pan-mtor inhibitor mln0128 is effective against ...€¦ · shanshan zhang, xinhua song, dan cao,...

25
1 Pan-mTOR inhibitor MLN0128 is effective against intrahepatic cholangiocarcinoma induced in mice by AKT and Yap co-expression Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, Junjie Hu, Bin Chen, Mingjie Dong, Maria G. Pilo, Antonio Cigliano, Katja Evert, Silvia Ribback, Frank Dombrowski, Rosa M. Pascale, Antonio Cossu, Gianpaolo Vidili, Alberto Porcu, Maria M. Simile, Giovanni M. Pes, Gianluigi Giannelli, John Gordan, Lixin Wei, Matthias Evert, Wenming Cong, Diego F. Calvisi and Xin Chen Table of content Supplementary Materials and Methods........................................................................... 2 Fig. S1. ........................................................................................................................... 8 Fig. S2. ........................................................................................................................... 9 Fig. S3. ......................................................................................................................... 10 Fig. S4. ......................................................................................................................... 11 Fig. S5. ......................................................................................................................... 12 Fig. S6. ......................................................................................................................... 13 Fig. S7 .......................................................................................................................... 14 Fig. S8.. ........................................................................................................................ 15 Fig. S9.. ........................................................................................................................ 16 Fig. S10.. ...................................................................................................................... 17 Fig. S11. ....................................................................................................................... 18 Fig. S12. ....................................................................................................................... 19 Fig. S13. ....................................................................................................................... 20 Table S1 ...................................................................................................................... .21 Table S2 ....................................................................................................................... 22 Table S3 ....................................................................................................................... 23 Supplementary references ............................................................................................ 25

Upload: others

Post on 25-Aug-2020

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

1

Pan-mTOR inhibitor MLN0128 is effective against intrahepatic

cholangiocarcinoma induced in mice by AKT and Yap co-expression

Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, Junjie

Hu, Bin Chen, Mingjie Dong, Maria G. Pilo, Antonio Cigliano, Katja Evert, Silvia

Ribback, Frank Dombrowski, Rosa M. Pascale, Antonio Cossu, Gianpaolo Vidili,

Alberto Porcu, Maria M. Simile, Giovanni M. Pes, Gianluigi Giannelli, John

Gordan, Lixin Wei, Matthias Evert, Wenming Cong, Diego F. Calvisi and Xin

Chen

Table of content

Supplementary Materials and Methods ........................................................................... 2

Fig. S1. ........................................................................................................................... 8

Fig. S2. ........................................................................................................................... 9

Fig. S3. ......................................................................................................................... 10

Fig. S4. ......................................................................................................................... 11

Fig. S5. ......................................................................................................................... 12

Fig. S6. ......................................................................................................................... 13

Fig. S7 .......................................................................................................................... 14

Fig. S8.. ........................................................................................................................ 15

Fig. S9.. ........................................................................................................................ 16

Fig. S10.. ...................................................................................................................... 17

Fig. S11. ....................................................................................................................... 18

Fig. S12. ....................................................................................................................... 19

Fig. S13. ....................................................................................................................... 20

Table S1 ...................................................................................................................... .21

Table S2 ....................................................................................................................... 22

Table S3 ....................................................................................................................... 23

Supplementary references ............................................................................................ 25

Page 2: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

2

Supplementary Materials and Methods

Constructs and Reagents

The constructs used for mouse injection, including pT3-EF1α, pT3-EF1α-HA-

myr-AKT (human), pT3-EF1α-YapS127A (human), pT3-EF1α-HA-myr-AKT-

shRaptor, pT3-EF1α-HA-myr-AKT-shLuc, pCMV-Cre and pCMV/sleeping beauty

transposase (SB), were described previously[1-3]. Plasmids were purified using

the Endotoxin free Maxi prep kit (Sigma-Aldrich, St.Louis, MO) before being

injected into the mice. Gemcitabine, purchased from LC Laboratories (Woburn,

MA), was dissolved in Saline to a concentration of 20 mg/ml and stored at -80℃.

Oxaliplatin (LC Laboratories) was dissolved in Saline to a concentration of 2

mg/ml and stored at -20℃. MLN0128 (LC Laboratories) was first dissolved in

NMP (1-methyl-2-pyrrolidinone; Sigma-Aldrich) to make a stock solution of 20

mg/ml and the aliquots were stored at -80℃. It was then 1:100 diluted into 15%

PVP/H2O (PVP: polyvinylpyrrolidone K 30, Sigma-Aldrich; Diluted in H2O at a

15.8:84.2 weight vol−1 ratio). The diluted solution could be stored at 4℃ for 2-3

weeks in the dark and be administered directly. MLN0128 was dissolved in

DMSO for in vitro experiments. Everolimus was dissolved in ethonal to make a 2%

(w/v) stock solution (100x) and stored in -20. Before gavage, stock solution was

diluted with 0.9% NaCl to make a microemulsion.

Histology and immunohistochemistry

Page 3: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

3

Liver specimens were fixed in 4% paraformaldehyde and embedded in paraffin.

Sections were done at 5 μm in thickness. Preneoplastic and neoplastic liver

lesions were assessed by two board-certified pathologists (M.E. and F.D.) in

accordance with the criteria by Frith et al.[4]. For immunohistochemistry, antigen

retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by placement in

a microwave on high for 10 min, followed by a 20-min cool down at room

temperature. After a blocking step with the 5% goat serum and Avidin-Biotin

blocking kit (Vector Laboratories, Burlingame, CA), the slides were incubated

with primary antibodies overnight at 4°C. Slides were then subjected to 3%

hydrogen peroxide for 10 min to quench endogenous peroxidase activity and

subsequently the biotin conjugated secondary antibody was applied at a 1:500

dilution for 30 min at room temperature. The primary antibodies against CK19

(Abcam, Cambridge, MA; 1:150), Vimentin, phosphorylated/activated (p)-AKT,

Yap (Cell Signaling Technology, Danvers, MA; 1:50), α-smooth muscle Actin

(Dako Cytomation, Carpinteria, CA; 1:200) and Ki-67 (Thermo Fisher scientific,

Waltham, MA; 1:150) were used. The immunoreactivity was visualized with the

Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA) and 3,3’-

diaminobenzidine as the chromogen. Slides were counterstained with

hematoxylin. Sirius Red staining was performed according to the standard

instruction. Immunoreactivity for p-AKT was estimated semi-quantitatively:

upregulation of p-AKT was defined when immunolabeling for the latter protein

was stronger in tumors when compared to corresponding surrounding non-

Page 4: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

4

neoplastic livers. Nuclear accumulation of the Yap protein was instead used to

determine Yap activation.

Protein Extraction and Western blotting

Frozen mouse liver specimens were homogenized and cultured cell samples

were lysated in Mammalian protein extraction reagent (Thermo Scientific,

Waltham, MA) containing the Complete Protease Inhibitor Cocktail. Protein

concentrations were determined with the Bio-Rad Protein Assay Kit (Bio-Rad,

Hercules, CA) using bovine serum albumin as standard. Aliquots of 40μg lysate

were denatured by boiling in Tris-Glycine SDS Sample Buffer (Invitrogen),

separated by SDS-PAGE, and then transferred onto nitrocellulose membranes

(Invitrogen, Grand Island, NY). Membranes were blocked in 5% non-fat dry milk

in Tris-buffered saline containing 0.1% Tween 20 for 1 hour and probed with

specific antibodies listed in Table S2. Each primary antibody was followed by

incubation with horseradish peroxidase-secondary antibody diluted 1:10,000 for 1

hour and then revealed with the Super Signal West Pico Chemiluminescent

Substrate (Pierce Chemical Co., New York, NY). Equal loading was assessed by

GAPDH and β -Actin Western blotting.

Quantitative reverse transcription real-time polymerase chain reaction

(qRT-PCR)

Total mRNA was extracted from liver tissues using Quick RNA miniprep kit

(Zymo Research, Irvine, CA, USA). mRNA expression was determined by qRT-

Page 5: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

5

PCR using SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA)

in an QuantStudio™ 6 Flex system (Applied Biosystems). Expression of each

specific gene mRNA by cells was normalized with the 18S rRNA. Thermal cycling

conditions included an initial hold period at 95°C for 10 minutes, which was

followed by a three-step PCR program of 95°C for 15 seconds, 60°C for 1 min

and 72°C for 30 seconds for a total of 35 cycles. Primers used in this study

included DR5: 5'- CGGGCAGATCACTACACCC -3' (forward) and 5'-

AGTTCCCTTCTGACAGGTACTG -3'(reverse); 18S rRNA: 5'-

CGGCTACCACATCCAAGGAA -3' (forward) and 5'- GCTGGAATTACCGCGGCT

-3'(reverse).

In vitro cell culture, colony forming assay, IC 50 determination and

apoptosis assessment

The HuCCT1 and KMCH human ICC cell lines were used for the in vitro studies.

Cell lines were maintained as monolayer cultures in Dulbecco’s modified Eagle

medium supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island,

NY, USA) and 100 U/ml penicillin, 100 g/ml streptomycin (Gibco). pLKO.1 puro,

shRaptor.1, shRaptor.2 and shRictor were obtained from Addgene. When cells

reached 50-60% confluency in 60 × 15 mm culture dishes, pLKO.1 or

shRaptor/shRictor lentivirus was added into culture medium. 48-72 hours later,

cells were trypsinized and cultured in 100 × 20 mm culture dishes in culture

medium containing puromycin at the concentration of 1ug/ml for HuCCT1 and

5ug/ml for KMCH. After 3 days of selection, cells were used for colony forming

Page 6: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

6

assay, and knockdown of Raptor or Rictor was confirmed by immunoblotting. For

colony forming assay, HuCCT1 and KMCH cells transfected with corresponding

lentivirus were plated in 6-well culture plates at a density of 1 × 103 cells per well

in triplicate. 2-3 weeks later, colonies were stained with crystal violet and then

counted for quantification. For IC50 determination, HuCCT1 and KMCH cells

were seeded in 24-well plates and treated with increasing doses of MLN0128 in

triplicate for 48 hours. Then cells were stained with crystal violet. After washed

and dried, stained cells were treated with lysate solution and shaken gently on a

rocking shaker for 20-30 minutes. Diluted lysate solutions were added into 96-

well plates and OD was measured at 590 nm with BioTek ELx808 Absorbance

Microplate Reader. Apoptosis was detected by using the Cell Death Detection

Elisa Plus Kit (Roche Molecular Biochemicals, Indianapolis, IN) following the

manufacturer's instructions. V-ZAD-FMK was purchased from Promega (Madison,

Wisconsin) and used at the concentration of 50 uM at least 2 hours before

MLN0128 treatment.

TUNEL assay

Apoptosis in mice liver tissues was detected with the ApoTag Peroxidase In Situ

Apoptosis Detection Kit (Millipore, Billerica, MA) according to the manufacturer’s

instructions.

CK19 staining quantification

Page 7: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

7

At least 4 samples were used from each group. The images of at least 3

randomly selected fields under 40x magnification were taken for each sample.

Quantification analysis was performed by using Image J software and data were

demonstrated as the percentage of positive staining area of the whole area.

Proliferation and apoptosis analysis

Proliferation and apoptosis indices were determined by counting Ki67 and

TUNEL positive cells respectively, on at least 3000 tumor cells per sample.

Microarray analysis

Liver tissues from control FVB/N mice (n=4) and tumor bearing AKT/YapS127A

mice (n=3) were used to isolate mRNA and preparation of probes for

hybridization on the Affymetrix GeneChip® Mouse 1.0 ST arrays following the

manufacturer’s instruction. Array data were normalized using the Robust

Multiarray Average (RMA) approach. The R package biomaRt was used to map

mouse gene symbols and human gene symbols. SAM in the siggenes R package

was used to perform differential expression analysis between the AKT/YapS127A

and wild type samples (fold change > 1.5 and False Discovery Rate <

0.1). The differentially expressed genes published by Gore’s lab were

used. Hypergeometric test was used to test the significance of overlapping

between two datasets. Both up and down-regulated genes overlapped

significantly in the two datasets (up: p value < 1E-200, down: p value < 1E-200).

Page 8: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

8

Fig. S1. ICC development in AKT/YapS127A mice.

(A) Time course of ICC development in AKT/YapS127A mice. Gross image, H&E

and CK19 staining of liver tissues from AKT/YapS127A mice at different time

points post hydrodynamic injection. (B) IHC staining of Vimentin and SMA and

Sirius Red staining in AKT/YapS127A mouse liver. LW, liver weight. (Scale bar:

500μm for 40X; 200μm for 100X; 100μm for 200X; 50μm for 400X).

Page 9: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

9

Fig. S2. Inhibiting Raptor expression suppresses the clonogenic capacity

of human ICC cell lines.

HuCCT1 (A) and KMCH (B) human ICC cell lines were transfected via lentivirus

with either pLKO.1 or shRaptor. Colony forming assay was performed in triplicate.

Representative photos were shown in the left panel. The colonies were counted

and data are presented as mean ± SE in right upper panel. Inhibition of Raptor

was confirmed by Western blotting (right lower panel). *** P < 0.001.

Page 10: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

10

Fig. S3. Inhibiting Rictor expression suppresses the clonogenic capacity of

human ICC cell lines.

HuCCT1 (A) and KMCH (B) human ICC cell lines were transfected via lentivirus

with either pLKO.1 or shRictor. Colony forming assay was performed in triplicate.

Representative photos were shown in left panel. The colonies were counted and

data are presented as mean ± SE in right upper panel. Inhibition of Rictor was

confirmed by Western blotting (right lower panel). *** P < 0.001.

Page 11: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

11

Fig. S4. Gemcitabine plus Oxaliplatin is effective in the treatment of early

stage AKT/YapS127A ICC.

(A) Study design. (B) Gross images, H&E staining, CK19 and Ki-67 IHC staining

of livers from vehicle- and Gemcitabine plus Oxaliplatin-treated early stage

AKT/YapS127A mice. (C) Liver weight and survival curve of vehicle- and

Gemcitabine plus Oxaliplatin-treated early stage AKT/YapS127A mice. Liver

weight of vehicle-, MLN0128- and Gemcitabine plus Oxaliplatin-treated early

stage AKT/YapS127A mice. (Scale bar: 200μm for 100X; 100μm for 200X). ** P

< 0.01.

Page 12: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

12

Fig. S5. Gemcitabine plus Oxaliplatin has mild efficacy in the treatment of

late stage AKT/YapS127A ICC.

(A) Study design. (B) Gross images, H&E staining, CK19 and Ki-67 IHC staining

of livers from vehicle- and Gemcitabine plus Oxaliplatin-treated late stage

AKT/YapS127A mice. (C) Liver weight and survival curve of vehicle- and

Gemcitabine plus Oxaliplatin-treated late stage AKT/YapS127A mice. (Scale bar:

200μm for 100X; 100μm for 200X). * P < 0.05.

Page 13: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

13

Fig. S6. Pancaspase inhibitor V-ZAD-FMK treatment prevents apoptosis by

MLN0128 in KMCH and HuCCT1 human ICC cell lines.

Apoptosis was assessed with the Cell Death Detection Elisa Plus Kit (Roche

Molecular Biochemicals, Indianapolis, IN) following the manufacturer’s protocol in

KMCH (A, B) and HuCCT1 (C, D) ICC cells. Tukey–Kramer test: at least P <

0.001 a, vs control (untreated cells); b, vs DMSO (solvent); c, vs MLN0128.

Apoptosis was determined at 24h (A, C) and 48h (B, D) time points. Experiments

were conducted at least three times in triplicate.

Page 14: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

14

Fig. S7. mTOR signaling is effectively suppressed after 5 days of MLN0128

administration at the dose of 1mg/kg.

Western blotting was performed to analyze mTOR signaling in wild-type normal

livers treated with vehicle or 1mg/kg MLN0128 for 5 days. Representative

immunoblotting is shown in left panel and quantified data are shown in right

panel.

Page 15: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

15

Fig. S8. MLN0128 leads to stable disease in early stage AKT/YapS127A ICC

mice.

(A) H&E staining of livers and (B) Liver weight of control AKT/YapS127A mice at

3.5 w.p.i. and AKT/YapS127A mice at 6.5 w.p.i. after 3 weeks of MLN0128

treatment. Ctrl, control. (Scale bar: 500μm for 40X).

Page 16: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

16

Fig. S9. Western blotting of liver tissues from mice subjected to either

vehicle or MLN0128 treatment for 3 weeks.

Representative immunoblotting in wild-type (WT), vehicle or MLN0128 treated

AKT/YapS127A liver tissues. GAPDH and β-Actin were used as loading controls.

Page 17: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

17

Fig. S10. MLN0128 suppresses both mTORC1 and mTORC2 signaling,

leading to apoptosis in AKT/YapS127A ICC.

The results of Western blotting in Figure 7 were quantified to analyze mTORC1

and mTORC2 signaling (A), proliferation (B) and apoptosis (C) in ICC tissues

from control AKT/YapS127A mice 3.5 w.p.i and AKT/YapS127A mice 6.5 w.p.i

after 3 weeks of MLN0128 treatment. (D) qRT-PCR was performed to determine

the gene expression level of DR5. Data are presented as mean ± SE. * P < 0.05;

** P < 0.01.

Page 18: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

18

Fig. S11. MLN0128 leads to tumor regression in late stage ICC developed in

AKT/YapS127A mice.

(A) Phenotype of AKT/YapS127A mice before and 1, 2, 3 days after MLN0128

treatment. (B) Gross images and H&E staining of livers from control

AKT/YapS127A mice at 5.5 w.p.i. and MLN0128-treated AKT/YapS127A mice at

different time points. (Scale bar: 500μm for 40X). LW, liver weight.

Page 19: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

19

Fig. S12. Comparison between the AKT/YapS127A ICC model and the

AKT/YapS127A/IL-33 ICC model.

(A) H&E, CK19 IHC and Sirius Red staining in AKT/YapS127A and

AKT/YapS127A/IL-33 mouse ICC tissues. (Scale bar: 200μm). (B) Microarray

was performed to detect global gene expression in AKT/YapS127A ICC tissues,

and the de-regulated genes in AKT/YapS127A and AKT/YapS127A/IL-33 were

compared.

Page 20: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

20

Fig. S13. MLN0128 has better efficacy than Everolimus for treatment of late

stage AKT/YapS127A ICC.

(A) Gross images, H&E staining, CK19 and Ki-67 IHC staining of livers from

vehicle- and Everolimus-treated late stage AKT/YapS127A mice. (B) Liver weight

and survival curve of vehicle-, MLN0128-, Everolimus- and Gemcitabine plus

Oxaliplatin-treated late stage AKT/YapS127A mice. * P < 0.05; ** P < 0.01.

Page 21: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

21

Table S1. Clinicopathological features of intrahepatic cholangiocarcinoma

(ICC) patients.

Variables

No. of patients Male Female

94 62 32

Age (years) <60 >60

42 52

Etiology HBV HCV Hepatolithiasis PSC NA

10 14 22 2 46

Liver cirrhosis Yes No

20 74

Tumor differentiation Well Moderately Poorly

35 32 27

Tumor size (cm) <5 53 >5 41

Tumor number Single 61 Multiple 33

Lymph node metastases Yes 14 No 47 NA 33

Abbreviations: NA, not available; PSC, primary sclerosing cholangitis

Page 22: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

22

Table S2. Logistic regression in 94 patients with intrahepatic cholangiocarcinoma. The dependent variable is the presence/absence of nuclear YAP.

Covariates Model 1§ Model 2#

ORs 95% CI of OR

p-value ORs 95% CI of OR

p-value

Age

< 60 1.000 ‒ ‒ 1.000 ‒ ‒

≥ 60 1.250

(0.169 – 9.269)

0.827 0.861 (0.101 –

7.316) 0.891

Gender

Female 1.000 ‒ ‒ 1.000 ‒ ‒

Male 6.310

(0.629 – 63.31)

0.117 8.702 (0.763 –

99.21) 0.081

Cirrhosis

No 1.000 ‒ ‒ ‒ ‒ ‒

Yes 0.000 Not evaluable 0.999 ‒ Not evaluable ‒

Aetiology

HBV 1.000 ‒ ‒ ‒ ‒ ‒

HCV 0.000 Not evaluable 0.999 ‒ ‒ ‒

Hepatolithiasis 0.591

(0.050 ‒ 7.049)

0.677 ‒ ‒ ‒

PSC 0.955

(0.082 ‒ 11.13)

0.970 ‒ ‒ ‒

NA 0.000 Not evaluable 0.999 ‒ ‒ ‒

Tumor size

< 5 1.000 ‒ ‒ 1.000 ‒ ‒

≥ 5 0.244

(0.024 ‒ 2.433)

0.229 0.161 (0.014 –

1.852) 0.143

Tumor number

Single 1.000 ‒ ‒ 1.000 ‒ ‒

Multiple 0.525

(0.071 ‒ 3.912)

0.530 0.405 (0.046 –

3.545) 0.414

Tumor differentiation

Well 1.000 ‒ ‒ ‒ ‒ ‒

Moderately 0.000 Not evaluable 0.999 ‒ ‒ ‒

Poorly 0.000 Not evaluable 0.999 ‒ ‒ ‒

Lymph node metastases

No 1.000 ‒ ‒ ‒ ‒ ‒

Yes 0.000 Not evaluable 0.999 ‒ ‒ ‒

§Each variable individually; #All variables simultaneously (full model); ORs are

not evaluable when the contingency tables contain cells with no patients.

Page 23: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

23

Table S3. Logistic regression in 94 patients with intrahepatic

cholangiocarcinoma. The dependent variable is the presence/absence of p-

AKT upregulation.

Covariates Model 1§ Model 2#

ORs 95% CI of

OR

p-value ORs 95% CI of

OR

p-value

Age

< 60 1.000 ‒ ‒ 1.000 ‒ ‒

≥ 60 0.703

(0.280 –

1.769) 0.454

0.331 (0.080 –

1.366)

0.126

Gender

Female 1.000 ‒ ‒ 1.000 ‒ ‒

Male 0.815

(0.309 –

2.150) 0.679

0.827 (0.212 –

3.233)

0.785

Cirrhosis

No 1.000 ‒ ‒ 1.000 ‒ ‒

Yes 0.482

(0.170 –

1.365) 0.169

1.520 (0.357 –

6.467)

0.571

Aetiology

HBV 1.000 ‒ ‒ ‒ ‒ ‒

HCV 1.571 (0.245 –

10.09) 0.634

‒ ‒ ‒

Hepatolithiasis 1.457

(0.271 ‒

7.821) 0.661

‒ ‒ ‒

PSC 0.000 Not evaluable 0.999 ‒ ‒ ‒

NA 0.886 (0.200 ‒

3.916) 0.873

‒ ‒ ‒

Tumor size

< 5 1.000 ‒ ‒ 1.000 ‒ ‒

≥ 5 1.341

(0.533 ‒

3.374) 0.534

1.251 (0.375 –

4.179)

0.715

Tumor number

Single 1.000 ‒ ‒ 1.000 ‒ ‒

Multiple 0.818

(0.321 ‒

2.086) 0.674

0.883 (0.247 –

3.153)

0.848

Tumor differentiation

Well 1.000 ‒ ‒ 1.000 ‒ ‒

Moderately 2.068 (0.663 ‒

6.449) 0.210

1.577 (0.345 –

7.204)

0.557

Poorly 2.110 (0.715 ‒

6.232) 0.176

1.712 (0.415 –

7.058)

0.457

Lymph node

Page 24: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

24

metastases

No 1.000 ‒ ‒ 1.000 ‒ ‒

Yes 3.000 (0.598 ‒

15.05) 0.182

2.358 (0.410 –

13.56)

0.337

§Each variable individually; #All variables simultaneously (full model); ORs are

not evaluable when the contingency tables contain cells with no patients.

Page 25: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice

25

Supplementary references

Author names in bold designate shared co-first authorship.

[1]. Tao J, Calvisi DF, Ranganathan S, Cigliano A, Zhou L, Singh S, et al. Activation of beta-catenin and Yap1 in human hepatoblastoma and induction of hepatocarcinogenesis in mice. Gastroenterology 2014;147:690-701. [2]. Marti P, Stein C, Blumer T, Abraham Y, Dill MT, Pikiolek M, et al. YAP promotes proliferation, chemoresistance, and angiogenesis in human cholangiocarcinoma through TEAD transcription factors. Hepatology 2015;62:1497-1510. [3]. Hu J, Che L, Li L, Pilo MG, Cigliano A, Ribback S, et al. Co-activation of AKT and c-Met triggers rapid hepatocellular carcinoma development via the mTORC1/FASN pathway in mice. Scientific reports 2016;6:20484. [4]. Frith CH, Ward JM, Turusov VS. Tumours of the liver. IARC scientific publications 1994:223-269.