Slide 1

2016 Pearson Education, Ltd.

PowerPoint LecturesCampbell Biology: Concepts & Connections, 8th Edition, Global EditionReece Taylor Simon Dickey HoganChapter 1 Lecture by Edward J. ZaliskoBiology: Exploring Life

1

IntroductionSnowy owls exhibit adaptations for life in their frozen, barren habit, includingfeathers that provide insulation in subzero weather andkeen vision and acute hearing that help owls locate prey.Snowy owls are the result of evolution, the process that has transformed life from its earliest beginnings. 2016 Pearson Education, Ltd.

2

Figure 1.0-1 2016 Pearson Education, Ltd.

3Figure 1.0-1 Why do so many animals match their surroundings?

Themes in the Study of Biology 2016 Pearson Education, Ltd.THEMES IN THE STUDY OF BIOLOGY

4

1.1 All forms of life share common propertiesBiology is the scientific study of life.Properties of life includeOrderthe highly ordered structure that typifies life,Reproductionthe ability of organisms to reproduce their own kind,Growth and developmentconsistent growth and development controlled by inherited DNA,Energy processingthe use of chemical energy to power an organisms activities and chemical reactions, 2016 Pearson Education, Ltd.

5Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details. Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief.Active Teaching TipsConsider asking students to pair up with someone sitting near them to identify examples of the seven properties of life in some organism from your region (or perhaps a school mascot, if appropriate).

1.1 All forms of life share common propertiesRegulationan ability to control an organisms internal environment within limits that sustain life, Response to the environmentan ability to respond to environmental stimuli, andEvolutionary adaptationadaptations evolve over many generations, as individuals with traits best suited to their environments have greater reproductive success and pass their traits to offspring. 2016 Pearson Education, Ltd.

6Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details. Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Active Teaching TipsConsider asking students to pair up with someone sitting near them to identify examples of the seven properties of life in some organism from your region (or perhaps a school mascot, if appropriate).

Video: Sea Horses 2016 Pearson Education, Ltd.

Figure 1.1-0(1) Order(2) Reproduction(3) Growth anddevelopment(4) Energyprocessing(5) Regulation(6) Response to theenvironment(7) Evolutionary adaptation 2016 Pearson Education, Ltd.

8Figure 1.1-0 Some important properties of life

Figure 1.1-1Order 2016 Pearson Education, Ltd.

9Figure 1.1-1 Some important properties of life (part 1)

Figure 1.1-2Reproduction 2016 Pearson Education, Ltd.

10Figure 1.1-2 Some important properties of life (part 2)

Figure 1.1-3Growth and development 2016 Pearson Education, Ltd.

11Figure 1.1-3 Some important properties of life (part 3)

Figure 1.1-4Energy processing 2016 Pearson Education, Ltd.

12Figure 1.1-4 Some important properties of life (part 4)

Figure 1.1-5Regulation 2016 Pearson Education, Ltd.

13Figure 1.1-5 Some important properties of life (part 5)

Figure 1.1-6Response to theenvironment 2016 Pearson Education, Ltd.

14Figure 1.1-6 Some important properties of life (part 6)

Figure 1.1-7Evolutionary adaptation 2016 Pearson Education, Ltd.

15Figure 1.1-7 Some important properties of life (part 7)

1.2 In lifes hierarchy of organization, new properties emerge at each levelBiological organization unfolds as follows:Biosphereall of the environments on Earth that support life,Ecosystemall the organisms living in a particular area and the physical components with which the organisms interact,Communitythe entire array of organisms living in a particular ecosystem,Populationall the individuals of a species living in a specific area, 2016 Pearson Education, Ltd.

16Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. For a chance to add a little math to the biological levels of organization, consider calculating the general scale differences between each level of biological organization. For example, are cells generally 5, 10, 50, or 100 times larger in diameter than organelles? Are organelles generally 5, 10, 50, or 100 times larger than macromolecules? For some levels of organization, such as ecosystems, communities, and populations, size/scale differences are perhaps less relevant and more problematic to consider. However, at the smaller levels, the sense of scale might enhance an appreciation for levels of biological organization. The U.S. Census Bureau maintains updated population clocks that estimate the U.S. and world populations on its website at www.census.gov/main/www/popclock.html. If students have an accurate general idea of the population of the United States, statistics about the number of people affected with a disease or disaster become more significant. For example, the current population of the United States is about 318 million (in 2014). It is currently estimated that about 1 million people in the United States are infected with HIV. The number of people infected with HIV is impressive and concerning, but not perhaps as meaningful as realizing that the number of people infected represents about one out of every 318 people in the United States. Although the infected people are not evenly distributed among geographic and ethnic groups, if you apply this generality to the enrollments in your classes, the students might better appreciate the tremendous impact of the infection.

1.2 In lifes hierarchy of organization, new properties emerge at each levelOrganisman individual living thing,Organ systemseveral organs that cooperate in a specific function,Organa structure that is composed of tissues,Tissuea group of similar cells that perform a specific function,Cellthe fundamental unit of life, 2016 Pearson Education, Ltd.

17Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. For a chance to add a little math to the biological levels of organization, consider calculating the general scale differences between each level of biological organization. For example, are cells generally 5, 10, 50, or 100 times larger in diameter than organelles? Are organelles generally 5, 10, 50, or 100 times larger than macromolecules? For some levels of organization, such as ecosystems, communities, and populations, size/scale differences are perhaps less relevant and more problematic to consider. However, at the smaller levels, the sense of scale might enhance an appreciation for levels of biological organization. The U.S. Census Bureau maintains updated population clocks that estimate the U.S. and world populations on its website at www.census.gov/main/www/popclock.html. If students have an accurate general idea of the population of the United States, statistics about the number of people affected with a disease or disaster become more significant. For example, the current population of the United States is about 318 million (in 2014). It is currently estimated that about 1 million people in the United States are infected with HIV. The number of people infected with HIV is impressive and concerning, but not perhaps as meaningful as realizing that the number of people infected represents about one out of every 318 people in the United States. Although the infected people are not evenly distributed among geographic and ethnic groups, if you apply this generality to the enrollments in your classes, the students might better appreciate the tremendous impact of the infection.

1.2 In lifes hierarchy of organization, new properties emerge at each levelOrganellea membrane-enclosed structure that performs a specific function within a cell, andMoleculea cluster of small chemical units called atoms held together by chemical bonds.

2016 Pearson Education, Ltd.

18Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. For a chance to add a little math to the biological levels of organization, consider calculating the general scale differences between each level of biological organization. For example, are cells generally 5, 10, 50, or 100 times larger in diameter than organelles? Are organelles generally 5, 10, 50, or 100 times larger than macromolecules? For some levels of organization, such as ecosystems, communities, and populations, size/scale differences are perhaps less relevant and more problematic to consider. However, at the smaller levels, the sense of scale might enhance an appreciation for levels of biological organization. The U.S. Census Bureau maintains updated population clocks that estimate the U.S. and world populations on its website at www.census.gov/main/www/popclock.html. If students have an accurate general idea of the population of the United States, statistics about the number of people affected with a disease or disaster become more significant. For example, the current population of the United States is about 318 million (in 2014). It is currently estimated that about 1 million people in the United States are infected with HIV. The number of people infected with HIV is impressive and concerning, but not perhaps as meaningful as realizing that the number of people infected represents about one out of every 318 people in the United States. Although the infected people are not evenly distributed among geographic and ethnic groups, if you apply this generality to the enrollments in your classes, the students might better appreciate the tremendous impact of the infection.

Figure 1.2-0BiosphereFloridaEcosystemFloridaEvergladesCommunityAll organisms in thiswetland ecosystemPopulationAll alligators livingin the wetlandsOrganisman American alligatorOrgan systemNervous systemNerveSpinalcordBrainOrganBrainTissueNervous tissueCellNerve cellNucleusOrganelleNucleusMoleculeDNAAtom 2016 Pearson Education, Ltd.

19Figure 1.2-0 Lifes hierarchy of organization

Figure 1.2-1BiosphereFloridaEcosystemFloridaEvergladesCommunityAll organisms in thiswetland ecosystemPopulationAll alligators livingin the wetlandsOrganisman American alligator 2016 Pearson Education, Ltd.

20Figure 1.2-1 Lifes hierarchy of organization (part 1)

Figure 1.2-2Organisman American alligatorOrgan systemNervous systemNerveSpinalcordBrainOrganBrainTissueNervous tissueCellNerve cellNucleusOrganelleNucleusMoleculeDNAAtom 2016 Pearson Education, Ltd.

21Figure 1.2-2 Lifes hierarchy of organization (part 2)

Figure 1.2-3Biosphere 2016 Pearson Education, Ltd.

22Figure 1.2-3 Lifes hierarchy of organization (part 3)

Figure 1.2-4Community:All the organisms in thiswetland ecosystem 2016 Pearson Education, Ltd.

23Figure 1.2-4 Lifes hierarchy of organization (part 4)

Figure 1.2-5Population:All alligators living in the wetlands 2016 Pearson Education, Ltd.

24Figure 1.2-5 Lifes hierarchy of organization (part 5)

Figure 1.2-6AtomMolecule: DNA 2016 Pearson Education, Ltd.

25Figure 1.2-6 Lifes hierarchy of organization (part 6)

1.2 In lifes hierarchy of organization, new properties emerge at each levelEmergent properties are new properties that arise in each step upward in the hierarchy of life from the arrangement and interactions among component parts. 2016 Pearson Education, Ltd.0

26Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. For a chance to add a little math to the biological levels of organization, consider calculating the general scale differences between each level of biological organization. For example, are cells generally 5, 10, 50, or 100 times larger in diameter than organelles? Are organelles generally 5, 10, 50, or 100 times larger than macromolecules? For some levels of organization, such as ecosystems, communities, and populations, size/scale differences are perhaps less relevant and more problematic to consider. However, at the smaller levels, the sense of scale might enhance an appreciation for levels of biological organization. The U.S. Census Bureau maintains updated population clocks that estimate the U.S. and world populations on its website at www.census.gov/main/www/popclock.html. If students have an accurate general idea of the population of the United States, statistics about the number of people affected with a disease or disaster become more significant. For example, the current population of the United States is about 318 million (in 2014). It is currently estimated that about 1 million people in the United States are infected with HIV. The number of people infected with HIV is impressive and concerning, but not perhaps as meaningful as realizing that the number of people infected represents about one out of every 318 people in the United States. Although the infected people are not evenly distributed among geographic and ethnic groups, if you apply this generality to the enrollments in your classes, the students might better appreciate the tremendous impact of the infection.

1.3 Cells are the structural and functional units of lifeCells are the level at which the properties of life emerge.A cell canregulate its internal environment,take in and use energy,respond to its environment, develop and maintain its complex organization, andgive rise to new cells. 2016 Pearson Education, Ltd.

27Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Here is a simple way to contrast the relative size of prokaryotic and eukaryotic cells. Mitochondria and chloroplasts are thought to have evolved by endosymbiosis. Thus, mitochondria and chloroplasts are about the size of bacteria, contained within a plant cell. A figure of a plant cell therefore provides an immediate comparison of these sizes, not side by side, but one inside the other! Examples of biological form and function relationships are nearly endless. Those immediately apparent to your students will be easiest to comprehend. Have your students examine (in photos or in specimens) the teeth of various vertebrates. The diet of these animals is implied by the shape of the teeth (sharp teeth in carnivorous cats and blunted molars in a rat). Sliding your tongue over your teeth reveals our omnivorous history, with sharp canine teeth for slicing flesh and flat rear molars well suited for grinding plant material.

1.3 Cells are the structural and functional units of lifeAll cellsare enclosed by a membrane that regulates the passage of materials between the cell and its surroundings anduse DNA as their genetic information. 2016 Pearson Education, Ltd.

28Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Here is a simple way to contrast the relative size of prokaryotic and eukaryotic cells. Mitochondria and chloroplasts are thought to have evolved by endosymbiosis. Thus, mitochondria and chloroplasts are about the size of bacteria, contained within a plant cell. A figure of a plant cell therefore provides an immediate comparison of these sizes, not side by side, but one inside the other! Examples of biological form and function relationships are nearly endless. Those immediately apparent to your students will be easiest to comprehend. Have your students examine (in photos or in specimens) the teeth of various vertebrates. The diet of these animals is implied by the shape of the teeth (sharp teeth in carnivorous cats and blunted molars in a rat). Sliding your tongue over your teeth reveals our omnivorous history, with sharp canine teeth for slicing flesh and flat rear molars well suited for grinding plant material.

1.3 Cells are the structural and functional units of lifeThere are two basic forms of cells.Prokaryotic cellswere the first to evolve,are simpler, andare usually smaller than eukaryotic cells.Eukaryotic cellsare found in plants, animals, fungi, and protists andare subdivided by membranes into various functional compartments, or organelles, including a nucleus that houses the DNA. 2016 Pearson Education, Ltd.

29Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Here is a simple way to contrast the relative size of prokaryotic and eukaryotic cells. Mitochondria and chloroplasts are thought to have evolved by endosymbiosis. Thus, mitochondria and chloroplasts are about the size of bacteria, contained within a plant cell. A figure of a plant cell therefore provides an immediate comparison of these sizes, not side by side, but one inside the other! Examples of biological form and function relationships are nearly endless. Those immediately apparent to your students will be easiest to comprehend. Have your students examine (in photos or in specimens) the teeth of various vertebrates. The diet of these animals is implied by the shape of the teeth (sharp teeth in carnivorous cats and blunted molars in a rat). Sliding your tongue over your teeth reveals our omnivorous history, with sharp canine teeth for slicing flesh and flat rear molars well suited for grinding plant material.

Figure 1.3Eukaryotic cellProkaryotic cellDNA(no nucleus)MembraneOrganellesNucleus(membrane-enclosed)DNA (throughoutnucleus) 2016 Pearson Education, Ltd.

30Figure 1.3 Contrasting the size and complexity of prokaryotic and eukaryotic cells

1.3 Cells are the structural and functional units of lifeSystems biology is the study of a biological system and the modeling of its dynamic behavior, ranging from the functioning of the biosphere to the complex molecular machinery of an organelle. 2016 Pearson Education, Ltd.

31Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Here is a simple way to contrast the relative size of prokaryotic and eukaryotic cells. Mitochondria and chloroplasts are thought to have evolved by endosymbiosis. Thus, mitochondria and chloroplasts are about the size of bacteria, contained within a plant cell. A figure of a plant cell therefore provides an immediate comparison of these sizes, not side by side, but one inside the other! Examples of biological form and function relationships are nearly endless. Those immediately apparent to your students will be easiest to comprehend. Have your students examine (in photos or in specimens) the teeth of various vertebrates. The diet of these animals is implied by the shape of the teeth (sharp teeth in carnivorous cats and blunted molars in a rat). Sliding your tongue over your teeth reveals our omnivorous history, with sharp canine teeth for slicing flesh and flat rear molars well suited for grinding plant material.

1.3 Cells are the structural and functional units of lifeCells illustrate another theme in biology: the correlation of structure and function.Structure is related to function at all levels of biological organization.

2016 Pearson Education, Ltd.

32Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Here is a simple way to contrast the relative size of prokaryotic and eukaryotic cells. Mitochondria and chloroplasts are thought to have evolved by endosymbiosis. Thus, mitochondria and chloroplasts are about the size of bacteria, contained within a plant cell. A figure of a plant cell therefore provides an immediate comparison of these sizes, not side by side, but one inside the other! Examples of biological form and function relationships are nearly endless. Those immediately apparent to your students will be easiest to comprehend. Have your students examine (in photos or in specimens) the teeth of various vertebrates. The diet of these animals is implied by the shape of the teeth (sharp teeth in carnivorous cats and blunted molars in a rat). Sliding your tongue over your teeth reveals our omnivorous history, with sharp canine teeth for slicing flesh and flat rear molars well suited for grinding plant material.

1.4 Organisms interact with their environment, exchanging matter and energyLiving organisms interact with their environments, which includeother organisms andphysical factors.In most ecosystems,plants are the producers that provide the food,consumers eat plants and other animals, anddecomposers act as recyclers, changing complex matter into simpler chemicals that plants can absorb and use. 2016 Pearson Education, Ltd.

33Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Help the class think through the diverse interactions between an organism and its environment. In class, select an organism and have the class develop a list of environmental components that interact with the organism. Items in this list will likely fall into living and nonliving categories. Perhaps you have seen and can find a photo of a glass-enclosed miniature ecosystem, likely containing some plants and shrimp. These are sometimes called a shrimp biosphere, Aqua-Biosphere, or Ecosphere. Present this system to your students and challenge them to explain the dynamics of energy and nutrients in this system. Such an analysis will reveal that energy flows through but nutrients cycle within this system.

1.4 Organisms interact with their environment, exchanging matter and energyThe dynamics of ecosystems include two major processes:the recycling of chemical nutrients from the atmosphere and soil through producers, consumers, and decomposers back to the air and soil andthe one-way flow of energy through an ecosystem, entering as sunlight and exiting as heat. 2016 Pearson Education, Ltd.

34Student Misconceptions and Concerns Many students enter our courses with a limited appreciation of the diversity of life. Ask any group of freshmen at the start of the semester to write down the first type of animal that comes to mind, and the most frequent response is a mammal. As the diversity of life is explored, the common heritage of biological organization can be less, and not more, apparent. The diverse forms, habits, and ecological interactions overwhelm our senses with striking distinctions. Emphasizing the diversity and the unifying aspects of life is necessary for a greater understanding of the rich evolutionary history of life on Earth. We live in a world that is largely understood by what we can distinguish and identify with our naked senses. However, the diversity of life and the levels of biological organization extend well below the scale of our unaided perceptions. For many students, appreciating the diversity of the microscopic world is abstract, nearly on par with an understanding of the workings of atoms and molecules. The ability to examine the microscopic details of the world of our students (the surface of potato chips, the structure of table salt and sugar, the details of a blade of grass) can be an important sensory extension that prepares the mind for greater comprehension of these minute biological details.Teaching Tips Consider asking students to bring to class a page or two of some article about biology that appeared in the media in the last month. Alternatively, you might have each student post a recent biology-related news article on a course website. The scientific organization Sigma Xi offers a free e-mail summary of the major science news articles appearing each weekday in major U.S. news media. The first paragraph or so of each article is included in the e-mail with a hyperlink to the rest of the article. The diverse topics are an excellent way to learn of general scientific announcements and reports in the national media. Typically, 510 articles are cited in each email. To sign up for this free service, go to www.sigmaxi.org and sign up for the Sigma Xi Smart Brief. Help the class think through the diverse interactions between an organism and its environment. In class, select an organism and have the class develop a list of environmental components that interact with the organism. Items in this list will likely fall into living and nonliving categories. Perhaps you have seen and can find a photo of a glass-enclosed miniature ecosystem, likely containing some plants and shrimp. These are sometimes called a shrimp biosphere, Aqua-Biosphere, or Ecosphere. Present this system to your students and challenge them to explain the dynamics of energy and nutrients in this system. Such an analysis will reveal that energy flows through but nutrients cycle within this system.

Figure 1.4-0ENERGY FLOWSunInflow oflight energyProducers(plants)Chemical energyin foodConsumers(animals)Outflow ofheatLeaves take upCO2 from air; rootsabsorb H2O andminerals from soilDecomposers suchas worms, fungi,and bacteria returnchemicals to soil

2016 Pearson Education, Ltd.

35Figure 1.4-0 The cycling of nutrients and flow of energy in an ecosystem

Figure 1.4-1ENERGY FLOWSunInflow oflight energyProducers(plants)Chemical energyin foodConsumers(animals)Outflow ofheatLeaves take upCO2 from air; rootsabsorb H2O andminerals from soilDecomposers suchas worms, fungi,and bacteria returnchemicals to soil

2016 Pearson Education, Ltd.

36Figure 1.4-1 The cycling of nutrients and flow of energy in an ecosystem (part 1)

Figure 1.4-2 2016 Pearson Education, Ltd.

37Figure 1.4-2 The cycling of nutrients and flow of energy in an ecosystem (part 2)

Evolution, the Core Theme of Biology 2016 Pearson Education, Ltd.

38

1.5 The unity of life is based on DNA and a common genetic codeAll cells have DNA, the chemical substance of genes.Genesare the unit of inheritance that transmit information from parents to offspring,are grouped into very long DNA molecules called chromosomes, andcontrol the activities of a cell. 2016 Pearson Education, Ltd.

39Student Misconceptions and Concerns Students likely have heard the terms chromosome, DNA, and gene. But distinguishing between a chromosome and DNA is often difficult for students, and defining a gene has been problematic even for scientists. Consider spending additional time to distinguish between these terms and note how our understanding has dramatically changed in the last 60 years.Teaching Tips The authors make an analogy between the four bases used to form genes and the 26 letters of the English alphabet used to create words and sentences. One could also make an analogy between the four bases and trains composed of four different types of railroad cars (perhaps an engine, boxcar, tanker, and flatbed). Imagine how many different types of trains one could make using just 100 rail cars of four different types. (The answer is 4100.)

1.5 The unity of life is based on DNA and a common genetic codeA species genes are coded in the sequences of the four kinds of building blocks making up DNAs double helix.All forms of life use essentially the same code to translate the information stored in DNA into proteins.The diversity of life arises from differences in DNA sequences.

2016 Pearson Education, Ltd.

40Student Misconceptions and Concerns Students likely have heard the terms chromosome, DNA, and gene. But distinguishing between a chromosome and DNA is often difficult for students, and defining a gene has been problematic even for scientists. Consider spending additional time to distinguish between these terms and note how our understanding has dramatically changed in the last 60 years.Teaching Tips The authors make an analogy between the four bases used to form genes and the 26 letters of the English alphabet used to create words and sentences. One could also make an analogy between the four bases and trains composed of four different types of railroad cars (perhaps an engine, boxcar, tanker, and flatbed). Imagine how many different types of trains one could make using just 100 rail cars of four different types. (The answer is 4100.)

Figure 1.5-0NucleusDNACellCGCGCGCGCGCGCGCGCGATATATATATATATAT 2016 Pearson Education, Ltd.

41Figure 1.5-0 The four building blocks of DNA (left); part of a DNA double helix (right)

Figure 1.5-1NucleusDNACellCGCGCGCGATAT 2016 Pearson Education, Ltd.

42Figure 1.5-1 Part of a DNA double helix (part 1)

Figure 1.5-2CGCGCGCGCGATATATATATAT 2016 Pearson Education, Ltd.

43Figure 1.5-2 The four building blocks of DNA (left); part of a DNA double helix (right) (part 2)

1.5 The unity of life is based on DNA and a common genetic codeThe entire library of genetic instructions that an organism inherits is called its genome.In recent years, scientists have determined the entire sequence of nucleotides in the human genome. 2016 Pearson Education, Ltd.

44Student Misconceptions and Concerns Students likely have heard the terms chromosome, DNA, and gene. But distinguishing between a chromosome and DNA is often difficult for students, and defining a gene has been problematic even for scientists. Consider spending additional time to distinguish between these terms and note how our understanding has dramatically changed in the last 60 years.Teaching Tips The authors make an analogy between the four bases used to form genes and the 26 letters of the English alphabet used to create words and sentences. One could also make an analogy between the four bases and trains composed of four different types of railroad cars (perhaps an engine, boxcar, tanker, and flatbed). Imagine how many different types of trains one could make using just 100 rail cars of four different types. (The answer is 4100.)

1.6 The diversity of life can be arranged into three domains

We can think of biologys enormous scope as having two dimensions.The vertical dimension is the size scale that stretches from molecules to the biosphere.The horizontal dimension spans across the great diversity of organisms existing now and over the long history of life on Earth. 2016 Pearson Education, Ltd.

45Student Misconceptions and Concerns As noted in the text, the classification of life has changed significantly in recent years. Many of your students may have used outdated materials in high school, increasingly common in difficult financial times. Therefore, the current descriptions may be contrary to schemes already understood by your students. Noting these revisions in classification can also be an opportunity to reflect on the nature of science, as new information is used to revise our understandings.Teaching Tips An excellent introduction to the domains and kingdoms of life is presented at www.ucmp.berkeley.edu/exhibits/historyoflife.php.

1.6 The diversity of life can be arranged into three domains

Diversity is the hallmark of life.Biologists have identified about 1.8 million species.Estimates of the actual number of species range from 10 million to over 100 million.Taxonomy is the branch of biology that names species and classifies species into a hierarchy of broader groups: genus, family, order, class, phylum, and kingdom. 2016 Pearson Education, Ltd.

46Student Misconceptions and Concerns As noted in the text, the classification of life has changed significantly in recent years. Many of your students may have used outdated materials in high school, increasingly common in difficult financial times. Therefore, the current descriptions may be contrary to schemes already understood by your students. Noting these revisions in classification can also be an opportunity to reflect on the nature of science, as new information is used to revise our understandings.Teaching Tips An excellent introduction to the domains and kingdoms of life is presented at www.ucmp.berkeley.edu/exhibits/historyoflife.php.

1.6 The diversity of life can be arranged into three domains

The diversity of life can be arranged into three higher levels called domains.Bacteria are the most diverse and widespread prokaryotes.Archaea are prokaryotes that often live in Earths extreme environments.Eukarya have eukaryotic cells and includesingle-celled protists andmulticellular fungi, animals, and plants.

2016 Pearson Education, Ltd.

47Student Misconceptions and Concerns As noted in the text, the classification of life has changed significantly in recent years. Many of your students may have used outdated materials in high school, increasingly common in difficult financial times. Therefore, the current descriptions may be contrary to schemes already understood by your students. Noting these revisions in classification can also be an opportunity to reflect on the nature of science, as new information is used to revise our understandings.Teaching Tips An excellent introduction to the domains and kingdoms of life is presented at www.ucmp.berkeley.edu/exhibits/historyoflife.php.

Figure 1.6-0Domain BacteriaDomain EukaryaBacteriaDomain ArchaeaProtists(multiple kingdoms)Kingdom PlantaeArchaeaKingdom FungiKingdom Animalia 2016 Pearson Education, Ltd.

48Figure 1.6-0 The three domains of life

Figure 1.6-1Domain BacteriaBacteria 2016 Pearson Education, Ltd.

49Figure 1.6-1 The three domains of life (part 1)

Figure 1.6-2Domain ArchaeaArchaea 2016 Pearson Education, Ltd.

50Figure 1.6-2 The three domains of life (part 2)

Figure 1.6-3Domain EukaryaProtists(multiple kingdoms)Kingdom PlantaeKingdom FungiKingdom Animalia 2016 Pearson Education, Ltd.

51Figure 1.6-3 The three domains of life (part 3)

Figure 1.6-4Protists(multiple kingdoms) 2016 Pearson Education, Ltd.

52Figure 1.6-4 The three domains of life (part 4)

Figure 1.6-5Kingdom Plantae 2016 Pearson Education, Ltd.

53Figure 1.6-5 The three domains of life (part 5)

Figure 1.6-6Kingdom Fungi 2016 Pearson Education, Ltd.

54Figure 1.6-6 The three domains of life (part 6)