotavirus (CerTest biotec, Spain) was used for qualitative detection of rotavirus in stool samples. This test is one step colored chromatographic immunoassay. Rotavirus was detected in the fecal specimens following the instructions provided by the manufacturer. Fifty fecal samples that revealed negative tests for rotavirus and for cryptosporidiosis by modified Ziehl-Neelsen technique were selected to be tested by polymerase chain reaction (PCR).

Molecular detection of cryptosporidiosisExtraction of DNADeoxyribonucleic acid (DNA) was extracted from the fecal specimens using QIAamp DNA Stool Mini Kit (Qiagen, Germany). The extraction procedure was performed following the protocol provided by the manufacturer.

Polymerase chain reaction (PCR)Nested PCR was performed to amplify 18S ribosomal ribonucleic acid (RNA) gene as described elsewhere.10 Primary amplification was carried out using the primers 5’-TTCTAGAGCTAATACATGCG 3’(F), and 5’CCCTAATCCTTCGAAACAGGA-3’ (R). The amplification products was then subjected to second PCR using the primers 5’-GGAAGGGTTGTATTTATTAGATAAAG-3’ (F), and 5’-AAGGAGTAAGGAACAACCTCCA-3’ (R). In both PCR rounds, the master mix involved 1.5 μL of primers, 1.5 μL of DNA sample and 47 μL of PCR reaction mixture (taqDNA polymerase, PCR buffer, dNTPs, gel loading dyes and novel

green). The amplification was performed using PCR Thermal cycler (Eppendrof master cycle, France). Amplification protocol was consisted of 40 cycles of initial denaturation 30 seconds at 98°C, denaturation 10 seconds at 98°C, annealing 30 seconds at 55°C, extension 30 seconds at 72°C, and final extension 10 minutes at 72°C. Nested PCR amplification process consisted of 45 cycles of initial denaturation 30 seconds at 98°C, denaturation 10 seconds at 98°C, annealing 30 seconds at 61.4°C, extension 30 seconds at 72°C, and final extension 10 minutes at 72°C. The amplification products were detected on 1.5% agarose gel electrophoresis.

Statistical analysisThe collected data were statistically analyzed using statistical package for social sciences (SPSS) version 17 software. The association of two or more categorical variables was assessed by Chi-square test. Count and percentages were used to describe the frequency of different variables between all possible paired combinations of study groups. p≤0.05 was considered statistically significant.

RESULTS

Out of 400 stool samples that were collected from children who experienced gastroenteritis, all showed negative results for cryptosporidiosis by modified Ziehl-Neelsen technique. However, three samples (6%) out of fifty that were tested by PCR targeting 18 S rRNA gene, revealed positive bands at 550 bp (Figure 1). On the other hand, rotavirus infection was found to be positive in 128 (32.0%) of 400 cases. The incidence of cryptosporidiosis was almost similar among children who were from urban and rural areas. In contrast, rotavirus infection

1 3 2 L L L

Figure 1. A, B, C, show the results of nested second round PCR using outer primers 5'-TTCTAGAGCTAATACATGCG 3'(F), 5'CCCTA-ATCCTTCGAAACAGGA-3' (R) and inner primers 5'-GGAAGGGTTGTATTTATTAGATAAAG - 3' (F), and 5'-AAGGAGTAAGGAA-CAACCTCCA-3' (R).Three positive bands (1, 2, 3) were detected at 550 bp region. L: 100 bp DNA ladder

A B C

http://mji.ui.ac.id


193


Cryptosporidiosis Rotavirus infectionNo. of examined samples No. of positive (%) No. of examined samples No. of positive (%)

Residency p>0.05 P < 0.05Urban 35 1 (2.8) 295 102 (34.6)Rural 18 2 (8.6) 105 26 (24.7)Total 50 3 (6.0) 400 128 (32.0)

Table 1. Frequency of cryptosporidiosis and rotavirus infection according to residency

Cryptosporidiosis Rotavirus infection

No. of examined samples

No. of positive (%)

No. of examined samples

No. of positive (%)

Gender p>0.05 p>0.05Male 32 2 (6.25) 180 62 (34.4)Female 18 1 (5.55) 220 66 (30.0)Total 50 3 (6.0) 400 128 (32.0)

Age group p>0.05 p<0.05≤2 year 17 2 (11.7) 109 34 (31.1)2–3 year 22 1 (4.54) 193 76 (39.3)3–5 year 11 0 98 18 (18.3)Total 50 3 (6.0) 400 128 (32.0)

Season p>0.05 p<0.01January and February 10 0 168 65 (38.6)March and April 21 2 (9.52) 140 51 (36.4)May and June 19 1 (5.26) 92 12 (13.0)Total 50 3 (6.0) 400 128 (32.0)

Table 2. Gender, age and seasonal distribution of cryptosporidiosis and rotavirus infection

Vaccination status No. of samples

No. of positive (%)

One vaccine 43 26 (60.4) p<0.01Two vaccine 67 37 (55.2) p<0.01Three vaccine 152 37 (24.3) p<0.01Total vaccinated 262 100 (38.2) p<0.01Non-vaccinated 138 91 (65.9) p<0.01

Table 3. Incidence change of rotavirus Gastroenteritis among 400 children in response to vaccination

was significantly (p<0.05) higher among children who were from urban.

The frequency of infection for cryptosporidiosis and rotavirus infection among infected children was higher among males (6.25%, 34.4%, respectively) than females (5.55%, 30.0%, respectively) (Table 2). Cryptosporidiosis was higher through March and April (9.52%). In contrast, rotavirus infection was significantly (p<0.01) higher (38.6%) during winter months (January and February). The highest rate of cryptosporidiosis was observed in the cases with ages less than two years old (11.7%). However, rotavirus infection was significantly (p<0.05) higher among children younger than three years old. Table 3 indicates that rotavirus infection was significantly higher among non-vaccinated children, and the infection was sharply reduced among children who accomplished their vaccination protocol.

DISCUSSION

Diarrheal illnesses in children are the major public health concern in developing countries, including Iraq as well as neighboring countries.4,11–14 According to WHO, diarrhea is regarded as the


second highest cause of morbidity and mortality among the children in developing countries,1 for which cryptosporidiosis and rotavirus are the most common parasitic and viral cause for gastroenteritis worldwide.2 Comparing with studies carried out in other Iraqi provinces, our record was much lower than that reported by 11,12 in children aged less than three years old in Erbil and Sulaimani, respectively. However this finding was higher than that reported in some surrounding countries, Iran (4.6%)13 and Kuwait (3.4%).14 This variance of cryptosporidiosis might be attributed to some technical and epidemiological factors such as geographic location, drinking water facilities, diagnostic procedure, keeping and handling domesticated animals, particularly, cows, as well as other risk factors that could be associated with the acquisition of the infection.6

Superior of nested PCR in the diagnosis of cryptosporidiosis and false negative results of modified Ziehl-Neelson technique might be due to the scanty number of the oocysts that are excreted with the feces which could be under detectable level.10 Similar findings were observed by Maikai et al2 and Helmy et al10 Because of sensitivity and easily performance, PCR seems to be an obvious choice for detection of Cryptosporidium from the fecal specimens.10 The present study indicates that cryptosporidiosis is one of the causative agents of diarrhea, particularly among children, in Erbil along with other common parasitic agents such as Entamoeba histolytica and Giardia lamblia. Koyee et al11 found that cryptosporidiosis is the first common cause of diarrheal disease among children followed by amoebiasis.11 Although the rate of Cryptosporidium infection in this study was more prevalent among males than females, the differences was not significant. This finding was in agreement with previous studies conducted by other groups in Iraq.10,11

In this study, both genders were equally infected by Cryptosporidium oocysts. No known sex related physiological and epidemiological factors that changed the susceptibility and resistance to infection in certain gender. In contrast, a study performed by Saneian et al,13 found that cryptosporidiosis was more prevalent among females than males for which they could not refer to any factors as the causes of gender

difference. Concerning the residency of the patients, the frequency of infection among rural dwellers was non-significantly higher than those in urban area. Interestingly our finding was in agreement with that observed by Koyee et al and Ali et al11,12 in Erbil and Sulaimani, at a national level and with that of Mahgoub et al15 in Jordan at international level, which could be explained by poor socioeconomic status, animal contact, and drinking non safe, and poor quality water. During the rainy season, heavy rains facilitate the spread of Cryptosporidium oocysts from infected animal feces, causing contamination of drinking water supplies. Therefore, the use of water purification systems and prohibition of grazing farm animals near the drinking water resources are important for preventing Cryptosporidium infection.6 For this reason, incidence pattern of cryptosporidiosis in livestock and other reservoirs should also be assessed in future studies in Erbil.

In the present study, the infection rate was found to be age-relevant, accordingly, since the infection rate was vary among the studied age groups. Most cases of cryptosporidiosis were detected among children within age group ≤2 years old. This finding was consistent with previously published data,3 which stated that cryptosporidiosis (43%) was much higher among children less than 4 years old in New South Wales, Australia, between January 2008 and December 2010. Consistently, Adamu et al. (2015),5 found that highest rate of cryptosporidiosis (46.8%) was among under two years old diarrheal children and who presented to a number of health care providers in Addis Ababa between January and March, 2004. Those authors attributed such age relevant infections to some personal and epidemiological practices such as contamination of milk bottles, creeping on a contaminated ground, and low personal hygiene as well as the lower levels of immunity against most infections including cryptosporidiosis. Therefore, a low infectious dose is sufficient to establish the infection, and since repeated exposure to the parasite could confer some sort of immunity against the infection, older children are more protected.16 Age was also found to be an important factor affecting the incidence of rotavirus gastroenteritis.17 We found that rotavirus infection was significantly (p<0.05) higher among children younger

http://mji.ui.ac.id


195


than 3 years of age comparing with children older than 3 years of age (70.4% vs 18.3%). Rotavirus infection can be occurred throughout the life, and symptomatic infection rates are the highest in children under two years of age and decrease progressively. The most severe symptoms tend to occur in children between six months to two years of age. This indicates that the first months of age are relatively protected from gastroenteritis, which might be due to transmitted maternal immunity through the placenta, lasting for the first few months of life. However, this immunity will be declined later on, increasing the risk of getting the infection through contaminated bottle milk feeding. The seasonal pattern of cryptosporidiosis showed that all cryptosporidiosis cases were detected over March, April, May, and June. This might be due to the relatively warm temperature and some other epidemiological factors in these months, such as little differences in the average of temperature and humidity as well as water abundance that facilitates contamination of drinking water supplies with animal feces and swage. On the other hand, the low percentage of infection in both winter months (January and February) might be due to the sever decrease in temperature in winter season which may reach 0°C or less, that has fatal impact on the oocysts viability and infectivity.18 Climate change is known to be another factor affecting the incidence of rotavirus infection. In studies done by other groups, they found high incidence of rotavirus gastroenteritis between December to April.19 Confirming our result, we found that peak incidence was in January and February (38.6%) followed by March and April (36.4%), and significantly lower incidence of infection was detected in May and June (13%) (p<0.05). Peak incidence during winter and spring seasons is possibly due to the moist and relatively cold period which might support viral stability in such climate.19 Since the samples were collected in the winter and spring seasons, the seasonal patterns of these infection were still obscure. Thus, further studies including summer season is recommended to provide a clear figure about seasonal distribution of cryptosporidiosis and rotavirus infection in Erbil.

Viruses are the most common causative agent for gastroenteritis which are estimated to cause about 70% of episodes of infectious diarrhea

in children.20 Among viral gastroenteritis, rotaviruses are the most common causative agent in newborns and young children both in developing and developed countries, in agreement with published data at national and international level.17,19 The present study shows that rotavirus is one of the common causative agents of diarrheal illness in children in Erbil city besides other common parasitic and bacterial infections. The overall rate of rotavirus infection among studied children was 32%. Not much known concerning rotavirus infection in Erbil. A previous single study that had been carried out in Erbil city recorded that 37% of rotavirus infection was among children less than five years old.17 On national level, our data (32%) were close to it, as well as to that obtained and recorded in Thi-Qar (39%),21 but surprisingly they were much lower than that recorded in Najaf (66.7%).22 Comparably, the results were also close to that reported in Jordan (33%)23 and Turkey (32.4%),19 the neighboring countries. The results also revealed that the incidence of rotavirus infection was significantly higher in urban (33.6%) areas compared to that observed among children from rural (24.7%) areas. This finding was agreed with that reported by Hasson.21 These regional differences that have been reported in respect to the residency of the patients might be due to differences in health care systems, people health education, and sanitary awareness.21

Rotavirus vaccine is an effective tool for preventing severe rotavirus gastroenteritis. Attempts to develop a vaccine against human rotavirus began in the early 1980s. Two bands of rotavirus vaccines, namely, Rotateq (with three live attenuated rotavirus vaccine doses) and Rotarix (with two live attenuated vaccine doses) have been licensed and introduced for clinical use in many countries.24 The current study revealed that vaccinating children with Rotateq at different times (2nd, 4th and 6th months of age), significantly (p<0.05) declined the infection rate (14.1% vs 65.9%), indicating that the vaccine and the vaccination protocol that were applied in our communities were effective against rotavirus infection. This finding is supported by several other studies that have been carried out in this regard.24 The possible protective mechanisms of rotavirus vaccination as revealed by studies in animals


and humans, involved rotavirus specific IgA antibodies in the gut lumen and rotavirus specific B cells expressing α4β7 intestinal receptor are important for protective immunity. On the other hand, rotavirus specific maternal antibody may interfere with the efficacy of the vaccination in infants and young animals.25

The present study has some limitations that the chance of detecting more positive cryptosporidiosis cases might be increased by increasing the number of the samples that selected to be tested by PCR since PCR appeared more efficient technique than Modifies Ziehl-Neelson staining technique. Furthermore, the study was enrolled children who attended only one health service provider (Raparin Pediatrics Hospital) during only six months. Therefore, more studies are required to support a true figure of cryptosporidiosis and rotavirus gastroenteritis in Erbil governorate.

In conclusion, the incidence of cryptosporidiosis is declining. However, rotavirus gastroenteritis is relatively high among young children in Erbil, and rotateq vaccine significantly reduces the incidence of this later infection.

Conflict of InterestThe authors affirm no conflict of interest in this study.

AcknowledgmentsWe would like to acknowledge the physicians, laboratory, and inpatient section staff of Raparin Pediatrics Hospital in Erbil for their kind assistance to arrange a direct interview with the parents and also for their valued assistance in collecting fecal specimen. Grateful thanks to dean and laboratory staff in Medical Research Center/ Hawler Medical University for their kind assistance to host the laboratory and molecular investigations.

REFERENCES

1. Nyarango RM, Aloo PA, Kabiru EW, Nyanchongi BO. The risk of pathogenic intestinal parasite infections in Kisii Municipality, Kenya. BMC Public Health. 2008;8:237.

2. Maikai B V, Umoh JU, Lawal IA, Kudi AC, Ejembi CL, Xiao L. Molecular characterizations of Cryptosporidium, Giardia, and Enterocytozoon in humans in Kaduna State, Nigeria. Exp Parasitol. 2012;131(4):452–6.

3. Waldron LS, Dimeski B, Beggs PJ, Ferrari BC, Power

ML. Molecular epidemiology, spatiotemporal analysis, and ecology of sporadic human cryptosporidiosis in Australia. Appl Environ Microbiol. 2011;77(21):7757–65.

4. Areeshi MY., Beeching NJ., Hart CA. Cryptosporidiosis in Saudi Arabia and neighboring countries. Ann Saudi Med. 2007;27(5):325–32.

5. Adamu H, Endeshaw T, Teka T, Kifle A, Petros B. The prevalence of intestinal parasites in paediatric diarrhoeal and non-diarrhoeal patients in Addis Ababa hospitals, with special emphasis on opportunistic parasitic infections and with insight into the demographic and socio-economic factors. Ethiop J Heal Dev. 2006;20(1):39–46.

6. Sim S, Yu J, Lee Y, et al. Prevalence of Cryptosporidium Infection among Inhabitants of 2 Rural Areas in White Nile State, Sudan. 2015;53(6):745–7.

7. Narci H, Ugur M, Kisinma A, Turan H. Age distribution and seasonal pattern of rotavirus infection in children under 5 years. Jundishapur J Microbiol. 2013;6(1):16–9.

8. Stephenson J. Health in Iraq. Jama. 2007;297(19):2069.9. Casemore DP. Laboratory methods for diagnosing

cryptosporidiosis. J Clin Pathol. 1991;44(6):445–51.10. Helmy YA, Krücken J, Nöckler K, von Samson-

Himmelstjerna G, Zessin KH. Molecular epidemiology of Cryptosporidium in livestock animals and humans in the Ismailia province of Egypt. Vet Parasitol. 2013;193(1–3):15–24.

11. Koyee QM, Faraj AM. Prevalence of Cryptosporidium Spp. With other intestinal microorganisms among regular visitors of raparin pediatric hospital in Erbil City- Kurdistan Region, Iraq. Zanco J Pure Appl Sci. 2015;27(4):57–64.

12. Ali FM, Ali SAK. Cryptosporidosis in Sulaimini Pediatric Teaching Hospital and comparison of different diagnostic methods for its detection. Eur Sci J. 2013;9(36):454–64.

13. Saneian H, Yaghini O, Yaghini A, Modarresi M-R, Soroshnia M. Infection rate of Cryptosporidium parvum among diarrheic children in Isfahan. Iran J Pediatr. 2010;20(3):343–7.

14. Iqbal J, Khalid N, Hira PR. Cryptosporidiosis in Kuwaiti children: Association of clinical characteristics with cryptosporidium species and subtypes. J Med Microbiol. 2011;60(5):647–52.

15. Mahgoub ES, Almahbashi A, Abdulatif B. Cryptosporidiosis in children in a north Jordanian paediatric hospital. East Mediterr Heal J. 2004;10(4–5):494–501.

16. Tahira, F, Khan, HM, Shukla I, Fatima, S, Malik, MA , Shahid M. Prevalence of Cryptosporidium in children with diarrhoea in North Indian Tertiary Care Hospital. J Community Med Heal Educ. 2012;2(3):1–3.

17. Ahmed HM, Coulter JBS, Nakagomi O, et al. Molecular characterization of rotavirus gastroenteritis strains, Iraqi Kurdistan. Emerg Infect Dis. 2006;12(5):824–6.

18. Mor SM, Tzipori S. Cryptosporidiosis in children in Sub-Saharan Africa: a lingering challenge. Clin Infect Dis. 2008;47(7):915–21.

19. Ceyhan M, Alhan E., Salman N., et al. Multicenter prospective study on the burden of rotavirus gastroenteritis in Turkey, 2005-2006: A hospital-based study. J Infect Dis. 2009;200(Suppl 1):S234–8.

http://mji.ui.ac.id


197

20. Elliott EJ, Dalby-Payne J. 2. Acute infectious diarrhoea and dehydration in children. Med J Aust. 2004;181(10):565–70.

21. Hasson DAJ. Prevalence of rota virus infection among children with acute gastroenteritis in Thi-Qar governorate. Thi-Qar Med J. 2009;3(1):88–100.

22. Yasir S. Diagnostic Study on NSP5 of human rotavirus in Najaf Governorate. Kufa J Nurs Sci. 2015;5(3):1–9.

23. Youssef M, Shurman A, Bougnoux M, Rawashdeh M, Bretagne S, Strockbine N. Bacterial, viral and parasitic enteric pathogens associated with acute diarrhea in

hospitalized children from northern Jordan. FEMS Immunol Med Microbiol. 2000;28(3):257–63.

24. Dulgheroff ACB, Figueiredo EF, Moreira LP, Moura LM, Gouvêa VS, Domingues AL. Distribution of rotavirus genotypes after vaccine introduction in the Triângulo Mineiro region of Brazil: 4-Year follow-up study. J Clin Virol. 2012;55(1):67–71.

25. Desselberger U, Huppertz HI. Immune responses to rotavirus infection and vaccination and associated correlates of protection. J Infect Dis. 2011;203(2):188–95.



High preterm birth at Cipto Mangunkusumo Hospital as a national referral hospital in Indonesia

Keywords: outcome, preterm birth, prevalence, risk factor

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1454 • Med J Indones. 2017;26:198–203• Received 26 May 2016 • Accepted 17 Jul 2017

Corresponding author: Budi Iman Santoso, [email protected]


Ali Sungkar,1 Adly N.A. Fattah,1 Raymond Surya,1 Budi I. Santoso,1 Ivica Zalud2

1 Department of Obstetrics and Gynecology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo Hospital, Jakarta, Indonesia

2 Department of Obstetrics and Gynecology and Women's Health, John A Burns School of Medicine, University of Hawaii, Hawaii, U.S

Cl inical Research


ABSTRAK

Latar belakang: Kelahiran prematur merupakan penyebab langsung kematian neonatus. Indonesia merupakan salah satu penyumbang kelahiran prematur terbanyak pada tahun 2010. Studi ini bertujuan untuk mengidentifikasi prevalensi dan faktor risiko kelahiran prematur di RSUPN Cipto Mangunkusumo sebagai rumah sakit rujukan nasional.

Metode: Studi kohort retrospektif dengan melibatkan 2.612 wanita yang melahirkan dari Januari hingga Desember 2013. Semua data yang berkaitan dengan faktor risiko potensial dan luaran kelahiran prematur dicatat. Selanjutnya dilakukan analisis bivariat dengan chi-square dan t-test atau Mann-Whitney, serta analisis regresi logistik menggunakan SPSS versi 20.

Hasil: Sebanyak 1.020 dari 2.616 (38,5%) persalinan merupakan kelahiran prematur. Pasien yang datang karena rujukan meningkatkan 2 kali lipat kelahiran prematur (OR 1,89; 95% IK 1,37–2,61). Wanita dengan kehamilan tunggal (OR 0,17; 95% IK 0,12–0,25), presentasi kepala (OR 0,75; 95% IK 0,63–0,89), dan kunjungan antenatal yang teratur (OR 0,67; 95% IK 0,54–0,84) memiliki risiko rendah mengalami kelahiran prematur. Skor Apgar, berat lahir, dan cara persalinan sangat berbeda antara kelompok lahir cukup bulan dengan kelompok prematur.

Kesimpulan: Prevalensi kelahiran prematur di RSUPN Cipto Mangunkusumo 2,5 kali lipat lebih tinggi daripada angka nasional. Beberapa faktor protektif kelahiran prematur adalah kehamilan tunggal, presentasi kepala, dan kunjungan antenatal yang teratur.

ABSTRACT

Background: Preterm birth is the leading direct that causes neonatal death. Indonesia was listed as one of the countries with the greatest number of preterm birth in 2010. This study aims to identify the prevalence and the potential risk factors of preterm birth among women underwent delivery in Cipto Mangunkusumo Hospital, an Indonesian national reference hospital.

Methods: This retrospective cohort study involved 2,612 women who delivered between January and December 2013. Any clinical data which related to the potential risk factors and outcomes were recorded. The data were managed using chi-square for bivariate analysis and t-test or Mann-Whitney for numerical data followed by multiple logistic regression for multivariate analysis in SPSS version 20.0.

Results: Preterm birth affected 1,020 of 2,616 pregnancies (38.5%). Non-booked patients increased nearly twice risk for preterm delivery (OR 1.89, 95% CI 1.37–2.61). While women with singleton pregnancy (OR 0.17, 95% CI 0.12–0.25), head presentation (OR 0.75, 95% CI 0.63–0.89), and regular ANC (OR 0.67, 95% CI 0.54–0.84) had lower risk for preterm birth. Apgar score, birthweight, and mode of delivery were significantly different between the pre-term group and the full-term group.

Conclusion: Prevalence of preterm birth in Cipto Mangunkusumo Hospital was approximately 2.5 times higher compared to the national number. Several factors reducing preterm birth rate include singleton pregnancy, head presentation, and regular ANC.


Sungkar, et al.Preterm birth in Indonesia national tertiary referral hospital

199


Preterm birth is the leading direct cause of neonatal death.1 The rate of preterm birth has substantially increased in many locations.2 In 2010, Indonesia were listed as one of the countries with the greatest number of preterm birth. There were 15.5% preterm birth of all livebirths.3 Preterm deliveries occurred as a part of multi factorial process. Genetic, maternal, fetal and environmental factors affected the occurrence of preterm birth.4,5 Maternal age, low body mass index (BMI), multiple pregnancies were maternal factors associated with the incidence of preterm labour.5,6 Complex inflammation was the most responsible condition while infection probably has become the most clearly-understood factor.7,8

Preterm birth is associated with significant maternal, fetal, and neonatal risks. It accounts for 28% of causes in neonatal death and up to 75% of neonatal morbidity.9 In Indonesia, preterm birth contributed as many as 36% of all neonatal death causes.10 It possibly leads the newborn to neurocognitive deficits, pulmonary dysfunction and ophthalmologic disorders.9 Intrauterine fetal death (IUFD), intrauterine growth restriction (IUGR), heart rate abnormalities, early onset neonatal sepsis, intraventricular hemorrhage, cerebral palsy, anemia, constipation, and twin-twin transfusion syndrome were also associated with the preterm deliveries.7,11 These situations raise the needs for local epidemiological study of preterm birth in every level hospital in Indonesia. One of the tertiary national referral center hospital in Indonesia is Dr. Cipto Mangunkusumo Hospital. We assume that the prevalence of preterm birth in tertiary referral hospital will be higher than other hospitals because preterm delivery, especially the babies, needs advanced technology to increase the neonatal survival rate. Therefore, this study aims to determine the prevalence and potential risk factors for preterm birth among women underwent delivery in Dr. Cipto Mangunkusumo Hospital. The authors hope that by determining this prevalence and risk factors, the clinician, especially obstetrician, can perform strategic step to protect and early diagnose of preterm birth.

METHODS

The database used in this study was collected from the medical record of patients during the year of 2013. For each patient, we entered

demographics, obstetric history, diagnosis, management, laboratory data, as well as maternal and neonatal outcomes. Maternal age was classified into less than 20, 20 to 35 and more than 35 years old because the optimal and recommended reproductive age is 20 to 35 years old. Validated clinical information was recorded into the database in a consistent manner. Non-complete medical records were included in this study. However, for each analysis, medical records without required data have been excluded. The data for all patients were entered by a single data manager at the end of study period. The study has been approved by the Institutional Review Board at University of Indonesia number 503/H2.F1/ETIK/2014.

Retrospective analysis was conducted on the entire cohort of singleton and twin pregnancies. The patient could be both of booked and non-booked cases. The primary independent variable for this study was maternal age, number of fetus (single or multiple), parity, previous cesarean section (CS), referral type (booked-case or not), regularity of antenatal care (ANC), and leukocytes count at presentation. Gestational age was analyzed categorically as full-term (≥37 weeks), extremely preterm (<28 weeks), very preterm (28–<32 weeks), and moderate or late preterm (32–<37 weeks) newborns. Several preterm birth outcomes such as methods of delivery, Apgar score, birth weight, and amniotic fluid color (color of amniotic fluid observed during labor) were studied secondarily.

IBM SPSS Statistics version 20.0 was used for statistical analyses. Bivariate analyses for categorical data using chi-square was performed to findthe association between preterm birth and independent t-test or Mann-Whitney test used for numerical data. We considered p value <0.05 as statistically significant. Multiple logistic regression analysis with a backward elimination stepwise regression approach was used to evaluate the association between preterm delivery and potential risk factors. Adjusted odds ratios with their confidence intervals were used to describe the relative risk of the potential risk factors.

RESULTS

Preterm birth affected 1,020 of 2,616 (38.5%) all pregnancies was analyzed. Moderate to late


preterm births were accounted for 67.4% of all preterm births while very preterm and extremely preterm were 22.9% and 9.7%, respectively. The preterm birth cohort was characterized by a significantly higher prevalence of women aged 20–33, multiparous, non-booked cases patients, and singleton head presentation. Incomplete fields were not eligible for analysis. Therefore, the number of subjects for each bivariate analysis resulted in various number (Table 1). Maternal age, referral type, presentation, number of babies, and regularity of ANC were associated with preterm birth (Table 2). In multivariate analysis,

Gestational Age Proportion of all birth (n,%)

Preterm <37 weeks 1,020(38.5%)Extremely preterm* <28 weeks 99(9.7%)Very preterm* 28–<32 weeks 234(22.9%)Moderate to late preterm* 32–<37 weeks 687(67.4%)Full-term ≥37 weeks 1,574(59.9%)Post-term ≥42 weeks 35(1.3%)

Table1. Distribution of gestational age at birth according to gestational age group and subgroup

* Proportion of all preterm birth

Preterm Full-term P value OR (95%CI)Maternal age (n=2608) <0.001* -

<20 151 (15.6%) 157 (9.6%)20–35 654 (67.4%) 1,177 (71.9%)>35 165 (17.0%) 304 (18.6%)

Parity (n=2609) 0.097* -Nulliparous 456 (47.0%) 711 (43.4%)Primiparous 264 (27.2%) 446 (27.2%)Multiparous 250 (25.8%) 482 (29.4%)

Referral type (n=2598) <0.001* 1.80 (1.32–2.45)NBC 908 (94.0%) 1,464 (89.7%)BC 58 (6.0%) 168 (10.3%)

Previous cesarean section (n=2591) 0.870* -Yes 98 (9.6%) 154 (9.8%)No 922 (90.4%) 1,417 (90.2%)

Maternal morbidityPROM (n=2588) 420 (43.7%) 689 (42.3%) 0.500* 1.06 (0.90–1.24)Preeclampsia with severe features (n=2601) 238 (24.6%) 344 (21.0%) 0.033* 1.23 (1.02–1.48)Eclampsia (n=2600) 43 (4.5%) 31 (1.9%) <0.001* 2.41 (1.51–3.85)Anemia (n=2594) 207 (21.4%) 273 (16.8%) 0.003* 1.35 (1.11–1.66)

Presentation (n=2609) <0.001* -Head 809 (83.4%) 1,485 (90.6%)Breech 98 (10.1%) 92 (5.6%)Transverse 63 (6.5%) 62 (3.8%)

Number of babies (n=2608) <0.001* 0.17 (0.12–0.25)Singleton 841 (86.7%) 1,596 (97.4%)Multiple 129 (13.3%) 42 (2.6%)

ANC>3 times (n=2574) 0.001* 0.69 (0.56–0.86)Yes 784 (81.9%) 1,403 (86.8%)No 173 (18.1%) 214 (13.2%)

Leukocyte counts at presentation (x 103 μl) (n=2560) (median(min-max))

13,550 (2,100–42,500)

12,600 (1,860–39,300)

<0.015† -

Table 2. Clinical characteristics of pregnancies according to gestational age at deliveries

* Chi-Square Test; † Mann-Whitney U Test; NBC= non-booked case; BC= booked case; PROM= premature rupture of membrane; ANC= antenatal care

http://mji.ui.ac.id


201


Variable Coefficient p Adjusted OR 95%CIAge <20 years old 0.47 0.03 1.60 1.17–2.18Referral type (NBC) 0.63 <0.001 1.88 1.34–2.63Singleton baby -1.76 <0.001 0.17 0.12–0.25Head presentation -0.56 0.006 0.57 0.39–0.85Eclampsia 0.87 0.001 2.39 1.44–3.96Anemia 0.29 0.009 1.33 1.07–1.65ANC>3 times -0.27 0.022 0.76 0.60–0.96Constant 1.11 0.001 3.05

Table 3. Results of multiple logistic regression analysis on risk and protective factors for preterm delivery*

*Adjusted for maternal age, parity, referral type, premature rupture of membrane, preeclampsia with severe features, eclampsia, anemia, presentation, number of babies, antenatal care more than 3 times, and leucocyte more than 15,000/μL

Preterm Full-term pAPGAR score (mean (SD)) (n=2197) <0.001*

First minute 6.97 (2.54) 8.35 (1.28)Fifth minutes 8.35 (2.44) 9.50 (1.11)

Birth weight (grams) (mean (SD)) (n=2197) 1,925 (608) 3,045 (471) <0.001*Mode of delivery (n=2590) 0.003†

Vaginal delivery 490 (48.1%) 848 (54.0%)C-section 529 (51.9%) 723 (46.0%)

Amniotic fluid color (n=2289) <0.001†

Clear 772 (87.3%) 1142 (81.3%)Scanty-green 98 (11.1%) 196 (14.0%)Thick-green 14 (1.6%) 67 (4.8%)

Table 4. Perinatal outcomes associated with preterm birth according to gestational age at deliveries

* Chi-square test; † Mann-Whitney U test

age less than 20 years old, referral type, eclampsia, and anemia increased the risk of preterm birth while singleton baby, head presentation, and regular ANC reduced the risk (Table 3).

Apgar score, birthweight, need for induction, and mode of delivery were significantly different between the pre-term group and the full-term group (Table 4). Apgar score and birthweight were significantly lower in the preterm group. Preterm pregnancy significantly led to higher cesarean section rate compared to the full-term group.

DISCUSSION

To best knowledge, this is the largest hospital-based study finding at preterm birth prevalence

in Indonesia. The prevalence of preterm birth in this study was 2.5 times higher compared to the national prevalence (15.5%). It is predominantly affected by the high number of referral cases to this hospital. In accordance with a systematic review on prevalence of preterm birth, moderate to late preterm birth rate was the highest proportion of all preterm deliveries.3 The result was similar with our study (67.4% cases of moderate to late preterm birth). Application of standard preterm definitions is important to study the survival probability of the neonates.3

Primiparity did not increase the risk for preterm birth in our study. However, Erez et al12 concluded that primiparity was the independent risk factors for preterm delivery (OR 1.45, 95% CI 1.18-1.78). The age distribution of our population was


similar to a study conducted by Chen et al. among upper middle class in Chinese population.13 The percentage of women aged below 20 years old were higher in the preterm group compared to the non-preterm group in our study. Moreover, the association between maternal age and preterm birth was statistically significant. Nguyen et al14 found that women aged 24 or below were tend to deliver preterm babies 1.9 times compared to 24–35 years old women. Meanwhile, a systematic review found that older maternal age was associated with preterm birth.15 Therefore, there is insufficient evidence to conclude that older or younger maternal age is an independent risk factor for preterm birth.

This study did not find correlation between previous CS with preterm birth. Conversely, Di Renzo et al. found approximately three times increased risk for spontaneous preterm birth in women underwent previous CS.16 Regular ANC was one of the independent protective factors for having preterm birth. It had been described previously by Bastek,17 which stated that no prenatal care was one of the components in prediction models of women for having delivery before 37 weeks.

Singleton pregnancy revealed a reduced risk to preterm labor (p<0.001; OR 0.17; 95% CI 0.12-0.25). Nice Clinical Guidelines stated that more than 50% of twins and almost all triplets were born before 37 weeks of gestation, and 15–20% would be admitted in neonatal unit related to preterm.18 In this study, there was a significant association between white blood cell count and prevalence of preterm birth. However, it did not affect in multivariate analysis. Surabhi et al19 stated that stress of delivery may lead to brisk leukocytosis. Apart from that, the increase of white blood cell was usually identified in patients with intrauterine infection and adverse perinatal outcome. Nevertheless, amniotic fluid white blood cell was a better independent predictor than white blood cell.

Significant lower birthweight was found in most of preterm studies.20,21 The birthweight of preterm babies in this study was 1,925 grams. It is comparable with 33–35 weeks gestation babies delivered in ten California and Massachusetts hospitals, ranging from 1,759 to 2,215 grams.22 In another large study, the birthweight of 34–

36 weeks babies ranged from 2,195 to 2,687 grams.21 Very preterm babies included in the analysis could lower the mean of birthweight. Apgar scores in both 1st and 5th minutes were significantly associated with preterm birth. It had been previously described in China, with Apgar score on 1st min and 5th min was 7.7 (SD 2.43) and 8.9 (SD 1.81).13 Consequently, this situation will possibly lead to the substantial risk for neonatal deaths.20

The limitation of this study is that we collected the data from a tertiary, national referral hospital. Thus, the result might be hardly applied in general setting. The Apgar score was prepared by the attending neonatologist or neonatology residents. This could possibly lead to bias secondary to inter-practitioner variability in diagnostic criteria. However, it is difficult to eliminate this potential bias due to the academic hospital system.

In conclusion, prevalence of preterm birth in Dr. Cipto Mangunkusumo Hospital was approximately 2.5 times higher compared to national number. Several factors reducing the preterm birth rate include singleton pregnancy, head presentation, and regular ANC.

Conflict of interestThe authors affirm no conflict of interest in this study.

AcknowledgmentThank to all midwives, nurses, obstetrics and gynecology residents for their help in collecting data for preparing the manuscript.

REFERENCES

1. Lawn JE, Gravett MG, Nunes TM, Rubens CE, Stanton C, GAPPS Review Group. Global report on preterm birth and stillbirth (1 of 7): definitions, description of the burden and opportunities to improve data. BMC Pregnancy Childbirth. 2010;10 Suppl 1:S1.

2. Goldenberg RL, Culhane JF, Iams JD, Romero R. Epidemiology and causes of preterm birth. Lancet. 2008;371(9606):75–84.

3. Blencowe H, Cousens S, Oestergaard MZ, Chou D, Moller A-B, Narwal R, et al. National, regional, and worldwide estimates of preterm birth rates in the year 2010 with time trends since 1990 for selected countries: a systematic analysis and implications. Lancet. 2012;379(9832):2162–72.

http://mji.ui.ac.id


203


4. Warren JE, Silver RM. Genetics of the Cervix in Relation to Preterm Birth. Semin Perinatol. 2009;33(5):308–11.

5. Murphy DJ. Epidemiology and environmental factors in preterm labour. Best Pract Res Clin Obstet Gynaecol. 2007;21(5):773–89.

6. Lo CC, Hsu JJ, Hsieh CC, Hsieh TT, Hung T-H. Risk Factors for Spontaneous Preterm Delivery Before 34 Weeks of Gestation Among Taiwanese Women. Taiwan J Obstet Gynecol. 2007;46(4):389–94.

7. Hofer N, Kothari R, Morris N, Müller W, Resch B. The fetal inflammatory response syndrome is a risk factor for morbidity in preterm neonates. Am J Obstet Gynecol. 2013 Dec;209(6):542.e1–542.e11.

8. Olgun NS, Reznik SE. The matrix metalloproteases and endothelin-1 in infection-associated preterm birth. Obstet Gynecol Int. 2010;2010(11):1–8.

9. Wen SW, Smith G, Yang Q, Walker M. Epidemiology of preterm birth and neonatal outcome. Semin Fetal Neonatal Med. 2004;9(6):429–35.

10. UNICEF [Internet]. Maternal, Newborn & Child Survival. [update 2008 ; cited 2017]. Availabe from : www.unicef.org/eapro/Indonesia_Eng.pdf. p. 1–4.

11. Zachariassen G, Fenger-Gron J. Preterm dietary study: meal frequency, regurgitation and the surprisingly high use of laxatives among formula-fed infants following discharge. Acta Paediatr. 2014 Mar;103(3):e116–22.

12. Erez O, Mayer A, Shoham-Vardi I, Dukler D, Mazor M. Primiparity, assisted reproduction, and preterm birth in twin pregnancies: a population based study. Arch Gynecol Obstet. 2007 Oct 31;277(4):311–7.

13. Chen CP, Wang KG, Yang YC, See LC. Risk factors for preterm birth in an upper middle class Chinese population. Eur J Obstet Gynecol. 1996 Dec;70(1):53–9.

14. Nguyen N, Savitz DA, Thorp JM. Risk factors for preterm birth in Vietnam. Int J Gynecol Obstet. 2004;86(1):70–8.

15. Newburn-Cook CV, Onyskiw JE. Is older maternal age a risk factor for preterm birth and fetal growth restriction? A systematic review. Health Care Women Int. 2005;26(9):852–75.

16. Di Renzo GC, Giardina I, Rosati A, Clerici G, Torricelli M, Petraglia F, et al. Maternal risk factors for preterm birth: a country-based population analysis. Eur J Obstet Gynecol Reprod Biol. 2011 Dec;159(2):342–6.

17. Bastek JA, Sammel MD, Srinivas SK, McShea MA, Foreman MN, Elovitz MA, et al. Clinical prediction rules for preterm birth in patients presenting with preterm labor. Obstet Gynecol. 2012;119(6):1119–28.

18. Nice Clinical Guidelines. Multiple pregnancy: The management of twin and triplet pregnancies in the antenatal period. RCOG; 2011.

19. Chandra S, Tripathi AK, Mishra S, Amzarul M, Vaish AK. Physiological changes in hematological parameters during pregnancy. Indian J Hematol Blood Transfus. 2012; 28(3):144–6.

20. Marchant T, Willey B, Katz J, Clarke S, Kariuki S, Kuile FT, et al. Neonatal Mortality Risk Associated with Preterm Birth in East Africa, Adjusted by Weight for Gestational Age: Individual Participant Level Meta-Analysis. PLoS Med. 2012;9(8):e1001292.

21. Gouyon JB, Vintejoux A, Sagot P, Burguet A, Quantin C, Ferdynus C, et al. Neonatal outcome associated with singleton birth at 34–41 weeks of gestation. Int J Epidemiol. 2010;39(3):769–76.

22. McCormick MC, Escobar GJ, Zheng Z, Richardson DK. Place of birth and variations in management of late preterm (“near-term”) infants. Semin Perinatol. 2006;30(1):44–7.


The effect of Bifidobacterium animalis lactis HNO19 supplementation among pregnant and lactating women on interleukin-8 level in breast milk and infant’s gut mucosal integrity

Keywords: Bifidobacterium lactis animalis HNO19, breastmilk, gut mucosal integrity

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1481 • Med J Indones. 2017;26:204–11• Received 22 Jun 2016 • Accepted 06 Jul 2017

Corresponding author: Naomi E.F. Dewanto, [email protected]


Naomi E.F. Dewanto,1 Agus Firmansyah,2 Ali Sungkar,3 Nani Dharmasetiawani,4 Sudigdo Sastroasmoro,2 Siti B. Kresno,5 Rulina Suradi,2 Saptawati Bardosono,6 Dwi Prasetyo7

1 Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia 2 Department of Child Health, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia 3 Department of Obstetric Gynecology, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia 4 Department of Pediatric, Budi Kemuliaan Hospital, Jakarta, Indonesia5 Department of Pathology Clinic, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia 6 Department of Nutrition, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia7 Department of Child Health, Faculty of Medicine, Universitas Padjadjaran, Sumedang, Indonesia

Clinical Research


ABSTRAK

Latar belakang: Mukosa usus bayi baru lahir belum sepenuhnya berkembang sehingga bayi rentan mengalami diare. Pemberian probiotik diketahui dapat memicu maturasi saluran cerna. Penelitian ini bertujuan untuk mengidentifikasi apakah suplementasi probiotik sejak ibu hamil di trimester ketiga dapat meningkatkan integritas mukosa usus pada bayi baru lahir.

Metode: Uji klinis acak tersamar ganda dilakukan untuk mengetahui potensi efek pemberian probiotik terhadap kandungan probiotik dan interleukin-8 (IL-8) di ASI, kadar IFABP di urin ibu menyusui, dan kandungan α-1-antytripsin, serta kalprotektin pada feses bayi saat lahir (V0) dan saat usia 3 bulan (V3). Strain tunggal Bifidobacterium lactis animalis HNO19 (dikenal sebagai DR10) digunakan dalam studi ini karena bukan merupakan bakteri residen. Penelitian ini dilakukan di Rumah Sakit Budi Kemuliaan dan satelit kliniknya dari Desember 2014 hingga Desember 2015.

Hasil: Hasil penelitian menunjukkan bahwa sebanyak 14% (5/35) dan 20% (7/35) subjek memiliki DR10 pada kolostrum dan ASI saat bayi berusia tiga bulan. Nilai median IL-8 kelompok probiotik dibandingkan kelompok placebo pada V0 dan V3 berturut-turut adalah 2810,1 pg/mL vs. 1516,4 pg/mL (p=0,327) dan 173,2 pg/mL vs 132,7 pg/mL (p=0,211). IFABP 211,7 ng/mL vs 842,5 ng/mL (p=0,243) dan 25,3 ng/mL vs 25,1 ng/mL (p=0,466). AAT 136,2 mg/dL vs 148,1 mg/dL (p=0,466) dan 24 mg/mL vs 29,72 mg/mL (p=0,545). Kalprotektin 746,8 ng/mL vs 4645,2 ng/mL (p=0,233) dan 378,6 ng/mL vs 391,3 ng/mL (p=0,888).

Kesimpulan: Probiotik DR10 yang diberikan pada ibu hamil dan menyusui dapat ditemukan pada kolostrum dan ASI saat usia bayi 3 bulan, tetapi tidak memberikan efek terhadap kadar probiotik lain atau IL-8 dan integritas mukosa usus.

ABSTRACT

Background: Newborn’s gut mucosal is not fully developed, therefore infants are prone to diarrhea. Probiotic supplementation is known to induce the gut mucosal maturity. This study aimed to identify whether probiotics supplementation among pregnant women since the third trimester would increase the infant’s gut mucosal integrity.

Methods: A double-blind, randomized clinical trial was conducted to understand the potential effect of probiotic supplementation on the level of probiotics and IL-8 in breastmilk, urine IFABP, faecal α-1-antytripsin (AAT) and calprotectin in infant’s at birth (V0) and three-months old (V3). A single strain of Bifidobacterium lactis animalis HNO19 (known as DR10) was used since it was not the resident bacteria. The study was held at Budi Kemuliaan Hospital and its satellite clinics from December 2014 to December 2015.

Results: About 14% (5/35) and 20% (7/35) of the subjects had DR10 in the breastmilk’s colostrum and at the age of 3-months. The median values of IL-8 in the probiotic group vs the placebo group at V0 and V3 were 2810,1 pg/mL vs 1516.4 pg/mL (p=0.327) and 173.2 pg/mL vs 132.7 pg/mL (p=0.211) respectively. IFABP level 211.7 ng/mL vs 842.5 ng/mL (p=0.243) and 25.3 ng/mL vs 25.1 ng/mL (p=0.466); AAT 136.2 mg/dL vs 148.1 mg/dL (p=0.466) and 24 mg/mL vs 29.72 mg/mL (p=0.545); Calprotectin 746.8 ng/mL vs 4645.2 ng/mL (p=0.233) and 378.6 ng/mL vs 391.3 ng/mL (p=0.888).

Conclusion: Probiotic DR10 given to pregnant women since the 3rd trimester can be found in colostrum and 3-months breastmilk. However, it did not affect the level of other probiotics or IL-8 and the gut mucosal integrity.


Dewanto, et al.The effect of DR10 supplementation

205


The infant’s intestinal mucosal growth is not ma-ture, yet this is called “leaky gut”. The intestinal mucosal develops until the infants reach two years of age. Therefore, the highest incidence of diarrhea is found among children under two years old. The mucosal epithelial barrier and im-munoregulatory network are poorly developed in newborns. The infant’s abrupt introduction to life outside uterus and the exposure to antigens force the gastrointestinal (GI) tract to adapt quickly and commence its crucial duties.1

However, the neonate’s adaptive immune system is still immature, leaving the newborn in a state of vulnerability and at increased risk for serious infection.2 Human milk, the natural infant feed-ing, is a complex species-specific biological fluid adapted to perfectly satisfy the nutritional and immunological needs to neonate. The compounds presented in colostrum or mature milk may have anti-infective effect.3

Recently, extensive research has been conducted to understand the beneficial role of human milk oligosaccharides (HMO), introducing the new con-cept of the ‘milk microbiome’. The mechanism of whether bacteria contamination or active migra-tion helps bacteria to reach mammary gland is de-batable4 and further study is necessary. Numerous studies had identified probiotics in breastmilk.3,5 Probiotic consumptions may help other bacteria to grow, for example supplementation of bifido-bacteria affects lactobacillus growth.6 Administra-tion of Enterococcus faecium CRL 183 increases bifidobacteria and short chain fatty acid (SCFA) levels whereas Lactobacillus acidophilus CRL 104 increases Bifidobacterium and Lactobacillus, as well as acetate in an in vitro GI model.7 Interleukin 8 (IL-8) presents in significant amount in human milk. Studies showed that a consistent increase in cell migration, proliferation, and differentiation oc-cured when human fetal and adult intestinal cells were treated with rhIL-8 in vitro.8 Other in vitro study found the relationship of E. coli LTH 634 and Lactobacillus sakei with the production of IL-8.9

This study aims to provide evidence whether pro-biotics are present in breastmilk and affect the growth of other bacterias, and also increase the IL-8 production and mucosal integrity of infants, compared to the placebo group. A single strain of Bifidobacterium lactis animalis HNO19, a non-res-ident bacterium, was used in this study.

METHODS

Study designA double-blind, randomize controlled trial with two parallel groups was conducted to understand the effect of probiotic supplementation in preg-nant women, assessing the IL-8 production in breast milk, urinary intestinal fatty acid binding protein (IFABP), α-1-antytripsin (AAT) and cal-protectin in feses at birth and three-month old infant. This study was conducted from December 2014 to December 2015 at Budi Kemuliaan hospi-tal and its satellite clinics. A total of 110 pregnant women in their third trimester, who came to the obstetrics and gynecology outpatient department in the selected hospitals were enrolled. The inclu-sion criteria were pregnant women at third tri-mester, normal pregnancy, plan to deliver sponta-neously, no consumption of antibiotics, and plan to exclusively breastfeed the baby (at least until the baby is three months old). The newborns of the study were also included in the study. Exclu-sion criteria were pregnant women with pre-ec-lampsia, bleeding, infection, premature rupture of the membrane or other chronic disease. This study was approved by the Health Research Eth-ics Committee Faculty of Medicine University of Indonesia number 525/UNS.F1/ETIK/2014.

Sample selectionPregnant women who fulfilled the inclusion cri-teria at Budi Kemuliaan Hospital and its satel-lite clinics would be recruited. They were asked to participate in the study and signed the in-formed consent. The subjects were divided into two groups by block permutted randomization with the size of ten. The subjects were restrict-ed to consume food/drink with probiotic ingre-dients, such as yoghurt and yakult, during the study. Their diet was controlled by nutrition experts.

Intervention stageThe treatment group was given probiotic cap-sul of Bifidobacterium lactis animalis HNO 19 with the dose of 109 unit every day until their newborns were three-months old. While for the same period, the control group was given place-bo daily. In case of bleeding during birth delivery or cesarean surgery or antibiotics treatments, the subjects would be excluded from the study (dropped out).


Initial breastmilk in the first days after birth (colostrum) was obtained and examined us-ing real time (RT) polymerase chain reaction deoxyribose-nucleic acid (PCR DNA) to identify the total number of microbiota, genus Bifidobac-teria, genus Lactobacillus, and strain Bifidobac-terium lactis animalis HNO19 (DR10). A manual sampling was conducted; the nipples and mam-mary areole were cleaned with antiseptic. The researcher washed their hands and wore sterile gloves before doing the examination. Skin swab around the breast was also performed. Infants were examined for intestinal fatty acid binding protein (IFABP) in their urine and for calpro-tectin, alpha 1 antytripsin, in their stool. The gestational age, anthropometric status (birth weight, birth length, head circumference), mode of delivery, and Apgar score were recorded from the newborns. Infants with respiratory distress, asphyxia, seizures, congenital abnormalities, re-quire NICU or were not able to drink orally are considered as drop-out (DO). During breastfeed-ing, subjects were monitored and counseled by a breastfeeding counselor in order to achieve exclusive breastfeeding. Same procedures were performed when the infants reached three-months old.

Specimen collection and examination of breastmilkColostrum were obtained after birth delivery (day 1–5). Trained persons collected the sam-ples with aseptic and antiseptic action. After pumping, at least 0.1 mL of breastmilk was poured into a sterile tube containing 300 mg of zirconium beads (diameter 0.1 mm). After-wards, the samples were centrifuged several times in the laboratoray, washed with ethanol, and centrifuged again before DNA separated. Real-time PCR was performed using the ap-plied biosystems (ABI) 7500 Fast Sequence Detection System using software version 2.0 (Applied - Biosystems). Primers were designed based on 16S ribosa ribonucleic acid (rRNA) specific for Bifidobacterium sp., total bacte-ria, Lactobacillus sp. and Bifidobacterium lac-tis animalis HNO19 (Table 1). Each reaction run with duplication of the final volume 15 µl with a final concentration of 0.3 to 0.9 µM each primer, and 10 mL of appropriate dilution with the DNA sample. IL-8 in breastmilk was also examined using enzyme linked imunosor-bent assay (ELISA) method.10 Before collecting

breastmilk, we did skin swab around the breast and examined for DR 10.

Examination of urine IFABP, stool AAT and cal-protectineIn this study, I-FABP urine was measured by Elisa using human I- FABP ELISA kits HK406.11 One mL urine was collected with aseptic pro-cedure and removed to the poliprophylen tube, which then kept in -80°C storage. Before analy-sis, the specimens were removed to -20°C for one night, then they were removed again to room temperature (18–25°C), and mixed well. Centrifugation was conducted to remove the debris, then everything was done as in the kit procedure.

AAT and calprotectin was measured in stool.12,13 Make sure reagen and specimen were mixed ad-equately. Put 100 mg stool to a plastic vial then add 5 mL Exbuff. Centrifugation and dilution for AAT and calprotectin were performed differently according to the kit procedure.

Data Analysis All data were analysed using statistical product and service solutions (SPSS) version 20 and pre-sented in text, tables, or graphs. We used 95% of confidence level 80% power. Data with normal distribution presented mean and standard de-viations values while data with abnormal distri-bution used median values. Mann Whitney and independent t-test were applied in this study.

RESULTS

About 110 subjects were recruited and enrolled to this study, but 40 of them were dropped out, leaving only 70 subjects (Figure 1). Primer quantitative PCR for microbiota in breastmilk showed in Table 1. The majority were housewives, aged 20–29 years, giving birth once, graduated from high school, and received income of 2–9 million IDR (Table 2). About 14% (5/35) subjects in probiotic group had DR10 posi-tive in their breast milk during birth delivery (V0) and 20% (7/35) at three-months postpartum (V3). However, none were positive in the placebo group, both during birth delivery and at three-month post-partum. Skin swab indicated negative result in all groups (Table 3). Composition of microbiota and IL-8 in breastmilk showed in Table 4. Result of urine IFABP, stool AAT and calprotectin showed in Table 5.

http://mji.ui.ac.id


207


No Target Primer Sequence Reference1. Bifidobacterium sp. F_Bifid CGGGTGAGTAATGCGTGACC 14

R_Bifid TGATAGGACGCGACCCCA2. Total microbiota 8f_All GRGTTYGATYMTGGCTCAG 14

340R ACTGCTGCCTCCCGTAGGAGT3. Lactobacillus sp. F_Lacto AGCAGTAGGGAATCTTCCA 14

R_Lacto CGCCACTGGTGTTCYTCCATATA

4. Bifidobacterium animalis subsp. lactis strain HNO19 (DR10)

F_DR10R_DR10

CCCTTTCCACGGGTCCCAAGGGAAACCGTGTCTCCAC

14

Table 1. Primer quantitative PCR for microbiota in breastmilk.14

DISCUSSION This is the first study explaining the correlation between probiotic diet and breastmilk microbio-ta among women after birth delivery in Indone-sia. Many factors influence the viabillity and sur-vival of probiotic in breastmilk, such as genetic, culture, environment, diet, mode of delivery, and antibiotic treatment during pregnancy and lactation.15 Breastmilk of women who received antibiotics during pregnancy or lactation had

lower content of Lactobacilli or Bifidobacteria compared to women who received no antibiot-ics.16 In this study, both the intervention and the placebo group had Lactobacillus and Bifidobacte-rium in their breastmilk. Subjects who received antibiotics during pregnancy had been excluded from this study. One subject with premature rup-ture of membrane was excluded due to caesarean section. There were few subjects who received antibiotics during delivery or maximum five days postpartum via oral or three days via parenter-al. However, their test were still positive. These

Figure

Figure 1. Subject Recruitment

110 healthy pregnant women 32-34 weeks

gestation

Probiotic group

(n=54)

Placebo group

(n=56)

continue

(n=36)

finished

(n=35)

continue

(n=38)

finished

(n=35)

Born

Month 3

DO=19

Caesarian section 13

Unwilling to cont 3

Went to hometown 1

Unapproval from the husband 1

Formula milk 1

DO=21

Caesarian section 8

Unwilling to continue 1

Went to hometown 4

Vomit/diarrhea 2

Sick 2

Unapproval from the husband 1

Suami tidak setuju 1

Formula milk 1

Premature 2

Figure 1. Subject recruitment. DO= drop out


GroupProbiotic Placebo Total

n (%) n (%) n (%)Age (year)

<20 3 (5.6) 3 (5.4) 6 (5.5)20–29 35 (64.8) 31 (55.4) 66 (60.0)30–39 14 (25.9) 20 (35.7) 34 (30.9)

>40 2 (3.7) 2 (3.6) 4 (36)Education

Illiterate 0 (0) 0 (0) 0 (0)Primary school 11 (20.4) 10 (17.9) 21 (19.1)High school 39 (72.2) 39 (69.6) 78 (70.9)

Bachelor 2 (3.7) 4 (7.1) 6 (5.5)Diploma 2 (3.7) 3 (5.4) 5 (4.5)

Parity1 29 (53.7) 26 (46.4) 55 (50.0)2 14 (25.9) 14 (25.0) 28 (25.5)3 5 (9.3) 11 (19.6) 16 (14.5)4 6 (11.1) 4 (7.1) 10 (9.1)5 0 (0.0) 1 (1.8) 1 (0.9)

Income (IDR)<2 6 (11.1) 10 (17.9) 16 (14.5)2–9 48 (88.9) 42 (75.0) 90 (81.8)>9 0 (0) 4 (7.1) 4 (3.6)

JobHousewife 28 (51.9) 31 (55.4) 59 (53.6)Enterpreneur 2 (3.7) 4 (7.1) 6 (5.5)Employee 24 (44.4) 21 (37.5) 45 (40.9)

Total 54 (100.0) 56 (100.0) 110 (100.0)

Table 2. Subject charasteristic

Bifidobacterium lactis HNO19

Group

Probioticn=35

Placebon=35

Breast milk n (%)V0 5(14) 0V3 7(20) 0

Copy number/m Median ( min – max)

V0 53.6 (25.3–74.4) 0V3 80.4 (6.7–85.7) 0

Skin swabV0 0 0V3 0 0

Table 3. Bifidobacterium lactis HNO19 in breast milk and skin swab

V0= at delivery; V3= at 3 months

might happen because the microbiota depression period ranges usually between 3–8 weeks while the time period between V0 and V3 examination was three months. Our findings also support that Bifidobacterium animalis lactis HNO19 (DR 10) is transient microbiota that can be transferred from mother to fetus through mammary lymph nodes.17,18 After consumption, ingested bacteria enter a hostile environment where subsequent passage through stomach and duodenum ex-poses them to highly stressful physiochemical and biological conditions such as gastric acid and bile salt.15 DR 10 that reach gastric lumen are taken up by dendritic cell (DC) to the mesenteric lymph nodes, respiratory tract, genitourinary tract, salivary and lacrimal glands, and eventu-ally mammary gland. DCs and macrofags are able to discriminate between pathogenic and non-

http://mji.ui.ac.id


209


Group

p-value*Probioticn=35

Placebon=35

Total microbiotaMedian (min-max) copy number/mL

V0 963.8 (184.9–94106.7) 2523.2 (123.6–26821.6) 0.242V3 1803.6 (143.1–551256) 2201.1 (273.1–870017.1) 0.819

LactobacillusMedian (min-max) copy number/mL

V0 3.3 (0–16.8) 2.7 (0.06–1201.1) 0.819V3 3.7 (0.11–1389.9) 6.62 (0.42–165.5) 0.073

% Lactobacillus from total microbiota Median (min-max)

V0 0.185 (0–6) 0.105 (0.001–38.0) 0.435 V3 0.226 (0.001–30) 0.360 (0.002–34) 0.190

Bifidobacterium Median (min-max) copy number/mL

V0 122.3 (11.7–348.4) 120.6 (37.4–236.5) 0.911V3 61.3 (3.8–603.3) 61.9 (12.2–191.8) 0.577

% Bifidobacterium from total microbiota Median (min-max)

V0 8.8 (0.060–83) 6.3 (0.534–98) 0.442 V3 3.4 (0.075–43) 1.9 (0.022–45) 0.930

IBreast milk IL8 Median (min-max) pg/mL

V0

2810.1 (94.5–66246.9) 1516.4 (28.8–514157) 0.327

V3 173.2 (24.8–8118.2) 132.7 (35.4–3150.7) 0.211

Table 4. Composition of breast milk microbiota and level of IL-8 in breast milk

*= Mann Whitney; V0= at delivery; V3= at the baby 3 months of age

Groupp-value*

Probioticn=35

Placebon=35

Urine IFABP median (min-max) ng/mLV0 211.7 (23.8–6652.2) 842.5 (14.9–9619.8) 0.243V3 25.3 (18.1–952.6) 26.1 (17.2–255.3) 0.466

Stool AAT median (min-max) mg/dLV0 136.2 (6.8–576.6) 148.1 (18.6–670.4) 0.466V3 24.0 (7.4–168.5) 29.72 (3.1–130.7) 0.545

Stool calprotectin median (min-max) ng/mLV0 746.8 (39.4–1950.8) 465.2 (72.8–2622.6) 0.233V3 378.6 (169.69–1416.7) 391.3 (83.1–2132.8) 0.888

Table 5. Urine IFABP, stool AAT and calprotectin

*Mann Whitney; V0= at delivery; V3= at the baby 3 months of age


pathogenic compounds through the expression of various pattern-recognition receptors (PRRs).17,18 Bacterial signaling on the mucosal surfaces is de-pendent on the network between bacteria, epi-thelial cells, and the immune system. Therefore, not all subjects in the probiotic group had posi-tive DR 10 in their breastmilk. The composition of breastmilk microbiota is complex. From the hundreds of operational tax-onomic units (OTUs) detected in the milk of ev-ery woman, only nine were present. Surprisingly, these nine “core” OTUs represented about half of the microbial community observed. Infant’s im-mune system was greatly influenced by their ma-ternal immunity which transferred via placenta and breast milk. IL-8 in breastmilk indicated the leukocyte movement from mothers to infants. The levels of cytokine were high in colostrum and transient milk; then it would reduce in the first 21 days and 60 days of breastmilk production.19 This study confirmed that IL-8 level in colostrum was found higher in the probiotic group than in the placebo group after birth (V0), but their level of IL-8 was equal in the probiotic as well as the placebo group at three-month postpartum. Probi-otics did not affect the chemokine content from colostrum to mature milk.

Intestinal fatty acid binding protein (IFABP) is an indicator of enterocyte damage.20 In this study, the median IFABP level at delivery (V0) was lower in the probiotic group than in the placebo group (p=0.243). This means less enterocyte damage happened in the probiotic group. The low level on the probiotic group at V0 seemed to correlate with the high level of IL-8, which improved gut matu-rity, then decreased enterocyte damage although it was not significant. During breastfeeding, the guts had microbiota to protect enterocyte and therefore, no differences were found in terms of IFABP level in both the probiotic and the placenta group 3-month after birth. The supplementation of DR10 had no effect to make any difference on IFABP level.

AAT is a serum protein that is resistant to enzy-matic proteolysis in the gastrointestinal tract. This protein does not exist in the diet. Since this protein is excreted, testing the content of AAT in faeces could reflect protein entering the intestine from the intravascular space. Faecal AAT has been considered as a reliable and inexpensive method

for the estimation of enteric protein loss.21 The AAT level in both group at birth was similar, meaning that DR10 supplementation showed no effect in reducing enteropathy. While in the age of 3 months, the AAT level was decreased in both groups since the breastmilk already contained cy-tokine, secretory Ig A, and fatty acids.

Calprotectin, calcium and zinc binding protein, presents in monocytes, macrophages, and epi-thelial cells. Its function is to regulate inflamma-tory processes.22 High faecal calprotectin levels correlate with an increased turnover of leuko-cytes in the intestinal mucosa and granulocyte migration to intestinal lumen. Faecal calprotec-tin levels have been reported to be much higher during the first few weeks of life, both in healthy full-term and pre-term infants. The gut mucosa in newborn infants tends to have higher risk of inflammation.23 In gut inflammation, calprotec-tin can be detected in stool and plasma. There-fore, stool calprotectin could be used as a good marker for necrotizing enterocolitis (NEC). The calprotectin level in this study were both de-creasing and found to have similar level at V3. This might happened because breastmilk natu-rally had the ability to reduce inflammation in gut mucose. Longer follow-up after delivery is necessary to explore and analyse the effect of probiotics to the gut mucosal integrity and its role to improve gut mucosal integrity by com-paring subjects with and without probiotics.

A high number of dropped-out subjects was found in this study because of unexpected cesarean sec-tion and low compliance. The socio-economic condition of the subjects may influence their compliance. Dropped-out due to formula milk us-age was relatively low. In the first three months after birth, the rate of exclusive breastfeeding was still high. The same condition was found by Col-lado et al24 babies who got breast milk at delivery, 66.1% of them continued to give exclusive breast-feeding until 6 months postpartum. However, the average exclusive breastfeeding duration is three months. The data from Basic National Research (Riskesdas) in 2012, 42% of 0–6 months exclu-sive breastfeeding.25

In conclusion, probiotic Bifidobacterium animalis lactis HNO19 (DR10) given to pregnant women since the 3rd trimester can be found in colostrum and breastmilk (three-months postpartum).

http://mji.ui.ac.id


211


However, it did not affect the level of other probi-otics or IL-8 and the gut mucosal integrity.

Conflict of InterestThe funding and source of probiotic strain were supported by Friesland Campina Innovation and Fontera.

AcknowlegmentThe author is thankful to all people who were in-volved in this study especially dr. Yenny Tirtan-ingrum, dr. Yolanda Savitri, dr. Sri Nindita and all the midwives at Budi Kemuliaan Hospitals. I would like to express my thanks to Friesland Campina Innovation for providing financial assis-tance for my study. Thanks are also due to Fontera for suppliying the probiotic strain Bifidobacteri-um animals lactis HNO19 for the study.

REFERENCES

1. Burrin DG. Physiology of gastrointestinal tract in fetus and neonate. Dalam: Polin RA, Fox WW, Abman SH, eds. Fetal and neonatal physiology. 4th ed. USA: Elsevier Saunders; 2011:1181.

2. Jakaitis BM, Dening PW. Human breast milk and gas-trointestinal innate immune system. Clin Perinatol. 2014;41(2):423–35.

3. Villoslada FL, Olivares M, Sierra S, Rodriguez JM, Boza J, Xaus J. Benneficial effects of probiotic bacteria isolated from breast milk. Brit J Nutr. 2007;98:S96–S100.

4. Jeurink PV, Bergenhenegowen JV, Jimenez E, Knip-pels LM, Fernaindez L, Garssen J et al. Human milk: a source of more life than we imagine. Benef Microbes. 2013;4(1):17–30.

5. Martin R, Jiminez E, Heilig H, Fernandez L, Martin ML, Zoe-tendal EG et al. Isolation of bifidobacteria from breast milk and assessment of the bifidobacterial population by PCR-Deanturing gradient gel electrophoresis and quantitative real-time PCR. Appl Enviro Microbiol. 2009;75:965–9.

6. Ahmed M, Prasad J, Gill H, Stevenson L, Gopal P. Impact of consumption of different levels of Bifidobacterium lactis HNO 19 on the intstinal microflora of elderly hu-man subjects. J Nutr Health Aging. 2007;11(1):26–31.

7. Derrien M, Vlieg JET VH. Fate, activity, and impact of ingested bacteria within the human gut microbiota. Trends Microbiol. 2015;23(6):354–66.

8. Maheshwari A, Lu W, Lacson A, Barleycorn AA, Nolan S, Christensen RD, et al. Effects of interleu-kin-8 on the developing human intestine. Cytokine. 2002;20(6):256–68.

9. Lammers KM, Helwig U, Swennen E, Rizzello F, Venturi A, Caramelli E, et al. Effect of probiotic strains on inter-leukin 8 production by HT29/19A cells. Am J Gastroes-terol, 2002; 97(5):1182–6.

10. HK 310 Human IL-8 Elisa Kit. Product Information and Manual, Vol. 02-10. p. 1–14.

11. Hycult Biotech. HK 406 human I-FABP ELISA kit. Prod-uct information and manual. Edisi 08-13, p.1–14.

12. Manual of α-1 antitrypsin ELISA. EIA-5299. Version: 4.0. Feb 2015.

13. Human Kalprotektin in Stool ELISA. Protokol. Pediatric Research Unit. Departemen Ilmu Kesehatan Anak. FKUI 2009. Indonesian.

14. Oswari H, Prayitno L, Dwipoerwantoro PG, Firmansyah A, Makrides M, Lawley B, et al. Comparison of stool mi-krobiota compositions, stool alpha1-antitrypsin and calprotectin concentrations, and diarrhoeal morbidity of Indonesian infants fed breast milk or probiotic/pre-biotic-supplemented formula. J Paediatr Child Health. 2013;49(12):1032–9.

15. Kailasapathy K, Chin J. Survival and therapeutic poten-tial of probiotic organisms with reference to Lactobacil-lus acidophilus and Bifidobacterium spp. Immunol Cell Biol. 2000;78(1):80–8.

16. Soto A, Martín V, Jiménez E, Mader I, Rodríguez JM, Fernández L. Lactobacilli and bifidobacteria in human breast milk: influence of antibiotherapy and other host and clinical factors. J Pediatr Gastroenterol Nutr. 2014;59(1):78–88.

17. Rautava S, Luoto R, Salminen S, Isolauri E. Microbi-al contact during pregnancy, intestinal colonization and human disease. Nat Rev Gastroenterol Hepatol. 2012;9(10):565–76.

18. Collado MC, Rautava S, Salminen S, Isolauri E. Gut mi-krobiota: a source of novel tools to reduce the risk of human disease? Pediatr Res. 2015;72(1–2):182–8.

19. Ustundag B, Yilmaz E, Dogan Y, Akarsu S, Canatan H, Halifeoglu I, et al. Levels of cytokines (IL-1beta, IL-2, IL-6, IL-8, TNF-alpha) and trace elements (Zn, Cu) in breast milk from mothers of preterm and term infants. Media-tors Inflamm. 2005(6):331–6.

20. Gregory KE, Winston AB, Yamamoto HS, Dawood HY, Fashemi T, Fichorova NR, et al. Urinary IFABP predicts necrotizing enterocolitis within seven days prior to clin-ical onset. J Pediatr. 2014;164:1486–8.

21. Tangsilsat D, Atamasirikul K, Treepongkaruna S, Nath-sevee S, Sumritsopak R, Kunakom M. Faecal alpha –anti-trypsin in healthy and intestinal disorder Thai children. J Med Assoc Thai. 2007;90:1317–22.

22. Rouge C, Butel MJ, Piloquet H, et al. Faecal calprotectin excretion inpreterm infants during the neonatal period. PLoS One. 2010;5(6):1–6.

23. Kapel N, Campeotto F, Kalach N, Baidassare M, Butel MJ, Dupont C. Faecal calprotectin in term and preterm neo-nates. J Pediatr Gastroenterol Nutr. 2010;51:542–7.

24. Collad MC, Laitinen K, Salminen S, Isolauri E. Maternal weight and excessive weight gain during pregnancy modify the immunomodulatory potential of breast milk. Pediatr Res. 2012;72:77–85.

25. Badan Penelitian dan Pengembangan Kesehatan Ke-menterian Kesehatan RI [Internet]. Riset kesehatan dasar 2013. [update 2013; cited January 2015] Available from: http://www.riskesdas.litbang.depkes.go.id/2013. Indonesian.


The influence of water intake on waiting time prior to uroflowmetry: a prospective, randomized, double-blind trial

Keywords: drinking, urinary bladder, uroflowmetry, waiting time

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1628 • Med J Indones. 2017;26:212–7• Received 27 Okt 2016 • Accepted 21 Jun 2017

Corresponding author: Ponco Birowo, [email protected]


Nur Rasyid, Donny E. Putra, Widi Atmoko, Adianti Khadijah, Dyandra Parikesit, Ponco BirowoDepartment of Urology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo Hospital, Jakarta, Indonesia

Clinical Research


ABSTRAK

Latar belakang: Sebelum pemeriksaan uroflowmetry, pasien biasanya diinstruksikan untuk minum, lalu menunggu sampai kandung kemih penuh dan terasa ingin sekali berkemih. Jumlah asupan air dan waktu tunggu sampai kandung kemih penuh belum diketahui. Tujuan penelitian ini untuk mengetahui hubungan antara jumlah asupan air dan waktu tunggu yang diperlukan sebelum uroflowmetry.

Metode: Penelitian ini menggunakan metode randomisasi dengan peneliti, dokter, dan pasien tidak mengetahui jumlah asupan air yang diminum. Pasien dibagi menjadi tiga kelompok paralel berdasarkan jumlah asupan air dengan variabel terkontrol adalah waktu tunggu sebelum uroflowmetry. Randomisasi blok dilakukan dengan alokasi 1: 1: 1. Pasien yang dijadwalkan uroflowmetry bulan Maret–Desember 2013 di Klinik Urologi Rumah Sakit Cipto Mangunkusumo dimasukkan dalam kriteria inklusi yaitu laki-laki usia di atas 50 tahun dan indeks massa tubuh 18,5–24,9 kg/m2.

Hasil: Sebanyak 83 pasien secara acak dikategorikan menjadi 3 kelompok: 300 ml (28 pasien), 400 ml (28 pasien), dan 500 ml (27 pasien). Semua pasien dimasukkan dalam analisis akhir. Rerata waktu tunggu adalah 85,1±59,8 menit, 107,2±70,4 menit dan 66±28,4 menit untuk asupan 300, 400, dan 500 ml air putih (p=0,07). Volume kandung kemih akhir untuk tiga kelompok berbeda secara statistik (262,4±130,8 ml, 289,4±126,2 ml, 359,2±137 ml; p=0,02).

Kesimpulan: Volume asupan air 300–500 ml tidak mempengaruhi waktu tunggu sebelum uroflowmetry. Peningkatan asupan air minimal 500 ml menambah volume akhir kandung kemih dan memperpendek waktu tunggu.

ABSTRACT

Background: In uroflowmetry examination, patients are usually instructed to intake a large volume of water and wait until the bladder is full. The association between the volume of water intake and the waiting time before uroflowmetry is unknown. The aim of this study is to investigate the relationship between the volume of water intake and the waiting time prior to uroflowmetry.

Methods: This trial was designed as a randomized, researchers, caregivers and patients blinded, superiority trial with three parallel groups and primary endpoint of waiting time prior to the uroflowmetry study based on the volume of patients’ water intake. Randomization was performed by block randomization with a 1:1:1 allocation. Patients scheduled for uroflowmetry at the Urology Clinic of Cipto Mangunkusumo Hospital were enrolled from March 2013 until December 2013. The eligibility criteria were male patients with ages above 50 years and body mass index 18.5–24.9 kg/m2.

Results: A total of 83 patients was randomly assigned into 3 study groups: 300 ml (28 patients), 400 ml (28 patients), and 500 ml (27 patients). All patients were included in final analysis. Mean waiting time were 85.1±59.8 min, 107.2±70.4 min, and 66±28.4 min for patients intake 300, 400, and 500 ml of water respectively (p=0.07). The final bladder volumes for three groups were statistically different (262.4±130.8 ml, 289.4±126.2 ml, 359.2±137 ml; p=0.02).

Conclusion: The volume water intake of 300–500 ml did not affect waiting time before uroflowmetry. Increasing water intake at least 500 ml added the final bladder volume and shorter the waiting time.


Rasyid, et al.Water intake on a waiting time of uroflowmetry

213


Lower urinary tract symptoms (LUTS) is a collection of complaints consist of three groups: storage, voiding, and post micturition symptoms.1 The prevalence of LUTS in elderly male population is approximately 20–30%, and nocturia is common in 30 to 59-year-old men.2,3

In 2008, 45.2% of world population experienced one symptom of LUTS. It is expected that the prevalence will rise to 63.6% in 2018.4

Therefore, before the uroflowmetry study, patients should fill their bladder. The influence of water intake on waiting time before uroflowmetry study is unknown. There are no consensus guidelines on safe preparation or imaging modalities for pre-procedural fluid hydration.9 Patients are usually asked to drink plenty of water to achieve a full bladder and wait until they have a desire to urinate.7 The disadvantage of this method is some patients feel uncomfortable with a full bladder, and some other patients have their bladder not fully filled for uroflowmetry study. By knowing the amount of fluid intake, it will reduce excessive fluid intake and facilitate hospital to calculate unit cost of uroflowmetry. Another advantage of knowing time required before uroflowmetry study is that patients, doctors, and nurses can predict how long patients should come, so that patients and doctors do not have to wait too long. In this study, we investigated the influence of water intake on waiting time prior to uroflowmetry.

METHODS

This trial was designed as a randomized, researchers, caregivers and patients blinded, superiority trial with three parallel groups and primary endpoint of waiting time prior to the uroflowmetry study based on the volume of patients’ water intake. Randomization was performed by block randomization with a 1:1:1 allocation. The trial was completed, and there was not any change in protocol design. The trial received ethical committee, and informed consent was obtained from each patient (47/H2.F1/ETIK/2013). The trial was conducted at the Urology Clinic of Cipto Mangunkusumo Hospital, Jakarta, from March 2013 until December 2013.

The eligibility criteria were male patients who will have uroflowmetry examination with ages

above 50 years and body mass index (BMI) 18.5–24.9 kg/m2. The exclusion criteria were subjects have history of hematuria, urinary tract infection, renal insufficiency or urinary tract anomaly, hypertension, coronary heartt disease or congestive heart failure, diabetes mellitus, shock, residual urine ≥50 ml, history of operation or pelvic radiation, suprapubic mass, consumption of diuretic or anticholinergic.

The patients were asked to fill informed consent and personal data including age, occupation, education, blood pressure, height, and weight. History and physical examination were taken in relation to research status of patients. The blood level of urea, creatinine, glucose, and urinalysis were also determined. The patients were asked to measure bladder volume and urinate, and then the examiner checked the residual urine.

Patients who have met the inclusion criteria were mL randomly divided into three groups. The first group was given water about 300 ml (group A), the second group was given water about 400 mL (group B), and the third group was given water about 500 ml (group C). For the allocation of participants, a block randomization by a computer-generated list of random number was used by researchers with no clinical involvement in the trial. After the nurse had obtained patient’s consent, she contacted a staff member who was independent during the recruitment process for allocation consignment. The allocation sequence was concealed from researchers, caregivers, and patients. Each patients was given a sealed-bottle, and description amount of water given was contained in a sealed envelope. All sealed-bottles have same dimension, color, and appearance. The period of drinking was ten minutes. The patients did not allow drink or urinate until they felt first sensation of micturition. The staff member noted time and bladder volume when the subject wanted to urinate for the first time at the same day with randomization. Bladder volume was assessed by ultrasonography. The staff member who obtained outcome measurement was not informed of the group assignment. The staff who delivered the intervention did not take the outcome measurements.

The primary outcome was the relationship between the volume of water intake and the


waiting time before uroflowmetry study. The secondary outcome was the relationship between the volume of water intake and the total bladder volume before uroflowmetry.

Water intake is defined by volume of water which was given by researchers to be taken by patients. The volume of water intake has been determined to 300 ml, 400 ml, and 500 ml. Waiting time is defined by the time from ingestion of water until first sensation of micturition. The time is noted in minutes.

The minimum total samples needed to have 80% power to detect a significant difference (p=0.05, two-sided) were 27 for each group. The mean and standard deviation of quantitative

Figure 1. The CONSORT 2010 flow diagram about the influence of water intake on waiting time before uroflowmetry procedure. The process consists of four phases: enrollment, allocation, follow-up, and analysis

data were calculated and compared using one-way analysis of variance, statistical product and service solutions (SPSS) version 15.0. P<0.05 was considered statistically significant.

RESULTS

There were 91 patients who were eligible for the study. However, eight patients were excluded due to residual urine more than 50 ml. A total 83 patients were randomly assigned to 3 study groups: 300 ml (28 patients), 400 ml (28 patients), and 500 ml (27 patients). Flow diagram of the progress through the phases of a parallel randomized trial of three groups is shown in Figure 1.

http://mji.ui.ac.id


215


Characteristics

Mean ± standard deviation

300 ml group(n=28)

400 ml group(n=28)

500 ml group(n=27)

Age (year) 67.7±7.8 71.8±6.6 67.9±8.8BMI (kg/m2) 22.0±1.9 22.7±2.2 23.2±1.7Serum glucose level (mmol/L) 95.4±36.5 92.4±26.9 92±39.4Serum ureum level (mmol/L) 28.9±13.2 30.8±12.5 29.6±7.6Serum creatinine level (mmol/L) 1.1±0.3 1.1±0.2 1.2±0.3Residual urine (mL) 26.6±14.9 24.6±14 27.6±14.1Frequency

Yes 16 (57.1%) 17 (60.7%) 17 (63%)No 12 (42.9%) 11 (39.3%) 10 (37%)

NocturiaYes 22 (78.6%) 21 (75%) 22 (81.5%)No 6 (21.4%) 7 (25%) 5 (18.5%)

UrgencyYes 8 (28.6%) 4(14.3%) 6 (22.2%)No 20 (71.4%) 24(85.7%) 21 (77.8%)

Table 1. Demographic and clinical characteristics of patients in each study group

**

**

*(85.159.8) *(107.270.4) *(65.928.4)

*(262.4130.8) *(289.4126.2) *(359.3137)

**

**

*(85.159.8) *(107.270.4) *(65.928.4)

*(262.4130.8) *(289.4126.2) *(359.3137)

A

0 0

200

300 400 500

400

600

300

*(85.1±59.8)

Drinking volume (mL) Drinking volume (mL)

*(107.2±70.4) *(262.4±130.8) *(289.4±126.2) *(359.3±137)*(65.9±28.4)

400 500

50

100

150

200

250

Wai

ting

time

to u

roflo

wm

etry

(min

)

Blad

der v

olum

e (m

L)

B †

†

Figure 2. Average waiting time (A) and total bladder volume before uroflowmetry (B). Analysis used One Way Anova with post -hoc Bonferroni. *mean±SD; †p<0.05

The demographic and clinical characteristics of subjects in three groups are shown in Table 1. There were not any patients complain in relation to bladder discomfort during the trial.

The average waiting time and the total bladder volume between groups are described in Figure 2. There were no statistically significant differences in waiting time between three groups (p=0.07). The average waiting time was comparable for 300 and 400 ml groups; however the 500 ml group

had the least waiting time and variation. The total bladder volumes among the 3 study groups were higher in the 500 ml group among them all. The final bladder volumes for three groups were statistically different (p=0.02).

DISCUSSION

Uroflowmetry is the preferred examination tools for patient with LUTS complain. This examination


required voiding volume between 150 ml and 400 ml to achieve optimal result. An increase in volume water ingested increased the urine output, and we hypothesized that increasing the volume of water ingested would reduce the time needed to fill the bladder sufficiently prior to uroflowmetry.6–8

This study is the first study that investigated relationship between the water intake and the waiting time prior to uroflowmetry. The result of this study indicated that waiting time before uroflowmetry study reduced as the volume of water intake increased (300, 400, and 500 ml). However, this relationship was not significant (p=0.07). The possibility of this finding could be due to the small sample size or the insufficient volume of water intake to reduce waiting time. Jordan et al10 concluded that there was not any change in plasma renin and vasopressin after drinking 500 ml of water. Thus, the waiting time might be reduced if water intake was more than 500 ml. No previous study recommended the volume of water intake for patients undergoing urine flow studies. The lack of consensus guidelines on pre-study fluid consumption could lead to adverse event due to excessive water intake. Some reports have been published about water intoxication before flow study caused severe hyponatremia and seizure.9,11,12 In this study, water intake of 300–500 ml was safe and did not cause any complains from patients. We suggest patients should take more than 500 ml of water prior to uroflowmetry.

A study about the influence of water intake on waiting time prior gynecologic abdominal ultrasound concluded that differences in the volume of water intake (range 300–500 ml) did not affect waiting time before transabdominal ultrasound examination. The possible reason is the inadequate sample size. Another possibility is the volume of water ingested was not sufficient enough to reduce waiting time.13 The previous study is in accordance with our study. We used the same volume of water (range 300–500 ml) and did not find significant differences in waiting time. As suggested by previous study, larger sample size may be needed.

This study also showed that increasing water intake significantly added total bladder volume. The minimum water intake of 300 ml was

sufficient to fill bladder of 262.4±130.8 ml. This volume of water might be enough to consume before uroflowmetry. The accuracy of residual urine measurement in men cannot be accurate as catheterization. Ultrasonography is poor for quantitative assessment of bladder volumes, particularly with volume below 48 ml. It is reported that inaccuracies from methods used in ultrasonography varied from 12.9% to 20% in adults.14 This study used ultrasonography to assess the residual urine before water intake and final bladder volume after water intake. This study used residual urine above 50 ml to exclude patients from randomization. Therefore, we can minimize the chance of ultrasonography inaccuracy in assessing the bladder.

The measurement of post-micturition residual urine that recorded before water load is different from that of recorded after increased water load diuresis. The residual urine volume after increased water load diuresis is larger than after normal bladder filling and voiding at first desire.15 In this study, we measured the bladder volume and asked the patients to urinate first.After that, the post micturition residual urine was remeasured. Thus, we can measure post-void residual urine volume that reflected everyday normal bladder filling.

This study has several limitations. There were some variables that could lead to bias including hydration status, previous activities of subject, and unpredicted blood loss. We cannot measure these factors to be considered as eligibility criteria. In history taking, we asked the patients whether they have history of hematuria, including education and occupation. We also checked urinalysis to confirm whether there was hematuria and assessed specific gravity to grossly determine hydration status of patients. The history of underlying disease could affect waiting time prior to uroflowmetry. Patients who have dominant storage complaints will have shorter waiting time. In addition to that, the intervention was implemented for male patients with LUTS, age >50 years old, and normal BMI, the results indicate that all male patients with that characteristic would not benefit from water intake 300–500 ml on waiting time before uroflowmetry study. Further studies by using larger sample sizes, more homogenous baseline characteristics, larger volume intake, and more

http://mji.ui.ac.id


217


accurate measurements methods are needed to confirm our findings. However, the characteristic patients included in this study covered most of patients who need uroflowmetry study in clinical setting. This suggests that this study result can be implemented in preparation of patients before uroflowmetry.

In conclusion, drinking volume of water of 300 to 500 ml is safe for patients who undergo uroflowmetry, and patients should drink at least 500 ml of water to increase bladder volume and reduce waiting time.

Conflicts of interestThe authors affirm no conflict of interest in this study.

REFERENCES

1. Abrams P, Cardozo L, Fall M, Griffiths D, Rosier P, Ulmsten U, et al. The standardisation of terminology of lower urinary tract function: report from the Standardisation Sub-committee of the International Continence Society. Neurourol Urodyn. 2002;21(2):167–78.

2. Spigt M, Schayck OV, Knipschild P, Westerterp K, Beek CVD, Kerrebroeck PV, et al. Is it possible to improve elderly male bladder function by having them drink more water? A randomized trial of effects of increased fluid intake/urine output on male lower urinary tract function. Urology. 2006;68(5):1031–6.

3. Platz EA, Smit E, Curhan GC, Nyberg LM, Giovannucci E. Prevalence of and racial/ethnic variation in lower urinary tract symptoms and noncancer prostate surgery in U.S. men. Urology. 2002;59:877–83.

4. Irwin DE, Kopp ZS, Agatep B, Milsom I, Abrams P. Worldwide prevalence estimates of lower urinary

tract symptoms, overactive bladder, urinary incontinence and bladder outlet obstruction. BJU Int. 2011;108(7):1132–8.

5. Kelly CE, Krane RJ. Current concepts and controversies in urodynamics. Curr Urol Rep. 2000;1:217–26.

6. Schafer W, Abrams P, Liao L, Mattiasson A, Pesce F, Spangberg A, et al. Good urodynamic practices: uroflowmetry, filling cystometry, and pressure-flow studies. Neurourol. Urodinam. 2002;21(3):261–74.

7. Abrams P. Uroflowmetry. In: Abrams P. Urodynamics Third Edition. London: Springer; 2006. p. 20–38.

8. Blaivas J, Chancellor MB, Weiss J, Verhaaren M. Uroflowmetry. In: Blaivas J, Chancellor MB, Weiss J, Verhaaren M. Atlas of Urodynamics Second Edition. New York: Blackwell Publishing; 2007. p. 37–45.

9. Su M, Woo HH. Severe hyponatremia from water intoxication associated with preparation for a urine flow study. J Med Cases. 2012;3(2):123–5.

10. Jordan J, Shannon JR, Black BK, Ali Y, Farley M, Costa F, et al. The pressor response to water drinking in human asympathetic reflex? Circulation. 2000;101(5):504–9.

11. Issa MM, Pruthi RS, Vial C, McNamara DE, Terris MK. An unusual complication following uroflowmetry: water intoxication resulting in hyponatremia and seizure. Urol Int. 1997;59:129–30.

12. Vishwajeet S, Aneesh S. Water intoxication leading to hyponatremia and seizures: a rare complication of uroflowmetry. Int Urol Nephrol. 2005;37:275–6.

13. Titapant V, Phithakwatchara N, Chuenwattana P, Tontisirin P, Viboonchard S, Butsansee W. Influence of water intake on the waiting time prior to gynecologic transabdominal ultrasound. Int J Gynecol Obstet. 2009;105(3):233–5.

14. Simfroosh N, Dadkhah F, Hosseini SY, Asgari MA, Nasseri A, Safarinejad MR. Accuracy of residual urine measurement in men: comparison between real time ultrasonography and catheterization. J Urol. 1997;158:59–61.

15. Alivizatos G, Skolarikos A, Albanis S, Ferakis N, Mitropoulos D. Unreliable residual volume measurement after increased water load diuresis. Int J Urol. 2004;11:1078–81.


Diagnostic accuracy of magnetic resonance imaging in detecting anterior cruciate ligament injuries

Keywords: ACL, arthroscopy, knee, MRI

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1873 • Med J Indones. 2017;26:218–23• Received 15 Feb 2017 • Accepted 04 Jun 2017

Corresponding author: Ashfaq Ahmed, [email protected]


Ashfaq Ahmed, Muhammad A. Razzaque, Muhammad Kaleem, Atiq U. Zaman, Rizwan Akram, Shahzad Javed

Department of Orthopedics and Spine, Ghurki Trust Teaching Hospital, Lahore, Pakistan

Clinical Research


ABSTRAK

Latar belakang: berbagai Ligamen krusiata anterior (ACL) menstabilitasi sendi saat hiperekstensi dan mencegah translasi anterior terhadap tulang femur. Diagnosis cedera ACL masih banyak didiskusikan. Tujuan penelitian ini menentukan akurasi diagnostik MRI dalam mendiagnosis cedera ACL pada pasien trauma lutut dan mengambil artroskopi sebagai baku emas.

Metode: Pasien yang memenuhi kriteria inklusi dievaluasi secara klinis, MRI dan artroskopi pada Departemen Orthopedi dan Tulang Belakang di Rumah Sakit Pendidikan Ghurki Trust, Lahore. Akurasi, sensitivitas dan spesifisitas MRI dalam mendiagnosis cedera ligament krusiata anterior dikonfirmasi dengan temuan artroskopi. Data dianalisis dengan program SPSS versi 17.

Hasil: Sebanyak 185 pasien terdiri dari 91,1% laki-laki dan rerata usia 28,25 tahun. Akurasi pemeriksaan MRI untuk mendiagnosis cedera ACL adalah 91,9% dengan sensitivitas 93,3%, spesifisitas 85,7%, nilai duga positif 96,6% dan nilai duga negatif 75%.

Kesimpulan: Pemeriksaan MRI adalah modalitas yang akurat dan non invasive untuk menilai cedera ligament. Pemeriksaan ini dapat digunakan sebagai pemeriksaan lini pertama pada pasien dengan cedera ACL.

ABSTRACT

Background: The anterior cruciate ligament (ACL) stabilizes the joint during hyperextension and prevents anterior translation over femur. The objective of this study was to determine the diagnostic accuracy of magnetic resonance imaging (MRI) in detecting ACL injury by taking arthroscopy as gold standard in patients with traumatic knee injury.

Methods: Patients fulfilling the study criteria were treated with clinical examination, MRI and then arthroscopy at the Department of Orthopedics and Spine in the Ghurki Trust Teaching Hospital, Lahore. The accuracy, sensitivity and specificity of MRI in diagnosing the anterior cruciate ligament injury were calculated based on arthroscopic findings. All the data were analyzed using SPSS 17.0 version.

Results: A total 185 patients were included. 91.1% were males and 8.9% were females with Mean age of 28.25±0.433. The accuracy of MRI in diagnosing the anterior cruciate ligament was 91.89%, with sensitivity of 93.33%, specificity of 85.71%, positive predictive value of 96.55% and the negative predictive value of 75%.

Conclusion: MRI is accurate and non-invasive modality for the assessment of ligamentous injuries. It can be used as a first line investigation to patients with suspicion of ACL injury.


Ahmed, et al.Accuracy of MRI in anterior cruciate ligament injuries

219


The anterior cruciate ligament is currently the most common ligament injury in the knee joint. The number of incidences is as many as 1 in 3,500 individuals each year.1 Sports like skiing, ice hockey, and gymnastics can also produce enough stress to disrupt knee ligaments. Automotive accidents, especially those involving motorcycles, are common causes of knee ligament disruptions. Sudden severe loading without a fall or contact, like deceleration of a running athlete can also cause ligament disruption.2–3

The anterior cruciate ligament is the major stabilizer of knee joint. It prevents the anterior tibial displacement over the femur. Selective sectioning of the anterior cruciate ligament has shown that the anteromedial band is tight in flexion, providing the primary restraint, whereas the posterolateral bulky portion of this ligament is tight in extension.4 The posterolateral bundle provides the primary resistance for hyperextension.

There are many modalities to diagnose the anterior cruciate ligament (ACL) injury, however good history and physical examination are the key steps. The patient’s history of the experience (i.e., the knee’s buckling or jumping out of place; an audible pop; the location, severity, and relative time at the onset of pain; the ability to walk after the injury occurred) is important.5 In physical examination, anterior drawer and Lanchman tests are most useful tests. The Lanchman test is most sensitive for anterior tibial displacement.4–6

Imaging and arthroscopy are two most common modalities. Magnetic resonance imaging has several advantages over arthroscopy. Magnetic resonance imaging is sensitive, non-invasive and accurate in detecting soft tissue injuries of knee.7 It is a reliable method to confirm the clinical diagnosis and may even reveal the ligament tears which may be missed by arthroscopy.8–9

Ligament tears can be accurately assessed with MRI, but distinguishing partial tears from ruptures of the ACL can be challenging. Determining the extent of a partial tear is often extremely difficult to accurately assess.7–10 However, it is a routinely prescribed test in suspecting soft tissue injuries of knee. Kostov H. et al6 reported 83% sensitivity, 88.37% specificity, 93% positive predictive value, 74.5% negative

predictive value, 82.5% accuracy in detecting anterior cruciate ligament. The prevalence of ACL tear in knee injuries is 14.4%.11

Arthroscopy directly visualizes all the internal structures of the knee joint. It can be used as a diagnostic and at the same time as a therapeutic tool. The knee is the joint in which arthroscopy has its greatest diagnostic and intra articular surgical application.12 The usefulness of arthroscopic techniques in diagnosis and treatment of intra articular pathology has been well documented.10 Arthroscopy needs special instruments and expert surgeons. This makes arthroscopy more costly than magnetic resonance imaging (MRI). The main aim of this study is to determine the efficacy of MRI in detecting the anterior cruciate ligament injuries in our set up.

METHODS

This descriptive study uses a non-probability consecutive sampling at the Department of Orthopedics and Spine Centre, Ghurki Trust Teaching Hospital, Pakistan from January 1st, 2016 to December 31st, 2016. A written informed consent from every patient and approval from the Hospital Ethical Committee were obtained. 185 patients with the ages between 16–55 years of both sexes having had recent post traumatic knee injuries within two months were included in the study. While the patients having inconclusive findings on MRI, degenerative changes on X-rays or having previous history of knee surgery or managed conservatively or not in the range of above inclusion age were excluded from the study. All patients with positive anterior drawer test and positive Lachman test were subjected to MRI. However patients who had already done MRI were also included. Images of magnetic resonance were performed with 0.5 tesla (Philips Medical system) at the Radiology Institute Ghurki Trust Teaching Hospital, Lahore Medical and Dental College, Lahore. Standardized magnetic resonance imaging protocol consisted of sagittal, coronal and axial sequences in section thickness of 3–5 mm. Magnetic resonance images were reported by a consultant radiologist who then determined whether the ACL is intact or torn. Arthroscopy were performed after informed consent and


demographic information like name, age and gender were recorded. All arthroscopies were performed by the same consultant orthopedic surgeons who were blinded to the radiologist’s diagnosis. He determined whether the ACL intact or torn.

Arthroscopy was done in a standardized manner using inferolateral and medial portal which include the survey of the entire joint and anatomical structure, lesions involved with the presence or absence of tear, its location, status of the articular cartilage.

StatisticsThe collected data were entered initially on a pre-formed proforma and then analyzed using statistical product and service solution (SPSS) version 17. Sensitivity, specificity, positive predictive value, negative predictive value and accuracy were calculated by generating a 2×2

Frequency (n) Percentage (%) Age in years

16–35 139 75.1%36–50 46 24.9%

Sex Male 168 91.1%Female 17 8.9%

Side of limb involvementRight 123 66.49%Left 62 33.51%

Mechanism of injuryRoad traffic accidents 94 50.81%Sports injuries 85 45.95%Miscellaneous 6 3.24%

Body Mass IndexBelow normal 32 17.3%Normal 138 74.6%Above normal 15 8.1%

Table 1. Basic demographic characteristics of patients

Arthroscopic positive findings Arthroscopic negative findingsMRI positive findings 140 (TP) ( 93.33%) 5 (FP) (14.29%) 145MRI negative findings 10 (FN) (6.67%) 30 (TN) (85.71%) 40Total 150 (100%) 35 (100%) 185

Table 2. Comparison of MRI to arthroscopic findings in ACL injury detection

TP= true positive; TN= true negative; FN= false negative; FP= false positive; MRI= magnetic resonance imaging

contingency table. Categorical variables like ACL injury on MRI and on arthroscopy and gender were summarized using frequency and percentages. Quantitative variables like age and body mass index (BMI) were presented as mean ± SD.

Data were stratified by age, gender and BMI to address effect modifiers. A post-stratification Chi-square test was applied with p≤0.05 as significant.

RESULTS

This study included 185 patients out of which 168 (91.1%) were males and 17 (8.9%) were female. The male to female ratio of 9.88:1 and the mean age was 28.25±12.25 years. The different characteristics such as right or left knee involvement, patients from different age groups, mechanism of injury and body mass index are summarized in Table 1.

The arthroscopic findings for the ACL tear were positive for 150 (81.08%) compared to MRI findings, i.e. 145 (78.37%). The arthroscopic findings were negative for 35 (18.92 %) and on MRI it was 40 (21.62%). The results of different variables like sensitivity, specificity, positive and negative predictive value and accuracy of MRI and arthroscopy are summarized in Table 2.

Though the gold standard of detecting anterior cruciate ligament injuries is arthroscopy, the diagnostic accuracy of MRI is also much more. The sensitivity and specificity of MRI in detecting anterior cruciate ligament injuries is 93.33% and 85.71%. Similarly MRI has high positive and negative predictive value, i.e. 96.55% and 75%. The arthroscopic and MRI pictures of two patients having sports injury and trauma to knee joints are given in Figure 1 (a, b) and Figure 2 (a, b).

http://mji.ui.ac.id


221


Figure 1. Arthroscopic and MRI image of 35 years-old-male having twist injury to right knee joint. Complete tear of ACL are shown in arthroscopy as well as MRI

Figure 2. Arthroscopic and MRI image of 29 years-old-male had left knee injury during sports. There is complete ACL tear found on arthroscopy as well as MRI

DISCUSSION

MRI commonly uses modality to diagnose soft tissue injuries when other modalities fail to diagnose. It plays a vital role in diagnosing meniscal and ligamentous knee injuries. The knee often experiences injured joint due to its involvement in motion. It is complicated joint

that includes multiple structures for support and stability. Cruciate ligaments, collateral ligaments and menisci provide stability during motion. The ACL commonly gets injured during sports and accidents. It can occur isolated or associated with menisci and other ligaments. The first diagnosis of ACL tear was made by Galin and Stark12 and the first intra articular ACL reconstruction was made by the father of ligamentoplasties i.e. Hey Groves.


The difference between acute and chronic injury as well as partial or full tear is difficult to define on clinical examination. Clinical examination has very low sensitivity and specificity. Ultrasonography is another modality for diagnosis of ACL tear. It has a high sensitivity and specificity but requires the hands of an expert.13 The advent of MRI technology in the early 1980s helped orthopedic surgeons in the treatment of knee disorders in several ways. In the early use of the technology, the improved initial diagnostic accuracy with preoperative MRI proved to be cost-effective in reducing unnecessary surgical interventions and altering treatment plans.14 The addition of oblique axial imaging to standard MR imaging improves diagnostic accuracy for detecting partial tears of the ACL as well as individual bundle tears of the ACL.15 3D MR imaging has the potential to allow surgeons to: (1) tailor an ACL reconstruction technique or graft choice based on the ACL footprint size, (2) plan for selective bundle ACL reconstruction for partial tears, and (3) preoperatively template tunnel position according to the patient’s individual anatomy.16 MRI has high accuracy for patients with complete ACL rupture. Due to the higher economic costs and increased complication risks of diagnostic arthroscopy, MRI is therefore recommended as the principal investigation following clinical examination, to diagnose ACL rupture.17 However, there are still controversies. According to Liodakis et al.18 the MRI scans are not routinely necessary as an indication for knee arthroscopy as clinical examination and plain radiograph are sufficient.

Our results showed that MRI had sensitivity and specificity of 93.33% and 85.71%. Similarly, the positive predictive value, the negative predictive value and accuracy are 96.55%, 75.0%, and 91.89%. Khan et al.19 concluded that MR had 100% sensitivity and NPV 0f 70% of diagnosing ACL tears in their study, which was higher than our findings. Clinical examination had sensitivity of 88% and NPV 75% in diagnosing ACL injuries. Gupta et al.20 found that MRI showed a sensitivity of 74.42%, specificity of 93.10%, accuracy of 84.21%, and a negative predictive value of 88.04%. These findings were almost similar to our findings. Thiga et al21 found that the sensitivity and specificity of MRI for anterior cruciate ligament rupture (whether complete or partial) was 83.3% and 90.9% respectively. Similarly,

Similarly, Amr et al22 found that in comparison with knee arthroscopy, magnetic resonance imaging revealed an overall of 93.9% sensitivity and 66.6% specificity. Chiranjib et al.23 also found that the sensitivity of MRI for diagnosis of ACL was 87.5%, specificity was 66.67%, positive predictive value -87.5%, negative predictive value -66.6% and accuracy of 81.82%. Almost all of the studies discussed above yield almost similar findings with our study in that we are in favor of conducting MRI for diagnostic purposes. While arthroscopy should be restricted for therapeutic purpose, MRI is non-invasive and cost-effective compared to arthroscopy and should always be considered as an option of choice for diagnosing ACL injuries.

There are some limitations in our study. Firstly the findings were not compared with the findings from the clinical examinations. Moreover chronic injuries were excluded to reduce the bias. Therefore, further research needs to be carried out to yield different results.

In conclusion, MRI is highly accurate in the diagnosis of ACL injuries in traumatic knees. Arthroscopy should be considered when it is required as therapeutic. Diagnostic use of arthroscopy is limited in the presence of MRI. MRI is an appropriate screening tool for therapeutic arthroscopy, making diagnostic arthroscopy unnecessary in most patients.

Conflicts of Interest The authors affirm no conflict of interest in this study.

REFERENCES

1. Solomon L. Warwick D, Nayagam S. Apley’s system of orthopaedics and fractures. 9th edition. Imaging of knee. Bristol. UK;2010:553.

2. Canale ST, Beaty JH. Campbell’s operative orthopaedics. 12th edition New York: Mosby; 2013:2133–6.

3. Clayton RA, Court-Brown CM. The epidemiology of musculoskeletal tendinous and ligamentous injuries. Injury. 2008;39(12):1338–44.

4. Muhle C, Ahn JM, Dieke C. Diagnoses of ACL and meniscal injuries: MR imaging of knee flexion versus extension compared to arthroscopy. Springerplus. 2013;2(1):213.

5. Noyes F, Mooar P, Matthews D, Butler DL. The symptomatic anterior crucial deficient knee: Part I: the long-term functional disability in athletically active individuals. J Bone Joint Surg Am. 1983;65(2):154–62.

http://mji.ui.ac.id


223


6. Kostov H, Stojmenski S, Kostova E. Reliability assessment of arthroscopic findings versus MRI in ACL injuries of knee. Acta Inform Med. 2014;22(2):111–4.

7. Cellar R, Sokol D, Lacko M, Štolfa Š, Gharaibeh A, Vaško G. Magnetic resonance imaging in the diagnosis of intra-articular lesions of the knee. Acta Chir Orthop Traumatol Cech. 2012;79(3):249–54.

8. Sharma UK, Shrestha BK, Rijal S, Bijukachhe B, Barakoti R, Banskota B, et al. Clinical, MRI and arthoscopic correlation in internal derrangement of knee. Kathmandu Univ Med J. 2011;9(35):174–8.

9. Siddiqui A, Ahmad I, Sabir AB, Ekram Ullah, Rizvi SA, RizvI SW. Clinical examination vs. MRI: evaluation of diagnostic accuracy in detecting ACL and meniscal injuries in comparison to arthroscopy. Pol Orthop Traumatol. 2013;78:59–63.

10. Gupta S, Sharma R, Sachar R, Saini Y, Saini N. Comparison of clinical examination, MRI and arthroscopy in knee injuries. Internet J Orthop Surg. 2012;19(3):275–81.

11. Stein V, Li L, Lo G, Guermazi A, Zhang Y, Kent Kwoh C, et al. Pattern of joint damage in persons with knee osteoarthritis and concomitant ACL tears. Rheumatol Int. 2012;32(5):1197–208.

12. Leblanc M-C, Kowalczuk M, Andruszkiewicz N, Simunovic N, Farrokhyar F, Turnbull TL, et al. Diagnostic accuracy of physical examination for anterior knee instability: a systematic review. Knee Surg Sports Traumatol Arthrosc. 2015;23(10):2805–13.

13. Palm H-G, Bergenthal G, Ehry P, Schwarz W, Schmidt R, Friemert B. Functional ultrasonography in the diagnosis of acute anterior cruciate ligament injuries: a field study. Knee. 2009;16(6):441–6.

14. Milewski MD, Sanders TG, Miller MD. MRI-arthroscopy correlation: the knee. J Bone Joint Surg Am. 2011;93(18):1735–45.

15. Ng AW, Griffith JF, Hung EH, Law KY, Yung PS. MRI diagnosis of ACL bundle tears: value of oblique axial imaging. Skeletal Radiol. 2013;42(2):209–17.

16. Han Y, Kurzencwyg D, Hart A, Powell T, Martineau PA. Measuring the anterior cruciate ligament’s footprints by three-dimensional magnetic resonance imaging. Knee Surg Traumatol Arthrosc. 2012;20(5):986–95.

17. Smith TO, Lewis M, Song F, Toms AP, Donell ST, Hing CB. The diagnostic accuracy of anterior cruciate ligament rupture using magnetic resonance imaging: a meta-analysis. Eur J Orthop Surgery Traumatol. 2012;22(4):315–26.

18. Liodakis E, Hankemeier S, Jagodzinski M, Meller R, Krettek C, Brand J. The role of preoperative MRI in knee arthroscopy: a retrospective analysis of 2,000 patients. Knee Surgery Sports Traumatol Arthroscopy. 2009;17(9):1102–6.

19. Khan HA, Ahad H, Sharma P, Bajaj P, Hassan N, Kamal Y. Correlation between magnetic resonance imaging and arthroscopic findings in the knee joint. Trauma Mon. 2015;20(1):e18635.

20. Gupta K, Guleria M, Sandhu P, Galhotra R. Correlation of clinical, MRI and arthroscopic findings in diagnosing meniscus and ligament injuries at knee joint: A prospective study. J Orthop Allied Sci. 2013;1(1):2–6.

21. Thiga L. Findings of magnetic resonance imaging of intra-articular knee pathology: Radioarthroscopic correlation. University of Nairobi, CHS, Kenya; 2008.

22. Khalil AO, Resnick D, Zeid AF, Zaiton FM. The role of magnetic resonance musculoskeletal imaging in evaluation of sports injuries of the knee joint. Zagazig University Medical Journal. 2015;20(6).

23. Murmu C, Tiwari P, Sircar S, Agrawal V. Accuracy of magnetic resonance imaging in diagnosis of knee injuries. Int J Orthop. 2017;3(1):85–8.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cell%C3%A1r R%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sokol D%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lacko M%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=%C5%A0tolfa %C5%A0%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gharaibeh A%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=Va%C5%A1ko G%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/?term=Va%C5%A1ko G%5BAuthor%5D&cauthor=true&cauthor_uid=22840957

http://www.ncbi.nlm.nih.gov/pubmed/22840957

http://www.ncbi.nlm.nih.gov/pubmed/22840957


Serum specific IgE responses to inhalant allergens sensitization

Keywords: allergic rhinitis, asthma, house dust mites, IgE sensitization, specific IgE

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1909 • Med J Indones. 2017;26:224–8• Received 16 Mar 2017 • Accepted 06 Sep 2017

Corresponding author: Iris Rengganis, [email protected]


Iris Rengganis,1 Suriani Alimuddin,2 Agus J. Susanto3

1 Department of Internal Medicine, Faculty of Medicine, Universitas Indonesia, Jakarta, Indonesia2 Department of Internal Medicine, Faculty of Medicine, Universitas Hasanuddin, Makassar, Indonesia3 Department of Internal Medicine, Faculty of Medicine, Universitas Sebelas Maret, Surakarta, Indonesia

Clinical Research


ABSTRAK

Latar belakang: Sensitisasi IgE spesifik (ssIgE) terhadap alergen hirupan yang lazim belum pernah diteliti di Indonesia. Studi ini bertujuan untuk mengetahui produksi IgE spesifik terhadap alergen hirupan yang lazim pada pasien dengan asma dan/atau rinitis alergi di Jakarta, Indonesia.

Metode: Desain penelitian adalah studi potong lintang pada pasien dengan riwayat alergi pernapasan yang dilakukan pada bulan September-Desember 2016 pada pasien usia 19–59 tahun di Klinik Alergi dan Imunologi, RS Cipto Mangunkusumo, Jakarta. Pasien diinklusi dalam penelitian jika terdapat sedikitnya satu hasil positif pada uji tusuk kulit (SPT) terhadap alergen lingkungan. Pemeriksaan ssIgE dilakukan dengan metode multiple allergosorbent (MAST). Alergen hirupan yang diperiksa adalah tungau debu, serbuk sari, kecoa, serpihan kulit hewan, dan jamur. Kadar IgE serum lebih dari 0,35 kU/L dianggap positif.

Hasil: Seratus orang subjek dilibatkan dalam studi (76% perempuan). Enam puluh dua orang memiliki riwayat asma dan rinitis alergi. Secara keseluruhan, sensitisasi terhadap tungau debu adalah 75%, disusul oleh kucing/anjing (31%), kecoa (27%), serbuk sari (24%) dan jamur (6%). Hampir semua pasien yang sensitif terhadap kecoa, serbuk sari, kucing/anjing, dan jamur juga positif terhadap tungau debu. Dua puluh dua (22%) pasien negatif terhadap semua alergen yang diperiksa.

Kesimpulan: Sensitisasi IgE terhadap alergen hirupan sangat bervariasi pada pasien alergi pernapasan. Tungau debu rumah dan tungau gudang merupakan alergen terbanyak. Sekitar seperlima subjek tidak memperlihatkan sensitisasi IgE-spesifik, sehingga pemeriksaan ini harus selalu dikombinasikan dengan uji tusuk kulit untuk mendiagnosis alergi.

ABSTRACT

Background: Serum specific immunoglobulin E (ssIgE) sensitization to common inhalant allergens has not been studied in Indonesia. This study aimed to evaluate specific IgE production of common inhalant allergens in patients with asthma and/or allergic rhinitis in Jakarta, Indonesia.

Methods: This was a cross-sectional study in adult patients with respiratory allergy from September to December 2016 at Cipto Mangunkusumo Hospital, Jakarta. Patients were included if they showed at least one positive skin prick test (SPT) to environmental allergens. Serum specific IgE was assayed by using multiple allergosorbent methods. Inhalant allergens tested were dust mites, pollen, cockroach, animal dander, and mould. Serum IgE level more than 0.35 kU/L was considered positive.

Results: One hundred subjects were enrolled (76% women). Dust mites made up 75% of sensitization, followed by cat/dog (31%), cockroach (27%), pollen (24%), and mould (6%). Almost all patients sensitized to cockroach, pollen, cat/dog epithelia and mould were also co-sensitized with dust mites. Twenty two percent of patients were negative to all tested allergens.

Conclusion: IgE-sensitization to inhalant allergens varies widely in respiratory allergic patients. House dust and storage mites are the most common allergens. About one-fifth of the subjects did not show specific-IgE sensitization. Thus, this test should always be combined with SPT to diagnose allergy.


Rengganis, et al.Specific IgE to inhalant allergens

225


Respiratory allergic disease is often diagnosed based on the patient’s history and experience. Sometimes it is difficult to associate symptoms with a specific allergen exposure, and patient subjective impression to an allergen trigger can also be misleading.1 An accurate and comprehensive identification of inhalant allergen sensitization is important to plan allergen avoidance and immunotherapy. Skin prick test (SPT) is currently the gold standard to evaluate allergic sensitization. It is usually performed on the volar aspect of the forearm, which can accommodate 20–26 allergens simultaneously. A positive SPT result means that the person is sensitive or has been sensitized to the tested allergen.2 At molecular level, it shows the propensity of an individual to develop immunoglobulin E (IgE) antibodies against common environmental allergens and not necessarily being allergic to the allergen. Previous study using SPT in Jakarta showed that respiratory allergies were usually caused by environmental inhalant allergens such as dust mites (Dermatophagoides pteronyssinus, Dermatophagoides farinae, and Blomia tropicalis), German cockroach (Blatella germanica), tree and grass pollens.3–5 However, although considered safe and inexpensive, SPT cannot be performed in patients under antihistamines or corticosteroid treatment and those who have serious skin disorder.

Detection of serum specific IgE (ssIgE) is another method to assess allergic sensitization. Serum collection is more convenient to the patient and may allow detection of more than 25 specific allergens from a single blood collection. Although imperfect, several preliminary studies have shown good agreement between ssIgE and SPT.6 Serum specific IgE testing is now accepted as a part of diagnostic work-up for allergy diseases.7 This test has long been available in Indonesia for diagnosing allergy diseases such as respiratory and skin allergy. However, the previously available panel tests were not specifically made based on local allergens of Indonesia. Based on our proposal, a newly designed IgE-specific panel test consisting of 44 and 54 local allergens is now available with the assistance of two European companies. As previous studies using SPT have shown that respiratory allergic patients are commonly sensitized to inhallant allergen,3–5

we conducted this study to evaluate the specific IgE production to common inhalant allergens in patients with asthma and/or allergic rhinitis in Jakarta, Indonesia.

METHODS

Study design and subjectsThis was a cross-sectional study in patients with a history of respiratory allergy in Jakarta, Indonesia between September and December 2016. Adult asthmatic and/or allergic rhinitis patients aged 19–60 years were invited to undergo serum specific IgE testing at the Allergy and Immunology Clinic, Cipto Mangunkusumo Hospital, Jakarta. Patients were included if they showed at least one positive skin prick test with main environmental allergens causing allergy in Indonesia. Patients gave a written informed consent prior to enrollment of this study. Ethical approval was granted by the Ethical Committee of Medical Research, Faculty of Medicine, University of Indonesia No. 796/UN2.F1/ETIK/2016.

Specific IgE MeasurementQuantitative determination of specific IgE in serum was carried out by immunoblot method known as multiple allergosorbent (MAST) assays. In order to give more comprehensive data, we used allergen panel tests provided by Euroline® (Euroimmun, Germany) and Alleisa Screen® (Mediwiss, Germany) as per proposal. The allergens include: House dust mite (D. pteronyssinus, D. farinae, D. microceras, B. tropicalis, T. putrescentiae, G. domesticus, and A. siro), Pollen allergens (Bermuda grass, timothy grass, grass mixed, acacia pollen, australian pine, pine mixed, maize, and oil palm), Cockroach allergens (German cockroach and cockroach mixed) and Animal dander allergens (cat and dog) and mould allergen (Mould mix).

Standards of specific IgE concentrations were ranged from 0.35 to 100 kU/L. Both manufactures defined a positive result as serum sIgE level more than 0.35 kU/L. The results were also reported as categories as follows: Class 0: <0.35 kU/L no specific antibody detection. Class 1:0.35–0.7 kU/L very weak antibody concentration.


Class 2:0.70–3.49 kU/L weak antibody concentration. Class 3:3.50–17.49 kU/L clear antibody concentration. Class 4:17.50–49.99 kU/L strong antibody concentration. Class 5:50.00–100.00 ku/L very strong antibody concentration. Class 6:>100.00 kU/L extremely high antibody concentration.

RESULTS

Characteristics of the study subjects are shown in Table 1. and distribution of positive result in number of patients to specific IgE sensitization (n=100) is shown in Table 2. The most common allergen were D. pteronyssinus. B. tropicalis, D. farinae, and D. microceras were also important house dust allergen in Indonesia (more than 50% sensitization). It means that these allergens should also be

Characteristics Mean ± SD N (%)Age (years) 38.8±12.3Gender

Female 76 (76)Male 24 (24)

DiagnosisAsthma 20 (20)Asthma and allergic rhinitis 62 (62)Allergic rhinitis 18 (18)

IgE sensitizationSingle allergen 32 (32)Multiple allergens 46 (46)No-sensitization 22 (22)

Table 1. Characteristics of the study subjects (n=100)

Allergen Total subjects n (%)

Class 1n (%)

Class 2n (%)

Class 3n (%)

Class 4n (%)

Class 5n (%)

Class 6n (%)

House Dust Mite Dermatophagoides pteronyssinus 62 (62) 8 (8) 13 (13) 21 (21) 14 (14) 2 (2) 4 (4)Blomia tropicalis 58 (58) 10 (10) 13 (13) 16 (16) 9 (9) 4 (4) 6 (6)Dermatophagoides farinae 53 (53) 10 (10) 14 (14) 11 (11) 12 (12) 6 (6) 0Dermatophagoides microceras 51 (51) 7 (7) 11 (11) 15 (15) 12 (12) 6 (6) 0Acarus siro 47 (47) 11 (11) 17 (17) 14 (14) 3 (3) 1 (1) 1 (1)Glycyphagus domesticus 45 (45) 8 (8) 17 (17) 14 (14) 5 (5) 0 1 (1)Tyrophagus putrescentiae 38 (38) 13 (13) 14 (14) 8 (8) 0 3 (3) 0

CockroachBlatella mixed 22 (22) 8 (8) 11 (11) 2 (2) 1 (1) 0 0Blatella germanica 10 (10) 8 (8) 1 (1) 1 (1) 0 0 0

Pollen Maize pollen 15 (15) 5 (5) 4 (4) 4 (4) 1 (1) 1 (1) 0Acacia pollen 10 (10) 7 (7) 1 (1) 2 (2) 0 0 0Pine mix pollen 10 (10) 3 (3) 5 (5) 2 (2) 0 0 0Grass mix pollen 8 (8) 2 (2) 4 (4) 2 (2) 0 0 0Bermuda grass 3 (3) 1 (1) 1 (1) 0 0 1 (1) 0Timothy grass 3 (3) 0 1 (1) 2 (2) 0 0 0Australian pine 2 (2) 2 (2) 0 0 0 0 0Oil palm 1 (1) 0 0 0 0 0 0

Animal epitheliaDog epithelia 19 (19) 10 (10) 9 (9) 0 0 0 0Cat epithelia 17 (17) 8 (8) 6 (6) 3 (3) 0 0 0

MouldMould mix 6 (6) 3 (3) 3 (3)

Table 2. Distribution of specific IgE sensitization (n=100)

avoided by allergic patients. The sensitization of cockroach, pollen, animal epithelia and mould were very low.

http://mji.ui.ac.id

Rengganis, et al.Specific IgE to inhalant allergens

227


DISCUSSION

This is the first study to assess the IgE-sensitization among adult respiratory allergic patients in Indonesia. Serum-specific IgE testing only cannot be used to establish the diagnosis of allergic disease. Other diagnostic measures are needed. In our study, 22% of patients did not show sensitization to any tested allergen although subjects’ inclusion criteria has included at least one positive SPT. This could be due to the fact that ssIgE has lower sensitivity than SPT to diagnose allergy disease. Discordance between ssIgE and SPT results is common; therefore, it is advisable to use both methods complimentarily.1

House dust mites showed the highest prevalence of sensitization, which were predominated by three species, i.e. D. pteronyssinus, D. farinae, and B. tropicalis. These 3 species were accounted for 73% of all IgE-sensitization or 97.3% of mite-IgE-sensitizations in our study. It was not surprising because house dust mites has been the major source of allergens in people throughout the world.8 There are more than 250 dust mite species causing health problems, but only the pyroglyphid mites (D. pteronyssinus and D. farinae) that are responsible for more than 90% of house dust mites allergies worldwide.9 D. microceras, is the third Dermatophagoides found in this study and could be an important house dust mites allergen. A study in Taiwan found that IgE-sensitization to D. microceras among 579 asthmatic patients was quite high (59%), almost similar to D. pteronyssinus (59.8%) and slightly higher than D. farinae (56.8%).10–11 B. tropicalis is a storage mite which its importance is getting higher as inhalant house dust allergen in urban environment in Asia.12 Another study in Taiwan reported that 40% sensitization to B. tropicalis was among asthmatic patients.13 Another Taiwanese study on asthmatic children aged 3–15 years found that sensitization to D. microceras was in 84%, not too much different from D. pteronyssinus (87%) and D. farinae (85%), but it was higher than B. tropicalis (65%).14

A. siro, T. putrescentiae, and G. domesticus are not very important in Indonesia. G. domesticus is also known as furniture mite and is found in foods, grains in warehouses, and other storage areas.15 This mite may also induce asthma and

rhino-conjunctivitis symptoms in sensitized individuals.16 T. putrescentiae and A. siro are other storage mites that belong to the family of Acaridae. T. putrescentiae lives in hot, humid climates and is a common pest of stored food products.17 It was reported to be a dominant species of storage mites in Korea and caused IgE reactivity.18

Strong association between sensitization status and total IgE values, and the striking co-sensitization among biologically unrelated allergens suggest that polysensitization is the expression of a distinct clinical, more severe, atopic phenotype, rather than of biological cross-reactivity to similar allergens.19 In this study, we found that 48 patients were sensitized to both B. tropicalis and D. pteronyssinus allergens. Concurrent sensitization of both species was also reported in 63.3% of asthmatic patients in Taiwan.13 Further study confirmed that about 18% of patients sensitized to B. tropicalis might have been caused by a cross-reaction.20

In addition to dust mites, our study also found sensitization to cat/dog dander (31%), cockroach (27%), and pollen (24%). Mould might not have clinical significance since only a small number of patients were sensitized to it. Pet dander and cockroach are also important allergens in Asia. A study in Taiwan showed that IgE sensitization to cockroach was 38.3% whereas sensitization to dog dander was found in 26.3%; cat dander in 10%, Candida albicans in 13.3%, and Cladosporium herbarum in 6.6%.10

Serum specific IgE is superior compared to SPT in testing more variant of allergens in one time. However, in this descriptive study, we can only measure the degree of sensitization based on level of ssIgE positivity. To assess whether this ssIgE has a correlation to the clinical manifestation of the patient, a further diagnostic study is needed. In conclusion, IgE-sensitization to inhalant allergens varies widely in respiratory allergic patients. House dust and storage mites comprises 75% of all sensitization to the tested allergen. Co-sensitization among inhalant allergens is also common, and 80% occurs with dust mites. However, 22% of the subjects failed to show IgE sensitization, confirming the importance combining serum IgE test with skin prick test to diagnose allergy. Sensitization to D. microseras was quite high in our study. Thus, this allergen can


be considered to be included in standard allergen of SPT in Indonesia.

Conflict of interest All of the authors have no relevant financial affiliations to disclose. This study was partly supported by Euroline®, Euroline® (Euroimmune) and Alleisa Screen® (Mediwiss Companies), which providing the reagents for this study.

REFERENCES

1. De Vos G. Skin testing versus serum-specific IgE testing: which is better for diagnosing aeroallergen sensitization and predicting clinical allergy? Curr Allergy Asthma Rep. 2014;14:430.

2. Pawankar R, Canonica GW, Holgate ST, Lockey RF, Blaiss M. The world allergy organization (WAO) white book on allergy: Update 2013;WAO:87–92.

3. Baratawidjaja IR, Baratawidjaja PP, Darwis A, Hwe LS, Tim CF, Wah LB, et al. Prevalence of allergic sensitization to regional inhalant among allergic patient in Jakarta, Indonesia. Asian Pac J Allergy Immunol.1999;17:9–12.

4. Sundaru H. House dust mite allergen level and allergen sensitization as risk factor for asthma among student in Central Jakarta. Med J Indones. 2006;15:55–9.

5. Rengganis I, Hartana A, Guhardja E, Djauzi S, Budiarti S. Pollen sensitivity among respiratory allergic patients. Majalah Kedokteran Indonesia. 2008;58:327–34. Indonesian.

6. Calabria CW, Dietrich J, Hagan L. Comparison of serum-specific IgE (ImunoCAP) and skin prick test result for 53 inhalant allergens in patients with chronic rhinitis. Allergy Asthma Proc. 2009;3:386–90.

7. Canonica GW, Ansotegui IJ, Pawankar R, Schmid-Grendelmeier P, van Hage M, Baena-Cagnani CE, et al. A WAO – ARIA – GA2LEN consensus document on molecular-based allergy diagnostics. WAO J. 2013;6:17.

8. Bousquet J, Khaltaev N, Cruz AA, Denburg J, Fokkens WJ, Togias A et al. Allergic rhinitis and its impact on asthma

(ARIA) 2008 update (in collaboration with the World Health Organization, GA(2)LEN and AllerGen). Allergy 2008;63 (Suppl 86):8–160.

9. Thomas WR. Geography of house dust mite allergens. Asian Pac J Allergy Immunol. 2010;28:211–24.

10. Sidenius KE, Hallas TE, Poulsen LK, Mosbech H. House dust mites and their allergens in Danish mattresses – results from a p.

11. Chiang CH, Wu KM, Wu CP, Yan HC, Perng WC. Evaluation of risk factors for asthma in Taipei City. J Chin Med Assoc 2005;68:204–9.

12. Fernandez-Caldas E, Lockey RF. Blomia tropicalis, a mite whose time has come. Allergy. 2004;59:1161–4.

13. Tsai JJ, Wu HH, Shen HD, Hsu EL, Wang SR. Sensitization to Blomia tropicalis among asthmatic patients in Taiwan. Int Arch Allergy Immunol. 1998;115:144–9.

14. Lai CL, Shyur SD, Wu CY, Chang CL, Chu SH. Specific IgE to 5 different major house dust mites among asthmatic children. Acta Paediatr Taiwan 2002;43:265–70.

15. Thind BB, Clarke PG. The occurrence of mites in cereal-based foods destined for human consumption and possible consequences of infestation. Exp Appl Acarol 2001;25:203–15.

16. Musken H, Franz JT, Wahl R, Paap A, Cromwell O, Masuch G, Bergmann KC. Sensitization to different mite species in German farmers: clinical aspects. J Investig Allergol Clin Immunol 2000;10:346–51.

17. Mullen GR, OConnor BM. Mites (Acari). In: Mullen GR, Durden LA. Medical and Veterinary Entomology. 2nd Ed. Academic Press (Elsevier Imprint), 2009.

18. Jeong KY, Kim WK, Lee JS, Lee J, Lee IY, Kim KE, Park JW, Hong CS, Ree HI, Yong TS. Immunoglobulin E reactivity of recombinant allergen Tyr p 13 from Tyrophagus putrescentiae homologous to fatty acid binding protein. Clin Diagn Lab Immunol. 2005;12:581–5.

19. Ferraroni NR, Oliveira S, Ferraroni JJ. Prevalence of Sensitization to the Storage Mite Acarus Siro in Middle-East of Brazil J Allergy Clin Immunol 2013;131:AB163.

20. Pomés A, Chruszcz M, Gustchina A, Wlodawer A. Interfaces between allergen structure and diagnosis: Know your epitopes. Curr Allergy Asthma Rep. 2015 Apr;15(8):506.

http://mji.ui.ac.id

Mochtar, et al.Kidney transplantation in Indonesia

229

Milestones of kidney transplantation in Indonesia

Keywords: Indonesia, kidney, transplantation

pISSN: 0853-1773 • eISSN: 2252-8083 • http://dx.doi.org/10.13181/mji.v26i3.1770 • Med J Indones. 2017;26:229–36• Received 20 Jan 2017 • Accepted 07 Sep 2017

Corresponding author: Chaidir A. Mochtar, [email protected]


Chaidir A. Mochtar,1,3 Fekhaza Alfarissi,1 Adhitama A. Soeroto,1 Agus Rizal A.H. Hamid,1,3 Irfan Wahyudi,1,3 Maruhum B.H. Marbun,2,3 Arry Rodjani,1,3 Endang Susalit,2,3 Nur Rasyid1,3

1 Department of Urology, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo General Hospital, Jakarta, Indonesia2 Departement of Internal Medicine, Faculty of Medicine, Universitas Indonesia, Cipto Mangunkusumo General Hospital,

Jakarta, Indonesia3 The Indonesian of Transplantation Society, Indonesia

Review Article


ABSTRAK

Meskipun Indonesia telah melaksanakan tindakan transplantasi ginjal sejak tahun 1977, penggunaan metode ini sebagai tata laksana pasien gagal ginjal stadium akhir masih kurang dari 3%. Hal ini menandakan bahwa perkembangan transplantasi ginjal di Indonesia masih stagnan. Perkembangan transplantasi ginjal di Indonesia berdasarkan observasi, dapat dibagi ke dalam beberapa masa, yaitu masa awal/kelahiran terapi baru untuk gagal ginjal terminal, masa pertumbuhan awal, masa penurunan, masa stabil, masa bergejolak, masa kebangkitan kembali, dan masa pertumbuhan eksplosif. Beberapa faktor yang mempengaruhi hal ini, di antaranya: kebijakan pemerintah tentang transplantasi organ, masalah pendanaan, ketersediaan donor, budaya donasi organ, sumber daya manusia, pendekatan multi-disiplin, serta terapi pasca-transplan. Namun beberapa hal sudah dilakukan untuk mengatasi masalah ini, di antaranya adalah dukungan pemerintah terhadap pembentukan pusat-pusat transplan baru, penggunaan teknik invasi minimal, pengembangan transplantasi ginjal pada anak serta regulasi terbaru terkait dengan dukungan program Jaminan Kesehatan Nasional (JKN) terhadap program transplantasi. Diharapkan dengan perubahan ini, transplantasi ginjal di Indonesia akan meningkat dengan pesat.

ABSTRACT

Although kidney transplantation in Indonesia has started since 1977, it has only covered less than 3% ESRD treatment methods. This indicates that the development of kidney transplantation program in Indonesia is still stagnant. Based on observation, the growth of kidney transplantation in Indonesia can be divided into several eras, which are: the birth of new treatment for ESRD era, the expected growth era, the first downfall, the stable period, the unstable period, the rebirth of kidney transplant era, and the explosive growth era. Many factors contribute to this issue including the government policy, the funding problems, the limited donor pool, the dissenting cultural views, the number of human resources, the need for multi-disciplinary approach, and the life-after-graft care. However, many improvements have been made to increase kidney transplantation i.e. the government support for opening new kidney transplant centers, the use of minimally invasive techniques, the development of pediatric kidney transplant, and National Insurance coverage for transplantation. These conditions are expected to improve the number of kidney transplantation in Indonesia.



Based on the 8th Indonesian Renal Registry, the number of end-stage renal cases (ESRD) in Indonesia has been increasing annually. In 2015, there were 21,050 new cases of renal dysfunction of which 89% were categorized as end-stage renal disease (ESRD).1 Furthermore, a surge in non-communicable diseases, such as diabetes and hypertension, caused a rapid increase of ESRD incidence.2 The presence of this disease could trigger many issues, especially in socio-economy aspect. The majority of ESRD cases opted for hemodialysis as their treatment. In the past, the cost of hemodialysis was cheaper than kidney transplantation. In the early years of kidney transplant in Indonesia, one complete procedure cost approximately US$ 15,000, but as years passed, this trend changed.3 The overall cumulative cost of kidney transplant becomes lower than that of hemodialysis.3 The high incidence and long-term treatment of hemodialysis for ERSD patients contribute to the national health burden. Furthermore, Heathcare and Social Security Agency (Badan Penyelenggara Jaminan Sosial Kesehatan/BPJS Kesehatan) reported that the cost of renal disease treatment is the second highest health expenses.4 To cover the cost of two times a week of dialysis, it needs 500 healthy insured people. To further explain about the cost of hemodialysis in Indonesia, data from 2006 showed that the cost of hemodialysis varies from US$ 4,900 to US$ 6,500 depending on the facility.5 This is considered expensive considering the average Indonesian earns US$ 1280 per year (one year’s dialysis is equal to 5 years of the average Indonesian wage), thus it needs an alternative option to overcome this condition. Two other alternatives that are considered as renal replacement therapy are continuous ambulatory peritoneal dialysis (CAPD) and kidney transplantation. CAPD is considered as an alternative as it provides many advantages compared to hemodialysis, such as liberal dietary intake of protein, potassium, sodium, and fluids, elimination of need for anticoagulation, increased patient mobility and lower costs, but it has high incidence complications like peritonitis, catheter malfunction up to 70%, and high hematocrit levels in many patients.6 On the other hand, according to emerging evidences, kidney transplantation is considered as the most desired and cost-effective modality for patients with ESRD.7 According to the National Kidney Foundation/Kidney Disease Outcomes Quality Initiative (NKF/KDOQI), early

kidney transplant in ESRD patient has the best result on costs and medical outcomes.7 Laupacis et al8 also showed that kidney transplantation had better advantages compared to hemodialysis in terms of cost and survival rate.

The first recorded clinical kidney transplantation was conducted on March 13th, 1902 by Erich Ullmann in ‘Wiener klinische Wochenschrist’. He performed kidney transplantation to a dog by transplanting one of the dog’s kidney on another dog’s neck vessel. The first renal transplantation from human to human was successfully conducted in 1933 by Yuri Voronoy in Ukraine,9 using 6 hours anoxic cadaver kidneys to be re-implanted into medial thigh of a 26-year-old woman with acute mercury intoxication, but the result was poor due to ABO incompatibility and hyperacute rejection. Afterwards, the discovery of immunosuppressive medication and the better understanding regarding cross matching between recipient and donor greatly increased the survival of kidney transplantation in humans. Until December 23rd, 1954, Dr. John Murray, who eventually won the Nobel Prize in Medicine for his achievement, performed the first successful kidney transplant in Brigham and Women’s Hospital Boston to a 23-year-old patient with ESRD. The donor was his identical twin brother.8,10 As it progressed, more minimal invasive procedures were found, such as laparascopic donor nephrectomy, laparoscopic kidney transplantation, and robotic kidney transplantation. The introduction of these techniques increased the number of transplantation conducted around the world.11 In Indonesia, BPJS Kesehatan recently endorsed kidney transplantation as an alternative treatment option for ESRD patients.

This review identifies the milestones in the development of kidney transplantation in Indonesia and elucidate factors that affect its growth. This identification may be used to further strengthen and develop Indonesia’s kidney transplantation program. Therefore, we divide the era of kidney transplantation into several periods.

The birth of a new ESRD treatment (1977–1980)The first kidney transplantation procedure in Indonesia was conducted on November 11th, 1977 in Cipto Mangunkusumo Hospital and supervised by a Japanese urologist

http://mji.ui.ac.id


231

named Professor Ota from Tokyo Women Medical College. This was the beginning of a historical hallmark in Indonesia. In 1977, renal transplantations were mainly conducted in two hospitals, Cipto Mangunkusumo Hospital (RSCM) and PGI Cikini Hospital, with the number of transplantations was still less than 5 per year. The number of surgeons who was capable to do kidney transplantation surgery was less than 10 surgeons.12 In order to boost up the number of surgeons capable to perform kidney transplantation surgery, these experts continued to share their knowledge to other colleagues, especially outside of Jakarta. As a result of these events, later in 1985, Kariadi Hospital and Telogorejo Hospital Semarang successfully conducted several transplantation surgeries. Thus, after this breakthrough, the number of kidney transplantation was increasing every year although it was still less than 20 per year.

At this period, the organ donor shortage, the expensive cost, and the public opinion still emerged as the main barriers.13 Furthermore, consensus regarding kidney transplantations in the main religions has not established yet.

Expectant growth (1981–1984) In 1981, the government issued new laws regarding surgery in deceased bodies and transplantation of human tissues (Peraturan Pemerintah/Government Regulation No. 18/1981). It was the first national law that became the basis of kidney transplantation law in Indonesia.14 This law was supported by an International Consensus made by the Transplantation Society which has been updated from time to time. This law and consensus provided the first guideline for the distribution and the use of organs from cadavers and living unrelated donors. Thus, it encouraged the increase of kidney transplantation numbers in this era.

The first downfall (1984–1987)In this period, the first major downfall in numbers of kidney transplantation occured. This was seen as an expected downfall, considering that in these years, kidney transplantation was still a relatively new procedure, and economically, Indonesia was still unstable.12,15 Several factors were believed to contribute for the declining of kidney transplant. The first issue was that in the 1983, the value of Rupiah begin to drop, from Rp. 702 to Rp. 970

per 1 US$, (a devaluation up to 38%). At first, this issues didn’t have any impact on the number of kidney transplant. In 1985-1986, Indonesian Government devaluated the value of Rupiah even further, from Rp.1,134 to Rp. 1,664 per 1 US$, a devaluation of 47%. In 1986, Indonesia was affected by the global economic crisis due to the drop in global oil prices (on January 1986, the price of oil per barrel was 25 US$, but six months later dropped to 10 US$ per barrel), which affected Indonesia’s revenue.15 This economic problem was believed to have a correlation with the number of transplantation in Indonesia (especially at 1985–1986). As the economy condition in Indonesia crumbled, people could not afford kidney transplant surgery.

The stable period (1988–1995)In this period, centers for kidney transplantation grew in several cities, including Bandung, Semarang, Yogyakarta, Surabaya, and Medan. The number of kidney transplantation doubled compared to the previous period. However, the growth in the number of cases of kidney transplantation was relatively slow.

Various regulations encouraged the economic growth and promoted the growth of health programs. The examples of these programs were an earlier form of national health insurance and well-balanced distribution of health services around Indonesia through primary health care centers. Organ transplantation law was also renewed in the form of Undang Undang No 23 Tahun 1992 (Law No. 23/1992).16 This law stated that organ transplantation could only be conducted for humanitarian purposes, and any commercializations of organ transplantation were prohibited. Moreover, in 1995, a consensus was made between religious leaders and health experts including nephrologists and urologists. It was named Kesepakatan Kemayoran (Kemayoran Agreement).17 This consensus, that were formulated at the 2nd

PERNEFRI (Perhimpunan Nefrologi Indonesia/Indonesian Society of Nephrology) and YAGINA (Yayasan Ginjal Nasional/National Kidney Foundation) symposium, concluded that kidney transplantation was one the best treatments for ESRD and stated that the use of cadaveric donor was permitted from the perspective of religion (all five official religions in Indonesia), perspective of health experts, and culture aspects.



The unstable period (1996–2005)The year 1996–1999 was the peak of global economy crisis which increased health cost and led millions of people into poverty in Indonesia. As a result, many Indonesians were unable to afford health care facilities including kidney transplantation. Furthermore, the government mainly focused to provide primary health care and used most of its resources for this sector. As a result, the budget allocated for kidney transplantation was small because chronic kidney disease (CKD) was not categorized as a main health care problem. Kidney transplantation also was not the primary treatment for ESRD patients during this time. However, there were many Indonesian ESRD patients who went abroad for kidney transplantation.18 Other aspects that were suspected to have an effect in declining the number of kidney transplantations in Indonesia (especially in 2004–2005), were the changes in the political climate in Indonesia, the 2004 Election. This year’s election was the hallmark of Indonesian democracy and reformation. Therefore, many policies in Indonesia (including health policy) were changed, such as the implementation of keluarga miskin policy (GAKIN)/Policy for Poor Families, and also these changes affected the economic stability in Indonesia back then.15 Also in this period, one of the worst natural tragedies in Indonesia, the Aceh tsunami unfolded, further

affected the economic stability in Indonesia. Figure 1 shows that the unstable number of kidney transplants mainly happens in PGI Cikini Hospital. In 2004, Markum17 tried to deduce several factors that affected the number of organ transplant donor. These factors were the availability of living donors, the reluctance of using cadaveric organ donors, the donor availability problem, and the pre- and post-operative cost. Moreover, the issue of organ donor compensation was still an ethical dilemma between medical practitioners. The demand for transplantable organs became a burden not only in Indonesia, but also in most of ASEAN countries.19 Singapore, Malaysia, and the Philippines encountered shortage of organ donor. Each country tried to resolve this issue through various methods. Singapore gave birth to the “Human Organ Transplant Act” which allowed medical staff to give compensation to the donor in the form of medical saving accounts. Malaysia and the Philippines expanded the living-related donor definition by including emotional related relationship. A close friend or marital partner could be included as the source of organ donor. Furthermore, to overcome this problem, ASEAN countries tried to adapt the Scandinavian transplant program. This program allowed Scandinavian countries to work together to fill the demand organ transplant by exchanging their donor pool.

Figure 1. The unstable and rebirth of kidney transplant era. This figure shows that the unstable condition mainly happens in PGI Cikini Hospital, and the rebirth mainly happens in Cipto Mangunkusumo Hospital, and it keeps on going until present time

http://mji.ui.ac.id


233

The rebirth of kidney transplantation in indonesia (2006–2010)In the early 2000s, increasing demands of kidney transplantation were not balanced by the number of organ donors.17 As a result of this problem, illegal donor retrieval, such as organ trafficking, began to arise.20, 21

During 2006, there was global concern regarding organ donor commercialization in several countries. Organ trafficking was on the rise worldwide with numerous unfortunate stories of brokers, physicians, and hospitals engaged in illegal trade were featured in high-profile media.20 The example of this problem was the case of Falun Gong Followers’ organ harvesting in China, which Amnesty International reportedly said that 99% of organs in China came from executed prisoners.20 Other reported case is India’s black market organ scandal that was based in Gurgaon, a business center close to the capital New Delhi.21 This black market organ transplant ring had been harvesting poor Indian laborers, sometimes against their wishes, then sold to foreigners desperate for transplants. Doctors usually paid as little as $ 1,000 for kidneys and sold them as much as $ 37,500. As the consequences, World Health Organization (WHO) conducted an international investigation regarding organ donor, and the World Health Assembly issued a resolution for all WHO member states to prohibit transplant tourism.20 This ultimately ended up with organ transplantation tourism being banned around the world, as stated in the Declaration of Istanbul on Organ Trafficking and Transplant Tourism.20,22,23 This condition reduced the number of countries that provided organ donor for transplantation tourism and forced end-stage renal disease patients to look for available donors in their own countries. This issue caused the demand of domestic renal transplantation increased in Indonesia and in many other countries. The rapid growth of information technology bridged the supply and demand of organ transplantation, and after a short slump, it helped in increasing the number of kidney transplantations in Indonesia.

In 2008, the Indonesian Health Ministry passed a new regulation regarding inform consent. This law mandated hospitals to obtain inform consent to conduct any medical procedures. The aim of this regulation was to protect health care personnel from any lawsuit. Following this

regulation, the government issued a new law related with organ transplantation (UU No.36 Tahun 2009).24 It specifically regulated the use of transplantation as the option for end-stage disease patients. This regulation allowed organ transplantation only for medical purposes and without any commercial motivation. Moreover, government health insurance was improved in 2005 when a new regulation (UU No. 40 Tahun 2004 about National Social Security System)25 was created. These changes were made to ensure that poor people will get sufficient health care services.

All of these regulations and laws affected the number of kidney transplantation in Indonesia. Figure 2 shows that the number of kidney transplantation started to increase progressively in these years, especially in Cipto Mangunkusumo Hospital. It indicates that the rebirth mainly happened in Cipto Mangunkusumo Hospital although the number of transplants were still relatively low compared to the present time. In 2005–2010, kidney transplant was still considered as special surgery, which was still conducted only on Saturday (especially in our Cipto Mangunkusumo Hospital), required expensive logistics, and there were no clear standard operating procedure (SOP) back then. Following this trend, several hospitals, Dr. Saiful Anwar Hospital Malang, Dr. Moewardi Hospital Solo, and Dr. M. Djamil hospital Padang also successfully conducted their first kidney transplantation. These marked the distribution of transplantation skills and knowledge among medical services in Indonesia.

The explosive growth (2011–2015)The year 2011–2012 was an important breakthrough of kidney transplant in Indonesia. The numbers of kidney transplantation in Cipto Mangunkusumo Hospital was rising high in this period (Figure 2). The important aspect in this period was the application of a minimal invasive technique, laparoscopic living donor nephrectomy (LLDN). In November 2011, the first LLDN was successfully conducted in Cipto Mangunkusumo Hospital, and this technique was widely introduced to the media in a Press Conference entitled “RSCM Mampu Melakukan Teknik Transplantasi Ginjal Berstandar Internasional di Gedung RSCM Kencana” that was held on Thursday, 12 January 2012. This technique has surely become one of the most important milestones in Indonesia. It can be observed that after this LLDN technique



was introduced to the public through media, the number of kidney transplants were increasing dramatically. Meta-analysis study from 2008 by Nanidis et al26 concluded that LLDN has less postoperative pain, less post-operational morbidity, and most importantly shorter recovery time and shorter time to get back to work post operation.

Another milestone of kidney transplantation in Indonesia that happened in this period was the pediatric kidney transplantation. In March 2013, Cipto Mangunkusumo Hospital successfully conducted the first renal transplantation in a pediatric case. It was commonly known that the renal transplantation surgery in children was harder compared to adult patients. Various issues were needed to be considered when transplantation was conducted in children. The issues were the requirement of chronic immunosuppression, the immune responsiveness, the sexual and emotional transition, the dosage changes, and the risk of post-transplant viral infections and lymphoproliferative disorders (PTLDs).27 Until now, RSCM has performed 4 cases of pediatric kidney transplantations.

Drastic changes also happened in 2014, where in this year, the government through Ministry of Health appointed 11 government hospitals to do (or restart in several centers) kidney transplantation services. Following this

appointment, Cipto Mangunkusumo Hospital established kidney transplantation specialized team consisted of urologist, nephrologist, cardiologist, pulmonologist, anesthesiologist, clinical pathologist clinical and anatomical pathologists, radiologist, pediatrician, forensics, and nutritionist. This team was created to manage the high number of organ transplantation demands and provide comprehensive service to patient with ESRD. Until now, RSCM has supervised a kidney transplantation program at other government hospitals in Aceh, Medan, Padang, Palembang, Solo, Malang and Denpasar. Furthermore, the Ministry of Health Republic of Indonesia has established a National Transplantation Committee as an oversight committee for hospitals that deliver kidney transplantation surgery/program (Peraturan Menteri Kesehatan Republik Indonesia Nomor 38 Tahun 2016).28 This regulation also states that the permitted donor is not only related donor, but also unrelated donor.

Other aspects that affected the number of transplantation were the revision of the reimbursement for kidney transplantation (Peraturan Menteri Kesehatan Republik Indonesia Nomor 52 Tahun 2016) by BPJS.29 This revision was made due to the high long term cost of hemodialysis. After the realization of this issue, BPJS endorsed kidney transplantation surgery and CAPD as the recommended treatment for ESRDs.

Further development in Indonesia’s kidney tranplantation (2016–later)To further develop kidney transplantation, a national kidney transplantation program is needed. Irlianti et al5 described that transplant procurement management (TPM) can be used as one of the solutions. TPM is defined as a system that provides every service required for living or deceased donors and manages the procurement and distribution of available organs through available transplantation institutions. By using this type of management, the available donor will be prioritized to severely needing patients. Indonesia is behind in terms of organ donor management. Until now, there are no specific organizations that facilitate people who want to donor their organ or to help end-stage renal failure patients to find a suitable donor within Indonesia. The management of organ transplantation is conducted mainly by the hospitals that are performing kidney

http://mji.ui.ac.id

Figure 2. The growth of kidney transplantation. This figure explains the number of kidney transplants in each designat-ed era of kidney transplant in Indonesia

All…

PGI…

0

50

100

150

200

250

300

350

400

1977-1980 1981-1984 1985-1987 1988-1995 1996-2005 2006-2010 2011-2015

NUM

BER

OF

KIDN

EY T

RANS

PLAN

TATI

ON

Period of Kidney Transplantation

Growth of Kidney Transplantation in Indonesia

All Hospitals

RSCM

PGI Cikini

Period of kidney transplantation

Num

ber o

f kid

ney

tran

spla

ntat

ion

400

350

300

250

200

150

100

50

0


235

transplantations. As a comparison, the Philippines already established an independent organization called the National Kidney and Transplant Institute (NKTI) with its primary role to manage the national kidney donor-recipient program since 1981. This organization ensures the source of donor is legal and not based on commercial purposes. As a result, the number of deceased and living donor increased significantly in the Philippines and until February 2013, they have performed 5,000 kidney transplantations.30

Markum et al17 summarized that there are several strategies to overcome kidney transplantation stagnancy issues in Indonesia. First strategy is by modifying the donor criteria, such as enlarging the age range for donor or allowing donor with comorbidities (marginal or sub-optimal donor). However, long-term survival rate of this technique is still a controversy. Secondly, the government needs to create operational standards for laws that regulate the use of cadaveric donor for organ transplantation. This law will be used as the legal standing to use a dead body for source of organ donor. The permission to use cadaver as organ donor is still a cultural controversy Indonesia.3 A new law that was decreed in 2016 re-emphasized the use of cadaveric donors28 (Indonesia adopts the opt in concept of donation). To enhance the progress of kidney transplantation, the government has formed a National Transplant Committee (Komite Transplantasi Nasional)28 to oversight committee and to control the legal, ethical, clinical and cultural aspects of all segments of organ transplantation.

Further development strategy that could be used in Indonesia to increase the number of kidney transplantation surgery is the use of advanced technology, such as robotic-assisted surgery. Recent study showed the beneficial effects of robotic assisted kidney transplantation.31 As a further statement, the use of minimally invasive technique was proven adequate to increase the number of kidney transplantation, as seen in Cipto Mangunkusumo Hospital. After usage of LLDN, the number of kidney transplantation hugely increased.

Another development plan in Cipto Mangunkusumo Hospital is to establish the Uro-Nephrology and Kidney Transplantation Center. Developing this new center is in response to a tremendous growth in kidney transplantation.

The presence of this center can further enhance the development of donation and recipient matching technique, establishment of a national kidney transplantation clinical pathway, and long-term follow up for the donor and recipient. Furthermore, this center will act as a kidney transplantation education and training center.

However, it must be remembered that the absence of an ethical transplant procurement management system is still hindering the progression of kidney transplantation in Indonesia, even in Asia

In conclusion, kidney transplantation program in Indonesia has re-gained popularity in recent years. Government support and health insurance coverage are examples of the reasons of this improvement. However, there is still a long process to increase the quantity and quality of kidney transplantation program, i.e. expanding kidney transplantation center, organ procurement program, improved donor and recipient cross-matching technology, development of minimal invasive technique in kidney transplantation surgery, improved immunosuppression, and increased pediatric kidney transplantation.

Conflict of interestAgus Rizal A.H. Hamid is the editor-in-chief of this journal, but this article is also peer reviewed.

AcknowledgmentWe would like to acknowledge PGI Cikini Hospital kidney transplantation staffs: dr. David Manuputty, SpB-SpU(K); dr. Tunggul D. Situmorang, SpPD-KGH; dr. Sutjahjo Endardjo, SpPA, MSc; dr. Juniara Sidabutar, SpPD; Prof.dr. Wiguno Prodjosudjadi, PhD, SpPD-KGH; dr. Marihot Tambunan, SpPD-KGH for helping the data collection.

REFERENCES

1. Report of Indonesian Renal Registry. Indonesia: Perhimpunan Nefrologi Indonesia (PERNEFRI); 2015. 45 p. Report No.: 8. Indonesian.

2. Ojo A. Addressing the global burden of chronic kidney disease through clinical and translational research. Trans Am Clin Climatol Assoc. 2014;125:229–46.

3. Bennett PN, Hany A. Barriers to kidney transplants in Indonesia: a literature review. Int Nurs Rev. 2009 Mar; 6(1):41–9.


https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4112688/


4. Badan Penyelenggara Jaminan Sosial Kesehatan. Agar BPJS Kesehatan Tidak Layu Sebelum Berkembang [Internet]. Indonesia: INFOBPJS Kesehatan Edisi XVII; 2015 [cited 2016 October]; [about 3 screens]. Available from: https://bpjs-kesehatan.go.id/bpjs/dmdocuments/e 6 e 2 6 8 a 2 1 3 6 8 f b 4 9 c a 2 1 b 2 c 4 2 1 1 a 6 9 0 e . p d f . Indonesian.

5. Irlianti PI. Manajemen pengadaan organ untuk transplantasi. Fakultas Kedokteran Universitas Indonesia. 2014. Indonesian.

6. Kavalakkat JP, Kumar S, Kekre NS. Continuous ambulatory peritoneal dialysis catheter placement: Is omentectomy necessary? Urol Ann. 2010;2(3):107–109.

7. Abecassis M, Bartlett ST, Gaston RS. Kidney transplantation as primary therapy for end-stage renal disease: A National Kidney Foundation/Kidney Disease Outcomes Quality Initiative (NKF/KDOQI) Conference. Clin J Am Soc Nephrol. 2008 Mar;3(2):4.

8. Laupacis A, Keown P, Pus N, Krueger H, Ferguson B, Wong C, Muirhead N. A study of the quality of life and cost-utility of renal transplantation. Kidney International. 1996 Jun;50(1):235–42.

9. Matevossian E, Kern H, Huser N, Doll D, Snopok Y, Nahrig J, et al. Historical Perspective surgeon yurii voronoy (1895-1961): a pioneer in the history of clinical transplantation: in memoram at the 75th anniversary of the first human kidney tranplantation. Transplant International. Dec 2009;22(12):1132–9.

10. Sifferlin A. How the first successful kidney transplant happened [Internet]. New York: TIME; 2014 [cited 2017 April]. Available from: http://time.com/3644215/history-kidney-transplant/

11. Kuo PC, Johnson LB. Laparoscopic donor nephrectomy increases the supply of living donor kidneys: a center-specific microeconomic analysis. Transplantation. May 2000;69(10):2211–3.

12. Rahardjo D, Hardjowijoto S, Tigor A. Sejarah 40 tahun IAUI. Jakarta: Balai Penerbit IAUI; 2013.Indonesian.

13. Indonesia Invesments [Internet]. Indonesia; 2015. Sejarah Indonesia: Politik dan Ekonomi di Bawah Soekarno; 2015 Jan 31 [cited Mar 2017]; [about 4 screens]. Available from: http://www.indonesia-investments.com/id/budaya/kolom-budaya/sejarah-indonesia-politik-dan-ekonomi-di-bawah-sukarno/item5271. Indonesian.

14. Peraturan Pemerintah Nomor 18 Tahun 1981 tentang bedah mayat klinis dan bedah mayat anatomis serta transplantasi alat dan atau jaringan tubuh manusia. [cited: Mar 2017]. Available from: http://www.idionline.org/wp-content/uploads/2010/03/PP-No.-18-Tahun-81-ttg-Bedah-Mayat-Klinis-Dan-Bedah-Mayat-Anatomis-Serta-Transplantasi-Alat-Dan-A.pdf. Indonesian.

15. Sherlock S. Crisis in Indonesia: Economy, Society, and Politics [Internet]. Parliament of Australia [cited Apr 2017]. Available from: http://www.aph.gov.au/About_Parliament/ Parliamentary_Departments/Parliamentary_Library/Publications_Archive/CIB/CIB9798/98cib13

16. Undang-Undang Nomor 23 Tahun 1992 Tentang Kesehatan. [cited: Mar 2017]. Available from: http://www.hukumonline.com/pusatdata/detail/412/node/20/undangundang-nomor-23-tahun-1992. Indonesian.

17. Markum HMS. Renal transplantation problem in Indonesia. Acta Medica. Jul-Sep 2004; 36(3):184–6.

18. Prodjosudjadi W. Incidence, prevalence, treatment, and cost of end-stage renal disease in Indonesia. Ethn Dis. 2006 Spring;16(2): S2–14–6.

19. Jingwei AH, Yu-Hung AL, Ching L. Living Organ Transplantation Policy Transition in Asia: towards Adaptive Policy Changes. Global Health Governance. 2010;3(2):1–14.

20. Jafar TH. Organ Trafficking: Global Solutions for a Global Problem. American Journal of Kidney Diseases. Dec 2009;54(6):1145–57.

21. Robinson S. India’s black market organ scandal [Internet]. New York: TIME; Feb 1 2008 [cited 2017 April]. Available from: content.time.com/time/world/article/ 0,8599,1709006,00.html

22. Li J. Taiwan shuts down organ transplant tourism [Internet]. New York: The Epoch Times; Jun 21 2015 [Cited 2016 October 16]. Available from: http://www.theepochtimes.com/n3/1399326-taiwan-shuts-down-organ-transplant-tourism/

23. Matas D. Organ sourcing in China: The official version [Internet]. New York: The Epoch Times; Apr 25 2015 [Cited 2016 October 19]. Available from: http://www.theepochtimes.com/n3/1332895-organ-sourcing-in-china-the-official-version/full/

24. Undang-Undang Republik Indonesia Nomor 36 Tahun 2009 Tentang Kesehatan Available from: http://www.depkes.go.id/resources/download/general/ UU%20Nomor%2036%20Tahun2%20009%20tentang%20Kesehatan.pdf. Indonesian.

25. Undang-Undang Republik Indonesia Nomor 40 Tahun 2004 Tentang Sistem Jaminan Sosial Nasional. Available from: http://www.jkn.kemkes.go.id/attachment/unduhan/UU%20No.%2040%20Tahun%202004%20tentang%20SJSN.pdf. Indonesian.

26. Nanidis TG. Laparoscopic Versus Open Live Donor Nephrectomy in Renal Transplantation: A Meta-Analysis. Ann Surg. 2008;247:58–70.

27. Gulati A. Sarwal M.M. Pediatric renal transplantation: an overview and update. Curr Opin Pediatr. 2010 Apr; 22(2):189–96.

28. Peraturan Menteri Kesehatan Republik Indonesia Nomor 38 Tahun 2016 Tentang Penyelenggaraan Transplantasi Organ. [cited: Mar 2017] Available from: http://hukor.depkes.go.id/uploads/produk_hukum/PMK_No._38_ttg_Penyelenggaraan_Transplantasi_Organ_.pdf. Indonesian.

29. Peraturan Menteri Kesehatan Republik Indonesia Nomor 52 Tahun 2016 Tentang Standar Tarif Pelayanan Kesehatan Dalam Penyelenggaraan Program Jaminan Kesehatan. [Cited: Mar 2017] Available from: http://djsn.go.id/storage/app/uploads/public/58d/487/cdd/58d487cdd4630003169427.pdf. Indonesian.

30. Parayno A.C. Kidney Transplantation in The Philipines: Celebrating more than 30 years of Best Practices [Lecture]. Lecture presented on 26 August 2016; Universitas Indonesia.

31. Modi P, Pal B, Modi J, Kumar S, Sood A, Menon M. Robotic assisted kidney transplantation. Indian J Urol. 2014 Jul-Sep;30(3):287–92.

http://mji.ui.ac.id

http://time.com/3644215/history-kidney-transplant/

http://time.com/3644215/history-kidney-transplant/

http://www.indonesia-investments.com/id/budaya/kolom-budaya/sejarah-indonesia-politik-dan-ekonomi-di-bawah-sukarno/item5271



http://www.idionline.org/wp-content/uploads/2010/03/PP-No.-18-Tahun-81-ttg-Bedah-Mayat-Klinis-Dan-Bedah-Mayat-Anatomis-Serta-Transplantasi-Alat-Dan-A.pdf




http://www.hukumonline.com/pusatdata/detail/412/node/20/undangundang-nomor-23-tahun-1992



http://www.theepochtimes.com/n3/1399326-taiwan-shuts-down-organ-transplant-tourism/



http://www.theepochtimes.com/n3/1332895-organ-sourcing-in-china-the-official-version/full/



http://www.depkes.go.id/resources/download/general/

http://www.depkes.go.id/resources/download/general/

pawitan. - webicdn.com · pawitan. editorial 167 prospect of alternative therapies to kidney...

Documents