molecular phylogeny and biogeography of north american isolates of anaplasma marginale...

Veterinary Parasitology 97 (2001) 65–76

Molecular phylogeny and biogeography of NorthAmerican isolates of Anaplasma marginale

(Rickettsiaceae: Ehrlichieae)

José de la Fuente a,∗, Ronald A. Van Den Bussche b,Katherine M. Kocan a

a Department of Veterinary Pathobiology, College of Veterinary Medicine,Oklahoma State University, Stillwater, OK 74078, USA

b Department of Zoology and Collection of Vertebrates, Oklahoma State University, Stillwater, OK 74708, USA

Received 25 October 2000; received in revised form 19 December 2000; accepted 8 January 2001

Abstract

Anaplasma marginale (A. marginale) is a tick-borne ehrlichial pathogen of cattle that causes thedisease anaplasmosis. Six major surface proteins (MSPs) have been identified on A. marginale fromcattle and ticks of which three, MSP1a, MSP4 and MSP5, are from single genes and do not varywithin isolates. The other three, MSP1b, MSP2 and MSP3, are from multigene families and mayvary antigenically in persistently infected cattle. Several geographic isolates have been identifiedin the United States which differ in morphology, protein sequence and antigenic properties. Anidentifying characteristic of A. marginale isolates is the molecular weight of MSP1a which variesin size among isolates due to different numbers of tandemly repeated 28–29 amino acid peptides.For these studies, genes coding for A. marginale MSP1a and MSP4, msp1� and msp4, respectively,from nine North American isolates were sequenced for phylogenetic analysis. The phylogeneticanalysis strongly supports the existence of a south-eastern clade of A. marginale comprised ofVirginia and Florida isolates. Analysis of 16S rDNA fragment sequences from the A. marginaletick vector, Dermacentor variabilis, from various areas of the United States was used to evaluatepossible vector–parasite co-evolution. Our phylogenetic analysis supports identity between themost parsimonious tree from the A. marginale MSP gene data and the tree that reflected the westernand eastern clades of D. variabilis. These phylogenetic analyses provide information that may beimportant to consider when developing control strategies for anaplasmosis in the United States.© 2001 Elsevier Science B.V. All rights reserved.

Keywords: Anaplasma; Biogeography; Co-evolution; Dermacentor; Ehrlichia; Major surface protein; Rickettsia;Tick; Vaccine

∗ Corresponding author. Tel.: +1-405-744-372; fax: +1-405-744-5275.E-mail address: jose [email protected] (J. de la Fuente).

0304-4017/01/$ – see front matter © 2001 Elsevier Science B.V. All rights reserved.PII: S0 3 0 4 -4 0 17 (01 )00378 -8

66 J. de la Fuente et al. / Veterinary Parasitology 97 (2001) 65–76

1. Introduction

Anaplasma marginale (A. marginale) is a tick-borne pathogen of cattle that causes thedisease anaplasmosis (Ristic and Watrach, 1963). This obligate intraerythrocytic organismwas recently classified as an Ehrlichia based on 16S rDNA sequences (Roux and Raoult,1995; Walker and Dumler, 1996). The only known site of A. marginale development in cattleis within bovine erythrocytes, and the rapid removal of infected erythrocytes by the bovineimmune system results in anemia and icterus. The acute phase of the disease is characterizedby weight loss, fever, abortion, lowered milk production and often death (Kuttler, 1984).Biological transmission of A. marginale is affected by feeding ticks, while mechanical trans-mission occurs when infected blood is transferred to susceptible animals by biting flies orby blood contaminated fomites. Cattle that recover from acute infection remain persistentlyinfected and serve as reservoirs for mechanical transmission and infection of ticks.

Approximately 20 species of ticks have been incriminated as A. marginale vectorsworld-wide (Dikmans, 1950; Kocan et al., 1981; Ewing, 1981). Dermacentor sp., includ-ing D. variabilis, D. andersoni and D. albipictus, are the major vectors of anaplasmosis inthe United States. After ingestion and subsequent development of A. marginale in tick gutcells, many other tick tissues become infected, including the salivary glands from which theEhrlichia is transmitted to vertebrates during feeding (Kocan, 1986; Kocan et al., 1992a,b;Ge et al., 1996). Male ticks become persistently infected with A. marginale and can transmitinfection to multiple cattle (Kocan et al., 1992a,b).

Six major surface proteins (MSPs) have been identified on A. marginale from cattle andticks of which three, MSP1a, MSP4 and MSP5, are from single genes and do not varywithin isolates. The other three, MSP1b, MSP2 and MSP3, are from multigene families andmay vary antigenically in persistently infected cattle (as reviewed by Kocan et al., 2000).MSP1 is a heterodimer composed of two structurally unrelated polypeptides: MSP1a whichis encoded by a single gene, msp1�, and MSP1b which is encoded by at least two genes,msp1�1 and msp1�2 (Barbet et al., 1987; Viseshakul et al., 2000; Camacho-Nuez et al.,2000). The molecular weight of MSP1a varies in size among isolates due to differentnumbers of tandemly repeated 28–29 amino acid peptides (Allred et al., 1990). MSP4,encoded by a single gene, is highly conserved among geographic isolates (Oberle et al., 1993;Oberle and Barbet, 1993). MSP1a has been described as adhesin for bovine erythrocytesand tick cells while the function of MSP4 is unknown (McGarey et al., 1994; McGarey andAllred, 1994; de la Fuente et al., 2001).

Several geographic isolates of A. marginale have been identified in the United Stateswhich differ in biology, morphology, protein sequence and antigenic characteristics (Smithet al., 1986; Allred et al., 1990; as reviewed by Palmer, 1989). Some isolates of A. marginaleare not transmissible by Dermacentor sp. ticks. The Florida isolate of A. marginale wasnot transmissible by D. variabilis (Smith et al., 1986) or D. andersoni (Wickwire et al.,1987). Lack of transmissibility by Dermacentor sp. suggests that mechanical transmissionby other vectors or transmission by other tick species may be the mechanism of A. marginaletransmission in some geographic areas of the US.

Phylogenies provide important frameworks for formulating hypotheses of relatedness.We report the first molecular phylogeny for North American isolates of A. marginale anddiscuss implications for biogeography and co-evolution of the pathogen and its tick vector.

J. de la Fuente et al. / Veterinary Parasitology 97 (2001) 65–76 67

2. Materials and methods

2.1. A. marginale isolates and D. variabilis ticks

A. marginale and D. variabilis isolates used in this study are detailed in Table 1. A.marginale isolates were originally obtained from naturally infected cattle and isolated forthis study from bovine erythrocytes collected from experimentally infected cattle. D. vari-abilis were field collected. Information for A. marginale isolates from Florida (msp1� andmsp4), Washington (msp1�), and Idaho (msp1�) was obtained from Allred et al. (1990).16S rDNA sequences for D. variabilis isolates from Massachusetts (U14144) and one from

Table 1Amplified sequences of parasite and tick isolates and their origins

Isolate Origin (location and year) Genes GenBank accessionnumber

A. marginaleVirginia USDA, Beltsville, MD, Virginia, 1978 msp1� AY010246

msp4 AY010254Florida Florida (Wickwire et al., 1987; Allred et al., 1990) msp1� M32871, M32872

msp4 L01987Okeechobee Okeechobee, Florida, 1999 msp1� AY010244

msp4 AY010253Mississippi Mississippi msp1� AY010243

msp4 AY010251Oklahoma Wetumka, Oklahoma, 1997 msp1� AY010247

msp4 AY010252Washington Washington (Allred et al., 1990) msp1� M32869Saint Maries Saint Maries, northern Idaho (Eriks et al., 1994) msp1� AY010245

msp4 AY010249Idaho Idaho (Allred et al., 1990) msp1� M32868

msp4 AY010250California Wheatland, California, 1999 msp1� AY010242

msp4 AY010248

D. variabilisVirginia Virginia, 2000 16S rDNA AY010240

16S rDNA AY010241Florida Gainesville, Florida, 2000 16S rDNA AY010236

16S rDNA AY010237Massachusetts Massachusetts (Caporale et al., 1995) 16S rDNA U14144Oklahoma Payne County, Oklahoma, 2000 16S rDNA AY010239Idaho Snake river, south of Lewiston, Idaho, 2000 16S rDNA AY010238California Placer County, California (Crosbie et al., 1998) 16S rDNA AF001257California Santa Lucia Preserve, Monterey, California, 2000 16S rDNA AY010235

D. andersoniD. andersoni Idaho (Crosbie et al., 1998) 16S rDNA AF001234D. andersoni Rocky Mountain Laboratory (Crosbie et al., 1998) 16S rDNA AF001235

B. annulatusB. annulatus Unknown 16S rDNA Z97877


California (AF001257) were obtained from Caporale et al. (1995) and Crosbie et al. (1998),respectively. The 16S rDNA sequences used for outgroup comparisons were obtained fromGenBank: D. andersoni (AF001234, AF001235; Crosbie et al., 1998) and Boophilus annu-latus (Z97877).

2.2. DNA extraction

A. marginale DNA was extracted from 1 ml stored washed red blood cells prepared fromblood collected during the acute peak of parasitemia in EDTA-treated tubes. Blood sampleswere centrifuged at 10 000×g for 5 min, washed with PBS and DNA extracted employing250 �l Tri Reagent (Sigma, USA) and following manufacturer’s recommendations. Ex-tracted DNA was re-suspended in 100 �l distilled water. Three individual ethanol-preservedD. variabilis larvae or adults were rinsed in water, dried and homogenized with a pipettetip in 500 �l Tri Reagent (Sigma, USA). DNA was extracted following manufacturer’srecommendations and was re-suspended in 50 �l distilled water.

2.3. A. marginale msp1α and msp4 polymerase chain reaction (PCR)

The msp1� gene was amplified from 1 �l (1–10 ng) DNA by PCR using 10 pmol ofeach primer MSP1aP: 5′GCATTACAACGCAACGCTTGAG3′ and MSP1a3: 5′GCTTTA-CGCCGCCGCCTGCGCC3′ in a 50 �l volume (1.5 mM MgSO4, 0.2 mM dNTP, 1X AMV/Tfl 5X reaction buffer, 5u Tfl DNA polymerase) employing the Access RT-PCR sys-tem (Promega, USA). Reactions were performed in an automated DNA thermal cycler(Eppendorf Mastercycler® personal, USA) for 35 cycles. After an initial denaturationstep of 30 s at 94◦C, each cycle consisted of a denaturing step of 30 s at 94◦C and anannealing-extension step of 2.5 min at 68◦C. The program ended by storing the reactions at4◦C. The msp4 gene was amplified as described above but using oligonucleotides MSP45:5′GGGAGCTCCTATGAATTACAGAGAATTGTTTAC3′ and MSP43: 5′CCGGATCCTT-AGCTGAACAGGAATCTTGC3′ and a PCR profile of a denaturing step of 30 s at 94◦C,annealing for 30 s at 60◦C and an extension step of 1 min at 68◦C. PCR products wereelectrophoresed on 1% agarose gels to check the size of amplified fragments.

2.4. D. variabilis 16S rDNA PCR

Oligonucleotides were designed specifically for the amplification by PCR of a ∼356 bpfragment of Dermacentor sp. mitochondrial 16S rDNA (Caporale et al., 1995; Crosbie et al.,1998) (D16S5: 5′GAATGCTAAGAGAATGGAAT3′ and D16S3: 5′GTCTGAACTCAGA-TCAAGT3′). PCR reactions were performed as described above in 50 �l volume contain-ing 1 �l (1–10 ng) DNA and 10 pmol each primer employing the Access RT-PCR system(Promega, USA) in an automated DNA thermal cycler (Eppendorf Mastercycler® personal,USA) for 35 cycles. After an initial denaturation step of 30 s at 94◦C, each cycle consistedof a denaturing step of 30 s at 94◦C, annealing for 30 s at 52◦C and an extension step of1 min at 68◦C. The program ended by storing the reactions at 4◦C. PCR products wereelectrophoresed on 1% agarose gels to check the size of amplified fragments.


2.5. Cloning and sequencing of PCR products

Amplified fragments were resin purified (Wizard, Promega, USA) and cloned into pGEM-T vector (Promega, USA) or used directly for sequencing both strands by double-strandeddye-termination cycle sequencing (Core Sequencing Facility, Department of Biochemistryand Molecular Biology, Noble Research Center, Oklahoma State University). The msp4 genewas completely sequenced. For msp1� gene, only the fragment containing the upstream andvariable regions was sequenced in all the isolates. When cloned, at least two independentclones were sequenced from each PCR.

2.6. Sequence alignment and phylogenetic analysis

The ∼356 nucleotides fragment from tick 16S rDNA (Caporale et al., 1995; Crosbieet al., 1998), the A. marginale msp1� gene fragment containing the upstream and vari-able regions and the entire msp4 gene were used for sequence alignment and phylogeneticanalysis. Multiple sequence alignment was performed using the program AlignX (Vec-tor NTI Suite V 5.5, InforMax, USA) with an engine based on the Clustal W algorithm(Thompson et al., 1994). Nucleotides were coded as unordered, discrete characters withfive possible character-states; A, C, G, T, or N (missing) and gaps were coded as missingdata. Parsimony analyses were conducted with equal weights for all characters and substi-tutions. Searches for the most parsimonious tree employed the branch and bound (for the16S rDNA) or exhaustive search (for the msp1� and msp4 data) options in PAUP∗4.0b4a(Swofford, 2000). Stability or accuracy of inferred topology(ies) was assessed via bootstrapanalysis (Felsenstein, 1985) of 500 branch and bound iterations. To evaluate intra-specificrelationships within D. variabilis, character-state changes were polarized by designatingB. annulatus and two representatives of D. andersoni as outgroups. Kishino and Hasegawa(1989), Templeton (1983), and winning-sites (Prager and Wilson, 1988) tests were used toevaluate the degree of congruence between the most parsimonious tree(s) from the primarilyprotein-coding A. marginale data and the 16S rDNA data from D. variabilis.

3. Results

A ∼356 bp fragment of the 16S rDNA gene (Caporale et al., 1995; Crosbie et al., 1998)was examined from nine geographic isolates of D. variabilis and three outgroup taxa. Align-ment of these sequences resulted in 356 aligned sites, of which 33 (9.3%) were phyloge-netically informative. Designating B. annulatus and two representatives of D. andersoni asoutgroups, four equally parsimonious trees of 46 steps (consistency index (CI) = 0.9565;retention index (RI) = 0.9683) resulted from analysis of equal weights applied to allcharacters and substitutions (Fig. 1). This analysis strongly supported monophyly of D.variabilis (bootstrap support (bs) = 98%). Moreover, within D. variabilis, strong bootstrapsupport was detected for a western clade composed of isolates from California and Idaho(bs = 100%) and an eastern clade composed of isolates from Florida, Massachusetts, Okla-homa, and Virginia (bs = 85%) with little support for the branching sequence within eitherclade (Fig. 1).


Fig. 1. Relationships of the D. variabilis geographic isolates using a ∼356 bp mitochondrial 16S rDNA fragment.Strict consensus topology of four equally parsimonious trees of 46 steps (consistency index (CI) = 0.9565;retention index (RI) = 0.9683) resulting from a unweighted branch and bound parsimony analysis. Numbersabove each branch reflect branch lengths, whereas numbers below each branch are the percentage of 500 branchand bound bootstrap iterations that each clade was detected.

PCR amplification of the msp1� gene from nine geographic isolates of A. marginaleresulted in fragments with a variable number of tandem repeats, ranging from two in theVirginia isolate to eight in the Florida isolate (Table 2 and Fig. 2). The msp4 gene was veryconserved among eight geographic isolates of A. marginale with only two substitutions atthe protein level (threonine for serine at position 33 in the St. Maries isolate and a leucinefor isoleucine at position 82 in the Idaho isolate).

The msp4 protein-coding gene sequence was examined for eight geographic isolates ofA. marginale. Sequence alignment resulted in 851 positions of which 10 were variable. Ofthe 10 variable positions, only 6 were potentially phylogenetically informative. We also se-quenced the upstream and variable regions of the msp1� gene from nine geographic isolates

Table 2Number of tandem repeats in the variable region of msp1� in geographic isolates of A. marginale

A. marginale isolatea Number of repeats

Virginia 2Florida 8Okeechobee 5Mississippi 5Oklahoma 3Washington 4Saint Maries 3Idaho 6California 3

a The origin of the isolates is detailed in Table 1.


Fig. 2. Deduced amino acid sequence comparison of msp1� variable region from geographic isolates of A.marginale. The one letter amino acid code was used indicating in red the residues identical in all 9 sequences, inblue those conserved in 5–8 sequences, in black those conserved in 2–4 sequences and in green those present inonly one sequence.


Fig. 3. Relationships of the A. marginale geographic isolates using the msp sequences. Strict consensus topologyof two equally parsimonious trees of 27 steps (consistency index (CI) = 0.7407; retention index (RI) = 0.7742)based on an exhaustive search using all phylogenetically informative characters from the combined msp1� andmsp4 sequence data. Numbers above branches indicate branch lengths, whereas numbers below each branch arethe percentage of 500 branch and bound bootstrap iterations that each clade was detected.

of A. marginale. Alignment of these sequences resulted in 1137 positions of which 261 werein the non-coding leader sequence. Among the 1137 aligned positions, 51 were variablebut only 19 were potentially phylogenetically informative. Of the 19 potentially phyloge-netically informative sites, one site occurred in the leader sequence with the remaining 18occurring in the MSP1a protein-coding region.

With the exception of the A. marginale isolate from Washington, all geographic iso-lates were sequenced for both the msp4 and msp1� gene regions. Due to the low levelsof DNA sequence variability in each gene region, DNA sequences from both gene re-gions were combined into a single phylogenetic analysis of 1988 bp. For the A. marginaleisolate from Washington, the msp4 gene region was coded as missing data for subse-quent phylogenetic analyses. Parsimony analyses of phylogenetically informative siteswere conducted with and without the A. marginale isolate from Washington to deter-mine if the presence of missing data affected our final conclusions. Unweighted parsi-mony analysis of the 25 phylogenetically informative characters (6 from msp4 and 19from msp1�) resulted in two equally parsimonious trees of 27 steps (CI = 0.7407; RI =0.7742). Results of this analysis strongly supported (bs = 87%) a south-eastern cladeof A. marginale, consisting of isolates from Virginia and Florida (Fig. 3). Additionally,strong bootstrap support (85%) was detected for all isolates of A. marginale with theexception of those from St. Maries, Idaho and California (Fig. 3). Removing the Wash-ington isolate of A. marginale from the analysis did not alter the topology shown inFig. 3.

Kishino and Hasegawa (1989), Templeton (1983), and winning-sites (Prager and Wil-son, 1988) tests for identity between the most parsimonious tree from the primarily protein-coding A. marginale data (Fig. 3) and a tree that reflected the western and eastern cladesdepicted by the 16S rDNA data from D. variabilis (Fig. 1) detected no significant differ-ences (P = 0.08, 0.08, 0.018 for Kishino-Haseqawa, Templeton, and winning-sites tests,respectively). Because D. variabilis was not sequenced for an isolate from Washington, for


this analysis, we assumed that this isolate would be aligned with isolates from Californiaand Idaho in the western clade.

4. Discussion

We chose two A. marginale MSPs, msp1� and msp4, and a mitochondrial 16S rDNA genefragment (Caporale et al., 1995; Crosbie et al., 1998) from D. variabilis for phylogeneticanalysis. Mitochondrial genes are known to evolve more rapidly than nuclear genes andare, therefore, good markers to analyze close relationships within species. This fragmentof the tick mitochondrial 16S rDNA has been used before for the phylogenetic analysis ofDermacentor sp. and has been shown to be phylogenetically informative for resolution ofrelationships below the subfamilial level in ticks (Black and Piesman, 1994; Caporale et al.,1995; Rich et al., 1995; Crosbie et al., 1998). MSPs are involved in interactions with bothvertebrate and invertebrate hosts (McGarey et al., 1994; McGarey and Allred, 1994; de laFuente et al., 2001), and, therefore, are also likely to evolve more rapidly than other nucleargenes because they are subjected to selective pressures exerted by host immune systems.msp1� has been found to be a stable genetic marker in isolates of A. marginale within ageographical region, within individual infected animals during acute and chronic phases ofinfection, and before and after tick transmission (de la Fuente, unpublished results). msp4has also been shown to be conserved during the multiplication of the Oklahoma isolate ofA. marginale in the bovine and tick hosts (de la Fuente, unpublished results). We found thatmsp4 and msp1� genes combined provide a valuable tool for investigating the evolutionaryrelationships among the strains of A. marginale. Similar findings have been reported forother Rickettsiae employing outer membrane proteins for phylogenetic analysis (Welleret al., 1998).

An evolutionary tree can be used to examine geographic distribution patterns (biogeog-raphy) and the co-evolution of vector–parasite interactions (Eggleston and Raven, 1994;Weller et al., 1998). Our analysis of A. marginale MSPs strongly supported (bs = 87%;Fig. 3) a south-eastern clade of A. marginale, consisting of isolates from Virginia and Florida.As can be seen from Fig. 3, there is considerable variation between the two isolates fromIdaho. However, because we did not have an outgroup to root this tree, it does not necessarilyreflect the evolutionary relationships of these genes and, therefore, the placement of the twoisolates from Idaho do not appear as sister-taxa primarily due to (a) high levels of sequencedifferences between the two isolates, and (b) we may also be having some long branch at-traction between the Idaho and Mississippi isolates. Within D. variabilis, strong bootstrapsupport was detected for a western clade composed of isolates from California and Idaho(bs = 100%; Fig. 1) and an eastern clade composed of isolates from Florida, Massachusetts,Oklahoma, and Virginia (bs = 85%; Fig. 1). Furthermore, the analysis of these hypothesessupported congruence between the most parsimonious tree from the A. marginale msp data(Fig. 3) and the tree that reflected the western and eastern clades of D. variabilis (Fig. 1).This result suggests a co-evolution (Hafner and Nadler, 1988) between D. variabilis and A.marginale. However, some isolates of A. marginale are not transmissible by D. variabilisticks (Smith et al., 1986), suggesting that these isolates have radiated into other tick speciesor rely on mechanical transmission for survival. In Rickettsiae of the spotted fever group,


Weller et al. (1998) supported the hypothesis that these species were initially associated withRhipicephalus ticks and subsequently radiated into other arthropod hosts multiple times.The analysis of more strains and a better understanding of A. marginale-tick biology arerequired to fully address the evolution of tick–parasite interactions in these species.

Our results have important implications for the control of anaplasmosis in the UnitedStates. Existing vaccine formulations are based on A. marginale initial bodies purifiedfrom infected bovine erythrocytes and are partially effective in restricted geographicalregions. The ability to culture different geographic isolates of A. marginale in continuouscultures of embryonic Ixodes scapularis tick cells (Munderloh et al., 1996; Blouin et al.,1999) offers new possibilities for vaccine development. The inclusion of A. marginalefrom the different clades in our analysis may provide better protection coverage of vaccineformulations derived from cultured A. marginale. Finally, the design of recombinant subunitvaccines must focus on functionally relevant conserved regions within A. marginale antigensto overcome the host responses restricted to particular geographic isolates.

Acknowledgements

This research was supported by Project 1669 of the Oklahoma Agricultural ExperimentStation and the Endowed Chair for Food Animal Research (K.M. Kocan), College of Vet-erinary Medicine, Oklahoma State University. We thank Drs. G. Palmer (Washington StateUniversity, Pullman, WA), D. Ruff (Okeechobee Veterinary Clinic, Okeechobee, Florida)and G. Luther (Louisiana State University, Baton Rouge, LA) for providing the St. Maries,Okeechobee and Mississippi isolates of A. marginale, respectively. We thank D. Stiller(University of Idaho, Moscow, ID), Dr. B. Lane (University of California at Berkley), Dr.D. Sonenshine (Old Dominion University, Norfolk, VA) and Patrick Mueese (Universityof Florida, Gainesville, FL) for providing D. variabilis from Idaho, California, Virginiaand Florida, respectively. Dr. E. Blouin is acknowledged for valuable discussions. Sue AnnHudiburg and Janet J. Rogers (Core Sequencing Facility, Department of Biochemistry andMolecular Biology, Noble Research Center, Oklahoma State University) are acknowledgedfor oligonucleotide synthesis and DNA sequencing, respectively.

References

Allred, D.R., McGuire, T.C., Palmer, G.H., Leib, S.R., Harkins, T.M., McElwain, T.F., Barbet, A.F., 1990.Molecular basis for surface antigen size polymorphisms and conservation of a neutralization-sensitive epitopein Anaplasma marginale. Proc. Natl. Acad. Sci. U.S.A. 87, 3220–3224.

Barbet, A.F., Palmer, G.H., Myler, P.J., McGuire, T.C., 1987. Characterization of an immunoprotective proteincomplex of Anaplasma marginale by cloning and expression of the gene coding for polypeptide AM 105L.Infect. Immun. 55, 2428–2435.

Black IV, W.C., Piesman, J., 1994. A phylogeny of hard and soft tick taxa based on mitochondrial 16S ribosomalDNA sequences. Proc. Natl. Acad. Sci. U.S.A. 91, 10034–10038.

Blouin, E.F., Barbet, A.F., Jooyoung, Yi., Kocan, K.M., Saliki, J.T., 1999. Establishment and characterization ofan Oklahoma isolate of Anaplasma marginale in cultured Ixodes scapularis cells. Vet. Parasitol. 87, 301–313.

Camacho-Nuez, M., de Lourdes Munoz, M., Suarez, C.E., McGuire, T.C., Brown, W.C., Palmer, G.H., 2000.Expression of polymorphic msp1� genes during acute Anaplasma marginale rickettsemia. Infect. Immun. 68,1946–1952.


Caporale, D.A., Rich, S.M., Spielman, A., Telford III., S.R., Kocher, T.D., 1995. Discriminating between Ixodesticks by means of mitochondrial DNA sequences. Mol. Phylogenet. E 4, 361–365.

Crosbie, P.P., Boyce, W.M., Rodwell, T.C., 1998. DNA sequence variation in Dermacentor hunteri and estimatedphylogenies of Dermacentor sp. (Acari: Ixodidae) in the New World. J. Med. Entomol. 35, 277–288.

de la Fuente, J., Garcia-Garcia, J.C., Blouin, E.F., Kocan, K.M., 2001. Differential adhesion of major surfaceproteins 1a and 1b of the Ehrlichial cattle pathogen Anaplasma marginale to bovine erythrocytes and tick cells.Int. J. Parasitol. 31, 145–153.

Dikmans, G., 1950. The transmission of anaplasmosis. Am. J. Vet. Res. 11, 5–16.Eggleston, P.E., Raven, P.H. (Ed.), 1994. Phylogenetics and Ecology. Academic Press, London, UK.Eriks, I.S., Stiller, D., Goff, W.L., Panton, M., Parish, S.M., McElwain, T.F., Palmer, G.H., 1994. Molecular and

biological characterization of a newly isolated Anaplasma marginale strain. J. Vet. Diagn. Invest. 6, 435–441.Ewing, S.A., 1981. Transmission of Anaplasma marginale by arthropods. In: Proceedings of the 7th National

Anaplasmosis Conference, Mississippi State University, MS, USA, pp. 395–423.Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791.Ge, N.K., Kocan, K.M., Blouin, E.F., Murphy, G.L., 1996. Developmental studies of Anaplasma marginale

(Rickettsiales: Anaplasmataceae) in male Dermacentor andersoni (Acari: Ixodidae) infected as adults usingnon-radioactive in situ hybridization. J. Med. Ent. 33, 911–920.

Hafner, M.S., Nadler, S.A., 1988. Phylogenetic trees support the co-evolution of parasites and their hosts. Nature(London) 332, 258–259.

Kishino, H., Hasegawa, M., 1989. Evaluation of the maximum likelihood estimate of the evolutionary treetopologies from DNA sequence data, and the branching order in Hominoidea. J. Mol. Evol. 29, 170–179.

Kocan, K.M., 1986. Development of Anaplasma marginale: coordinated development of a Rickettsial organismsand its tick host. In: Sauer, J.R., Hair, J.A. (Eds.), Morphology, Physiology and Behavioral Ecology of Ticks.Horwood, Chichester, pp. 472–505.

Kocan, K.M., Hair, J.A., Ewing, S.A., Stratton, L.G., 1981. Transmission of Anaplasma marginale theiler byDermacentor andersoni stiles and Dermacentor variabilis (say). Am. J. Vet. Res. 42, 15–18.

Kocan, K.M., Stiller, D., Goff, W.L., Claypool, P.L., Edwards, W., Ewing, S.A., McGuire, T.C., Hair, J.A., Barron,S.J., 1992a. Development of Anaplasma marginale in male Dermacentor andersoni transferred from infectedto susceptible cattle. Am. J. Vet. Res. 53, 499–507.

Kocan, K.M., Goff, W.L., Stiller, D., Claypool, P.L., Edwards, W., Ewing, S.A., Hair, J.A., Barron, S.J., 1992b.Persistence of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in male Dermacentor andersoni (Acari:Ixodidae) transferred successively from infected to susceptible cattle. J. Med. Ent. 29, 657–668.

Kocan, K.M., Blouin, E.F., Barbet, A.F., 2000. Anaplasmosis control: past, present and future. Ann. N.Y. Acad.Sci. 916, 501–509.

Kuttler, K.L., 1984. Anaplasma infections in wild and domestic ruminants: a review. J. Wild. Dis. 20, 12–20.McGarey, D.J., Allred, D.R., 1994. Characterization of hemagglutinating components on the Anaplasma marginale

initial body surface and identification of possible adhesins. Infect. Immun. 62, 4587–4593.McGarey, D.J., Barbet, A.F., Palmer, G.H., McGuire, T.C., Allred, D.R., 1994. Putative adhesins of Anaplasma

marginale: major surface polypeptides 1a and 1b. Infect. Immun. 62, 4594–4601.Munderloh, U.G., Blouin, E.F., Kocan, K.M., Ge, N.L.W.L., Kurtti, T.J., 1996. Establishment of the tick (Acari:

Ixodidae)-borne cattle pathogen Anaplasma marginale (Rickettsiales: Anaplasmataceae) in tick cell culture. J.Med. Ent. 33, 656–664.

Oberle, S.M., Barbet, A.F., 1993. Derivation of the complete msp4 gene sequence of Anaplasma marginale withoutcloning. Gene 136, 291–294.

Oberle, S.M., Palmer, G.H., Barbet, A.F., 1993. Expression and immune recognition of the conserved MSP4 outermembrane protein of Anaplasma marginale. Infect. Immun. 61, 5245–5251.

Palmer, G.H., 1989. Anaplasmosis vaccines. In: Wright, I.G. (Ed.), Veterinary Protozoan and HemoparasiteVaccines. CRC Press, Boca Raton, Florida, pp. 1–29.

Prager, E.M., Wilson, A.C., 1988. Ancient origin of lactalbumin from lysozyme: analysis of DNA and amino acidsequences. J. Mol. Evol. 27, 326–335.

Rich, S.M., Caporale, D.A., Telford III, S.R., Kocher, T.D., Hartl, D.L., Spielman, A., 1995. Distribution of theIxodes ricinus-like ticks of eastern North America. Proc. Natl. Acad. Sci. U.S.A. 92, 6284–6288.

Ristic, M., Watrach, A.M., 1963. Anaplasmosis. Part VI. Studies and a hypothesis concerning the cycle ofdevelopment of the causative agent. Am. J. Vet. Res. 24, 267–276.


Roux, V., Raoult, D., 1995. Phylogenetic analysis of the genus Rickettsia by 16S rDNA sequencing. Res. Microbiol.146, 385–396.

Smith, R.D., Levy, M.G., Kuhlenschmidt, M.S., Adams, J.H., Rzechula, D.L., Hardt, T.A., Kocan, K.M., 1986.Isolate of Anaplasma marginale not transmitted by ticks. Am. J. Vet. Res. 47, 127–129.

Swofford, D.L., 2000. PAUP∗ phylogenetic analysis using parsimony (∗ and other methods) version 4.02b. SinauerAssociates Inc. Publishers, Sunderland, Massachusetts.

Templeton, A.R., 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with particularreference to the humans and apes. Evolution 37, 221–244.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiplesequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.Nucl. Acids Res. 22, 4673–4680.

Viseshakul, N., Kamper, S., Bowie, M.V., Barbet, A.F., 2000. Sequence and expression analysis of a surfaceantigen gene family of the Rickettsia Anaplasma marginale. Gene 253, 45–53.

Walker, D.H., Dumler, J.S., 1996. Emergence of the Ehrlichioses as human health problems. Emerg. Infect. Dis.2, 18–29.

Weller, S.J., Baldridge, G.D., Munderloh, U.G., Noda, H., Simser, J., Kurtti, T.J., 1998. Phylogenetic placement ofRickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J. Clin. Microbiol. 36, 1305–1317.

Wickwire, K.B., Kocan, K.M., Barron, S.J., Ewing, S.A., Smith, R.D., 1987. Infectivity of three Anaplasmamarginale isolates for Dermacentor andersoni. Am. J. Vet. Res. 48, 96–99.

molecular phylogeny and biogeography of north american isolates of anaplasma marginale...

Documents