Bioresource Technology 143 (2013) 147–153

Contents lists available at SciVerse ScienceDirect

Bioresource Technology

journal homepage: www.elsevier .com/locate /bior tech

Oxalate degradation in a bioelectrochemical system: Reactorperformance and microbial community characterization

0960-8524/$ - see front matter � 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.biortech.2013.05.116

⇑ Corresponding author. Tel.: +34 902789449.E-mail addresses: august.bonmati@irta.cat (A. Bonmatí), ana.sotres@irta.cat (A.

Sotres), yangmu@ustc.edu.cn (Y. Mu), r.rozendal@awmc.uq.edu.au (R. Rozendal),K.rabaey@uq.edu.au, r.rozendal@paqus.nl (K. Rabaey).

A. Bonmatí a,⇑, A. Sotres a, Y. Mu b,c, R. Rozendal b,d, K. Rabaey b,e

a IRTA, GIRO Joint Research Unit IRTA-UPC, Torre Marimon, E-08140 Caldes de Montbui, Barcelona, Spainb Advanced Water Management Centre, Gehrmann Building, The University of Queensland, Brisbane, Queensland 4072, Australiac Department of Chemistry, University of Science and Technology of China, Hefei, Anhui 230026, Chinad Paques BV, T. de Boerstraat 24, 8561 EL Balk, The Netherlandse Laboratory of Microbial Ecology and Technology (LabMET), Ghent University, Coupure Links 653, 9000 Ghent, Belgium

h i g h l i g h t s

� Oxalate can be used as the sole electron donor in a bioelectrochemical system (BES).� Complete oxalate removal was observed, albeit low coulombic efficiency (33.9%).� Anode potential didnot affect oxalate degradation efficiency but decreased coulombic efficiency.� Anode microbial community showed a clear shift during BES start-up.

a r t i c l e i n f o

Article history:Received 5 April 2013Received in revised form 27 May 2013Accepted 28 May 2013Available online 3 June 2013

Keywords:Bioelectrochemical systemMicrobial fuel cellOxalate degradationPCR–DGGEqPCR

a b s t r a c t

The aim of this work was to investigate the feasibility of using oxalate at the anode in a continuous reac-tor. Complete oxalate removal was observed, albeit at a maximum coulombic efficiency of 33.9 ± 0.4%. Atthe cathode side, there was an increase in pH from 8 to 11 showing production of caustic. Analysis of themicrobial community demonstrated a clear shift during reactor start-up, resulting in enrichment ofmicroorganisms belonging to Bacteroidetes, Firmicutes, Mollicutes, and b and c-Proteobacteria. Methanewas produced throughout the experiment; Archaea belonging to the Methanosarcinacea, Methanomicrobi-aceae and Methanosaetaceae were identified as key representatives.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction As not much H+ will be produced in the oxidation of oxalate, not

Oxalate is an important intermediate in the mineralization ofmany organic pollutants (Alvarez-Gallbergos and Pletcher, 1999;Huston and Pingnatello, 1999). It is present in sediments of manyaquatic environments (Smith and Oremland, 1983), as well as inindustrial wastewater from e.g. mining operations (Bangun andAdesina, 1998). Typically, it is removed from waste streams usingelectrochemical or photoelectrochemical oxidation processes (By-rne and Eggins, 1998; Xiong and Karlsson, 2002; Bangun and Ade-sina, 1998; Byrne et al., 1999).The electrochemical oxidation ofoxalate on carbon electrodes occurs via an irreversible 2e� reactionto yield 2 protons and CO2 as the sole product and no intermediatespecies are produced.

much buffer will be needed for pH control; nevertheless, in all thecases it is necessary to use expensive electrodes and/or catalyst toreach high removal efficiencies.

Microbial bioelectrochemical systems (BESs) use microorgan-isms as catalysts for oxidation and/or reduction reactions at theelectrodes (Rabaey et al., 2007). A BES is called a microbial fuel cell(MFC) if electrical power is produced and is called a microbial elec-trolysis cell (MEC) if electrical energy is supplied to drive a non-spontaneous reaction (Hamelers et al., 2010). Depending onwhether they are MFCs or MECs, BESs have many potential appli-cations. For example, they can be used for wastewater treatmentand renewable energy recovery (Angenent et al., 2004), for biodeg-radation of recalcitrant compounds (Mu et al., 2009) or the produc-tion of valuables products as hydrogen hydroxide (Rozendal et al.,2009) and biochemicals (Rabaey and Rozendal, 2010).

At the anode, electrochemically active microorganisms oxidizeelectron donors and transfer these electrons to the electrode. Apart

148 A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153

of the well-known Geobacteraceae and Shewanellaceae species,many electrochemically active bacteria have been identified (Lo-gan and Regan, 2006). Microorganisms grow in consortia develop-ing as a biofilm or as planktonic microbes in the anolyte. While theformation of a biofilm typically leads to the highest electron trans-fer efficiency (Franks et al., 2010), planktonic microorganisms canalso indirectly interact with the electrode (Rabaey et al., 2004,2005a,b). To identify the interactions between members of themicrobial community it is important to understand the role thatthe non-exoelectrogenic microorganisms could play in the micro-bial ecology of the anode (Manefield et al., 2002). Furthermore,depending of the carbon source the composition of the microbialcommunity could vary significantly, as stated by many previousstudies such as Freguia et al. (2010).

To the author’s knowledge, a highly oxidised short-chain organ-ic acid, as oxalate, has never been used as electron donor in a BES.Therefore, the aim of this study is to investigate the feasibility ofoxalate degradation in a bioelectrochemical system and to charac-terize the microbial consortium developing at the anode.

2. Methods

2.1. Bioelectrochemical system

The BES was constructed by assembling two equal rectangularPerspex frames with internal dimensions of0.14 � 0.12 � 0.02 m3. The frames were bolted together betweentwo Perspex square plates. A cation exchange membrane (UltrexCMI-7000, Membranes International, U.S.) was placed betweenthe anode and the cathode. Sealing was ensured by rubber sheetsinserted between each frame. The total empty volume for eachcompartment was 336 � 10�6 m3. The granular graphite withdiameter ranging from 2 to 6 mm (El Carb 100, Graphite Sales,Inc., U.S.) was used as anode electrode, reducing the compartmentliquid volume to 182 � 10�6 m3. A stainless steel mesh was used ascathode electrode. An Ag/AgCl reference electrode (MF-2052 Bio-analytical Systems, USA) was placed in the anode compartment,with an assumed potential of +0.197 V versus standard hydrogenelectrode. The anode was connected to the cathode through apotentiostat (VMP3 multichannel potentiostat, Princeton AppliedResearch, USA) for anode potential control.

2.2. Reactor operation

The anodic compartment of the BES was inoculated with a mix-ture of microbial consortium previously enriched in two differentlab scale MFCs fed with acetate (INMFC-1, INMFC-2), as well as bio-mass from an UASB reactor treating wastewater from a brewery(INUASB). Enrichment was performed under controlled current den-sity; current was increased from 1 mA to 5 mA in five steps (day 0– day 30), and under constant anodic polarization at 0 mV vs SHE(day 31–60). During the first 45 days of BES start-up, a mediumcontaining sodium acetate (0.456 g L�1) and potassium oxalate(4.09 g L�1) as carbon source was supplied to the anodic reactorat a flow rate of 0.628 L d�1. The micronutrient medium was pre-pared as described elsewhere (Rabaey et al., 2005a,b) with theaddition of 0.1 g L�1 of yeast extract to favour biomass adaptation.Subsequently, sodium acetate was removed from the medium andpotassium oxalate was used as the sole electron donor during thenext 15 days. Polarization curves were performed throughout theexperiment (one hour in open circuit and with a scan rate of0.1 mV s�1) to assess the enrichment process.

In order to investigate the effect of the anode potential on oxa-late degradation in BESs, experiments were conducted at three dif-ferent anode potentials:+100, 0 and �100 mV vs SHE. Each

potential was maintained for 2 days in order to allow the establish-ment of steady state conditions, evidenced by constant currentproduction and stable cathodic potential. Then, three liquid phasesamples were collected (one each 2 h) for the analysis of acetate,oxalate and dissolved CH4.

In order to elucidate the origin of the transferred electrons, aCOD and a current balance were performed assuming a theoreticalyeast extract composition (C5H7NO2, with a COD of 142 mg L�1)and its corresponding oxidation reaction. To estimate the mini-mum amount of oxalate oxidized at the anode, it was assumed thatall removed yeast extract was converted to electrons and trans-ferred to the electrode.

Throughout the experiments, the influent catholyte of BES onlycontained 0.1 g L�1 NaCl. The hydraulic retention time (HRT) was6.96 and 12.84 h respectively at the anode and cathode. Continu-ous recirculation was applied to both compartments at the rateof 0.2 L min�1.

2.3. Analytical methods

Throughout the experiment, samples taken from the anodecompartment were immediately filtered through 0.22 lm sterilefilters. The concentration of acetate and oxalate was determinedusing a High-Performance Liquid Chromatograph (HPLC; Shima-dzu, Japan), which was equipped with a refractive index detector(RID-10AVP), a diode array detector (SPD-M10AVP) and an HPX-87H ion exclusion column (300–7.8 mm; BioRad), COD measure-ments were done according to the dichromate method (APHAet al., 1995). Methane was measured by gas chromatography (Shi-madzu GC-9A) using the protocol described in Guisasola et al.(2008).

2.4. Community analysis

The microbial community composition and structure of Eubac-terial and Archaeal populations of the three initial inocula, as wellas the supernatant of the anodic compartment and the anodic bio-film at the end of the enrichment process were analyzed with PCR–DGGE and quantitative PCR – qPCR. Total DNA was extracted pertriplicate by using the PowerSoil DNA isolation kit (MoBio Labora-tories Inc., USA), according to the instructions of the manufacturer.Eubacterial and Archaeal microbial populations were assessed bydenaturing gradient gel electrophoresis (DGGE) based on the 16SrRNA gene. To assess the Eubacterial microbial community, theV3–V5 hypervariable region of the 16S rRNA were amplified usingF341-GC and R907 primers (Yu and Morrison, 2004). A nested PCRprotocol, with a first amplification step using a specific primers forArchaea (Arch0025F/R1517) (Vetriani et al., 1999) and a secondstep using 344F/R915-GC nested primers (Casamayor et al.,2002). PCR reactions were carried out in a Thermocycler Mastercy-cler (Eppendorf).

The PCR amplicons obtained (20 ll) were loaded into an 8% (w/v) polyacrylamide gel (0.75 mm thick), with a chemical gradient offormamide-urea of 30–70% for Eubacteria and Archaea (100%denaturant stock solution contain 7 M urea and 40% (w/v) of form-amide). The gels were performed on a DGGE-4001 System (CBS Sci-entific, Del Mar, CA, USA) at 100 V and 60 �C for 16 h in TAE 1�buffer (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA, pH 7.4)(Muyzer et al., 1993). DGGE gels were stained in darkness for45 min in 15 mL of X1 TAE buffer containing 3 L of SybrGold10,000� (Molecular Probes, Eugene, OR, USA). Then the gels werescanned with an UV transilluminator model Syngene (GelVueTransilluminator & Gen Flash).

Relevant DGGE bands were excised under blue light, using the con-verter Blue-plate (UV Products, USA) to prevent DNA degradation, sus-pended in sterilized Milli-Q water and stored overnight at 4 �C. The

A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153 149

eluded bands were then reamplified by PCR (F341/R907 and F344/R915 for Eubacterial and Archaeal respectively) and sequenced usingthe kit ABI PRISM Big Dye Terminator Cycle Sequencing Kit (version3.1 Applied Biosystems, Foster City, CA) according to the instructionsof the provider. Sequences were processed using the BioEdit software(version 7.0) and compared and aligned in the GenBank database,from BLASTN (BLAST Alignment Search Tool) and in the RibosomalDatabase Project (RDP) (version 10). After the alignment, Bellerophonv.3 (GreenGenes, Berkeley, CA, USA) was used to eliminate chimericalsequences. The Eubacterial and Archaeal 16S rRNAgene nucleotide se-quences determined in this study have been submitted in the Gen-bank (NCBI) database under the accession numbers JX126819-JX126840 and JX105738-JX105744 respectively.

In order to analyze statistically changes on the microbial diver-sity, a principal component analysis (PCA) based on the distributionand relative intensity of the DGGE bands present on the DGGE pro-files previously digitalized were performed using the MS Excel appli-cation StatistiXL v.1.4 (Broadway–Nedlands, Australia).

Gene copy numbers of Eubacterial 16S rRNA, and Archaeal mcrArRNA fragments were quantified with the quantitative PCR (qPCR).The analysis was carried out using Brilliant II SYBR Green qPCRMaster Mix (Stratagene, La Jolla, CA) in a quantitative PCR SystemMX3000-P (Stratagene). The standard curves were performed withthe gens cloned plasmid and quantified by Quant-iTTM PicoGreen�

dsDNA Reagent using MX3000P (Stratagene) as a detector system.The primers forward/reverse used were 519FqPCR (GCCAG-CAGCCGCGGTAAT)/907R qPCR (CCGTCAATTCCTTTGAGTTT) andME1F (GCMATGCARATHGGWATGTC)/ME3R (TGTGTGAASCCKACDCCACC) for Eubacterial and Archaeal respectively.

Annealing temperature was set at 50 �C/30 s for Eubacterial and54 �C/30 s for Archaeal, other parameters were selected according toBustin et al. (2009). The qPCR efficiencies of amplification acceptedwere between 90% and 110%, with a R2 greater than 0.985. All the re-sults were processed with MxPro™ QPCR Software (Stratagene).

3. Results and discussion

3.1. BES start-up

After inoculation, the BES was kept in open circuit for 24 h, atwhich time the anode potential decreased to �275 mV vs SHE.Then the circuit was closed and current was controlled at 1 mA,and was progressively increased till 5 mA. As no COD removal

Fig. 1. Anode potential (Ewe/V), Cathode potential (Ece/V) and Current (I/mA) during enrPeriod from day 46.5th to 49.5th with Oxalate feeding.

was detected the experiment was changed to potentiostatic con-trol, setting the anode potential at 0 mV vs SHE. Current startedto increase after 5 h and reached 20 mA in less than 5 days(Fig. 1a).

During the first 15 days of the potentiostatic enrichment, CODremoval reached values over 80% and the average current was29.5 ± 9 mA, resulting in a Coulombic efficiency of 47 ± 15% (Ta-ble 1). In the effluent, acetate concentration was 53 ± 21 mg L�1;oxalate, however, was not be detected. Nevertheless, COD acetatein the effluent only explains 32% of the COD effluent, and the restof COD could be attributed to non-degraded yeast extract. Polariza-tion curves performed for the anode at day 40 and 45 showsimprovement of the anode performance (Fig. 2a).

Acetate was omitted from the feed on day 45 and oxalate re-mained as the sole electron donor with an OLR of 1.91 kg CODm�3 d�1. As anticipated, the current decreased to 9 ± 1 mA(Fig. 1b). The Coulombic efficiency also reduced to 21 ± 2% (Ta-ble 1). Again, oxalate was not detected in the effluent, thus CODeffluent was all related to non-degraded yeast extract. Polarizationcurves at day 51 and 57 follow similar patterns and only a slightincrease of the anode performance was observed, as shown inFig. 2b.

The cathode potential remained stable below �1.1 V vs SHE(Fig. 2b) throughout the experiment, and the catholyte pH reachedvalues up to 11, indicating proton consumption and concomitantcaustic production as previously described in Rabaey et al. (2010).

3.2. Effect of anode potential on oxalate degradation

The anode potential was first increased from 0 to +100 mV vsSHE, and then decreased to �100 mV vs SHE. When the anode po-tential was decreased from +100 to �100 mV vs SHE, the COD re-moval efficiency decreased from 84.7 ± 1% to 78 ± 0.7%, andconcomitantly the current production decreased from 13.7 ± 0.4to 9.6 ± 0.5 mA and Coulombic efficiency from 33.9 ± 0.4 to26.6 ± 0.2%. On the other hand, the methane production showedan opposite pattern; the lower the anode potential the higher themethane production (Table 2). This finding was also observed be-fore using acetate as electron donor (Virdis et al., 2009). The oxa-late removal efficiency was 100% in all the cases.

While oxalate was completely removed, small quantities of ace-tate were present in the effluent, which might be due to the yeastextract degradation. Nevertheless, CODacetate only represented 12%,

ichment experiment: (a) period from day 30 to 35th with Acetate + Oxalate feed, (b)

Table 1Summary of results of enrichment experiments: acetate/oxalate feed and oxalatefeed.

Anodefeed

OLR (kgCODm�3d�1)

CODremoval

Current(mA)

Coulombicefficiency(%)

Acetateeff.(mg/L)

Oxalateeff.(mg/L)

Acetate/ oxalate 2.9782.2 ± 5

29.5 ± 9 47.0 ± 1553 ± 21

ndOxalate 1.91 87.3 ± 3 9.0 ± 1 21.3 ± 2 nd nd

Table 2Reactor performance fed with oxalate at various anode potentials.

Eanode(mVvs SHE)

CODremoval (%)

CODCH4(mg L�1)

Current(mA)

Coulombicefficiency (%)

+100 84.7 ± 1.0 52.4 ± 2 13.7 ± 0.4 33.9 ± 0.40 82.1 ± 0.4 55.4 ± 10 10.4 ± 0.9 26.6 ± 0.1�100 78.0 ± 0.7 61.2 ± 6 9.6 ± 0.5 26.0 ± 0.2

Table 3COD and current estimation at various anode potentials (YE = Yeast Extract).

Eandode (mVvs SHE)

CODoxalateremv

(mg/L)

COD YEremv

(mg/L)Max currentYE (mA)

Min currentOxalate (mA)

+100 370.7 64.7 ± 5.5 5.7 ± 0.5 8.0 ± 0.50 370.7 63.0 ± 1.8 5.5 ± 0.2 4.9 ± 0.2-100 370.7 49.3 ± 3.4 4.3 ± 0.3 5.3 ± 0.3

150 A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153

20% and 28% of the CODeffluent, at +100 mV, 0 mV and �100 mV vsSHE, respectively, indicating that yeast extract was still present inthe effluent. As shown in Table 3, a COD and current balance wasperformed to investigate if electrons come from oxalate and/oryeast extract degradation. Table 3 presents COD oxalate and CODyeast extract removed, the maximum current produced from yeastextract (considering all the electrons are transferred to the elec-trode), and the minimum current produced by oxalate degradation(subtracting the maximum yeast extract current to the totalcurrent produced). As can be seen, current attributable to oxalateoxidation was between 4.9 ± 0.2 and 8.0 ± 0.5 mA. This shows thatthe population could use oxalate as electron donor, albeit at lowCoulombic efficiency.

3.3. Microbial community structure

In order to analyse the microbial community structure andcompare it with the initial inocula, samples of the supernatant(MFCOX-S) and of the biofilm (MFCOX-B) were taken at day 60. Thesamples together with the three inocula (INMFC-1, INMFC-2, andINUASB) were analysed with 16SrDNA–DGGE (Bacteria and Archaea)and qPCR (16SE rRNA and mcrA genes).

The profile obtained for the bacterial community (Fig. 3)showed that the DGGE banding pattern in the anodic compartment(the supernatant as well as the biofilm) is different from the threeinocula, with a remarkable enrichment of some bands. The pre-dominant bands, in both supernatant and biofilm (MFCOX-S andMFCOX-B), belong to the same phylum, with higher diversityin the supernatant with respect to the biofilm. Contrary,

Fig. 2. Polarization curves during enrichment experiment: (a) acetate + oxalate feed [PC

Rismani-Yazdi et al. (2011) found a different band pattern betweenplanktonic and anode-attached populations. This difference couldbe attributable to the different fed-mode of the reactors; whereas(Rismani-Yazdi et al., 2011) operated the MFC in batch mode, inthis study the reactor was fed in a continuous mode, and in orderto assure complete mixing, a high recirculation rate was set.

The excised DGGE bands from INMFC-1 and INMFC-2, belonged toProteobacteria, Mollicutes, Bacteroidetes, Firmicutes, Cyanobacteriaand Deferribacteres phyla (Table 4). The dominant phylum was Pro-teobacteria, mainly represented by b and c-Proteobacteria. Fromthose, the c-proteobacteria, Pseudomonadaceae and Xanthomonad-aceae have been found previously in MFC working with acetate asthe sole electron donor (Borole et al., 2009).

The sequences found in the inoculum from the brewery anaer-obic reactor (INUASB) mainly relate to Proteobacteria and Firmicutes,some of them are also found in MFCOX-S and MFCOX-B inocula (Ta-ble 4 and Fig. 3). This agrees with Goud and Mohan (2013) who re-ported that most of the microorganisms capable to produce currentin a MFC belonged to these phyla.

-30 (day 30), PC-35 (day 35)] (b) oxalate feed [PC51 (day 51) and PC 57 (day 57)].

Fig. 3. DGGE 16SE rRNA profile for the total Eubacteria community.

A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153 151

The microbial community of the anodic compartment (MFCOX-S

and MFCOX-B) displayed a slight increase of diversity, with a rich-ness–Rr– (according to Marzorati et al., 2008) of 27.2 (MFCOX-B)and 40.7 (MFCOX-S) relative to a Rr between 26.6–32.2 of the othersamples. Noteworthy are the sequence with high similarity to Ali-shewanella sp. (c-proteobacteria) with close proximity to the genusShewanella sp., and a strain identified as a Geovibrio ferrireducensstrain belonging to Deferribacteres filum.

Principal component analysis (PCA) of the DGGE profile (Fig. 4a)shows that the INMFC-2 was different from the INUASB and INMFC-1,and that operation of the MFC on oxalate caused a community shift(MFCOX-S, MFCOX-B). The Pearson cluster analysis (Fig. 4b) showstwo clusters (MFCOX-S and MFCOX-B) close to INMFC-1 and separatedfor the other two clusters (INUASB and INMFC-2). This confirms a shiftin the microbial community on the anodes working with oxalate

Table 4Closest match for bands excised from the Eubacterial DGGE (Fig. 3).

DGGE bands Length (pb) Accession number Similar sequence (genbank)

B2 = B3 519 JX126819 Pseudomonas sp. (EU177802.1)B5 483 JX126820 Stenotrophomonas maltophilia straiB7 523 JX126821 Stenotrophomonas acidaminiphila stB8 349 JX126822 Acholeplasma sp. (EU517562.1)B9 494 JX126823 Uncultured bacterium clone (EU80B10 496 JX126824 Uncultured bacterium clone (HQ68B11 512 JX126825 Simplicispira metamorpha strain (AB12 538 JX126826 Spirochaetes bacterium (AY695841B16 461 JX126827 Sulfurovum lithotrophicum strain (NB19 515 JX126828 Uncultured Firmicutes bacterium (B22 506 JX126829 Uncultured bacterium clone (GU94B23 433 JX126830 Caldilinea aerophila DSM 14535 strB24 534 JX126831 Levilinea saccharolytica strain (NR_B26 = B34 511 JX126832 Bacterium enrichment culture clonB27 = B35 511 JX126833 Bacterium B3C1-6 16S ribosomal RB28 457 JX126834 Azoarcus evansii strain (NR_029266B29 542 JX126835 Alishewanella sp. (EU841499.1)B32 456 JX126836 Hydrogenophaga palleronii strain (NB37 459 JX126837 Proteiniphilum acetatigenes strain (B39 480 JX126838 Geovibrio ferrireducens strain (NR_0B40 479 JX126839 Thiobacillus thioparus strain (HM53B43 462 JX126840 Thiomonas perometabolis strain (HM

respect to the initial inocula. This change in the microbial diversityexplained close to 60% of the variance and is not related to an in-crease or decrease of the population quantity, which was evi-denced by the qPCR analysis, that shows a similar number ofgene copies in all samples (1.72 – 4.22 � 107 gene copies num-ber/g).

The DGGE of the Archaeal community elucidated that all thediversity belongs to three families, Methanosarcinaceae, Methano-microbiaceae and Methanosaetaceae (Table 5). In the inoculumfrom the anaerobic digester (INUASB), Methanosaeta is the pre-dominated group, whereas in the other samples (INMFC-1, INMFC-

2, MFCOX-S and MFCOX-B) Methanosarcina sp. was the predominantone. This genus has been previously described to have acetoclas-tic and hydrogenotrophic capacity (Deremil and Scherer, 2008).Hence, its presence may indicate a syntrophic association with

% Simil. Phylogenetic group (RDP)

99% Pseudomonadaceae (Gammaproteobacteria)n (JF783988.1) 100% Xanthomonadaceae (Gammaproteobacteria)rain (GU945535.1) 98% Xanthomonadaceae (Gammaproteobacteria)

98% Acholeplasmataceae (Mollicutes)8597.1) 99% Bacteroidetes8582.1) 100% Bacteroidetes

Y780904.1) 99% Comamonadaceae (Betaproteobacteria).1) 95% SpirochaetesR_024802.1) 97% Helicobacteriaceae (Epsilonproteobacteria)FM992013.1) 93% Clostridiaceae (Firmicutes)0697.1) 98% Cyanobacteriaain (NR_040878.1) 88% Chloroflexi040972.1) 90% Anaerolineaceae Chloroflexie (GQ221080.1) 99% BacteroidetesNA gene (EU481693.1) 99% Bacteroidetes.1) 95% Rhodocyclaceae Betaproteobacteria

99% Alteromonadaceae (Gammaproteobacteria)R_024936.1) 98% Comamonadacae (Betaproteobacteria)

NR_043154.1) 95% Porphyromonadaceae (Bacteroidetes)29309.1) 99% Deferribacteraceae (Deferribacteres)5226.1) 90% Betaproteobacteria856178.1) 96% Burkholderiales (Betaproteobacteria)

Fig. 4. Principal component analysis (a) and cluster analysis from a similarity matrix according to the Pearson’s Index (b) of the total eubacteria community DGGE profile.

Table 5Closest match for bands excised from the Archaeal DGGE.

DGGE bands Length (pb) Accession number Similar sequence (genbank) % Simil. Phylogenetic group (RDP)

B4 465 JX105738 Methanosarcina vacuolata (FR733661.1) 100% MethanosarcinaceaeB5 443 JX105739 Methanosarcina barkeri strain (HQ591417.1) 93% MethanosarcinaceaeB9 = B8 = B10 426 JX105740 Candidatus Methanoregula boonei(CP000780.1) 96% MethanomicrobiaceaeB11 = B12 = B13 426 JX105741 Methanosaeta concilii (CP002565.1) 99% MethanosaetaceaeB20 475 JX105742 Methanolinea tarda NOBI-1 (NR_028163.1) 98% MethanomicrobialesB29 411 JX105743 Methanosaeta concilii (CP002565.1) 92% MethanosaetaceaeB30 419 JX105744 Methanosarcina siciliae partial 16S rRNA gene (FR733698.1) 99% Methanosarcinaceae

152 A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153

bacteria producing CH4 from oxalate oxidation over hydrogen.On the other hand, qPCR (mcrA gene) showed similar numberof gene copies in all samples. The presence of Archaea in theMFCOX samples could explain the low Coulumbic efficiency ofthe BES and the change of the methane production dependingon the voltage (Table 2). Nevertheless, a longer experimentationand an in depth analysis of the community would be needed tosubstantiate this process.

4. Conclusions

This study demonstrated that oxalate can be completely de-graded in a BES with concomitant caustic soda production in thecathode. Electrochemically active bacteria can use oxalate as elec-tron donor, although the maximum Coulombic efficiency was33.9%. The anode potential did not affect oxalate degradation effi-ciency but did impact the Coulombic efficiency: the lower the an-ode potential the lower the Coulombic efficiency and the higherthe methane production. A clear shift of the microbial communitywas shown in the BES working with oxalate, showing an enrich-ment of microorganisms belonging to taxonomic classes previ-ously described in BES.

Acknowledgements

Part of this research was funded by the Spanish Ministry of Sci-ence and Innovation (MICINN project CTM2009-12632). AugustBonmatí research stay at AWMC was financed by José Castillejosgrant program, Ministry of Education (Spain). Korneel Rabaey issupported by the European Research Council (ERC Starter Grant‘‘Electrotalk’’) and the Centre for Microbial Electrosynthesis(CEMES, The University of Queensland).

References

Alvarez-Gallbergos, A., Pletcher, D., 1999. The removal of low level organics viahydrogen peroxide formed in a verticulated carbon cathode cell. Part 2. Theremoval of phenols and related compounds from aqueous effluents.Electrochim. Acta 44 (14), 2483–2492.

Angenent, L.T., Karim, K., Al-Dahhan, M.H., Dominguez-Espinosa, R., 2004.Production of bioenergy and biochemicals from industrial and agriculturalwastewater. Trends Biotechnol. 22 (9), 477–485.

APHA, AWWA, WEF, 1995. Standard methods for the examination of water andwastewater, 19th ed. American Public Health Association/American WaterWorks Association/Water Environment Federation, Washington, DC, USA.

Bangun, J., Adesina, A.A., 1998. The photodegradation kinetics of aqueous sodiumoxalate solution using TiO2 catalyst. Appl. Catal. 175, 221–235.

Borole, A.P., Hamiltonb, C.Y., Vishnivetskayaa, T., Leakc, D., Andrasc, C., 2009.Improving power production in acetate-fed microbial fuel cells via enrichmentof exoelectrogenic organisms in flow-through systems. Biochem. Eng. J. 48, 71–80.

Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R.,Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. TheMIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55 (4), 611–622.

Byrne, J.A., Eggins, B.R., 1998. Photoelectrochemistry of oxalate on particulate TiO2

electrodes. J. Electroanal. Chem. 457, 61–72.Byrne, J.A., Eggins, B.R., Byers, W., Brown, M.D., 1999. Photoelectrochemical cell for

the combined photocatalytic oxidation of organic pollutants and the recovery ofmetals from waste waters. Appl. Catal. 20, L85–L89.

Casamayor, E.O., Massana, R., Benlloch, S., Øvreås, L., Dıez, B., Goddard, V.J., Gasol,J.M., Joint, I., Rodrıguez-Valera, F., Pedros-Alio, C., 2002. Changes in Archaeal,bacterial and eukaryal assemblages along a salinity gradient by comparison ofgenetic fingerprinting methods in a multipond solar saltern. Environ. Microbiol.4, 338–348.

Deremil, B., Scherer, P., 2008. The roles of acetotrophic and hydrogenotrophicmethanogens during anaerobic conversion of biomass to methane: a review.Environ. Sci. Biotechnol. 7, 173–190.

Franks, A.E., Malvankar, N., Nevin, K.P., 2010. Bacterial biofilms: the powerhouse ofa microbial cell. Biofuels 1 (4), 589–604.

Freguia, S., Teh, E.H., Boon, N., Leung, K.M., Keller, J., Rabaey, K., 2010. Microbial fuelcells operating on mixed fatty acids. Bioresour. Technol. 101, 1233–1238.

Guisasola, A., De Hass, D., Keller, J., Yuan, Z., 2008. Methane formation in sewersystems. Water Res. 42 (6–7), 1421–1430.

Hamelers, H.V.M., Heijne, A.T., Sleutels, T.H.J.A., Jeremiasse, A.W., Strik, D.P.B.T.B.,Buisman, C.J.N., 2010. New applications and performance of bioelectochemicalsystems. Appl. Microbiol. Biotechnol. 85 (6), 1673–1685.

Huston, P.L., Pingnatello, J.J., 1999. Degradation of selected pesticide activeingredients and commercial formulations in water by the photo-assistedFenton reaction. Water Res. 33 (5), 1238–1246.

A. Bonmatí et al. / Bioresource Technology 143 (2013) 147–153 153

Goud, R.K., Mohan, S.V., 2013. Prolonged applied potential to anode facilitateselective enrichment of bio-electrochemically active Proteobacteria formediating electron transfer: microbial dynamics and bio-catalytic analysis.Bioresour. Technol. 137, 160–170.

Logan, B.E., Regan, J.M., 2006. Microbial challenges and applications. Environ. Sci.Technol. 40, 5172–5180.

Manefield, M., Whiteley, A.S., Griffiths, R.I., Bailey, M.J., 2002. RNA stable isotopeprobing, a novel means of linking microbial community function to phylogeny.Appl. Environ. Microbiol. 68, 5367–5373.

Marzorati, M., Wittebolle, L., Boon, N., Daffonchio, D., Vestraete, W., 2008. How toget more out of molecular fingerprints: practical tools for microbial ecology.Environ. Microbiol. 10, 1571–1581.

Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbialpopulations by denaturing gradient gel electrophoresis analysis of polymerasechain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol.59 (3), 695–700.

Rabaey, K., Boon, N., Siciliano, S.D., Verhaege, M., Verstraete, W., 2004. Biofuel cellsselect for microbial consortia that self-mediate electron transfer. Appl. Environ.Microbiol. 70 (9), 5373–5382.

Rabaey, K., Bützer, S., Brown, S., Keller, J., Rozendal, R.A., 2010. High currentgeneration coupled to caustic production using a lamellar bioelectrochemicalsystem. Environ. Sci. Technol. 44 (11), 4315–4321.

Rabaey, K., Ossieur, W., Verhaege, M., Verstraete, W., 2005a. Continuous microbialfuel cells convert carbohydrates to electricity. Water Sci. Technol. 52 (1–2).

Rabaey, K., Rodriguez, J., Blackall, L.L., Keller, J., Gross, P., Batstone, D., 2007.Microbial ecology meets electrochemistry: electricity-driven and drivingcommunities. ISME J. 1, 9–18.

Rabaey, K., Rozendal, R., 2010. Microbial electrosynthesis – revisiting the electricalroute for microbial production. Nat. Rev. Microbiol. 8 (10), 706–716.

Rabaey, K., Boon, N., Hofte, M., Verstraete, W., 2005b. Microbial phenazineproduction enhances electron transfer in biofuel cells. Environ. Sci. Technol.39 (9), 3401–3408.

Rismani-Yazdi, H., Christy, A.D., Carver, S.M., Yu, Z., Dehority, B.A., 2011. Effect ofexternal resistance on bacterial diversity and metabolism in cellulose-fedmicrobial fuel cells. Bioresour. Technol. 102, 278–283.

Rozendal, R.A., Leone, E., Keller, J., Rabaey, K., 2009. Efficient hydrogen peroxidegeneration from organic matter in a bioelectrochemical system. Electrochem.Commun. 11, 1752–1755.

Smith, R.L., Oremland, R., 1983. Anaerobic oxalate degradation: widespread naturaloccurrence in aquatic sediments. Appl. Environ. Microbiol. 46 (1), 106–113.

Vetriani, C., Jannasch, H.W., MacGregor, B.J., Stahl, D.A., Reysenbach, A.L., 1999.Population structure and phylogenetic characterization of marine benthicArchaea in deep-sea sediments. Appl. Environ. Microbiol. 65, 4375–4384.

Virdis, B., Rabaey, K., Yuan, Z., Rozendal, R.A., Keller, J., 2009. Electron fluxes in amicrobial fuel cell performing carbon and nitrogen removal. Environ. Sci.Technol. 43, 5144–5149.

Xiong, Y., Karlsson, H.T., 2002. An experimental investigation of chemical oxygendemand removal from the wastewater containing oxalic acid using three-phasethree-dimensional electrode reactor. Adv. Environ. Res. 7, 139–145.

Mu, Y., Rabaey, K., Rozendal, R., Keller, J., 2009. Nitrobenzene removal inbioelectrochemical systems. Environ. Sci. Technol. 43, 8690–8695.

Yu, Z., Morrison, M., 2004. Comparison of different hypervariable regions of rrsgenes for use in fingerprinting of microbial communities by PCR-denaturinggradient gel electrophoresis. Appl. Environ. Microbiol. 70 (8), 4800–4806.