molecular characterization of non structural protiens of avian influenza virus

Zagazig University

Faculty of Veterinary Medicine

Department of Virology

Molecular characterization of non structural proteins of Avian Influenza

Virus Presented By

Ibrahim Mohamed Thabet Thabet Hagag

B.V.M.Sc. (Zagazig University, 2009)

Diploma of Microbiology (Zagazig University, 2011)

Under Supervision of

Dr. Ahmed Abd El-Samie H. Ali

Professor of Virology and Viral Immunology

Head of Department of Virology


Zagazig University

Dr. Ali Abdel-Rasheed A. Salama

Professor of Microbiology



Zagazig University

Dr. Mohammed El-Bakry A. Ismaeil

Professor of Microbiology



Zagazig University

Dr. Shimaa Mohammed G. Mansour

Assistant Professor of Virology


Faculty of Veterinary Medicine Zagazig University

A Thesis Submitted to

Zagazig University

For the degree of

Master of Veterinary Medical Sciences (Virology)

Department of Virology (2015)

Acknowledgement

First and foremost, I have to thank and give all praises to

Almighty Allah who has blessed me with so many gifts that I

continue to discover.

Thanks to my father; Mohamed Thabet Thabet Hagag and

mother; Madiha Messalm Mansour Hagag for devoting their life for

me in order to get a good education, they never hesitated to support

my education all of their life. Thanks are also continued to all

members of my family, Ahmed, Islam, Osama, Ayman, Asmaa,

Omayma.

I would like to express great gratitude to the main thesis

supervisor; Prof. Dr. Ahmed Abd EL-Samie Hassan Ali, Professor

and Head of Virology Department, Faculty of Veterinary Medicine,

Zagazig University, Egypt, for his supervision, scientific advices, and

helpful discussions and instructions as well.

Thanks are expressed also to Prof. Dr. Ali. Abd Rasheed Ali

Salama, Professor of Microbiology, Faculty of Veterinary Medicine,

Zagazig University, Egypt for his supervision during the first part of

the thesis.

Thanks to Prof. Dr. Mohamed El-Bakry Abdel-Rheim

Ismaeil, Professor of Microbiology, Faculty of Veterinary Medicine,

Zagazig University, Egypt for his continuous advices and helpful

discussions.

Thanks are also continued to Dr. Shimaa Mohammed Galal

Mansour, Assistant Professor of Virology, Faculty of Veterinary

Medicine, Zagazig University, Egypt, for her supervision, scientific

advices, and helpful discussions as well.

Thanks are continued to members of department of Virology

for helpful advices and support.

Many thanks to Prof. Dr. Mohamed Azawy for kindly

providing clinical samples that were used in this study. Thanks for

Mohammed Afifi for helpful statistical analysis.

Thanks are also extended to the Egyptian Ministry of Higher

Education (ParOwn Grant members), Egypt for funding my 6 months

training grant in USA at which most of laboratory experiments were

done.

It is my pleasure also, to thank Prof. Dr. Zheng Xing,

associate professor of Virology and Immunology, Department of

Veterinary Medical Sciences, University of Minnesota, USA for

hosting me in his laboratory during the practical work of my thesis.

He helped me in conceiving the project, performing experiments,

analysis of data, and writing as well.

Special thanks to Jan Shivers, chief of Immunohistochemistry

(IHC) laboratory, Veterinary Diagnostic laboratory, University of

Minnesota, USA for her help in performing cross section

Immunohistochemistry experiments. Thanks also for Dr. Rob Porter

for photographing of slides of IHC.

I would like to express my deepest gratitude and thankful

greetings to PLOS ONE Editorial Team for accepting publishing data

from this thesis under title of “Pathogenicity of Highly Pathogenic

Avian Virus H5N1 in Naturally Infected Poultry in Egypt”.

DEDICATION

To

“MY MOTHER, MY FATHER

ALL MEMEBERS OF MY FAMILY

AND

THOSE WHO I LEARNED FROM

THEM EVERYWHERE”

Contents

iii

CONTENTS

Subject Page

1. Introduction ……………………………… 1

2. Review of literature ……………………… 4

3. Material and methods …..………………. 39

4. Results ………………...………………... 65

5. Discussion ………………………………… 83

6. Summary and Conclusion ……………… 93

7. References …………………..….………… 97

8. Vita ……………………….......................... 125

Arabic summary …………………………… -

Contents

iv

List of Tables

No. Table description Page

1 Clinical data of chicken and duck flocks

suspected to be affected with AIV.

40

2 Sequences of the oligonucleotide primers

and probe used in the study. 46

3 Results of viral isolation, HA, RT-PCR, and

IHC of HPAIV H5N1 from infected chicken

and duck flocks.

79

4 Distribution of viral antigen NP in IHC

stained tissues and cells of HPAIV H5N1

infected chickens.

80

Contents

v

List of Figures

Descript ion Page

Figure 1: Structure of IAV virion showing

encoded viral structural and non structural

proteins.

9

Figure 2: Binding sites of cellular proteins on

the domain of the NS1 protein.

12

Figure 3: Arrangement of the NS1 and nuclear

export protein (NEP) mRNAs of the IAV.

13

Figure 4: Topology diagram (A) and

hypothetical model (B) of the C-terminus

monomer of the NS1 protein.

18

Figure 5 (A-F): Clinical picture of chickens

and ducks suspected to be infected with

HPAIV H5N1.

66

Figure 6 (A-B): Evidence of IAV in

inoculated Embryonated Chicken Eggs

(ECEs).

67

Figure 7 (A-B): Detection of IAV using rapid

HA.

67

Figure 8 (A-B): Identification and subtyping

of IAV using Reverse Transcriptase –

Polymerase Chain Reaction (RT-PCR).

69

Figure 9: Phylogenetic tree on basis of

nucleotide sequences of complete coding

region of NS gene of HPAIV H5N1.

72

Figure 10: Phylogenetic tree of H gene

nucleotide sequences at the cleavage site of

HPAIV H5N1.

73

Contents

vi

Figure 11: Detection of IAV in tissue

specimens and serum samples using real-

time RT-PCR.

76

Figure 12 (A-C): Detection of viral antigen

nucleoprotein (NP) by IHC in trachea,

brain, and lung.

81

Figure 13 (A-F): Detection of nucleoprotein

(NP) viral antigen by IHC in pancreas,

proventriculus, spleen, bursa, liver, and

testis.

82

Contents

vii

LIST OF ABBREVIATIONS

Abbreviation Full Name

AGID Agar Gel Immunodiffusion

AI Avian Influenza

AIV Avian Influenza Virus

ASP92 Aspartate 92

BHK-21 Baby Hamster Kidney-21

bp Base Pair

Cat. Catalogue

cDNA Complementary DNA

CEF Chicken Embryo Fibroblast

CEK Chicken Embryo Kidney

CPSF30 Cleavage and Polyadenylation

Specificity Factor 30

C-terminus Carboxyl Terminus

D92E Mutation of Asparate to Glutamate

dNTP Deoxy-Nucleotide Triphosphate

dsRNA Double-Stranded RNA

ECE Embryonated Chicken Egg

eIF4GI Eukaryotic Initiation Factor 4GI

EMEA European-Middle Eastern-African

GS Glycosylated Carbohydrate

H Hemagglutinin

Contents

viii

H0 Hemagglutinin zero

H1 Hemagglutinin 1

H2 Hemagglutinin 2

HA Hemagglutination Assay

HI Hemaggultination Inhibition

HN Hemagglutinin Neuraminidase

HPAIV Highly Pathogenic Avian Influenza

Virus

HRP Horse Radish Peroxidase

IFN Interferon

IgG Immunoglobulin G

IHC Immunohistochemistry

IL18 Interleukin 18

IL1β Interleukin 1β

IL6 interleukin 6

IN Intranasal

ISH In-situ Hybridization

IT Intratracheal

IV Intravenous

IVPI Intravenous Pathogenicity Index

kD Kilo Dalton

LB Luria-Bertani (Bacterial Media)

LPAIV Low Pathogenic Avian Influenza Virus

M Matrix

M1 Matrix 1

Contents

ix

M2 Matrix 2

MDCK Madin-Darby Canine Kidney

MIP-1α Macrophage Inflammatory Protein-1

alpha

N Neuraminidase

NCBI National Center for Biotechnology

Information

NLS-1 Nuclear Localization Signal-1

NP Nucleoprotein

NS Non structural

NS1 Non Structural Protein 1

NS2/NEP Non Structural Protein 2/ Nuclear

Export Protein

OIE Organization of International

Epizootics

PA Polymerase Acidic

PAB II Poly(A)-Binding Protein II

PB1 Polymerase Basic 1

PB1-F2 Polymerase Basic 1–F2

PB2 Polymerase Basic 2

PBS Phosphate Buffer Saline

PCS Proteolytic Cleavage Site

PKR Protein Kinase RNA-Regulated

Psi Pound per square

RBD Receptor Binding Domain

Contents

x

RNA Ribonucleic Acid

RRT-PCR Reverse Real Time Polymerase Chain

Reaction

RT-PCR Reverse Transcriptase Polymerase

Chain Reaction

RT-qPCR Reverse Transcriptase quantitative

polymerase chain reaction

SA Sialic Acid

SD Standard Deviation

Ser195 Serine 195

TA Thiamine Adenine

Thr197 Threonine 197

Uni-12

UV

Universal 12

Ultra Violet

vRNP

WHO

Viral Ribonucleoprotein

World Health Organization

Contents

xi

List of abbreviations and codes of Amino acids (Rules,

1969)

Three- letter code Single letter code Full Name

Ala A Alanine

Arg R Arginine

Asn N Asparagine

Asp D Aspartic acid

Cys C Cysteine

Gln Q Glutamine

Glu E Glutamic acid

Gly G Glycine

His H Histidine

Ile I Isoleucine

Leu L Leucine

Lys K Lysine

Met M Methionine

Phe F Phenylalanine

Pro P Proline

Ser S Serine

Thr T Threonine

Trp W Tryptophan

Tyr Y Tyrosine

Val V Valine

- X Unknown

INTRODUCTION

Introduction

1

1. INTRODUCTION

Avian Influenza (AI) is contagious endemic and epidemic

viral infection affecting wide variety of avian and mammalian

hosts (Irvine et al., 2007). Influenza A virus (IAV) is negative-

stranded, segmented RNA virus, classified within the genus

Influenza A viruses in the family Orthomyxoviridae (Cox and

Subbarao, 2000). IAV is classified into various subtypes

according to their hemagglutinin and neuraminidase surface

glycoprotiens and highly pathogenic (HP) or low pathogenic

(LP) viruses based on their virulence (Suarez and Schultz-

Cherry, 2000).

The segmented genome of IAV consists of 8 segments

that code 10 or 11 proteins depending on whether the 11th

protein, PB1-F2, is present or not (Chen et al., 2001). These

proteins are divided into three main categories: A) surface

proteins (hemagglutinin; H, neuraminidase; N and matrix 2;

M2), B) internal proteins (polymerase subunits; PB2, PB1, PA,

nucleoprotein; NP, matrix1; M1 and nuclear export protein;

NEP), and C) non-structural proteins (NS1 and PB1-F2)

(Webster et al., 1992; Cheung and Poon, 2008). Novel extra

protein products have been recently identified as PB1-N40, PA-

X, PA-N155, PA-N182, and M3 increasing the number of the

IAVs encoded proteins to 15 or 16 (Muramoto et al., 2013).

The non structural protein (NS1), considered a virulence

factor, is thought to play an important role in viral replication

and pathogenicity during infection by antagonizing the host

Introduction

2

interferon defense mechanism (Garcia-Sastre et al., 1998;

Bergmann et al., 2000). It has been previously reported that

mutations or deletions within the NS1 protein significantly

hampered replication of influenza viruses, both in vitro and in

vivo due to an increased interferon (IFN) response and rapid

elimination of the virus (Dankar et al., 2011; Petersen et al.,

2013).

The HPAI H5N1 viruses produce systemic infections,

morbidity and mortality as high as 100% (Spickler et al., 2008;

Swayne, 2007), cause severe agricultural and economic

burden, and pose a serious public health threat. They were

transmitted to Africa with reported outbreaks in Nigeria,

Egypt, Cameroon, and other African countries in 2006

(Enserink, 2006; Aly et al., 2008). Since then, they become

endemic only in Egypt, spreading from farms to farms,

causing several economic losses to poultry industry, and

infecting human, even under H5 vaccine induced immune

pressure, that potentially lead to continuous viral evolution

and mutations (Abdelwhab et al., 2010).

Strikingly, it has been recently reported that the Egyptian

HPAIV H5N1 viruses possess the greatest pandemic risk due to

their unique genomic fingerprints including the mutations at

H154-156, where a glycosylation site is missing, and PB2627K

(Neumann et al., 2012). Accordingly, providing more information

about the Egyptian HPAIV H5N1 recent outbreaks with

supplementary genetic, antigenic, and pathogencity data is of great

global interest, which is the main objective of this study.

Introduction

3

The objectives of this study are:

1. Isolation, identification, and subtyping of IAV caused

outbreaks in commercial chickens and backyard ducks,

Sharkia, Egypt, 2013.

2. Sequencing of Non Structural (NS) and Hemagglutinin (H)

genes to characterize molecular pathogenicity determinants

of HPAI H5N1 viruses.

3. Investigation of distribution and spread of the HPAI H5N1

viruses in different tissues of naturally infected chickens and

ducks by RT-qPCR and Immunohistochemistry (IHC).

.

REVIEW OF LITERATURE

Review of Literature

4

2. REVIEW OF LITERATURE

2.1. Avian Influenza Virus (AIV) infection: nature

and economic importance:

Avian influenza viruses can infect and causes in a large

variety of birds and mammals worldwide (Alexander, 2000).

Infections in birds can give rise to a wide variety of clinical signs

that may vary according to the host, strain of virus, the host's

immune status, ranging from respiratory manifestation and high

mortalities as high as 100% (Spickler et al., 2008; Swayne,

2007). The on-going epidemic of highly pathogenic avian

influenza (HPAI) H5N1 virus infections in poultry continues to

cause severe economic problems and threatens human health

worldwide, particularly where the infections became endemic

(Capua and Alexander, 2006; Peiris et al., 2007).

2.2. History of AIV:

AIV was firstly reported as fowl plaque or fowl pest in

1878 in Italy (Perroncito, 1878). In 1901, Centainii and

Savunozzi determined that the cause was a filterable agent. By

then it was already shown that human influenza viruses,

identified as a virus in 1933, (Smith et al., 1933). It was

recorded that avian and human influenza virus counterparts

many biological properties including the ability to grow in chick

embryos and agglutinate red blood cells (Hirst, 1941). Low

pathogenic avian influenza virus LPAI or midly pathogenic

avian influenza was reported in the middle of the 20th century


5

and the oldest outbreak was winter strain of Germany isolates

in chicken in 1949 (H10N7). It was demonstrated that fowl

plague was an avian influenza virus whose genomic composition

was virtually identical to the one found in the human influenza

virus (Schafer, 1955).

The first report of HPAIV outbreak caused by H5N1 was

occurred in Scotlandin 1959. Alexander listed five substantiated

outbreaks since 1975; this occurred in many areas in the world as

USA, Australia, England and others (Alexander and Gough,

1986). By the early part of the 20th century, the disease was

reported in other areas all over the world including Egypt. The

terminology “highly pathogenic avian influenza” was officially

adopted in 1981 at the First International Symposium on Avian

Influenza to designate the highly virulent forms of avian

influenza. The Office International des Epizooties (OIE) that

codifies sanitary and health standards, has included HPAIV as a

List A reportable disease. HPAIV has been recognized for more

than 100 years it was endemic in the first third of the 20th century

in some European countries, USA and occurred regular in others,

further more the involved isolates were classified as H7N1 and

H7N7, HPAIV outbreaks have been reported about 26 times

since 1955 till 2004 (Capua and Alexander, 2004).

Since end of 2003, simultaneous HPAIV outbreaks were

recorded in domestic and wild birds in at least 48 countries in the

Middle East, Africa and European countries in addition to East

Asia. On January 2006, an outbreak of Highly Pathogenic Avian

Influenza Virus (HPAIV) was recorded in Nigeria for the first

time (Fasina et al., 2009).

http://www.oie.int/eng/en_index.htm

http://www.oie.int/eng/en_index.htm


6

In 2006 the AIV was reported in ten African countries

including Egypt, Toga, Sudan, Benin, Niger, Nigeria, Ghana,

Cot d’Ivoir, Djibouti, Caeroon (OIE, 2008). Even without these

H5N1 outbreaks, the period 1995 to 2008 will be considered

significant in the history of HPAIV because of the vast numbers

of birds that died or were culled in three of the other ten

epizootics during this time (Belshe, 2005 and Alexander, 2008).

Egypt was the second African country, after Nigeria, to

declare infection of poultry with HPAIV H5N1 on 16 February

2006 (Aly et al., 2008). More than 30 million birds were culled

in the first wave of the outbreak in 2006 (Meleigy, 2007; Aly et

al., 2008) and 52 human fatalities out of 150 infected persons

have been reported until 6, July 2011 (WHO, 2011).

Full hemagglutinin gene sequencing was performed and

the data revealed that all Egyptian strains were very closely

related and belonging to subclade 2.2 of the H5N1 virus of

Eurasian origin, the same one circulating in the Middle East

region and introduced into Africa at the beginning of 2006 (Aly

et al., 2008). Re-emerging of H5N1 severe outbreaks in

vaccinated chickens at Sharkia Province in Egypt was observed

in October 2007 (Hussein et al., 2009). Despite intense attempts

to eradicate the virus, endemic status is reported in Egypt.

Continuous viral circulation is likely increases risks of sporadic

human infections.

In 2008, the Egyptian Government declared that H5N1

has become endemic in Egypt (Taha et al., 2010). Since that

time, active, passive and targeted surveillances were established

to elucidate the spread of H5N1 usually in poultry sectors and


7

rarely in other feral birds or farm animals. More information on

surveillance, diagnosis and control activities mobilized to

confront H5N1 virus in Egypt and the major challenges

hampering the containment of the disease has been reviewed in

details by (Abdelwhab and Hafez, 2011). Recently, it was

recorded that the rate of HPAIV H5N1 in commercial poultry

was significantly lower than that in backyards and live bird

markets (El-Zoghby et al., 2013).

Two subclades of H5N1 are circulating in Egypt (Arafa

et al., 2010): ‘‘Classic’’ 2.2.1 strains are present mainly in

backyard birds and have caused the majority of human cases

(Abdelwhab et al., 2010). ‘‘Variant’’ 2.2.1 strains circulated

mainly in vaccinated commercial farms since late 2007 (Arafa

et al., 2010; Hafez et al., 2010). Viruses of this lineage represent

antigenic drift variants and limit the efficiency of the currently

used vaccines (Grund et al., 2011).

Vaccination of backyard birds using inactivated H5

vaccines was provided by the government free of charge while

the commercial sector adopted their pertained vaccination

practices with widely varying standards (Hafez et al., 2010).

However, vaccination coverage was 1-50% and increase risk of

human infection due to silent circulation of the virus in

vaccinated backyard incited the government to cesses

vaccination of birds in the backyard sector (Peyre et al., 2009;

Abdelwhab and Hafez, 2011). On the contrary, several types of

inactivated vaccines based on H5N1 and H5N2 strains are

supplied by a number of vaccine manufacturers and are


8

permanently applied in the commercial sector (Abdelwhab et

al., 2009).

2.3. Taxonomy and classification of AIV:

Influenza virus A is a member of the Family

Orthomyxoviridae, this family composed of five genera,

influenza virus A, B and C viruses, Thogoto viruses and Isa

viruses. Type designation A, B and C is based on the antigenic

character of the matrix protein located in the virus envelope and

the nucleoprotein within the virus particle. The name influenza

comes from the Italian: influenza, meaning "influence",

(Latin: influentia) (Eccles, 2005).

2.4. Structure and morphology of AIV:

Influenza A viruses are enveloped, small (80 to 120 nm in

diameter), pleomorphic particles. The virions are typically spherical

to pleomorphic but can be filamentous virions (20 nm in diameter

and 200 to 300 nm long). Its genome consists of 8 segments of

linear, negative sense, single-stranded RNA that encodes 10th or

11th proteins (Fig. 1) depending on whether the 11th protein, PB1-

F2, is present or not (Chen et al., 2001). These proteins are

divided into three main categories: A) surface proteins

(hemagglutinin; H, neuraminidase; N and matrix 2; M2), B)

internal proteins (polymerase subunits; PB2, PB1, PA,

nucleoprotein; NP, matrix1; M1 and nuclear export protein;

NEP) and C) non-structural proteins (NS1 and PB1-F2)

(Webster et al., 1992; Cheung and Poon, 2008). Novel extra

protein products have been recently identified as PB1-N40, PA-


9

X, PA-N155, PA-N182, and M3 increasing the number of IAV

encoded proteins to 15 or 16 (Muramoto et al., 2013).

Figure 1: Structure of Influenza A virus showing encoded

viral structural and non structural proteins.

Hemagglutinin (H) surface protein:

Hemagglutinin (H) is one of surface proteins that is

responsible for attachment and fusion of the virus with the host

cell receptors. The H is synthesized as a precursor polypeptide,

H0 then cleaved by ubiquitous proteolytic enzymes into H1 and

H2 (Steinhauer, 1999). The H monomer consists of a globular

head region mainly of H1 connected to a fibrous stalk domain

formed by the two polypeptide segments of H1 and H2. Several

structures are present on the H1 protein namely receptor binding

domain (RBD), proteolytic cleavage site (PCS), N-Linked

https://web.csblab.or.kr/116

0


10

glycosylated carbohydrate (GS), antigenic sites and

immunogenic epitopes (Chen et al., 1998; Brown, 2000), while

the transmembrane domain and fusion peptide are associated

with the H2 protein (Armstrong et al., 2000).

The proximity of the globular head region harbors the

receptor-binding pocket of the virus which usually binds to α2-3

linkage sialosides abundant in the intestinal tract of birds in case

of avian influenza viruses (AIV) while human-adapted viruses

are specific for the α2-6 linkage mainly in the respiratory tract

(Parrish and Kawaoka, 2005). A switch from the α2-3 linkage

to the α2-6 linkage receptor specificity is a prerequisite for

emergence of avian viruses with pandemic potential (Stevens et

al., 2006). All influenza A viruses have PCS of an arginine (R)

residue adjacent to a conserved glycine (G) amino acid, the later

becomes the N-terminus of H2 protein (Garten and Klenk,

1983). Avian influenza of low pathogencity phenotypes has

monobasic amino acid, arginine or lysine (K) residues, in the

cleavage site while the existence of multibasic amino acids with

an R-X-K/R-R motif is a feature of high pathogenic subtypes

(Klenk and Garten, 1994).

Two different classes of proteases are responsible for

cleavage-activation of influenza viruses, and the distribution of

these proteases in the host appears to be the prime determinant of

tropism and pathogenicity (Klenk and Garten, 1994;

Steinhauer, 1999). The proteases that cleave non pathogenic

viruses are encountered in a limited number of cell or tissue

types, so these viruses normally cause localized infections in, for


11

example, the respiratory tract of mammals or the intestinal tract

of wild birds.

On the contrary, proteases that activate pathogenic

influenza viruses are ubiquitously expressed, allowing for the

systemic spread of the virus in infected hosts (Munch et al.,

2001). Five immunogenic epitopes (denoted A – E) of recent

H5N1 hemagglutinin were mapped (Kaverin et al., 2007;

Duvvuri et al., 2009). The repertoire of immunocompetent

antibody-producing cells is directed almost against the upper

surface of the H5 H molecule (Kaverin et al., 2007). Therefore,

most of the positively selected sites were found to be within or

adjacent to the immunogenic epitopes with a higher evolution

rate which could help the virus to circumvent the host immune

response (Lee et al., 2004; Duvvuri et al., 2009).

Non structural protein 1 (NS1):

The NS1 protein is a multifunctional protein that

participates in both protein-protein and protein-RNA

interactions. It binds non-specifically to double-stranded RNA

(dsRNA) and to specific protein targets. Multifunctional proteins

usually show a modular organization, with different domains

responsible for different functions. Two important domains have

been described in this 26 kDa NS1 protein accomplishing its

multiple functions (Fig. 2). The N-terminal structural domain

(RNA-binding domain, RBD), which protects the virus against

the antiviral state induced by IFN-α/β, primarily by blocking the

activation of the 2'-5'-oligo(A) synthetase/ RNase L pathway;

and the C-terminal structural domain (effector domain), which

inhibits the maturation and exportation of the host cellular


12

antiviral mRNAs by binding cleavage and polyadenylation

specificity factor (CPSF) and inhibiting poly(A)-binding protein

(PAB II) function. The effector domain is crucial for the function

of the RBD (Krug et al., 2003; Wang et al., 2002).

The influenza A virus RNA segment 8, which contains

890 nucleotides, directs the synthesis of two mRNAs in infected

cells. One is colinear with the viral RNA segment and encodes

for NS1 protein of 230 amino acids; the other is derived by

alternative splicing from the NS1 mRNA and translated into

nuclear export protein (NEP) of 121 amino acids. (Bullido et al.,

2001) (Figs. 2 and 3).

Figure 2: Binding sites of cellular proteins on the domains of

the NS1 protein (Dongzi LIN et al. 2007).


13

Figure 3: Arrangement of the NS1 and nuclear export

protein (NEP) mRNAs of the influenza A virus (Dongzi LIN

et al. 2007).

Structure and function of N-terminus of the NS1 Protein:

The dsRNA-binding domain of the NS1 protein is located

at its N-terminal end. An N terminal structural domain, which

comprises the first 73 amino acids of the intact protein NS1

(1−73), possesses all of the dsRNA binding activities of the full-

length protein (Qian et al., 1995). The function of the dsRNA-

binding activity of the NS1 protein during influenza A virus

infection has not been elucidated yet. Some of the previously

held theories have been disproved by new findings. In the early

studies, NS1 protein inhibited the activation of protein kinase

RNA-regulated (PKR) by sequestering dsRNA through the

dsRNA binding domain of the NS1 protein (Bergmann et al.,

2000; Lu et al., 1995; Hatada et al., 1999).


14

However, it was reported recently that the inhibition was

realized by the direct binding of NS1 protein and the N-terminal

230 amino acid region of PKR, for which the dsRNA-binding

domain is not responsible (Li et al., 2006). In another aspect,

previous studies reported that high levels of IFN-α/β and its

mRNA were produced in cells infected with a recombinant

influenza A/Wisconsin/33 (A/WSN/33) virus expressing an NS1

protein with a mutated RNA-binding domain (Donelan et al.,

2003; Wang et al., 2000).

However, a new study has shown that this mutant WSN

NS1 protein is located in the cytoplasm, rather than the nucleus

of infected cells and the phenotype of this mutant WSN virus is

due to the mislocalization of the mutant NS1A protein rather

than to the loss of NS1 dsRNA-binding activity. Mutant NS1

protein expressed by recombinant A/Udorn/72 virus could

localize in the nucleus of the infected cells for the second nuclear

localization signal. The experiment using this recombinant A/

Udorn/72 virus revealed that the RNA-binding activity of the

NS1A protein does not have a role in inhibiting the influenza A

virus-induced synthesis of IFN-β mRNA, but is required for the

protection of influenza A virus against the antiviral state induced

by IFN-β. This protection primarily involves inhibiting the IFN-

α/β-induced 2'-5'-oligo(A) synthetase/RNase L pathway (Min et

al., 2006).

Besides type I IFN, the NS1 protein is also involved in the

inhibition of other pro-inflammatory cytokines, such as tumor

necrosis factor-α, interleukin 6 (IL6), macrophage inflammatory

protein-1 alpha (MIP-1α), IL1β and IL18. NS1 protein regulates


15

the production of pro-inflammatory cytokines in infected

macrophages through the function of both N and C-terminal

domains. Moreover, the N-terminal part of the NS1 protein

appeared to be crucial for the inhibition of IL1βand IL18

production, whereas the C-terminal part was important for the

regulation of IFN-β, tumor necrosis factor-α, IL6 and MIP-1α

production in influenza A virus-infected human macrophages

(Stasakova et al., 2005).

The dsRNA binding domain of the NS1 protein can also

bind to the 5'untranslated region of viral mRNAs and poly(A)

binding protein 1 (PABP1). The eukaryotic initiation factor 4GI

(eIF4GI) binding domain is located in the middle of the NS1A

protein, a region close to PABP1 interacting domain.

Accordingly, it is reasonable to infer that the NS1 interactions

with eIF4GI and PABP1, as well as with viral mRNAs, could

promote the specific recruitment of the viral mRNA translation

initiation complexes, thus enhancing the translation of the viral

mRNA (Burgui et al., 2003).

Structure and function of C-terminus of the NS1 Protein:

The C-terminus of the NS1 protein mainly contains three

functional domains: eIF4GI, the 30 kDa subunit of CPSF

(CPSF30), and the PAB II binding domain. The biophysical

study (Bornholdt et al., 2006) on the NS1 effector domain

showed that each monomer consists of seven β-strands and three

α-helixes. Six of the β-strands form an antiparallel twisted β-

sheet, but not the last one (Fig. 4). Six of the β-strands surround

a central long α-helix, which is held in place through an

extensive network of hydrophobic interactions between the


16

twisted β-sheet and the α-helix. The CPSF30 binding domain is

at the base of the largest α-helix. Asp92, whose mutation to

glutamate is linked to increased virulence and cytokine

resistance in certain H5N1 strains, is located in the bottom of a

structurally dynamic cleft and is involved in strong hydrogen-

bonding interactions with Ser195 and Thr197, shown in (Figure

4).As described previously, there are binding sites for eIF4GI,

CPSF30 and PAB II in the C-terminus of the NS1 protein, and

the interaction between eIF4GI and NS1 protein is associated

with enhancement of the translation of the viral mRNA. It is also

mentioned that the dsRNA binding activity of the NS1 protein is

not related to the inhibition of the synthesis of IFN-β mRNA.

Nevertheless, the level of the IFN-β does decrease in virus-

infected cells. Why? It has already been identified that NS1

protein binds and inhibits the function of two cellular proteins

that are essential for the 3'-end processing of cellular pre-

mRNAs, CPSF30 and PAB II by way of its effector domain,

thereby inhibiting the production of mature cellular mRNAs,

including IFN-β mRNA (Noah et al., 2003).

The binding to CPSF30 and the resulting inhibition of 3'-

end processing of cellular premRNAs is mediated by amino acid

144 of the NS1 protein, as well as by amino acids 184 to 188

(the 186 region). These two regions interact with the CPSF30.

Amino acids 215 to 237 of the NS1 protein have been identified

as the binding site for PABII. Binding of NS1 and PABII, which

facilitates the elongation of oligo(A) tails during the generation

of the 3' poly(A) ends of mRNAs, prevents PAB II from

properly extending the poly-A tail of pre-mRNA within the host


17

cell nucleus, and blocks these pre-mRNAs exporting from the

nucleus (Chen et al., 1999). It was also reported that another

role of the C-terminal of the NS1 protein in vivo is to stabilize

and/or facilitate formation of NS1 dimers and therefore, to

promote the RNA binding function of the NS1 N-terminal

domain (Wang et al., 2002).

The cytokine resistance conferred by the D92E mutation

might be due to the increased affinity for dsRNA with this

mutation (Li et al., 2004). Because of the proximity of Asp92 to

the dimeric interface, this mutation might alter the stability or

orientation of the RBD to affect its dsRNA binding affinity.

However, the mutation D92E might lower the efficiency of NS1

phosphorylation. It is known that NS1 phosphorylation is

required for the induction of apoptosis that allows viral

ribonucleoprotein (vRNP) exporting from the nucleus. This

mutation results in a virulent phenotype by prolonging the viral

life cycle (Bornholdt et al., 2006).

The deletion of residues 80−84 found in recent H5N1

strains could increase cytokine resistance by altering either the

orientation or the stability of the RBD, or both, as these residues

are parts of a flexible linker between the RBD and the effector

domain (Bornholdt et al., 2006).


18

Figure 4: Topology diagram (A) and hypothetical model (B) of

the C-terminus monomer of the NS1 protein. The cleavage and

polyadenylation specificity factor binding site is shown in

orange, purple shows the nuclear export signal, and yellow

indicates Asp92, Ser195 and Thr197. The β-strands (blue) are

numbered 1−7, and the α-helices (red) are marked a, b and c. The

N-terminus and C-terminus are also shown. (Reproduced from

Bornholdt and Prasad) (Bornholdt et al., 2006).

Prospects of NS1 proteins:

The NS1 protein has various functions during IAV

infection through both its RNA-binding domain and effector

domain, such as protecting influenza A virus against the antiviral

state, inhibiting several kinds of pro-inflammatory cytokines,

and blocking the maturation and exportation of the host cellular


19

antiviral mRNAs. The crystal structures of the NS1 RNA

binding domain and effector domain indicate that NS1 protein

functions as a dimer. In this dimer, the NS1 RNA binding

domain and effector domain form a six-helical chain fold and an

α-helix β-crescent fold, respectively, which is unique. Together

with the hereditary conservation, the NS1 protein is regarded as

an appealing specific target against influenza A virus. At present,

the vaccines and antiviral drugs used to aim directly at the

haemagglutinin (HA) and neuraminidase (NA) of influenza A

virus have rendered prevention and treatment less predictably

effective because of the viral antigenic mutation. Based on the

above-mentioned data, it is feasible to develop live attenuated

viral vaccines using the NS1-mutational viruses (Falcon et al.,

2005), and design effective antiviral drugs to directly target some

of the functional sites, such as the CPSF30 binding site (Twu et

al., 2006). It is also possible to explore the assisting function in

tumor therapy using the recombinant virus expressing truncated

NS1 protein (Efferson et al., 2006).

2.5. Physical and chemical properties of AIV:

Family Orthomyxoviridae possesses enveloped viruses

that are sensitive to acid pH values, although their retention of

infectivity is dependent on the degree of acidity that is obtained

and the virus strain (Puri et al., 1990). Furthermore, they can be

inactivated through ionizing radiation and UV rays that have a

potential application in the laboratory for sterilizing tools and for

biological reagent manufacturing. The primary target by which

radiation brings about virus inactivation is viral RNA rather than


20

viral proteins and the radiation dose necessary for inactivation

tends to be correlated to the genome size (House et al., 1990).

Influenza A viruses are sensitive to temperature. Recent

studies on the effect of microwave and autoclave treatments on

Influenza A viruses demonstrated that for a human influenza A

virus, A/New Caledonia E 4020 (H1N1), from an initial titre of

105 EID50/ml on swabs, no virus could be detected after

microwave treatment for 5 s, and autoclave treatment for 20 min

was sufficient to inactivate the virus (Elhafi et al., 2004). The

effect of heat treatment on HPAIV (A/chicken/Korea/ES/2003,

H5N1 subtype) in chicken meat has also been investigated

(Swayne, 2006). Thigh and breast chicken meat, from

experimentally infected birds, was examined for virus infectivity

after exposure at 30, 40, 50, 60 and 70° C and after treatment at

70 °C for 1, 5, 10, 30 and 60 s, using the heating block of a

thermocycler as the inactivation method. The initial titres of

infected thigh and breast meat with the H5N1 strain were 106.8

and 105.6 EID50/g, respectively. After exposure at 30, 40 and 50°

C, the titre in both types of meat sample remained unchanged.

Complete inactivation was only reached after exposure at 70° C

(1 s) and at 70° C for 5 s in the breast and thigh meat,

respectively (Swayne, 2006).

On the basis of their resistance to chemical agents, viruses

can be divided into three categories (A, B, C) according to the

classification proposed by Noll and Youngner (1959). This

classification is based on the presence/ absence of lipids on the

virus and on the virus size, which appear to be the characteristics


21

that most influence resistance to chemical agents. Avian

influenza viruses belong to category A, which includes all

enveloped viruses of intermediate to large size. Many authors

have reached the same conclusion regarding the susceptibility of

viruses to chemical agents, i.e. the presence of lipids is

associated with a high susceptibility to all disinfectants (Maris,

1990).

2.6. Antigenic and genetic properties of AIV:

Influenza A viruses are classified into subtypes based on

HA and NA. Previously, Influenza A viruses are classified into

various subtypes; sixteen subtypes of H gene and nine subtypes

N gene have been identified (Fouchier et al., 2005; Alexander,

2007). After the recent discovery of a new virus genome subtype

identified from bat, H17N10 (Tong et al., 2012), there are

currently 17 H subtypes (H1 to H17) and 10 N subtypes (N1 to

N10) known. More recently, there are 18 H (H1 - H18) and 11 N

(N1 – N11) subtypes, the newly extra subtypes were isolated

from bats (Tong et al., 2013).

All subtypes of influenza A virus are prevalent in wild

and domesticated birds (Webster et al., 1992). Three H subtypes

(H1, H2 and H3) and two N subtypes (N1 and N2) are usually

infecting humans. However, and recently, human infections by

the previously avian-restricted subtypes H5, H7 and H9 have

been frequently reported (Perdue and Swayne, 2005). Likewise,

swine and horses are infected with a much narrower range of

AIV subtypes (Alexander, 2000).


22

Avian influenza viruses are classified according to the

pathogenicity for poultry into two main categories; low

pathogenic strains (LPAIV) result in mild or asymptomatic

infections and HPAIV causing up to 100% morbidity and

mortality (Swayne, 2009). To date, only H5 or H7 subtypes

fulfilled the defined criteria of high pathogenicity. Meanwhile,

the existence of H5 and H7 viruses of low pathogenicity were

also documented and these strains can potentially evolve into

high path subtypes (Garcia et al., 1996; Halvorson, 2002).

All H5 and H7 viruses have been listed as a “notifiable

disease” by the OIE which mandates all member countries to

report the OIE within 24 hours of confirming AIV infections

(Pearson, 2003). Therefore, the OIE defined the HPAIV as: (1)

viruses cause 75% mortality of 8 susceptible 4- to 8-week-old

chickens within a 10 days observation period or (2) viruses have

an intravenous pathogenicity index (IVPI) of greater than 1.2

upon inoculation of 10 susceptible 4- to 8-week-old chickens or

(3) H5 or H7 AIV with PCS amino acid sequence similar to any

of those that have been previously observed in HPAI viruses.

Moreover, nonpathogenic H5 and H7 in chickens that do not

posses PCS similar to any of those that have been observed in

HPAI viruses are designated as notifiable LPAI viruses while

other non-H5 or non-H7 AIV that are not virulent for chickens

are identified as LPAI viruses (OIE, 2009).

In the European Union (EU), the Council directive

2005/94/EC defined HPAIV infection in poultry or other captive

birds as: (1) infection with any influenza A virus of the subtypes


23

H5 or H7; or with any influenza having an IVPI >1.2 in 6-week

old chickens and/or (2) infection with H5 or H7 AIV subtypes that

have multiple basic amino acids at the PCS (cleavage site) of the

HA similar to that observed for HPAI viruses. AIV of subtypes

that do not comply with the previously mentioned criteria were

defined as LPAIV (EC, 2005).

Constant genetic and antigenic variation of AIV is an

intriguing feature for continuous evolution of the virus in nature

(Brown, 2000). Gradual antigenic variation via incremental

acquisition of point mutations is defined as “antigenic drift”

which is commonly regarded as the driving mechanism for

influenza virus epidemics from one year to another. However,

possible “antigenic shift” of influenza virus occurs by exchange

genes from different subtypes of influenza “reassortment”

leading to a complete alteration in the antigenic structure and

emergence of new viruses with novel gene constellations

(Brown, 2000). This unpredictable process is relatively

infrequent, however it results in severe pandemics since the

human population has no prior immunity to these de-novo

surface proteins (Ferguson et al., 2003).

The H5N1 H gene has evolved into ten phylogenetically

distinct clades (designated as clade 0 – 9) (WHO/OIE/FAO,

2009). Two major phylogenetic clades are wide-spread: Clade 1

viruses in Cambodia, Thailand, and Vietnam and clade 2 viruses

spread from China and Indonesia to the Europe, Middle East and

Africa. To date, six distinct subclades of clade 2 have been

identified (WHO/OIE/FAO, 2009).


24

In a previous study, genome analysis of viruses collected

from Europe, Northern Africa and the Middle East from late

2005 to 2006 in addition to Asian H5N1 revealed emergence of a

new European-Middle Eastern-African (EMA) lineage which

further was diversified into 3 distinct independently evolving

clades, designated as EMA clade 1, EMA clade 2 and EMA

clade 3. The early Egyptian strains in 2006 clustered within

EMA clade 1 (Salzberg et al., 2007). In another study, African

strains were classified into 3 sublineages denominated A – C,

where the early Egyptian strains clustered within the sublineage

B along with isolates from Southwest Nigeria and Djibouti

(Ducatez et al., 2007).

Later on, H5N1 viruses isolated from Egypt, Israel, the

Gaza Strip, Nigeria, and Europe in 2006 and 2007 were

classified as clade 2.2.1, within this clade the Egyptian viruses

further diversified to several subclades or groups

(WHO/OIE/FAO, 2009). The most recent WHO classification

allocated the Egyptian strains from human and backyard origin

within the 2.2.1/C group, meanwhile viruses from vaccinated

chickens belong to the 2.2.1/F group (WHO, 2011a).

2.8. Pathogenesis of AIV:

The mechanisms by which virulent strains of AI cause

disease and death of their hosts is not clear. Particularly, the

specific cells involved in viral replication and the mechanisms

by which these viruses injure these cells have not been defined

(Van-Campen et al., 1989).


25

AIV is normally transmitted by direct contact between

infected and susceptible birds or indirect contact through aerosol

droplets or exposure to virus contaminated fomites (Easterday

et al., 1997). The H protein of avian influenza viruses initiate

infection by binding sialic acid (SA)-containing glycoproteins on

cells (Rogers and Paulson, 1983). Hemagglutinin cleavability is

dependent on its primary structure at the site where cleavage

occurs and the presence of the right proteases in target tissues

that can carry out that cleavage. In epithelial cells lining the

respiratory and intestinal tracts, the hemagglutinin of all

incoming avian influenza viruses is cleaved by host proteases,

thereby activating its fusion activity and allowing its entry;

however, in other tissues, only the hemagglutinin of virulent

viruses is cleaved, leading to systemic disease and death. This

phenomenon accounts not only for viral strain differences but

also for the susceptibility or resistance of different avian species

(Murphy et al., 1999).

The cleavage of the H precursor molecule H0 is required

to activate virus infectivity, and the distribution of activating

proteases in the host is one of the determinants of tropism and, as

such, pathogenicity. The H proteins of mammalian and

nonpathogenic avian viruses are cleaved extracellularly, which

limits their spread in hosts to tissues where the appropriate

proteases are encountered. On the other hand, the H proteins of

pathogenic viruses are cleaved intracellularly by ubiquitously

occurring proteases and therefore have the capacity to infect


26

various cell types and cause systemic infections (Steinhauer,

1999).

Influenza virus enters its host cell by endocytosis. The

low pH inside the endosome triggers conformational changes in

the major viral membrane protein, hemagglutinin, leading to

fusion of the viral with the endosomal membrane (Günther-

Ausborn et al., 2000). M2 protein plays a key role in the

triggering process because it is an integral membrane protein that

allows H+ ions to enter into the virion, which causes a

conformational change of the H at the lower pH to allow the

fusion domain to become active (Pinto and Lamb, 2007). The

viral nucleocapsids are transported to the nucleus where viral

transcriptase complex synthesizes mRNA. Transcription is

initiated with 10--13 nucleotide RNA fragments generated from

host heterogenous nuclear RNA via viral endonuclease activity

of PB2. Six monocistronic mRNAs are produced in the nucleus

and transported to the cytoplasm for translation into H, N, NP,

PB1, PB2, and PA proteins. The mRNA of NS and M gene

segments undergo splicing with each producing two mRNAs

which are translated into NS1, NS2, MI. and M2 proteins. The H

and N proteins are glycosylated in the rough endoplasmic

reticulum, trimmed in the Golgi and transported to the surface

where they are embedded in the plasma membrane. The eight

viral gene segments along with internal viral proteins (NP, PBI,

PB2, PA and M2) assemble and migrate to areas of the plasma

membrane containing the integrated H, N, and M2 proteins. The

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Steinhauer%20DA%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Steinhauer%20DA%22%5BAuthor%5D


27

M1 protein promotes close association with the plasma

membrane and budding of the virions (Saif et al., 2008).

HPAIV H5N1 isolate caused systemic infections in

chickens and quail and killed all of the birds within 2 and 4 days

of intranasal inoculation, respectively. This isolate also

replicated in multiple organs and tissues of ducks and caused

some mortality. However, lower virus titers were observed in all

corresponding tissues of ducks than in chicken and quail tissues,

and the histological lesions were restricted to the respiratory tract

(Lee et al., 2005). HPAI viruses, including HPAIV H5N1, cause

severe systemic disease in galliform species as well as in

anseriform species and bird species of other orders (Kuiken et

al., 2010).

Following IV inoculation of AI virus leads to

demonstration of intranuclear and intracytoplasmic influenza

nucleoprotein in kidney tubule epithelium verifies the kidney as

a primary site of influenza virus replication and confirms the

nephropathogenicity of influenza virus. Furthermore, the

presence of diffuse, severe renal tubule necrosis in chickens that

died suggests acute renal failure, with associated blood

electrolyte and nitrogenous waste abnormalities as the cause of

death (Swayne and Slemons, 1994).

In contrast to systemic infection following IV inoculation,

IT and IN inoculation of influenza viruses resulted in influenza

virus replication and lesions in only the local area of exposure,

i.e., the respiratory tract. The absence of mortality, the lack of

kidney lesions, and the failure to isolate influenza virus from

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Kuiken%20T%22%5BAuthor%5D



28

kidney tissue (Slemons and Swayne 1990) following IN and IT

inoculation suggested that under defined experimental conditions

an innate barrier exists in the respiratory and immune systems

that prevents low-virulence avian-origin influenza viruses from

entering the blood stream and producing viremia and systemic

lesions. However, in chickens this innate barrier has been abated

in some experimental studies by specific test conditions or

laboratory manipulations. The predominant and severe

endothelial cell tropism or lymphocytic cellular tropism of high-

pathogenic avian influenza viruses in chickens obscured the

nephrotropic and/or nephropathogenic properties (Olander et

al., 1991 and Van Campen et al., 1989).

In addition, some avian-origin high-virulence influenza

viruses have no or minimal nephrotropism and nephropathogenic

properties (Acland et al., 1984). Finally, Swayne and Slemons,

(1994) indicated that low-virulence avian-origin influenza

viruses were nephrotropic during simulated systemic infection

(IV inoculation) and pneumotropic during simulated local

infection (IT and IN inoculation).

AIV antigen was located in the cerebrum, brain stem, and

pancreas, mainly in association with histological lesions.

Intranuclear and intracytoplasmic staining was seen in neurons

and glial cells of the cerebral gray matter and brain stem in 80%

of infected ducks. In the pancreas, immunolabeling was detected

in the nucleus and cytoplasm of necrotic acinar cells of 20% of

ducks (Vascellari et al., 2007). They found that through the

application of IHC, the localization of viral antigen was closely

correlated to clinical manifestations of disease and the histologic


29

lesions detected. In some samples, viral demonstration in

necrotic pancreatic foci was not possible, presumably due to the

extensive necrosis of affected cells. In contrast, both IHC and

ISH were able to reveal viral infection in individual cells before

the development of histologic lesions. ISH was more sensitive

than IHC, revealing a small amount of viral RNA in some

samples where viral nucleoprotein has not been detected by IHC.

They concluded that AI virus showed high pathogenicity,

associated with marked CNS and pancreatic damage. IHC and

ISH detected virus spread even in cells and tissues where

histologic lesions were not present, showing the strong viral

neurotropism in ducks.

Bröjer et al., (2009) found that high number of ducks

with encephalitis, in association with high levels of virus as

detected by IHC, suggests that the virus is highly neurotropic, as

previous studies showed by (Brown et al., 2006; Keawcharoen

et al., 2008). Signs of neurologic disturbance were, in fact, the

main observed clinical signs in infected birds. It is likely that the

encephalitis, in combination with an inability to feed or drink,

was the ultimate cause of death in most of the birds.

Neurotropism of the virus was also observed in the peripheral

nervous system, with detection of virus in the submucosal and

myenteric plexa of the intestine and in ganglion cells.

Van Riel et al., (2009) found in the severely edematous

wattle skin, most endothelial cells contained virus antigen, while

in all other tissues virus antigen was only detected in a few

endothelial cells. Viral antigen IHC showed that H7N7 virus


30

attached to more endothelial cells in wattle skin than in other

vascular beds. This might explain, at least partly, the tropism of

the virus and the associated severity of lesions in this tissue. Also

they found that AI antigen often associated with histologic

lesions, although virus antigen was also present in areas without

detectable lesions. Viral antigen was most commonly observed

in endothelial and mononuclear cells in all tissues. A remarkable

finding was that viral antigen was detected in many endothelial

cells in the wattle, while in all other tissues viral antigen was

only detected in a few, individual endothelial cells. Parenchymal

cells of the heart (cardiomyocytes), kidney (tubular epithelial

and glomerular cells), lung (epithelial cells), pancreas (acinar

cells), and trachea (epithelial cells) also contained viral antigen.

Although there was hepatocellular necrosis, virus antigen was

not detected in hepatocytes. In the wattle, keratinocytes of the

skin contained viral antigen in 1 focus, and a few cells in the

feather pulp of 1 feather follicle contained viral antigen.

Destruction of lymphoid tissues by A/turkey/Ont/7732/66

(H5N9) (Ty/Ont) is a characteristic of infection with this highly

virulent avian influenza virus and not of other virulent avian H5

viruses, A/tern/South Africa/1961 (H5N3) (Tern/S.A.) or

A/chicken/Pennsylvania/1370/83 (H5N2) (Ck/Penn). These three

strains vary in the cell type(s) in which viral antigen is found,

indicating that they infect and replicate in different cell types

(Van Campen et al., 1989). The striking feature of infection

with A/turkey/Ont/7732/66 (H5N9) (Ty/Ont) is the destruction

of lymphoid tissues. This could occur by virus infection that


31

results in killing lymphocytes and macrophages present in large

numbers in the spleen; however, processes other than viral

replication might be involved. In investigating this possibility,

they found that Ty/Ont affected the in vitro response of avian

lymphocytes to mitogen in a dose-dependent manner. Possible

explanations for the enhanced response with low doses of

Ty/Ont include the release of lymphocyte-activating factors by

macrophages, direct activation of lymphocytes or a direct

mitogenic effect of influenza virus on lymphocytes (Van

Campen et al., 1989).

HPAIV H5N1 nucleoprotein was detected by IHC in the

nucleus and cytoplasm of neutrophils in the placental blood of a

pregnant woman. Viral RNA was detected in neutrophils by in

situ hybridization and enhanced real time polymerase chain

reaction. Therefore, neutrophils may serve as a vehicle for viral

replication and transportation in avian influenza (Zhao et al.,

2008).

2.10. Diagnosis of AIV:

The confirmation of AIV should be carried out with

appropriate laboratory tests following the OIE Manual of

Diagnostic Tests and Vaccines for Terrestrial Animals (OIE,

2009). This includes samples collection, and in the primary

outbreak in a given country virus isolation and identification and

assessment of the pathogencity.


32

Isolation of AIV:

Embryonated chicken eggs (ECEs) obtained from specific

pathogen free or specific antibody negative fowls are the method

of choice for isolation and propagation of AIV (Woolcock,

2008; OIE, 2009). Inoculation of 9 -11 days old ECE via the

allantoic sac has been used for decades as a superior route for

growing of AIV. Occasionally, yolk sac or the chorioallantoic

membrane routes might be useful in isolation of non-chicken

originated AIV (Woolcock, 2008).

Allantoic fluid collected from inoculated ECE which have

hemagglutinating activity when mixed with chicken erythrocytes

could indicate presence of an AIV; however other

hemagglutinating viruses (e.g. paramyxoviruses) and

contaminating bacteria should be ruled out. Typically, an HPAIV

kills the embryo within 24-48 hours after inoculation of ECE but

further passages are required to propagate viruses of low

pathogenicity (Woolcock, 2008; OIE, 2009). High cost,

availability, less specificity and sensitivity are the main

disadvantages of ECE for AIV isolation (Suarez, 2008;

Woolcock, 2008). On the other hand, cell cultures and cell lines

were found to be as sensitive as egg inoculation in terms of virus

isolation, titration, selection and pathogenicity. Madin-Darby

canine kidney (MDCK), primary chicken embryo kidney (CEK),

primary chicken embryo fibroblast (CEF) cell cultures and baby

hamster kidney (BHK-21) cell lines are efficient systems for

growth of AIV. However, MDCK, CEK, and CEF were found


33

useful and cost-effective to process a higher volume of samples

(Moresco et al., 2010).

In case of LPAIV propagation in tissue cultures, trypsin

must be added. Nevertheless, chicken kidney cells produce

trypsin-like proteases which could allow replication of LPAIV

without prior addition of trypsin (Suarez, 2008). General

speaking, virus isolation remains the only tool for providing a

live virus for further investigation (Charlton et al., 2009). Yet,

confirmation and subtyping of AIV after primary isolation is

usually done by HI, agar gel immunodiffusion assay (AGID),

commercial immunoassay kits or RT-PCR (Spackman et al.,

2008; Woolcock, 2008; OIE, 2009).

Detection of nucleic acid by RT-PCR:

Several types of RT-PCR methods have been developed

since the early 2000s for diagnosis and differentiation of AIV

which are widely employed in surveillance, monitoring of

outbreaks, and research activities. Among those methods, the

RT-qPCR was described to be of high sensitivity, high

specificity, rapid, cheap, quantitative and cost-effective method

(Spackman and Suarez, 2008). A number of RT-qPCR assays

for diagnosis and characterization of AIV have been published.

These assays target the matrix gene (Spackman et al., 2002), the

nucleoprotein gene, the neuraminidase or the hemagglutinin gene

(Hoffman et al., 2001). Using specific primers and probes,

amplification of a conserved region within the matrix gene

among all AIV subtypes followed by or simultaneously with HA


34

and NA subtype-specific RT-qPCR is the common used

approach (Spackman et al., 2002).

Detection of viral antigen by Immunohistochemistry (IHC):

Reverse Transcriptase Real-time Polymerase Chain

Reaction (RT-qPCR) assays and IHC staining have been recently

developed for rapid and accurate diagnosis of the HPAIV H5N1

infections worldwide (Cattoli et al., 2004; Tsukamoto et al.,

2010; Nuovo, 2006).

IHC staining is a method to detect and locate the target

viral antigen in tissue sections (Nuovo, 2006). It has been used

to detect avian influenza virus nucleoprotein (NP) antigen. IHC

is suitable technique for a routine avian influenza diagnostic

laboratory because it does not need any sophisticated equipment

or skills (Chamnanpood et al., 2011).

Sequencing of AIV genome:

Identification of AIV genome sequence data is very

important to develop novel influenza vaccines, therapies and

diagnostics and increase our understanding for molecular

evolution, virulence-associated genetic markers and host-

pathogen interaction (Spackman et al., 2008). Genome

sequence of AIV has become relatively less expensive due to the

recent advancement in the field of automated sequencing

technology (Spackman et al., 2008).

In contrast to the standard tests for assessment of AIV

pathogenicity which is time-consuming, laborious and


35

logistically complex, sequencing of the PCS motif of the H for

rapid assessment of the virulence potential of AIV could be

generated easily within 24 hours and has been considered by the

OIE as a criteria for notifiable HPAIV (Spackman et al., 2008;

OIE, 2009). Furthermore, subtyping of AIV is achievable by

direct sequencing of whole or partially amplified H and N gene

segments (Spackman et al., 2008). In addition to rapid

pathotyping and subtyping of the AIV, sequence analysis was

applied successfully in molecular epidemiology to likely identify

the possible source of infection, spectrum of susceptible species,

ecological niche and geographic range (Shi et al., 2010).

2.11. Control and prophylactic against AIV:

Although enforcement of biosecurity measures and an

eradication strategy of an infected flock should be the basic line

in any control against H5N1 virus infections (Capua and

Marangon 2007); Vaccination as a “tailored synergy” has been

implemented as a main tool to confront the disease in many of

developing countries and to mitigate the impact of the

unbearable pre-emptive culling of infected birds (Swayne,

2009). Several types of H5 vaccines are available to protect birds

against H5N1 virus infection. Conventional inactivated

heterologous LPAIV (H5N2, H5N3, H5N9) or homologous

whole HPAIV H5N1 virus after removal of the PCS by means of

reverse genetics are commonly used vaccines in the field

(Swayne, 2009). Furthermore, vaccines include recombinant

viral vectors (e.g.: adenovirus, fowl poxvirus, Newcastle disease

virus, baculovirus, turkey herpes virus and infectious


36

laryngotracheitis virus) with an inserted AI H5 gene are a

recently developed promising approach (Beard et al., 1991).

Prevention of the clinical signs, mortality, reduced

shedding of the virus in the environment, increased the resistance

of birds to an infection, decreased bird-to-bird transmission and

limited decrease in the egg production are the main advantages

of the AI vaccines (Capua and Marangon 2007; Swayne,

2009). Yet, the virus is still able to infect vaccinated birds and

subsequent silent spread usually occurs (van der Goot et al.,

2007). It is worth pointing out that continuous circulation of AIV

under immune pressure in vaccinated populations for extended

period favour the antigenic drift of the field virus away from the

vaccine strain as reported in the H5N2 epidemic in Mexico (Lee

et al., 2004) and the endemic H5N1 in China (Tian et al., 2010)

as well as in Egypt (Peyre et al., 2009).

Generally, the immunity induced by vaccination is of

short duration and it is necessary to apply the vaccine several

times during one rearing period. There are little or no data

available about the frequency of vaccinations required for

keeping the breeder and layer flocks protected during the entire

production period (Hafez, 2008). Furthermore, there are several

factors which could affect the vaccine and vaccination against

HPAIV such as: subtype of the vaccinal strain, heterogeneity of

the vaccine and circulating virus, potency of the vaccine, dose,

antigen mass, adjuvant, surfactant, age of birds, species and the

breed of birds (Philippa et al., 2007).

Inappropriate storage, handling and improper

administration are further factors for vaccination failure. The


37

quality of the vaccine application is crucial since all non injected

chickens are not protected, and improperly injected chicks will

be poorly protected. Using post-vaccination necropsy (residue of

oil at the site of injection) or serological testing demonstrated

that it is not uncommon to see as much as 20 – 30% or even

more of chickens that were not injected (Gardin, 2007).

Finally, continuous antigenic and genetic drift of AIV,

differentiating vaccinated from field exposed birds and

inevitable circulation of the virus in vaccinated birds “silent

infection” are considered major challenges of any AIV vaccine

(Capua and Marangon, 2007). Therefore, vaccination alone is

inadequate to eliminate H5N1 virus in endemic countries. Thus,

it is essential to incorporate a sustainable awareness campaign

and education programs about the virus and modes of

transmission for veterinarians and para-veterinarians involved in

the poultry production chain (Hafez, 2008).

2.12. Public health significance of AIV:

The world’s first cases of human infection with the

H5N1strain were documented in 1997 in Hong Kong. For the

first time, evidence showed that the H5N1 strain can infect

humans directly without prior adaptation in a mammalian host. A

striking feature of this outbreak was the presence of primary

viral pneumonia in severe cases. Usually, pneumonia that occurs

in patients with influenza is a secondary bacterial infection. In

these cases, however, pneumonia was caused directly by the

virus, it did not respond to antibiotics, and it frequently was

rapidly fatal. The outbreak, which involved 18 cases, six of


38

which were fatal, coincided with outbreaks of infection of H5N1

in domestic poultry on farms and in live markets (WHO, 2005).

Although no sustained human-to-human transmission of

the H5N1 virus has occurred so far and no evidence of genetic

reassortment between human and avian influenza virus genes has

been found, the epizootic outbreak in Asia poses an important

public health risk. If the H5N1 viruses develop the ability for

efficient and sustained transmission between humans, an

influenza pandemic likely would result, with high rates of illness

and death (Ligon, 2005).

MATERIAL AND METHODS

Material and Methods

39

3. MATERIAL AND METHODS

3.1. Material:

3.1.1. Specimens:

Sampling was carried out from chickens and ducks flocks

suspected to be infected with AIV in Sharkia Province, Egypt,

2013. Specimens from tissues including (trachea, brain, lung,

pancreas, proventriculus, spleen, bursa, liver, intestine, and

testis) and sera were collected from infected birds.

Specimens were collected from 7 flocks; chicken broilers

(3), chicken layers (2), and backyard ducks (2) (Table 1). The

clinical picture of the examined birds included sudden deaths,

mortalities up to 40%, ecchymoses on the shanks and feet,

cyanosis of the comb and wattles, subcutaneous edema of head

and neck, and ecchymotic haemorrages on sterum bone for

chickens, and nervous signs (torticollis), for ducks (Figure 5).

3.1.2. Reference HPAIV H5N1:

Highly Pathogenic Avian Influenza Virus H5N1

(A/chicken/Egypt/SHAH-1403/2011, GenBank accession

number JQ927216) was kindly provided by Dr. Reham El

Bakery, Department of Avian and Rabbit Medicine, Faculty of

Veterinary Medicine, Zagazig University, Egypt. The virus

suspension was passage number 4 with titer of 5.7 log 10

EID50/ml.


40

Table 1: Clinical data of chicken and duck flocks infected with AIV.

Flock

No.

Species Locality Rearing system/

breed

Age/days No. of

sampled

birds

Mortality

rates (%)

Clinical picture of

submitted birds

1 Chicken

broilers

Zagazig Commercial/Cobb

500*

32 9 22.85

Respiratory signs,

cyanosis of the head,

comb and wattles,

subcutaneous edema of

head and neck with

ecchymoses on the shanks

and feet.

2 Chicken

broilers

Abou-

Hammad

Commercial/Cobb

500*

27 9 30.32

3 Chicken

broilers

Belbis Commercial/Cobb

500*

35 9 24.19

4 Chicken

Layers

Abou-

Kebeer

Commercial/Hyline* 105 9 24.50

5 Chicken

layers

Fakous Commercial/Hyline** 101 6 0.14

6 Ducks Zagazig Backyard/Mallard 25 1 28.50 Greenish diarrhea and

nervous signs 7 Ducks Abou-

Hammad

Backyard/Muscovy 30 3 40.00

Total Chickens

Ducks

-

-

-

-

-

-

42

4

-

- -

- * Chicken broiler and layer flocks were vaccinated once with H5N1 or H5N2 inactivated vaccines.

** Chicken layer flock was vaccinated two times with H5N1 or H5N2 inactivated vaccines.

Backyard ducks were not vaccinated.


41

3.1.3. Phosphate buffer saline (PBS), pH 7.4:

Sodium chloride (NaCl) 8 g

Potassium chloride (KCl) 0.2 g

Potassium dihydrogen phosphate (KH2PO4) 0.2 g

Disodium hydrogen phosphate (Na2HPO4)

12H2O

2.9 g

Distilled water (DW) up to 1000 ml

The pH was adjusted by Hcl or Sodium bicarbonate to be

7.4; it was sterilized by autoclaving and kept at 4oC till used. It

was used for preparation of samples.

3.1.4. Emryonated chicken eggs (ECE):

A total number of 150 ECE of 9-11 days were used for

isolation and propagation of HPAIV H5N1 via allantoic route.

3.1.5. Chicken erythrocytes (RBCs):

Chicken blood was collected in Na citrate 3.8 % by a

volume 1:4 and centrifuged in ordinary centrifuge at 1500

rpm/15 minutes. Chicken RBCs were collected from the

sediment and washed twice using PBS and then prepared as 10%

suspensions in PBS for rapid hemagglutination test.

3.1.6. Antibiotic mixture:

Pen Strept: (Gibco, Invitrogen, Code, 4512)

- Penicillin 10.000 IU/ml

- Streptomycin 10.000 µg/ml


42

The antibiotic mixture was added to sample supernatants to get a

final concentration of 1000 IU/ml Penicillin and 1000 µg/ml

Streptomycin.

3.1.7. Reagents used for conventional RT-PCR:

3.1.7.1 Reagents for RNA extraction:

Blood/Liquid sample Total RNA Rapid Extraction Kit

(Spin-Column) (Bioteke Corporation, China) (Cat. #: RP4001)

were used for total RNA extraction from 250 µl of HA-positive

allantoic fluids according to manufacturer's instructions.

3.1.7.2. Reagents for synthesis of cDNA and PCR reactions:

3.1.7.2.1. RT-PCR (cDNA synthesis) Kit:

The cDNA Diastar™ RT Kit with RNase inhibitor (Cat.#.

DR22-R10k, Solegent Co. Itd., Korea) was used for synthesis of

cDNA stand using random primer.

3.1.7.2.2. Master Mix:

The 2X Taq PCR master Mix (Bioteke Corporation, China)

was used in PCR.

3.1.7.2.3. Primers:

Two sets of primer (Table 2) were used in PCR reaction

for subtyping of AIV isolates (H5 and N1 forward and reverse

primers) to yield bands of ~317 and ~245 bp for H and N genes

respectively.


43

3.1.7.3. Reagents for agarose gel electrophoresis:

3.1.7.3.1. Tris-Acetate EDTA (TAE) buffer:

It is 50X stock solution (Fermentas). It was used as 1x

buffer solution for preparation of agarose and for gel

electrophoresis.

3.1.7.3.2. Agarose (Molecular Biology Grade):

It was used in concentration of 1.5% in TAE

Agarose 0.75 g

1x TAE buffer up to 50 ml

It was heated in microwave and used for agarose gel

electrophoresis of PCR products.

3.1.7.3.3. Ethidium Bromide:

A stock solution of ethidium bromide (Fluka) was prepared

as the following:

Ethidium bromide 5 mg

RNase free water 10 ml

It was used for staining the agarose gel electrophoresis

DNA by adding 50µl from stock solution to 50 ml 1.5%

melted agarose to give a final concentration of 0.5 µg/ ml.

3.1.7.3.4. Molecular weight marker: GeneRulerTM, 100 bp

plus DNA Ladder, Ready-to-use (Fermentas)

It is composed of fourteen chromatography-purified

individual DNA fragments (in base pairs): 3000, 2000, 1500,

1200, 1000, 900, 800, 700, 600, 500, 400, 300, 200, and 100 bp.


44

It contains two reference bands (1000 and 500 bp) for easy

orientation. It was added in volume of 5µl per lane.

3.1.8. Reagents for cloning and sequencing of NS gene:

3.1.8.1 Reagents for TA cloning:

3.1.8.1.1. RT-PCR (cDNA synthesis) Kit:

SuperScriptTM III RT-Kit (InvitrogenTM, USA)

(Cat.#:18080-093) was used for reverse transcription of the

extracted RNA according to manufacturer's instructions using

uni-12 primer (Table 2).

3.1.8.1.2. Amplification kit:

Taq. DNA polymerase enzyme (Takara Bio Inc., Japan),

was used for ampliphication of (cDNA) using specific sets of

primers for both ends of segment eight of H5N1 influenza virus

(NS segment) (Table 2).

3.1.8.1.3. PCR purification combo kits:

Specific bands of NS segment at the expected size (890+29

bp) on gel were excised and purified using PureLinkTM quick gel

extraction and PCR purification combo kit (InvitrogenTM,

USA)(Cat#: K2200-01) following manufacturer's instructions.

3.1.8.1.4. TA cloning® kits:

TA cloning® kit, with pCRTM 2.1 vector without competent

cells (Cat.#: K2020-20), subcloning efficiency TM DH5α TM

competent cells (Cat.# 18265-017) and PureLinkTM quick

plasmid miniprep kit (Cat.# K2100-10) were used For cloning of

NS (segment 8) following manufacturer's instructions.


45

3.1.8.2. Reagents for sequencing of NS gene:

Reagents for sequencing were performed by ACGT

sequencing company, Ilionos, Chicago, USA.

3.1.9. Reagents for purification and sequencing of amplified

H gene:

3.1.9.1. Reagents for purification of PCR product (DNA)

The gene JETTM Gel extraction Kit (Cat.# K0691,

Fermentus) was used according to manufacturer’s instructions.

3.1.9.2. Reagents for sequencing of H gene:

Reagents for sequencing were performed by Sigma

sequencing company, Cairo, Egypt.

3.1.10. Reagents for real-time RT-PCR:

3.1.10.1. Reagents for RNA extraction:

Blood/Liquid sample Total RNA Rapid Extraction Kit

(Spin-Column) (Bioteke Corporation, China) (Cat. #: RP4001)

were used for total RNA extraction different tissue specimens

according to manufacturer's instructions.

3.1.10.2. Real-time RT-PCR kit:

Ambion AgPath-IDTM one step RT-RealTime PCR kit

(Applied Biosystems®, USA) was used for TaqMan-based real-

time RT-PCR (Applied Biosystems) to measure viral M gene

transcripts in these tissues according to manufacturer's

instructions using sets of M gene specific primers and probe

(Table 2).


46

Table 2: Sequences of the oligonucleotide primers and probe used in the study

Target

gene

Primer Forward (5’>3’) Primer Reverse (5`>3`) Product

size (bp)

Application References

H5 H5-kha-1

CCTCCAGARTATGCMTAYAAAATTGTC

H5-kha-3

TACCAACCGTCTACCATKCC

YTG

~345 Subtyping and

Sequencing of AIV

H gene

Njouom et

al., 2008

N1 N1-54F

TCARTCTGYATGRYAAYTGG N1-298R

GGRCARAGAGAKGAATTGCC

~245 Subtyping of AIV N

gene Tsukamoto

et al., 2009

NS Bm-NS-1

TATTCGTCTCAGGGAGCAAAAGCAGGGT

G

Bm-NS-890R

ATATCGTCTCGTATTAGTAGA

AACAAGG

890+29 Cloning of NS gene Hoffman et

al., 2001

M M+25F

AGATGAGTCTTCTAACCGAG

GTCG

M-124R

TGCAAAAACATCTTCAAGTC

TCTG

- Real-time RT-PCR Spackman et

al., 2002

M gene

probe

M+64probe*

FAM-TCAGGCCCCCTCAAAGCCGA-TAMRA - Real-time RT-PCR Spackman et

al., 2002

* FAM: 6-Carboxyfluorescein

* TAMARA: Tetramethylerhodamine

* Y, K, M, R: codes for mixed base positions


47

3.1.11. Reagents for Immunohistochemistry (IHC):

3.1.11.1. Neutral buffered formalin 10%:

Ten percent neutral buffered formalin was used for fixation of

tissues as a preparatory step for (IHC). It was prepared by adding

10 ml formalin to 90 ml phosphate buffer saline.

3.1.11.2. Citrisolv clearing agent (deparaffinizing solutions):

Different series of ethanol's solutions (100% ethanol: 95%

Ethanol; 70% Ethanol; 50% Ethanol) and distilled water were

used.

3.1.11.3. Target retrieval solution (Dako; cat. # S1699)

3.1.11.4. Hydrogen peroxide (H2O2), 3%

3.1.11.5. 0.05 M Tris Buffered Saline, PH 7.6 with 0.05%

Tween 20

3.1.11.6. Normal goat serum, 1:10 (Sigma)

Goat serum was used as concentration 1:10 in Tris buffered

saline (TBS) as blocking solution.

3.1.11.7. Primary antibody:

Primary rabbit anti-influenza A nucleoprotein (NP) polyclonal

antibody (Cat.#: 9382; LifeSpan Biosciences, Inc.USA) was

used for detection of influenza A virus in tissues of chickens and

ducks.


48

3.1.11.8. Secondary antibody:

The EnVision+/HRP goat anti-rabbit IgG, (Dako; Ready-to-use;

cat.#: K3469).

3.1.11.9. Substrate:

Chromomgen-3-Amino-9-Ethylecarbazole+; AEC+ (Dako;

Ready-to-use; cat. #: K3469) was used in IHC staining.

3.1.11.10. Counter stain

Mayer's Hematoxylin stain was used as counter stain.

3.1.11.11. Aqueous mounting medium (Riedel-deHäen)

3.1.11.12. Positive and negative controls:

Positive control was known IAV positive tissue while negative

control was rabbit immunoglobulin fraction (Dako; cat. #

X0903).


49

3.2. Methods:

3.2.1. Preparation of collected samples:

3.2.1.1. Preparation of tissue samples for virus isolation:

Tissue homogenates 10% suspension was prepared by

mixing 0.5g of tissue to 5ml of sterile PBS then centrifuged at

2000rpm for 20 minutes at 4oC. Antibiotics were added to the

supernatant fluids to get a final concentration of 1000IU penicillin

and 1000µg streptomycin/ml, and then left for one hour at

refrigerator. The supernatant was aliquoted into sterile 1.5ml

eppendorffs, labeled and used for inoculation of SPF-ECE for

virus isolation.

3.2.1.2. Preparation of serum samples:

Blood samples were collected from chickens and ducks

and allowed to clot at room temperature then centrifuged at

2000rpm for 10 minutes for serum separation. The supernatant

sera were aspirated into small cryovials aliquots and stored at -

20°C until used for RNA extraction.

3.2.2. Isolation of AIV using ECE:

The embryonated chicken eggs of 9-11 days old were

inoculated via allantoic cavity route with 0.2ml of sample

(trachea and lung tissue homogenates pooled together). Each

sample was inoculated into 3 eggs. The inoculated eggs were

sealed melted wax. Additionally, three fertile eggs were

inoculated with reference AIV subtype H5N1 virus and another

three eggs were kept without inoculation as negative control.


50

These eggs were incubated at 37°C for 5 days, embryonic death

was monitored twice daily. The removed ECEs were chilled at

4˚C for 4 hours and then examined. The eggs were cleaned by

cotton piece soaked in 70% ethanol. At least three successive

embryo passages were applied for each sample to be negative.

Allantoic fluids were collected and preserved at (-20C) until

tested for hemagglutination activity using washed chicken RBCs

10% (OIE, 2012).

3.2.3. Detection of AIV using rapid HA:

Using clean glass slides, 50 µL of allantoic fluid from

each sample were mixed with 50 µL of washed chicken RBCs

10% and incubated at room temperature for 3-5 minutes. Tested

allantoic fluids which showed agglutination in form of

aggregation of RBCs were considered HA positive and subjected

to RT-PCR for subtyping AI viruses.

3.2.4. Detection, identification and subtyping of AIV isolates

using RT-PCR:

3.2.4.1. Extraction of RNA:

Viral RNA was extracted directly from 250µl of HA-

positive allantoic fluids, positive and negative controls were

included as well. RNA extraction step were done using

Blood/Liquid sample Total RNA Rapid Extraction Kit (Bioteke

Corporation, China) according to Manufacturer’s instructions. A

750µl of Lysis buffer were added to 250µl allantoic fluid in one

microcentrifuge tube followed by vortexing for 2 minutes.

Microcentrifuge tube was incubated for 10 minutes at room


51

temperature followed by adding 150µl chloroform and shaking

for 15 seconds, and then incubation for 3 minutes at room

temperature. After then, Samples were centrifuged at 12,000

rpm/10 minutes where the mixture was separated into 3 phases.

The upper aqueous phase was transferred to a fresh tube where

we added 500μl 70% ethanol. The alcohol-aqueous mixture was

transferred to the spin-column followed by centrifugation at

10,000 rpm and two steps of washing using washing buffers.

Finally, the spin column was placed into RNase-free centrifuge

tube and 60µl was added to the center of the column to elute

extracted RNA from silica membrane of spin-column.

3.2.4.2. Synthesis of cDNA:

The extracted viral RNAs from allantoic fluids were

reverse transcribed to cDNA using cDNA DiaStarTM RT Kit

(Solgent Co. ltd. Korea) according to Manufacturer’s

instructions. In a PCR tube, 5µl of extracted RNA was mixed

with 1µl of random primer. The mixture was heated to 56oC for

5 minutes and cooled immediately on ice. This was followed by

preparation of a mixture with the following condition:


52

Mix Volume (µl)/ one

reaction

Pre-heating product (RNA + random

primer)

6

5x RT Reaction buffer (RT

enzyme+10Mm dNTP mix)

4

8mM DTT (act as enhancer) 1

DiaStar™ RTase (RNase inhibitor) 1

RNase free water 8

Total 20

The mixture was mixed properly, incubated at 50oC for 60

minutes. The reaction was inactivated by heating at 95oC to stop

the action of RT enzyme. Pure cDNA was produced and ready

for amplification.

3.2.4.3. PCR reaction using H and N primers:

A total volume of 25µl in a sterile 0.2 ml RNase free PCR

tube using 2X power PCR master Mix (Bioteke Corporation,

China). The solution phase PCRs contain the following contents:

Mix Volume (µl)/ one

reaction

Master mix (including DNA polymerase +

10mM dNTP mix)

12.5

Forward primer H/or N (100 pMole) 0.25

Reverse primer H/or N (100 pMole) 0.25

Nuclease free water 9

Template (cDNA) 3

Total 25


53

The optimized PCR cyclic reaction conditions for H gene

were performed in MWG-Biotech thermal cycler as described as

followings:

Step Temp Time No of cycles

Initial Denaturation 95oC 3 minutes 1 cycle

Denaturation 95oC 30 seconds

30 cycles Annealing 53oC 30 seconds

Extension 72oC 30 seconds

Final extension 72oC 10 minutes 1 cycle

Cooling 4oC Forever

The optimized PCR cyclic reaction conditions for N gene

were performed in Biotech thermal cycler as described as

followings:

Step Temp Time No. of cycles




Extension 72oC 30 seconds


Cooling 4oC Forever

3.2.4.4. Agarose gel electrophoresis of RT-PCR products of

both H and N genes:

Fifty ml from 1.5% agarose was prepared in 1x TAE

buffer by heating and melting in microwave. The melted agarose

left till cool to about 45oC then 50µl from ethidium bromide


54

(stock=0.5 mg/ml) was added to give a final concentration of 0.5

µg/ml. The gel was poured, left for solidification, and the comb

was removed then 1X TAE buffer was added. Five µl of the PCR

products and 5 µl molecular weight marker were added into the

marked wells formed in gel. Electrophoresis was done at 100

volts for 40 min then the gel was viewed and photographed on

the UV transilluminator.

3.2.5. Cloning and sequencing of NS gene (Segment 8)

3.2.5.1. Synthesis of cDNA:

The extracted RNA from Allantoic fluid was reverse

transcribed to cDNA using SuperScriptTM III RT-Kit

(InvitrogenTM, USA)(Cat.#:18080-093) according to

manufacturer's instructions. Seven μl of extracted RNA, 0.5μl

uni-12 primer and 2.5μl RNase free water were added together in

one PCR tube and incubated at 70°C for 5 minutes, this was

called part #1. In another PCR tube, 1μl dNTPs (Takara 10 mM),

4μl Invitrogen 5X 1st strain buffer, 1μl Invitrogen M-MLV

polymerase, 1μl RNase inhibitor, 2μl of 0.1mM DTT and 1μl of

H2O were mixed together in one PCR tube, this was called part

#2. Part #1 was added to part #2 and transferred to thermocycler

under optimized cyclic reaction as followings: (25°C/15 minutes,

42°C/1.5 hour, 75°C/10 minutes and 4°C forever). The Reverse

Transcription product (cDNA) was used as template for the

amplification reaction.


55

3.2.5.2. Amplification reaction:

One microliter of (uni-12) RT-product was used as a

template for PCR using 2.5μl (10X) buffer, 1 μl dNTP, 0.5 μl

Taq. DNA polymerase enzyme (Takara Bio Inc., Japan), 19 μl

Nuclease free water and 0.5 μl from both forward and reverse

primer for NS segment.

The optimized PCR cyclic reaction conditions for NS

gene were as described as followings:

Step Temp Time No. of cycles




Extension 72oC 7 minutes


Cooling 4oC Forever

3.2.5.3. Agarose gel electrophoresis of RT-PCR product of

NS:

Agar gel electrophoresis was prepared as previously

described in H and N genes.

3.2.5.4. Purification of specific PCR amplicons from agarose

gel:

The PCR amplicons (~890 +29bp) were considered

specific bands for non structural (NS) segment of HPAIV H5N1

(Hoffman et al., 2001). Specific bands were excised using gel

cutter. About 300-450µl of gel solublizing buffer (InvitrogenTM,

USA) were added to excised gel slice in one eppendorff,


56

incubated in water bath 45°C until the gel slice was solubilized.

The solubilized solution was transferred to silica column

followed by two steps of washing according to manufacturer's

instructions (PureLinkTM quick gel extraction and PCR

purification combo kit, InvitrogenTM, USA). Finally, 40µl Tris-

HCL was used as ellution buffer.

3.2.5.5. Ligation of purified specific PCR amplicons into

cloning vector:

Purified PCR fragments were ligated into pCRTM 2.1

vector by adding 3µl from purified fragment to 0.5µl ligation

buffer, 0.5µl ligase and 1.0µl pCR 2.1 plasmid vector in one

eppendorf, then, incubated at 14°C/overnight.

3.2.5.6. Transformation of ligated plasmids into bacteria:

Transformation process was done using chemically

competent E. coli that has modified cell membrane and can

accept entry of plasmid vector (Subcloning efficiency TM DH5α

TM competent cells, InvitrogenTM, USA). This process was held

through the following successive steps:

Ice incubation: 3µl ligated plasmid were added to 35µl

competent bacteria followed by good gentle mixing and ice

incubation for about 40 minutes.

Heat shock: Sudden moving to water bath (42°C) for one

minute.

Recovery of bacteria: adding 150µl pre-warmed antibiotic free

LB medium to the eppendorf that contains 3µl ligated plasmid

and 35µl competent bacteria.


57

Incubation with shaking: Incubating recovered bacteria in

shaker incubator (37°C/250rpm) for 30 minutes and not more

than 60 minutes.

Staining of transformed bacteria by X-gal substrate: Adding

20-40μl X-gal substrate of blue color to the transformed

competent bacteria.

Plating on petry dishes: Streaking of the X-gal stained

transformed bacteria into LB semi-solid agar that contain

Ampicillin followed by incubation of plates in inverted direction.

Picking up successively transformed bacteria: Only white

bacterial colonies were picked up and transferred to eppendorfs

that contain LB fluid media. Only white colonies were picked up

because white color means that these bacterial colonies have our

cloned NS gene because this gene will stimulate beta-

galactosidase enzyme to change color of X-gal from blue to

white color. Picked up white colonies were subjected to hybrid

cloned plasmid extraction step.

3.2.5.7. Extraction of hybrid cloned plasmids from

transformed bacteria:

This step was done by adding 1.5ml of the bacterial

culture to 2ml eppedorfs followed by centrifugation at 4000rpm

for 2 minutes. Supernatants were discarded and 100µl of

resuspension buffer were added followed by vortexing to

resuspend bacteria. For lysis of bacterial cell wall, 200µl of lysis

buffer were added to resuspended bacteria. For neutralization of

basic pH that caused by lysis buffer, 150µl of neutralizing buffer


58

were added followed by vigorous mixing and centrifugation at

maximum speed for 2 minutes. Then, the harvested supernatants

that contain protein and nucleic acids were transferred to clean

eppendorf followed by addition of 200µl phenol and 200µl

chloroform and vigorous shaking to obtain nucleic acids free in

supernatants and get rid of proteins after centrifugation at

maximum speed for 2 minutes. 1ml of Ethyl alcohol was added

to the harvested supernatants followed by centrifugation at

maximum speed for 2 minutes. Finally, extracted plasmid pellets

were left to dry on bench until next step (plasmid digestion) was

started.

3.2.5.8. Purification of hybrid cloned plasmids:

Purification of white plasmid pellets was an essential step

before sending plasmids for sequencing. It was done using

PureLinkTM quick plasmid miniprep kits following manfacturer's

instruction. The steps were similar to that previously mentioned

for purification of PCR amplicons from gel slices.

3.2.6. Full length sequencing of NS gene (segment 8):

Purified hybrid cloned plasmids were sent for sequencing

(ACGT sequencing company, Ilionos, Chicago, USA).

Sequences were obtained using an ABI Big Dye Terminator

v.1.1 sequencing kit and run on a 3730 XL DNA Analyzer

(Applied Biosystems, Foster City, CA). The NS nucleotide

sequences of our isolates are available on GenBank database

under the accession numbers (KJ192204, KJ192205 and

KJ192206).


59

3.2.7. Partial sequencing of H gene:

The PCR products of the predicted molecular size (~345)

were purified using GeneJETTM Gel Extraction Kit (Fermentus)

as recommended by the manufacturer. Purified PCR products

were sent for sequencing (Sigma sequencing company, Cairo,

Egypt). The H nucleotide sequences of our isolates are available

on GenBank database under the accession numbers (KP311329

and KP311330).

3.2.8. Phylogenetic analysis of sequences of NS and H genes:

Phylogenetic analysis of the NS and H genes was based

on nucleotides 39–704 (666 bases) of NS and 791-1100 (309

bases) of H genes. All gene sequence data of known H5N1

strains were collected from the National Center for

Biotechnology Information (NCBI) flu database. Multiple

alignments were constructed using ClustalW Multiple alignment

using the MegAlign module of DNAStar software (Lasergene

version 7.2 (DNASTAR, Madison, WI, USA). The neighbour-

joining method with Kimura two-parameter distances was used

for constructing the phylogenetic tree using the Mega 4.1

(Kimura, 1980). The tree was rooted to the

A/goose/Guangdong/1/1996 virus sequence. The reliability of

the internal branches was assessed by the p-distance substitution

model and 1000 bootstrap replications. The NS and H genotypes

were determined using the Influenza A Virus FluGenome web

server, (http://www.flugenome.org/) (Lu et al, 2007).

http://www.flugenome.org/


60

3.2.9. Deduced amino acid sequence analysis of NS and H

genes:

The amino acid sequences of NS1, NS2 and H cleavage

site were deduced from the nucleotide sequences. The multi-

sequence alignment tool available in the flu database was used to

compare the deduced amino acid sequences of the Egyptian

H5N1 strain under study with other H5N1 lineages circulated in

Egypt, Middle East and worldwide in order to screen amino acid

residues that were identified as pathogenic determinants of

highly pathogenic avian influenza viruses.

3.2.10. Detection of AIV in tissue specimens and serum

samples using real-time RT-PCR:

3.2.10.1. Extraction of RNA:

Tissue homogenates from birds previously screened as

RT-PCR H5N1 positive were subjected to RNA extraction using

Blood/Liquid sample Total RNA Rapid Extraction Kit (Bioteke

Corporation, China) according to Manufacturer’s instructions.

Positive and negative controls were included as well.

3.2.10.2. Real time RT-PCR reaction:

The extracted viral RNA from different tissues was used for

TaqMan-based real-time RT-PCR to measure viral M gene

transcripts in tissues using sets of M gene specific primers and

probe (Table 2). Reaction conditions were optimized in accordance

with national veterinary service laboratory (Spackman, 2005,

USDA, USA) using the Ambion AgPath-IDTM one step RT-PCR

kit (Applied Biosystem®, USA). The experiments were held in


61

three successive times and positive and negative controls were

included along with the tested samples as well.

The solution phase PCRs contain the following

contents:

Mix Volume (µl)/ one reaction

2X Buffer 12.5

M+25F (20 µMole) 0.25

M-124R (20 µMole) 0.25

Probe (6µ Mole) 0.25

25X TaqMan Enzyme Mix 1

Detection Enhancer 1.67

Nuclease Free Water 1.08

Template (RNA) 8

Total 25

The Thermal Cycler Profile for M gene was performed

using the following machine (Applied Biosystems 7500 Real-

Time PCR System) as described as followings:

Thermal Cycler Profile for M gene

Stage Temperature Time Repetitions

1 45.0oC 10 minutes 1

2 95.0oC 10 minutes 1

3 94.0oC 15 seconds 45

60.0oC 45 seconds 30 seconds


62

3.2.11. Detection of AIV Nucleoprotein (NP) antigen in

different tissues using IHC (Key et al., 2006):

The collected tissues were fixed in 10% neutral buffered

formalin, routinely processed. Paraffin blocks were sectioned

and immunohistochemically stained.

3.2.11.1. Tissue deparaffization and rehydration:

The slides were placed at slides rack and then placed in

oven (58-62 °C) for 30 minutes to warm and melt paraffin in

formalin-fixed, paraffin-embedded tissues sections.

Deparaffinization were done through 4 changes of citrissolv

clearing agent (3 minutes/each solution) inside a fume hood.

Tissues were rehydrated through a graded ethanol series (100%,

95%, 70%, and 50%) and distilled water (3 minutes/each) inside

a fume hood.

3.2.11.2. Antigen retrieval:

The bottom of decloaker was firstly filled with 500 ml of

distilled water. Plastic slide racks were filled with antigen

retrieval solution and then were set inside decloaker. Plastic

racks with blank slides were set inside decloaker as well.

Decloaker was tightly closed and set to start heating/pressurizing

process up to 120°C/17-24 psi. Once temp/pressure was reached,

slides were held at that point for 30 seconds, after then, stop

button was pushed. Once decloaker reaches 85°C/10 seconds and

pressure was zero psi, decloaker lid was opened. Slide racks

were cooled immediately by placing them in two changes of 0.05


63

MTBS, PH 7.6, within tween 20 added (0.05% per volume) for 5

minutes/each.

3.2.11.3. IHC staining:

Endogenous peroxidase was firstly blocked with 3%

H2O2 for 15 minutes followed by rinsing slides in TBS/Tween

20 for 5 minutes. Non specific binding sites were blocked with

normal goat serum, 1:10 in TBS, for 15 minutes. Slides were

incubated with primary antibody overnight at 4°C followed by

rinsing in TBS/Tween 20 for 5 minutes and incubation with

EnVision+/HRP goat anti-rabbit IgG for 60 minutes. After

rinsing slides in TBS/Tween 20 for 5 minutes, immunoreactivity

was detected by adding substrate (3-Amino-9-Ethylocarbazole).

Positive staining development time was 10 minutes, after which

slides were rinsed with distilled water and placed in a glass dish

for running tap water for 5 minutes.

Finally, slides were counterstained with Mayer's

Hematoxylin for 5 minutes then rinsed in water followed by

covering slide by cover slip using aqueous mounting medium.

Two unstained sections per case block, one to be incubated with

primary antibody and one to be used as negative control

(incubated with negative control rabbit IgG fraction). All

previous steps were done at room temperature except the

primary antibody step, which was done at 4°C overnight.


64

3.2.12. Statistical Analysis

Data were collected and continuous variables were

analyzed using one-way analysis of variance (ANOVA), then

comparison of means was carried out with Duncan’s multiple

range tests (DMRT) and summarized as mean ± standard

deviation.

RESULTS

65

4. RESULTS

4.1. Isolation of IAV using ECE:

Inoculated embryos died within 48-72 hours post

inoculations with diffuse hemorrhages after three successive

passages were considered as positive samples (Fig. 6B).

4.2. Detection of IAV using rapid HA:

Allantoic fluids were tested for hemagglutination

reactivity using rapid hemagglutination assay (HA) and positive

reactions were detected (Fig. 7B). Hemagglutinating viruses

were detected in 34 birds out of 46 birds with a percentage of

73.9 % with 30 of 42 (71.4%) in chickens and 4 of 4 (100%) in

ducks, respectively (Table 3).

66

Figure 5: Clinical picture of chickens and ducks suspected to

be infected with HPAIV H5N1.A. Chicken Broilers:

Ecchymosis on shanks and feet; B. Chicken Broilers: cyanosis

of comb and wattles; C. Chicken Broilers: fascial oedema

(arrow); D. Chicken Layers: Hemorrhages on sternum bone

(arrow); E. Backyard Ducks: Nervous signs, torticollus (arrow);

F. Backyard Ducks: Liver necrotic lesions (arrow).

67

Figure 6: Evidence of IAV in inoculated ECEs. (A) Normal

control negative chicken embryo inoculated with PBS with

antibiotic mixture. (B) Chicken embryo inoculated with

supernatants of homogenized testicular tissue of naturally

infected chicken layers showing dead embryos within 48h with

severe congestion and hemorrhages after the first passage

(arrow).

Figure 7: Detection of IAV using rapid HA. (A) Normal

control negative washed chicken RBCs (10%). (B) Positive

reactions of tested allantoic fluids by rapid HA using 10%

washed chicken RBCs in form of aggregation or agglutination

(arrow).

68

4.3. Detection, identification and subtyping of IAV using

RT-PCR:

Allantoic fluids which showed positive reactions with

rapid HA assay were submitted to RT-PCR for subtyping of viral

isolates using specific primers for H and N genes. Reference

AIV subtype H5N1 and positive samples produced bands at

~345 bp (Fig. 7A) and ~245 bp (Fig. 7B) specific to AIV

subtype H5N1using H5 and N1 primers respectively. AIV H5N1

was detected in 34 birds out of 46 sampled birds with a

percentage of 73.9 % that distributed between chickens and

ducks by 30 of 42 (71.4%) and 4 of 4 (100%) respectively

(Table 3).

69

Figure 8: Detection, identification and subtyping of IAV

isolates using RT-PCR. (A) PCR amplification for H gene

showing band size of ~345 bp (arrow), First lane: Molecular

marker of 100 bp, Lane 1-7: Positive samples, Ctrl +ve:

Positive AIV subtype H5N1, Ctrl -ve: Negative control

(allantoic fluid of non inoculated ECE). (B) PCR amplification

for N gene showing band size of ~245 bp (arrow), First lane:

Molecular marker of 100bp, Lane 1-5: Positive samples, Ctrl

+ve: Positive AIV subtype H5N1, Ctrl -ve: Negative control

(allantoic fluid of non inoculated ECE).

70

4.3. Cloning and sequencing of NS gene (segment 8):

The NS genomic segments (segment 8) of the Egyptian

H5N1 isolates in this study were completely sequenced. The

results showed that the lengths of the RNA region coding NS1

and NS2 proteins were 822 bp. All NS1 and NS2/NEP genes

shared the first 30 nucleotides of the coding region. The percent

of identity of nucleotide sequences of the NS segments of our

isolates was 99 %. The sequences showed homology of 99%

with those of the HPAIV H5N1 viruses circulating in Egypt at

the time of this investigation, and confirmed that our isolates

belongs to genotype (NS1E) upon using the Influenza A Virus

FluGenome web server, (http://www.flugenome.org/) (Lu et al,

2007).

4.4. Partial sequencing of H gene:

The H gene (segment 4) of our isolates was also partially

sequenced at the coding region of amino acids motifs at H

cleavage site. The results showed that the percent of identity of

nucleotide sequences of H gene of our isolates was 99 %. The

sequences showed identity of 98-99% with those of HPAIV

H5N1 viruses circulating in Egypt at the time of this

investigation, and confirmed that our isolates belongs to

genotype (5J), using the same IAV FluGenome web server (Lu

et al, 2007). Interestingly, we noticed that the surface H protein

of the HPAIV H5N1 currently circulating in Egypt belongs to

genotype (5J), a different genotype from the genotypes of the

viral strains used in some available commercial vaccines (Fig. 9)

http://www.flugenome.org/

71

4.5. Phylogenetic analysis of sequences of NS and H

genes:

Several nucleotide sequences of NS gene (segment 8) of

known HPAIV H5N1 strains were collected from NCBI

Influenza Data base and were used for phylogenetic analysis.

The phylogenetic analysis, based on complete coding region of

NS gene, showed that our isolates formed a uniform cluster,

together with highly pathogenic H5N1 viruses isolated from

Egypt in (2010, 2011, 2012 and 2013), however, this cluster was

far from other viruses isolated from Egypt in 2006, 2007, 2008

(Fig. 8).

Several nucleotide sequences of H gene (segment 4) of

known HPAIV H5N1 strains were also retrieved from NCBI

Influenza Data base and were aligned for further use in

construction of phylogenetic tree. The phylogenetic analysis,

based on partial coding region of H gene, showed that our

isolates formed a uniform cluster, together with the HPAI H5N1

viruses from Egypt isolated in 2009, 2010, 2011, 2012, and

2013; however, this cluster was not identical to the HPAIV H5

strains used for commercial vaccine development in Egypt, and

was also phylogenetically distant from the viruses isolated from

Egypt in 2006, 2007, and 2008 (Fig. 9).

72

Figure 9: Phylogenetic tree on basis of nucleotide sequences

of complete coding region of NS gene of HPAIV H5N1. The

tree was constructed using Neighborhood joining method with

bootstrap values calculated for 1,000 replicates and cut off value

50%. Sequences from this study are marked with solid triangle.

73

Figure 10: Phylogenetic tree of the H gene nucleotide

sequences at the cleavage site of HPAIV H5N1. Vaccine H5

strains were included in the tree and marked with solid circles.

The tree was constructed with multiple alignment of a 309 base-

nucleotide sequence of HA genes using the Neighborhood-

joining method in MEGA4. The tree topology was evaluated by

1,000 bootstrap analyses.

74

4.5. Deduced Amino Acid Sequences Analysis of NS and

H genes:

The percent of identities of amino acid sequences among

NS1 and NS2 proteins of our isolates were more than 99%. The

NS1 proteins of the two Egyptian H5N1 isolates did not differ

from each other, but differed significantly when compared with

those of the low pathogenic avian influenza (LPAIV) isolates

retrieved from Gene bank (NCBI). In the current study, the

molecular determinants of HPAIV strains were identified within

NS1 protein of our H5N1 isolates, including 225 amino acids in

length, deleted 80TMASV84 motif, Glutamate at position 92

(92E), and C-terminus E-S-E-V motif. The following residues

(T5, P31, D34, R38, K41, G45, R46 and T49) were identified in

the RNA binding domain of NS1 protein. The NS2 protein of our

H5N1 isolates contained 121 amino acids residues with

tryptophan at position 78. The nuclear export signal (NES) motif

was identified in its N-terminus region to be

12ILVRMSKMQL21.

The percent of H amino acid sequence identities of our

sequenced isolates was 99%. We found that the HA of our

isolates encodes a multibasic amino acid motif, 321-

PQGERRRKKR*GLF-333, at the H cleavage site, which is a

characteristic feature of all HPAIV H5N1 strains. Interestingly,

we found that one of our isolates has a substitution of amino acid

(R325K) at this cleavage site, to make it PQGEKRRKKR*GLF.

75

4.6. Detection of IAV in tissue specimens and serum

samples using real-time RT-PCR:

Chicken and duck tissues including trachea, lung, liver,

spleen, intestine, brain, testis, and serum were collected from

birds that showed positive results by viral isolation, HA assay,

and RT-PCR. These tissues were subjected to total RNA

extraction and real-time RT-PCR with primers specific to M

gene to examine viral RNA in each organ type.

By real-time RT-PCR, viral RNA of the HPAIV H5N1 M

gene was detected in all tissues tested both in chickens and

ducks, with an exception to testis which was only positive for

chicken layers (Fig.10). Higher levels of viral RNA were in

general detected in tissues of chicken broilers and layers,

including trachea, lung, spleen, intestine, brain, and serum, than

in those of ducks (Fig.10). In chicken broilers, higher viral RNA

levels appeared in brain, trachea, and serum samples with

significance difference with those in chicken layers (Fig.10). No

significant differences in viral RNA levels were observed in

various tissues of ducks, except for higher levels detected in

trachea, lung, and liver tissues that were significant different

from those of chickens (Fig.10). However, these samples from

different birds cannot be emphatically compared because they

came from natural outbreaks with uncertain timing of the course

of infection.

76

Figure 11: Detection of IAV in tissue specimens and serum

samples using real-time RT-PCR. The tests were performed in

triplicates for each sample and the Ct numbers are average with

3times ± SD (error bar), (* P<0.05).Results were expressed as Ct

values. Ct values lower than (35) were considered positive while

values greater than (35) were considered negative. Strong

positive tissues included Ct values between 15 and 25, moderate

positive tissues included Ct values between 25 and 30, and weak

positive tissues included Ct values between 30 and 35.

77

4.7. Detection of IAV antigen (Nucleoprotein) in

different tissues using IHC:

Chickens and ducks tissues included trachea, lung, brain,

spleen, bursa, pancreas, liver, proventriculus, and testis were

collected from birds that showed positive results by real-time

RT-PCR. These tissues were prepared for cross-section IHC

using specific antiserum against influenza A virus nucleoprotein

(NP) to evaluate viral tissue tropism in tissues of chickens and

ducks naturally infected with HPAI H5N1 virus. The viral NP

antigen was observed in all tested tissues included trachea, lung,

brain, spleen and bursa, pancreas, proventriculus, liver, and testis

(Figs. 11 and 12).

Nucleoprotein viral antigen was clearly detected in

endothelial and epithelial cells of trachea (Fig. 11A), Neurons,

glial cells of Perkinji cell layer, and endothelial cells of brain

(Fig. 11B), mononuclear cells of lung (Fig. 11C). acinar

epithelium of pancreas (Fig. 12A), glandular epithelium of

proventriculus (Fig. 12B), lymphocytes and mononuclear cells

of spleen (Fig. 12C), lymphocytes of follicular layer of bursa

(Fig. 12D), and VanKuppfer cells of liver in between liver

sinusoids (Fig. 12E).

Strikingly, viral NP antigen was detected between

seminephrous tubules of testicular tissue and even sticking to

heads of sperms inside these tubules (Fig. 12F)

Staining of most tissues shared a common characteristic

feature which was detection of viral antigen in their endothelial

78

and mononuclear cells, which suggest that viral pathogenesis of

the HPAIV H5N1 may be associated with endothelial invasion,

and that the virus could be carried by infected monocytes.

A summary of viral antigen staining in various tissues that

were examined is shown in (Table 4).

It worse mention, that we prepared samples from duck

tissues and performed the same IHC staining on duck tissues as

chicken tissues. However, we could not detect viral NP in all

tissues examined (data not shown). This could be attributed to

the preparation of samples, since they were collected from dead

ducks in the field. Although viral RNA was still present and live

virus isolated and subtyped by RT-PCR successfully (Figs. 6, 7,

and 10), no sufficient viral antigen existed in the tissues due to

prolonged exposure at ambient temperature and/or prolonged

preservation in formalin before doing IHC staining.

79

Table 3: Results of viral isolation, HA, RT-PCR, and IHC of HPAIV H5N1 from infected

chicken and duck flocks.

Flock

No.

Species Rearing system/ breed No. of

samples

No. of

+ve

samples

Results of HPAIV H5N1

infected flocks

Viral

Isolation

Rapid

HA

assay

RT-

PCR

IHC

1 Chicken broilers Commercial/Cobb 500* 9 9 9/9 9/9 9/9 9/9

2 Chicken broilers Commercial/Cobb 500* 9 6 6/9 6/9 6/9 6/9

3 Chicken broilers Commercial/Cobb 500* 9 3 3/9 3/9 3/9 N/A*

4 Chicken Layers Commercial/Hyline* 9 9 9/9 9/9 9/9 9/9

5 Chicken layers Commercial/Hyline** 6 3 3/6 3/6 3/6 3/6

6 Ducks Backyard/Mallard 1 1 1/1 1/1 1/1 -ve

7 Ducks Backyard/Muscovy 3 3 3/3 3/3 3/3 N/A

Total Chickens

Ducks

-

-

42

4

30

4

* Chicken broiler and layer flocks were vaccinated once with H5N1 or H5N2 inactivated vaccines.

** Chicken layer flock was vaccinated two times with H5N1 or H5N2 inactivated vaccine.

Backyard ducks were not vaccinated. N/A Not applied

80

Table 4: Distribution of viral antigen NP in IHC stained

tissues and cells of HPAIV H5N1 infected chickens.

Tissue IHC

score

Type of cells expressing virus antigen

Trachea +++ Endothelial cells and epithelial cells

Lung + Macrophages, Lymphocytes

Brain +++ Endothelial cells, neurons and glial cells

especially in perkinji cell layer

Spleen + Lymphocytes, Endothelial mononuclear cells

Bursa + Lymphocytes inside Follicular layer, endothelial

cells

Pancreas +++ Pancreatic acinar epithelium, macrophages and

endothelial cells

Liver + Liver sinusoids (inside Van kupffer cells)

Proventriculus + Glandular epithelium

Testis ++ Inter-seminephrous space, intra seminephrous

tubules sticking to sperms

IHC scoring system: (+) few viral antigen distribution; (++) moderate

viral antigen distribution; (+++) strong viral antigen distribution.

81

Figure 12 (A-C): Detection of viral antigen nucleoprotein (NP) in HPAIV H5N1 infected birds by IHC. (A)

Trachea; (A-1) Trachea of control HPAIV H5N1 non infected birds (X=50μm); (A-2) Trachea of control HPAI H5N1

none infected birds (X=20μm); (A-3) Viral antigen in endothelial cells of trachea (arrow) (X=20μm); (A-4) Viral

antigen in epithelial cells of trachea (arrow) (X=20μm). (B) Brain; (B-1) Brain of control HPAIV H5N1 none infected

birds (X=50μm); (B-2) Brain of control HPAIV H5N1 none infected birds (X=20μm); (B-3) Viral antigen in endothelial

cells, neurons, and glia cells of brain (arrow) (X=20μm), (B-4) Viral antigen in endothelial cells of brain (arrow)

(X=20μm). (C) Lung; (C-1) Lung of control HPAIV H5N1 none infected birds (X=50μm); (C-2) Viral antigen in

mononuclear cells of lung (arrow) (X=50μm), (C-3) Viral antigen in mononuclear cells of lung (arrow) (X=20μm).

82

Figure 13 (A-F): Detection of nucleoprotein (NP) viral antigen in HPAIV H5N1 infected birds by IHC. (A)

Pancreas; (A-1) Viral antigen in acinar epithelium of pancreas (arrow) (X=50μm); (A-2) Viral antigen in acinar

epithelium of pancreas (arrow) (X=20μm). (B) Proventriculus; (B-1) Viral antigen in glandular epithelium of

proventriculus (X=50μm); (B-2) Viral antigen in glandular epithelium of proventriculus (arrow) (X=20μm). (C) Spleen;

(C-1) Viral antigen in lymphocytes of spleen (X=50μm); (C-2) Viral antigen in lymphocytes of spleen (arrow)

(X=20μm). (D) Bursa; (D-1) Viral antigen in lymphocytes of follicular layer of bursa (X=50μm); (D-2) Viral antigen in

lymphocytes of follicular layer of bursa (arrow) (X=20μm). (E) Liver; Viral antigen in VanKupffer cells of liver

(arrow) (X=50μm). (F) Testis; Viral antigen in-between seminephrous tubules of testicular tissue (arrow) (X=20μm).

DISCUSSION

Discussion

83

5. DISCUSSION

HPAIV H5N1 is still circulating and causing outbreaks

with significant mortality to both commercial chickens and

domestic backyard ducks in Egypt. Our data showed that

vaccination with H5N1 and H5N2 vaccines may provide partial

protection, especially to layers which were vaccinated twice. For

both broilers and layers in commercial farms, they appeared to

be protected with even one-time vaccination when compared to a

mortality of over 70% in non-vaccinated chickens (Grund et al.,

2011).Unfortunately, we did not perform serological evaluation

of the immunological status or vaccine efficacy in chickens,

therefore are unable to assess how well the mortality is

correlated to the vaccination. Therefore, we cannot conclude

emphatically that the much lower mortality in the layers, which

were vaccinated twice, was absolutely attributed to the boosted

immunity.

Vaccine efficacy may best be assessed in the setting of

natural outbreaks, which apparently differs from that designed

experimentally. In naturally infected free-living birds, the

clinical and pathologic manifestations of an HPAIV infection

may be influenced by multiple factors including the age of the

bird, the dosage of virus and routes of viral exposure, the

presence of concomitant infections, and the levels of immunity

acquired from vaccination or during previous exposure to

influenza viruses (Keawcharoen et al., 2008, Bröjer et al.,

2009), which could be significantly different from trials with

Discussion

84

experimental challenges. Data about vaccine protection and

efficacy from natural outbreaks may be more valuable when case

studies are carefully planned and serological survey is

thoroughly performed and assessed. Even though the mortalities

were lowered, the pathogenicity of the infection appeared to be

severe, and the virus was highly virulent in sick chickens as

shown in Fig. 5 and Table 1.

Laboratory diagnosis of Influenza A virus infections is

performed by viral isolation and identification followed by

subtyping using hemagglutination-inhibtion test and/or RT-PCR

(OIE, 2005). In this study, using viral isolation (Fig. 6), RT-

PCR (Fig. 7), and sequencing, we identified that the IAV that

caused an outbreak in commercial chickens and backyard ducks

in Sharkia province, Egypt, was of H5N1 subtype.

Complete genotype nomenclature is essential to describe

gene segment reassortment (Lu et al, 2007). The reassortment of

NS gene segments between different AI viruses, particularly the

H5N1 subtype has been previously reported (Munir et al.,

2013). Nucleotide sequences analysis of NS and H genes of our

isolates showed homology of 98-99% with those of the H5N1

viruses circulating in Egypt at the time of this investigation.

Genotyping tool (Lu et al, 2007), confirmed that our isolates

belongs to genotypes NS1E and 5J for NS and H genes

respectively which indicates that the current circulating H5N1

viruses in Egypt did not undergo reassortment of NS gene

segments till time of investigation. Moreover, they harbor a

different H genotype (5J) from the commercial vaccinal strains

Discussion

85

genotypes (Fig. 9), which may illustrate why vaccination failure

commonly occurs, but confirming this hypothesis need further

studies. Phylogenetic analysis of NS and H genes, showed that

our isolates were phylogenetically distant from the H5N1 viruses

isolated from Egypt in 2006, 2007, 2008, indicating the Egyptian

H5N1 strain has dramatically evolved from the parental strain

that hit Egypt in 2006 (Figs. 8 and 9).The phylogenetic analysis

of H gene, showed that our isolates formed a uniform cluster that

was not identical to the HPAIV H5 strains used for commercial

vaccine development in Egypt, which may also elucidate why

vaccination failure occurs, but further studies are crucial to

confirm this assumption (Fig. 9).

AIV pathogenicity can be determined by calculating the

intravenous pathogenicity index or by characterizing the

molecular pathogenicity markers such as multiple basic amino

acids located at the cleavage site of the H protein (OIE manual,

2005). Analysis of H gene amino acids sequences at cleavage

site revealed that our isolates encodes a multibasic amino acid

motif, 321-PQGERRRKKR*GLF-333, at the H protein cleavage

site, which is a characteristic feature of all HPAIV H5N1 strains.

Interestingly, we found that one of our isolates has a substitution

of amino acid (R325K) at this cleavage site, to make it

PQGEKRRKKR*GLF, whether this mutation could or could not

have a role in the increased pathogenicity of the isolated strains,

this may need further studies.

The nonstructural protein 1 (NS1), considered the main

modulator of host immunity and a virulence factor, is a

Discussion

86

multifunctional protein that protect IAV against the antiviral

state (Falcon et al., 2005). In this study, we found that NS1

protein of our isolates carries molecular pathogenicity

determinants of HPAIV H5N1 strains including deleted

80TMASV84 motif, Glutamate at position 92 (D92E), and C-

terminus E-S-E-V motif (Seo et al., 2002, Obenauer et al,

2006) which provide another evidence that our isolates were of

high pathogenicity. Glutamate at position 92 (D92E) is

associated with Interferons (IFNs) down regulation and cytokine

resistance (Seo et al., 2002). The NS1 protein shares in both

protein-protein and protein-RNA interactions by two important

domains, the N-terminal structural domain (RNA-binding

domain, RBD) and the C-terminal structural domain (effector

domain). In the RNA binding domain of NS1, the bases

responsible for its functions were characterized as following;

Thr5, Pro31, Asp34, Arg35, Arg38, Lys41, Gly45, Arg46, Thr49

(Wang et al., 1999). For keeping the RNA-binding activity of

the NS1 protein Arg38 and Lys41 are necessary. Locations of

Arg38 and Lys41 are highly preservative characteristic for the

avian influenza virus strains. Our isolates possess arginin and

lysine at positions 38 and 41 respectively. The NS2/NEP protein

function depends on the nuclear export signal (NES) motif in its

N terminus region. The amino acid sequence in this region is

highly conserved. The amino acid sequence of NES and the

NS2/NEP sequence in the A/WSN/33 viruses have previously

been identified to be 12ILMRMSKMQL21 (Iwatsuki Horimoto

et al, 2004). The NES sequence of the NS2/NEP H5N1 samples

Discussion

87

in this study was identified to be 12ILVRMSKMQL21.

Tryptophan at position 78 (Trp78) is necessary for export of

ribonucleoprotein complexes from nucleus (Akarsu et al.,

2003). In our studied strains tryptophan was located in position

78. Taken together, full deduced amino acids analysis of NS1

and NS2 proteins of the Egyptian HPAI H5N1 viruses isolated in

2013 indicated that no substitutions, deletion and/ or insertion

have been yet occurred at the mostly important amino acid

residues of these two proteins.

Pathogenicity of infection by HPAIV H5N1 has been

studied experimentally in chickens and domestic ducks. Vietnam

HPAIV H5N1 caused high mortality in two- and four-week-old

SPF White Leghorn chickens (G. gallusdomesticus) (48/48,

100%) with mean death times (MDT) from 36 to 48 hrs, and

two- and five-week-old Pekinwhite ducks (Anasplatyrhynchus)

(63/64, 98.4%) with MDTs from 2.7 to 4.4 days (Pfeiffer et al.,

2009). Pathogenicity of the Egyptian HPAIV H5N1 have been

tested experimentally only in domestic ducks (Wasilenko et al.,

2011). While A/ck/Egypt/08 killed 8/8 (100%) with an MDT of

4.1 days, A/ck/Egypt/07 killed 4/8 (50%) with an MDT of 7

days, indicating that HPAIV H5N1 isolates differ in their

virulence. Although these two isolates are considered to have

evolved from the same origin (Wasilenko et al., 2011), they are

far apart within the clade 2.2 in the phylogenetic tree and have

evolved different pathogenicity since the HPAIV H5N1 of clade

2.2 was introduced into Egypt. On the other hand, pathogenicity

observed in these experimental challenges cannot be directly

Discussion

88

compared with that in natural outbreaks. Apparent differences

exist between SPF birds with a certain age group infected

experimentally by the intranasal route (IN) and poultry of

various ages in commercial farms by natural exposure. The

mortality rates in our report were lower in duck and even much

lower in once- and twice-vaccinated chickens during the

outbreaks. However, sick birds expressed severe systemic

symptoms included nervous disorders in both chickens and

ducks, and infection was confirmed by detection of IAV viral

antigen NP.

The isolated HPAI H5N1 viruses, A/chicken/Egypt/IT-

1/2013 and A/chicken/Egypt/IT-2/2013, clearly demonstrate

their pantropism in tissues of H5N1 infected chickens. The viral

RNA and NP antigen were detected in multiple tissues, including

trachea, lung, brain, liver, spleen, pancreas, intestines,

proventriculus, bursa of fabricius, and testis in infected chickens,

similar to those observed in chickens infected with the

Vietnamese H5N1 virus (Pfeiffer et al., 2009). We could

conclude that even though vaccination may lower mortality

rates, it does not change pantropism of HPAIV H5N1 in sick

birds.

Our study showed that high levels of viral RNA were

detected in the brains of infected chickens (Fig. 10) and that viral

NP antigen was observed in the nuclei of neurons and glial cells

of the brain (Fig. 11B), clear signs of virus replication in brain,

in agreement with (Brown et al., 2009; Pantin-Jackwood et al.,

2009; Tang et al., 2009; Goletic et al., 2010) who previously

Discussion

89

described neurotropism of HPAIV H5N1 strains. Different

pathways have been proposed by which the HPAI H5N1 virus

infects the central nervous system (CNS) in chickens. It has been

hypothesized that the virus could reach the CNS through the

olfactory nerves (Majde et al., 2007), the peripheral nervous

system (Tanaka et al., 2003; Matsuda et al., 2004), or even the

bloodstream (Mori et al., 1995). Interestingly, we observed the

viral NP antigen in endothelial cells of brain, which provides

direct evidence that the HPAIV H5N1 likely invades the CNS by

replicating in blood vessels in the brain, and contributes to the

development of severe nervous symptoms. Based on our

evidence, we consider this to be one of the routes for HPAIV

H5N1 to invade CNS. Severe CNS disorders in birds are

probably one of the main causes for mortality when neurons are

infected; massive edema due to virus infection-induced altered

vascular permeability and multi-organ failure are commonly

blamed for high mortality in HPAIV infected birds.

Mechanisms for viral penetration of the blood-brain

barrier in the brain have been investigated previously. The virus

may invade neurons through the opening of endothelial cell

junctional complexes (para-cellular route) (Lossinsky &

Shivers, 2004), or through vesiculo-tubular structures (trans-

cellular route) (Liu et al., 2002). It could reach the vessels in the

brain through the bloodstream, or via a “Trojan horse

mechanism” where viral particles are transported through

infection of leukocytes and/or mononuclear cells (Verma et al.,

2009). In our study, viral RNA or antigen was detected in blood

Discussion

90

or sera and infected macrophages and monocytes, which

suggests that the endothelial cells may play a crucial role in viral

penetration of the blood-brain barrier, leading to severe

necrotizing encephalopathy and death. Our finding that

endothelial cells of the cerebellum were also strongly positive in

viral NP antigen supports this hypothesis (Fig. 11B4).

The viral antigen was strongly expressed in the acinar

epithelium of pancreas, giving rise to the possibility of a

potential role of the pancreas in viral pathogenesis. Evidence

showed that the virus also replicated in lymphocytes of follicular

layer of the bursa, which may be significant in inducing

immunity against the virus, a key process for recovery of sick

birds from infection. A remarkable isolation of virus from

testicular tissue samples explained the severe embryonic

hemorrhages, congestion, and deaths within 48hrs post-infection

(Fig. 6A). Moreover, high viral RNA levels were detected from

testicular tissue (Fig. 10), with viral NP antigen expressed in

between or inside seminephrous tubules or even sticking to

sperms (Fig. 12F). However, sexual transmission for apparently

healthy cocks to spread HPAIV H5N1 during the incubation

period is probably a scenario of low or unlikely probability. It is

likely that sperm collected from infected cocks with healthy

appearance could disseminate virus to both uninfected birds, and

farm handlers and workers either via natural insemination or

during application of artificial insemination.

In conclusion, this study, firstly, identified that the

outbreak that appeared in commercial chickens and backyard

Discussion

91

ducks in Sharkia province, Egypt, 2013 was attributed to HPAIV

H5N1infection. Secondly, genetic and amino acid analysis of H

gene at cleavage site indicated that they carry molecular

determinants of HPAIV strains. Moreover, H protein of our

isolates belongs to genotype (5J) which is different genotype

from those strains used in some available commercial vaccines

currently used in Egypt. Thirdly, genetic and amino acid analysis

NS gene of viral isolates indicated that they belong to genotype

NS1E with no reassortment between H5N1 subtype and other

subtypes currently circulating in Egypt. The amino acids

residues of NS-1 and NS-2 proteins of our strain did not show

progressive evolution as we did not detect amino acids

substitution, deletion and or insertion at the most important

motifs of the NS1 protein. Fourthly, by IHC we confirmed the

pan-tropism of the Egyptian HPAIV H5N1 in naturally infected

chickens where endothelial cells, mononuclear cells, and

testicular tissues expressed obvious viral antigen. Detection of

viral antigen in endothelial and mononuclear cells reflects that

the virus may have disseminated in all birds tissues via these

cells. Moreover, expression of viral antigen in brain tissues

suggests that severe necrotizing encephalopathy may be at least

one of the possible causes of death of birds, if not the only cause.

By end of this study, we recommend further studies on

continued subtyping and full genome characterization of IA

viruses currently circulating in the Egyptian poultry field and

also, functional characterization of NS1protien to identify its

specific role in virulence of HPAI viruses. Vaccine efficacy

Discussion

92

studies, possibility of sexual transmission of IAV viruses, and

pathogenicity of HPAIV in naturally infected ducks are also

necessary studies.

SUMMARY

Summary

93

6-SUMMARY

Highly pathogenic avian influenza virus (HPAIV) H5N1

has been endemic in Egypt since 2006 and raised concern

recently for its potential to evolve and be of highly transmissible

among humans. Infection of HPAIV H5N1 has been described in

experimentally challenged birds. However, pathogenicity of

HPAIV H5N1, isolated in Egypt, has not been reported in

naturally infected chickens and ducks, which could be unique

due to distinct transmission routes and dosage of infection. Here

we report a recent outbreak of HPAIV H5N1 in 2013, in

commercial poultry farms in Sharkia Province, Egypt. The main

symptoms were ecchymoses on the shanks and feet, cyanosis of

the comb and wattles and subcutaneous edema of head and neck

for chickens, and nervous signs (torticollis) for ducks. Within

48-72 hrs of the onset of illness, the average mortality rates were

22.8-30% and 28.5-40% in vaccinated chickens and non-

vaccinated ducks, respectively. Tissue samples of chickens and

ducks were collected for cross-section immunohistochemistry

and realtime RT-PCR for specific viral RNA transcripts. Higher

viral RNA transcripts were detected in tissues of chicken broilers

and layers, including trachea, lung, spleen, intestine, brain, and

serum, than those of ducks which have only viral RNA

transcripts in trachea, lung, and liver tissues. In chickens, the

highest viral RNA levels appeared to be in brain, trachea, and

serum with significant differences detected between chicken

Summary

94

broilers and layers in theses tissues in particular. Significant

differences of the viral RNA were observed in trachea, lung, and

liver tissues of ducks than those of chickens, indicating that

HPAI H5N1 replicates with distinct tissue tropism between

chickens and ducks. However, these samples from different birds

cannot be compared because they came from natural outbreaks

with uncertain timing of the course of infection. While the viral

RNA was nearly detected in all tissues and serum collected

indicating viral pan-tropism, the viral antigen was detected

almost ubiquitously accordingly in all tissues including testicular

tissues. Interestingly, viral antigen was also observed in

endothelial cells of the most organs, and seen clearly in trachea

and brain in particular as well as in mononuclear cells of various

tissues particularly lungs. We performed phylogenetic analyses

and compared the genomic sequences of the surface

hemagglutinin (H) and non structural protein 1(NS1) among the

isolated viruses, the HPAI H5N1 viruses circulated in Egypt in

the past and currently, and some available commercial vaccinal

strains. Analysis of deduced amino acids of both HA and NS1

revealed that our isolates carry molecular determinants of HPAI

viruses, including the multibasic amino acids at the cleavage site

in HA and glutamate at position 92 (D92E), C – terminus E-S-E-

V motif, and the deletion at position 80-84 in NS1 protein.

Taken together, this is the first study about pathogenicity of the

HPAIV H5N1 strain, currently circulating in Egypt, from

naturally infected poultry, which provides unique understanding

Summary

95

of the viral pathogenesis in HPAIV H5N1 infected chickens and

ducks.

In conclusion, this study, firstly, identified that the

outbreak that appeared in commercial chickens and backyard

ducks in Sharkia province, Egypt, 2013 was attributed to HPAIV

H5N1infection. Secondly, genetic and amino acid analysis of H

gene at cleavage site indicated that they carry molecular

determinants of HPAIV strains. Moreover, H protein of our

isolates belongs to genotype (5J) which is different genotype

from those strains used in some available commercial vaccines

currently used in Egypt. Thirdly, genetic and amino acid analysis

NS gene of viral isolates indicated that they belong to genotype

NS1E with no reassortment between H5N1 subtype and other

subtypes currently circulating in Egypt. The amino acids

residues of NS-1 and NS-2 proteins of our strain did not show

progressive evolution as we did not detect amino acids

substitution, deletion and or insertion at the most important

motifs of the NS1 protein. Fourthly, by IHC we confirmed the

pan-tropism of the Egyptian HPAIV H5N1 in naturally infected

chickens where endothelial cells, mononuclear cells, and

testicular tissues expressed obvious viral antigen. Detection of

viral antigen in endothelial and mononuclear cells reflects that

the virus may have disseminated in all birds tissues via these

cells. Moreover, expression of viral antigen in brain tissues

suggests that severe necrotizing encephalopathy may be at least

one of the possible causes of death of birds, if not the only cause.

Summary

96

Last but not least, this study gives insights into pathogenesis of

HPAIV in naturally infected birds which may be different from

that obtained from experimentally infected birds due to distinct

viral dosage and route of infection, distinct age and immunity of

birds, and possibility of presence of contaminant infection. Thus

it can serve as an augmentation to and in comparison with

experimental studies. This study is also important to the

veterinarians to perform accurate diagnosis on the actual field

samples.

By end of this study, we recommend further studies on

continued subtyping and full genome characterization of IA

viruses currently circulating in the Egyptian poultry field and

also, functional characterization of NS1protien to identify its

specific role in virulence of HPAI viruses. Vaccine efficacy

studies, possibility of sexual transmission of IAV viruses, and

pathogenicity of HPAIV in naturally infected ducks are also

necessary studies.

140

REFERENCES

References

97

7. REFERENCES

Abdelwhab, E. M. & Hafez, H. M. (2011). An overview of the

epidemic of highly pathogenic H5N1 avian influenza

virus in Egypt: epidemiology and control challenges.

Epidemiology and Infection, 139(05), 647-657.7

Abdelwhab, E. M., Arafa, A., Selim, A., Samaha, H., Kilany,

W. H., Shereen, G., Hassan, M. K., Aly, M. M. and

Hafez, H. M. (2009). Highly pathogenic avian influenza

in H5N1 in Egypt: Current situation and challenges. In:

Proceedings of the 5thInternational Meeting of the

Working Group 10 (Turkey) of WPSA (Ed. Hafez, H.M).

28th – 30th May, Berlin. Berlin. Mensch & Buch Verlag

pp. 308 – 316.

Abdelwhab, E. M., Selim A. A., Arafa, A., Galal, S., Kilany,

W. H., Hassan, M. K., … & Hafez, M. H. (2010).

Circulation of avian influenza H5N1 in live bird markets

in Egypt. Avian diseases 54 (2), 911-914.

Aclandl, H. M., Silverman-Bachin, L. A. and Eckroade, R. J.

(1984). Lesions in broiler and layer chickens in an

outbreak of highly pathogenic avian influenza virus

infection. Veterinary Pathology, 21: 564-569.

Akarsu, H., Burmeister, W. P., Petosa, C., Petit, I., Müller,

C. W., Ruigrok, R. W., & Baudin, F. (2003). Crystal

structure of the M1 protein‐binding domain of the

References

98

influenza A virus nuclear export protein (NEP/NS2). The

EMBO journal, 22(18), 4646-4655.

Alexander, D. J. (2000). A review of avian influenza in

different bird species. Veterinary Microbiology, 74:3-13.

Alexander, D. J. (2008). Orthomyxoviridae – avian influenza

Poultry Diseases. Chapter 26, (Sixth Edition), Pages 317-

332.

Alexander, D.J. (2007). An overview of the epidemiology of

Avian Influenza. Vaccine; 25: 5637- 5644.

Alexander, D.J. and Gough, R.E. (1986). Isolations of avian

influenza virus from birds in great Britain. Veterinary

Record, 118:535-538.

Aly, M., Arafa, A., Hassan, M., (2008). Epidemiological

findings of outbreaks of disease caused by highly

pathogenic H5N1 avian influenza virus in poultry in

Egypt during 2006. Avian diseases, 52: 269-277.

amplification. Ann. Diagn. Pathol. 10, 117–131.

Arafa, A., Suarez, D.L., Hassan, M. K. and Aly, M. M. (2010):

Phylogenetic analysis of hemagglutinin and neuraminidase

genes of highly pathogenic avian influenza H5N1 Egyptian

strains isolated from 2006 to 2008 indicates heterogeneity

with multiple distinct sublineages. Avian Diseases, 54:345-

349.

Armstrong, R.T., Kushnir, A. S., White, J. M. (2000). The

transmembrane domain of influenza hemagglutinin

References

99

exhibits a stringent length requirement to support the

hemifusion to fusion transition. Journal of Cell Biology,

151:425-437.

Beard, C. W., Schnitzlein, W. M., Tripathy, D. N. (1991).

Protection ofchickens against highly pathogenic avian

influenza virus (H5N2) by recombinant fowlpox viruses.

Avian Diseases, 35:356-359.

Belshe, R.B. (2005). The origins of pandemic influenza -lessons

from the 1918 virus. N Engl J Med., 353: 2209-11.

Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger,

H., Wolff, K., Palese, P., Muster, T., (2000). Influenza

virus NS1 protein counteracts PKR mediated inhibition of

replication. Journal of Virology, 74: 6203-6206.

Bornholdt, Z. A., Prasad, B., V. (2006). X-ray structure of

influenza virus NS1 effector domain. Nat Struct Mol Biol,

2006, 13: 559−560.

Bröjer, C., Ågren, E. O., Uhlhorn, H., Bernodt, K., Mörner,

T., Désirée, Jansson, S., Mattsson, R., Zohari, S.,

Thorén, P., Berg, M. and Gavier-Widén, D. (2009).

Pathology of Natural Highly Pathogenic Avian Influenza

H5N1 Infection in Wild Tufted Ducks (AythyaFuligula).

Journal of Veterinary Diagnostic Investigation, 21:579–

587.

Brown, E. G. (2000). Influenza virus genetics. Biomedecine &

Pharmacotherapy, 54:196-209.

References

100

Brown, J. D., Stallknecht, D. E., Beck, J. R., Suarez, D. L.

and Swayne, D. E. (2006). Susceptibility of North

American ducks and gulls to H5N1 highly pathogenic

avian influenza viruses. Emerging Infectious Diseases,

12: 1663-1670.

Brown, J. D., Stallknecht, D. E., Berghaus, R. D., & Swayne,

D. E. (2009). Infectious and lethal doses of H5N1 highly

pathogenic avian influenza virus for house sparrows

(Passer domesticus) and rock pigeons (Columbia livia).

Journal of veterinary diagnostic investigation, 21(4), 437-

445.

Bullido, R., Gomez-Puertas, P., Saiz, M. J., Portela, A.

(2001). Influenza A virus NEP (NS2 protein) down-

regulates RNA synthesis of model template RNAs. J

Virol 2001, 75: 4912−4917.

Burgui, I., Aragon, T., Ortin, J., Nieto, A. (2003). PABP1 and

eIF4GI associate with influenza virus NS1 protein in viral

mRNA translation initiation complexes. Journal of

General Virology, 2003, 84: 3263−3274.

Capua, I. and Alexander, D.J. (2004). Avian influenza: recent

developments. Avian Pathology, 33, 393–404.

Capua, I., Alexander, D.J., (2006). The challenge of avian

influenza to the veterinary community. Avian Pathology,

35, 189-205.

References

101

Capua, I., and Marangon, S. (2007). The challenge of

controlling notifiable avian influenza by means of

vaccination. Avian Diseases, 51:317-322.

Cattoli, G., Drago, A., Maniero, S., Toffan, A., Bertoli, E.,

Fassina, S., Terregino, C., Robbi, C., Vicenzoni, G.,

Capua, I. (2004). Comparison of three rapid detection

systems for type A influenza virus on tracheal swabs of

experimentally and naturally infected birds. Avian

Patholology, 33:432-437.

Centanni, E. and Savonuzzi, E. (1901). La peste aviaria I&II,

Communicazione fatta all’accademia delle scienze

mediche enaturali de Ferrara. Reported by Alexander,

D.J. and Brown, I.H. (2009). History of highly pathogenic

avian influenza. Rev. sci. tech. Off. int. Epiz., 28 (1), 19-

38.

Chamnanpood, C., Sanguansermsri, D., Pongcharoen, S., &

Sanguansermsri, P. (2011). Detection of distribution of

avian influenza H5N1 virus by immunohistochemistry,

chromogenic in situ hybridization and real-time PCR

techniques in experimentally infected chickens. Southeast

Asian Journal of Tropical Medicineand Public Health,

42(2), 303.

Charlton, B., Crossley, B., Hietala, S. (2009). Conventional

and future diagnostics for avian influenza. Comparative

Immunology & Microbiology Infection Diseases, 32:341-

350.

References

102

Chen, J., Lee, K. H., Steinhauer, D. A., Stevens, D. J., Skehel,

J. J., Wiley, D. C. (1998). Structure of the hemagglutinin

precursor cleavage site, a determinant of influenza

pathogenicity and the origin of the labile conformation.

Cell, 95:409-417.

Chen, W., Calvo, P. A., Malide, D., Gibbs, J., Schubert, U.,

Bacik, I., ... & Yewdell, J. W. (2001). A novel influenza

A virus mitochondrial protein that induces cell

death. Nature medicine, 7(12), 1306-1312.

Chen, Z., Li, Y., & Krug, R. M. (1999). Influenza A virus NS1

protein targetspoly (A)‐binding protein II of the cellular

3′‐end processing machinery. The EMBO journal, 18(8),

2273-2283.

Cheung, T. K. W. and Poon, L. L. M. (2008). Biology of

Influenza A Virus. Annals NY Acad Sci, 1102:1-25.

Cox, N. J., & Subbarao, K. (2000). Global epidemiology of

influenza: past and present. Annual review of

medicine, 51(1), 407-421.

Dankar, S. K., Wang, S., Ping, J., Forbes, N. E., Keleta, L.,

Li, Y., & Brown, E. G. (2011). Influenza A virus NS1

gene mutations F103L and M106I increase replication

and virulence. Virol J, 8(1), 13.

Donelan, N. R., Basler, C. F., Garcia-Sastre, A. (2003). A

recombinant influenza A virus expressing an RNA-

binding-defective NS1 protein induces high levels of beta

References

103

interferon and is attenuated in mice. J Virol 2003, 77:

13257−13266.

Ducatez, M. F., Olinger, C. M., Owoade, A. A., Tarnagda, Z.,

Tahita, M. C., Sow, A., De Landtsheer, S.,

Ammerlaan, W., Ouedraogo, J. B., Osterhaus, A.D.,

Fouchier, R. A., Muller, C. P. (2007). Molecular and

antigenic evolution and geographical spread of H5N1

highly pathogenic avian influenza viruses in western

Africa. J Gen Virol, 88:2297-2306.

Duvvuri, V. R., Duvvuri, B., Cuff, W. R., Wu, G. E., Wu, J.

(2009). Role of positive selection pressure on the

evolution of H5N1 hemagglutinin. Genomics Proteomics

Bioinformatics, 7:47-56.

Easterday, B.C; Hinshaw, V.S and Halvorson, D.A. (1997).

Avian influenza in diseases of poultry. (eds) Dis. Of

poultry, 10th ed. Iowa State University Press: Ames, 583-

605.

Efferson, C., Kawano, K., Sellappan, S., Yu, D., Babaian, R.,

Palese, P., ... & Murray, J. (2004). Prostate Tumor Cells

Infected with a Recombinant Influenza Virus with

Truncated NS1 Gene NS1 (1-126) Activate Cytolytic

CD8+ Cells Which Recognize Non-Infected

Tumors. Journal of Immunotherapy, 27(6), S53.

Elhafi, G., C. J. Naylor, C. E. Savage, and R. C. Jones,

(2004). Microwave or autoclave treatments destroy the

References

104

infectivity of infectious bronchitis virus and avian

Pneumovirus but allow detection by reverse transcriptase-

polymerase chain reaction. Avian Pathology, 33, 303–

306.

El-Zoghby, E. F., Aly, M. M., Nasef, S. A., Hassan, M. K.,

Arafa, A. S., Selim, A. A., ... & Hafez, H. M. (2013).

Surveillance on A/H5N1 virus in domestic poultry and

wild birds in Egypt. Virol J, 10, 203.

Enserink, M. (2006). H5N1 moves into Africa, European

Union, deepening global crisis. Science, 311: 932-932.

Erica Spackman (March 2005). Real-Time Reverse

Transcriptase-Polymerase Chain Reaction for the

Detection of Type A Influenza and the Avian H5 and H7

HA subtypes in tracheal and cloacal samples. Cepheid

Smart Cycler Protocol, USDA, National Veterinary

Science Laboratory.

Falcon, A. M., Fernandez-Sesma, A., Nakaya, Y., Moran, T.

M., Ortin, J., GarciaSastre, A. (2005). Attenuation and

immunogenicity in mice of temperature-sensitive

influenza viruses expressing truncated NS1 proteins. J

Gen Virol, 2005, 86: 2817−2821.

Falcón, A. M., Fernandez-Sesma, A., Nakaya, Y., Moran, T.

M., Ortín, J., & García-Sastre, A. (2005). Attenuation

and immunogenicity in mice of temperature-sensitive

References

105

influenza viruses expressing truncated NS1 proteins.

Journal of general virology, 86(10), 2817-2821.

Fasina, F. O., Bisschop, S. P. R., Joannis, T.M., Lombin, L.H.

and Abolnik, C. (2009). Molecular characterization and

epidemiology of the highly pathogenic avian influenza

H5N1 in Nigeria. Epidemiol. Infect, 137: 456–463.

Ferguson, N. M., Galvani, A. P., Bush, R. M. (2003).

Ecological and immunological determinants of influenza

evolution. Nature, 422:428-433.

Fouchier, R. A., Munster, V., Wallensten, A., Bestebroer, T.

N., Herfst, S., Smith, D., Rimmelzwaan, G. F., Olsen,

B., Osterhaus, A. D. (2005). Characterization of a novel

influenza A virus hemagglutinin subtype (H16) obtained

from black-headed gulls. J Virol, 79:2814-2822.

Garcia, M., Crawford, J. M., Latimer, J. W., Rivera-Cruz,

E., Perdue, M. L. (1996). Heterogeneity in the

haemagglutinin gene and emergence of the highly

pathogenic phenotype among recent H5N2 avian

influenza viruses from Mexico. J Gen Virol, 77:1493 -

1504.

Garcia-Sastre, A., Egorov, A., Matassov, D., Brandt, S.,

Levy, D.E., Durbin, J.E., Palese, P., Muster, T., (1998).

Influenza A virus lacking the NS1 gene replicates in

interferon-deficient systems. Virology, 252: 324-330.

References

106

Gardin, Y. (2007). Vaccination against H5N1 highly pathogenic

avian influenza: some questions to be addressed. In:

Proceedings of the 56th Western Poultry Diseases

Conference, Las Vegas, Nv, USA.

Garten, W. and Klenk, H. D. (1983). Characterization of the

carboxypeptidase involved in the proteolytic cleavage of

the influenza haemagglutinin. J Gen Virol, 64:2127-2137.

Goletic, T., Gagic, A., Rešidbegovic, E., Kustura, A.,

Kavazovic, A., Savic, V., ... & Prašovic, S. (2010).

Highly pathogenic avian influenza virus subtype H5N1 in

mute swans (Cygnus olor) in central Bosnia. Avian

diseases, 54(s1), 496-501.

Grund, C., Abdelwhab, E. S. M., Arafa, A. S., Ziller, M.,

Hassan, M. K., Aly, M. M., ... & Beer, M. (2011).

Highly pathogenic avian influenza virus H5N1 from

Egypt escapes vaccine-induced immunity but confers

clinical protection against a heterologous clade 2.2. 1

Egyptian isolate. Vaccine, 29(33), 5567-5573.

Günther-Ausborn, S., Schoen, P., Bartoldus, I., Wilschut, J.

and Stegmann, T. (2000). Role of Hemagglutinin

Surface Density in the Initial Stages of Influenza Virus

Fusion: Lack of Evidence for Cooperativity. Journal of

Virology, 74(6): 2714–2720.

Hafez, H. M. (2008). Respiratory diseases of poultry:diagnosis

and control. In: Proceedings of the 8th Scientific

References

107

Conference of the Egyptian Veterinary Poultry

Association, Cairo, pp 174–186.

Hafez, M. H., Arafa, A., Abdelwhab, E. M., Selim, A.,

Khoulosy, S. G., Hassan, M. K., Aly, M. M. (2010).

Avian influenza H5N1 infections in vaccinated

commercial poultry and backyard birds in Egypt. Poultry

Science, 89:1609-1613.

Halvorson, D. A. (2002). The control ofH5 or H7 mildly

pathogenic avian influenza: a role for inactivated vaccine.

Avian Pathol, 31:5-12.

Hatada, E., Saito, S., Fukuda, R. (1999). Mutant influenza

viruses with a defective NS1protein cannot block the

activation of PKR in infected cells. J Virol, 1999, 73:

2425−2433.

Hirst, G. K. (1941). The agglutination of red cells by allantoic

fluid of chick embryos infected with influenza virus.

Science, 94, 22-23.

Hoffmann, E., Stech, J., Guan, Y., Webster, R. G., & Perez,

D. R. (2001). Universal primer set for the full-length

amplification of all influenza A viruses. Archives of

virology, 146(12), 2275-2289.

House, C., House, J. A., & Yedloutschnig, R. J. (1990).

Inactivation of viral agents in bovine serum by gamma

irradiation. Canadian journal of microbiology, 36(10),

737-740.

References

108

Hussein, H.A., Sultan, H.A., El-Deeb, A.H. and EL-Sanousi,

A.A. (2009). Possible Causes of Re- Emerging outbreaks

of H5N1 Avian Influenza Virus in Vaccinated Chickens in

Sharkia Governorate in Egypt. International Journal of

Virology, 5 (1): 36-43.

Irvine, R. M., Banks, J., Londt, B. Z., Lister, S. A., Manvell,

R. J., Outtrim, L., ... & Brown, I. H. (2007). Outbreak

of highly pathogenic avian influenza caused by Asian

lineage H5N1 virus in turkeys in Great Britain in January

2007.Veterinary record, 161(3), 100-101.

Iwatsuki-Horimoto, K., Horimoto, T., Fujii, Y., & Kawaoka,

Y. (2004). Generation of influenza A virus NS2 (NEP)

mutants with an altered nuclear export signal

sequence. Journal of virology, 78(18), 10149-10155.

Kaverin, N. V., Rudneva, I. A., Govorkova, E. A.,

Timofeeva, T. A., Shilov, A. A., Kochergin-Nikitsky,

K. S., Krylov, P. S., Webster, R. G. (2007). Epitope

mapping of the hemagglutinin molecule of a highly

pathogenic H5N1 influenza virus by using monoclonal

antibodies. J Virol, 81:12911-12917.

Keawcharoen, J., Van Riel, D., van Amerongen, G.,

Bestebroer, T., Beyer, W. E., Van Lavieren, R., ... &

Kuiken, T. (2008). Wild ducks as long-distance vectors

of highly pathogenic avian influenza virus

(H5N1). Emerging infectious diseases, 14(4), 600.

References

109

Key, M. (2006). Immunohistochemistry Staining Methods.

Education Guide Immunohistochemical Staining Methods

Fourth Edition, 47.

Kimura, M. (1980). A simple method for estimating

evolutionary rates of base substitutions through

comparative studies of nucleotide sequences. Journal of

molecular evolution, 16(2), 111-120.

Klenk, H. D. and Garten, W. (1994). Host cell proteases

controlling virus pathogenicity. Trends Microbiol, 2:39-

43.

Krug, R. M., Yuan, W., Noah, D. L., Latham, A. G. (2003).

Intracellular warfare between human influenza viruses

and human cells: The roles of the viral NS1 protein.

Virology 2003, 309: 181−189.

Kuiken, T., van den Brand, J., van Riel, D., Pantin-

Jackwood, M. and Swayne, D. E. (2010). Comparative

pathology of select agent influenza a virus infections. Vet

Pathology, 47(5):893-914.

Lee, C. W. and Suarez, D. L. (2004). Application of real time

RT-PCR for the quantification and competitive replication

study of H5&H7 subtype avian influenza virus. Journal of

Virological Methods, 119: 151-158.

Lee, C. W., Senne, D. A., Suarez, D. L. (2004). Effect of

vaccine use in the evolution of Mexican lineage H5N2

avian virus. J Virol, 78:8372-8331.


http://www.ncbi.nlm.nih.gov/pubmed?term=%22van%20Riel%20D%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Pantin-Jackwood%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Pantin-Jackwood%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Swayne%20DE%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed/20682805


References

110

Lee, C., Suarez, D. L., Tumpey, T. M., Sung, H., Kwon, Y.,

Lee, Y., Choi, J., Joh, S., Kim, M., Lee, E., Park, J.,

Lu, X., Katz, J. M., Spackman, E., Swayne, D. E. and

Kim, J. (2005). Characterization of Highly Pathogenic

H5N1 Avian Influenza A Viruses Isolated from South

Korea. Journal of virology, 79(6): 3692–3702.

Li, S., Min, J. Y., Krug, R. M., Sen, G. C. (2006). Binding of

the influenza A virus NS1 protein to PKR mediates the

inhibition of its activation by either PACT or double-

stranded RNA. Virology 2006, 349: 13−21.

Li, W. X., Li, H., Lu, R., Li, F., Dus, M., Atkinson, P., ... &

Ding, S. W. (2004). Interferon antagonist proteins of

influenza and vaccinia viruses are suppressors of RNA

silencing. Proceedings of the National Academy of

Sciences of the United States of America, 101(5), 1350-

1355.

Ligon, B. L. (2005). Avian influenza virus H5N1: a review of its

history and information regarding its potential to cause

the next pandemic. In Seminars in Pediatric Infectious

Diseases (Vol. 16, No. 4, pp. 326-335). WB Saunders.

Lin, D., Lan, J., & Zhang, Z. (2007). Structure and function of

the NS1 protein of influenza A virus. Acta biochimica et

biophysica Sinica, 39(3), 155-162.

Liu, N. Q., Lossinsky, A. S., Popik, W., Li, X., Gujuluva, C.,

Kriederman, B., ... & Fiala, M. (2002). Human

immunodeficiency virus type 1 enters brain microvascular

References

111

endothelia by macropinocytosis dependent on lipid rafts

and the mitogen-activated protein kinase signaling

pathway. Journal of virology, 76(13), 6689-6700.

Lossinsky, A. S., & Shivers, R. R. (2004). Structural pathways

for macromolecular and cellular transport across the

blood-brain barrier during inflammatory conditions.

Review. Histology and histopathology, 19(2), 535-564.

Lu, G., Rowley, T., Garten, R., & Donis, R. O. (2007).

FluGenome: a web tool for genotyping influenza A

virus. Nucleic acids research, 35(suppl 2), W275-W279.

Lu, Y., Wambach, M., Katze, M. G., Krug, R. M. (1995).

Binding of the influenza virus NS1 protein to double-

stranded RNA inhibits the activation of the protein kinase

that phosphorylates the elF-2 translation initiation factor.

Virology 1995, 214: 222−228.

Majde, J. A., Bohnet, S. G., Ellis, G. A., Churchill, L., Leyva-

Grado, V., Wu, M., ... & Krueger, J. M. (2007).

Detection of mouse-adapted human influenza virus in the

olfactory bulbs of mice within hours after intranasal

infection.Journal of neurovirology, 13(5), 399-409.

Maris, P. (1990). Efficacite´ virucide de huit de´sinfectants

contre le pneumovirus, coronavirus et parvovirus. Ann.

Rech. Vet., 21, 275–279.

Matsuda, K., Park, C. H., Sunden, Y., Kimura, T., Ochiai,

K., Kida, H., & Umemura, T. (2004). The vagus nerve

References

112

is one route of transneural invasion for intranasally

inoculated influenza A virus in mice. Veterinary

Pathology Online,41(2), 101-107.

Meleigy, M. (2007). Egypt battles with avian influenza. Lancet,

370:553-554.

Min, J. Y., Krug, R. M. (2006). The primary function of RNA

binding by the influenza A virus NS1 protein in infected

cells: Inhibiting the 2'−5'oligo (A) synthetase/ RNase L

pathway. Proc Natl Acad Sci USA 2006, 103: 7100−7105.

Moresco, K. A., Stallknecht, D. E., Swayne, D. E. (2010).

Evaluation and attempted optimization of avian embryos

and cell culture methods for efficient isolation and

propagation of low pathogenicity avian influenza viruses.

Avian Dis, 54:622-626.

Mori, I., Komatsu, T., Takeuchi, K., Nakakuki, K., Sudo, M.,

& Kimura, Y. (1995). Viremia induced by influenza

virus. Microbial pathogenesis, 19(4), 237-244.

Munch, M., Nielsen, L. P., Handberg, K. J., Jørgensen, P. H.

(2001). Detection and subtyping (H5 and H7) of avian

type A influenza virus by reverse transcription-PCR and

PCR-ELISA. Arch Virol, 146:87-97.

Muramoto, Y., Noda, T., Kawakami, E., Akkina, R., &

Kawaoka, Y. (2013). Identification of novel influenza A

virus proteins translated from PA mRNA. Journal of

virology, 87(5), 2455-2462.

References

113

Murphy, F. A., Gibbs, E. P. J., Horzinek, M. C. and

Studdert, M. J. (1999).Veterinary Virology, 3rd edition.

Academic Press, 459-468.

Neumann, G., Macken, C. A., Karasin, A. I., Fouchier, R. A.,

& Kawaoka, Y. (2012). Egyptian H5N1 Influenza

Viruses—Cause for Concern?. PLoS pathogens, 8(11),

e1002932.

Njouom, R., Aubin, J. T., Bella, A. L., Demsa, B. M.,

Rouquet, P., Gake, B., ... & Rousset, D. (2008). Highly

pathogenic avian influenza virus subtype H5N1 in ducks

in the Northern part of Cameroon. Veterinary

Microbiology, 130(3), 380-384.

Noah, D. L., Twu, K. Y., Krug, R. M. (2003). Cellular antiviral

responses against influenza A virus are countered at the

posttranscriptional level by the viral NS1A protein via its

binding to a cellular protein required for the 3'end

processing of cellular pre-mRNAs. Virology 2003, 307:

386−395.

NOLL, H., & Youngner, J. S. (1959). Virus-lipid interactions.

II. The mechanism of adsorption of lipophilic viruses to

water-insoluble polar lipids. Virology, 8(3), 319-343.

Nuovo, G. J. (2006). The surgical and cytopathology of viral

infections: utility of immunohistochemistry, in situ

hybridization, and in situ polymerase chain reaction

amplification. Annals of diagnostic pathology, 10(2), 117-

131.

References

114

Obenauer, J. C., Denson, J., Mehta, P. K., Su, X., Mukatira,

S., Finkelstein, D. B., ... & Naeve, C. W. (2006). Large-

scale sequence analysis of avian influenza isolates.

Science, 311(5767), 1576-1580.

OIE (2005). OIE manual of diagnostic tests and vaccines for

terrestrial animals. Chapter, 2, 12.

OIE (2008). Update on highly pathogenic avian influenza in

animals (type H5 and H7).

OIE (2009). Office International des Epizoties.Chapter 2.3.4.

Avian Influenza. Manual of Diagnostic Tests and

Vaccines for Terrestrial Animals. http: //www. oie. int/

fileadmin/ Home/ eng/ Health_standards/tahm

2.03.04_AI.pdf. (Accessed 7th July 2011).

Olander, H. J., Brown, C. C. and Senne, D. (1991).

Immunohistochemical demonstration of the distribution

of avian influenza virus subtype H5N2 in mature chickens

after experimental exposure. Proceeding Annual Meeting

Am. Coll. Veterinary Pathology, 42: 19.

Pantin-Jackwood, M. J., & Swayne, D. E. (2009).

Pathogenesis and pathobiology of avian influenza virus

infection in birds. Revue scientifique et technique

(International Office of Epizootics), 28(1), 113-136.

Parrish, C. R. and Kawaoka, Y. (2005). The origins ofnew

pandemic viruses: the acquisition of new host ranges by

References

115

canine parvovirus and influenza A viruses. Annu Rev

Microbiol, 59:553-586.

Pearson, J. E. (2003). International standards for the control of

avian influenza. Avian Dis, 47:972-975.

Peiris, J.S.M., de Jong, M.D., Guan, Y., (2007). Avian

influenza virus (H5N1): a threat to human health. Clin.

Microbiol. Rev., 20, 243–267.

Perdue, M. L. and Swayne, D. E. (2005). Public healthrisk

from avian influenza viruses. Avian Dis, 49:317-327.

Perroncito, E. (1878). Epizoozia tifoide neigalliancei. Annali

della Academia d'agricoltora di Torino 21, 87-126.

Petersen, H., Wang, Z., Lenz, E., Pleschka, S., &

Rautenschlein, S. (2013). Reassortment of NS segments

modifies highly pathogenic avian influenza virus

interaction with avian hosts and host cells. Journal of

virology, 87(10), 5362-5371.

Peyre, M., Samaha, H., Makonnen, Y. J., Saad, A., Abd-

Elnabi, A., Galal, S., Ettel, T., Dauphin, G., Lubroth,

J., Roger, F., Domenech, J. (2009). Avian influenza

vaccination in Egypt: Limitations of the current strategy.

J Mol Genet Med, 3:198-204.

Pfeiffer, J., Pantin-Jackwood, M., To, T. L., Nguyen, T., &

Suarez, D. L. (2009). Phylogenetic and biological

characterization of highly pathogenic H5N1 avian

References

116

influenza viruses (Vietnam 2005) in chickens and

ducks. Virus research,142(1), 108-120.

Philippa, J., Baas, C., Beyer, W., Bestebroer, T., Fouchier,

R., Smith, D., Schaftenaar, W., Osterhaus, A. (2007).

Vaccination against highly pathogenic avian influenza

H5N1 virus in zoos using an adjuvanted inactivated H5N2

vaccine. Vaccine, 25:3800-3808.

Pinto, L. H. and Lamb, R. A. (2007). Controlling influenza

virus replication by inhibiting its proton channel.

Molecular Biosystems, 3: 18–23.

Puri, A., F. P. Booy, R. W. Doms, J. M. White, and R.

Blumenthal, (1990). Conformational changes and fusion

activity of influenza virus haemagglutinin of the H2 and

H3 subtypes: effects of acid pre-treatment. J. Virol., 8,

3824– 3832.

Qian, X. Y., Chien, C. Y., Lu, Y., Montelione, G. T., Krug, R.

M. (1995). An amino-terminal polypeptide fragment of

the influenza virus NS1 protein possesses specific RNA-

binding activity and largely helical backbone structure.

RNA, 1995, 1: 948−956.

Rogers, G. N. and Paulson, J. C. (1983). Receptor determinants

of human and animal influenza virus isolates: differences

in receptor specificity of the H3 hemagglutinin based on

species of origin. Virology, 127: 361-373.

References

117

Rules, I. I. T. (1969). A one letter notation for amino acid

sequence. Biochem. J, 113, 1-4.

Saif, Y. M., Barnes, H. J., Fadly, A. M., Glisson, J. R.,

McDougald, L. R. and Swayne, D. E. (2008). Influenza

in DISEASES OF POULTRY, 12th ed. D.E. Swayne and

D. A. Halvorson, eds. Black Well Publishing, 153-184.

Salzberg, S. L., Kingsford, C., Cattoli, G., Spiro, D. J.,

Janies, D. A., Aly, M. M., ... & Capua, I. (2007).

Genome analysis linking recent European and African

influenza (H5N1) viruses. Emerging infectious

diseases, 13(5), 713.

Schafer, W. (1955). Vergleichende sero-immunologische

untersuchungen uber die viren der influenza unf

klassichen geflugelpest. Z Naturforsch 10B, 81-91.

Seo, S. H., Hoffmann, E., & Webster, R. G. (2002). Lethal

H5N1 influenza viruses escape host anti-viral cytokine

responses. Nature medicine, 8(9), 950-954.

Shi, W., Lei, F., Zhu, C., Sievers, F., Higgins, D. G. (2010). A

complete analysis of HA and NA genes of influenza A

viruses. PLoS One, 5(12):e14454.

Slemons, R. D. and Swayne, D. E. (1990). Experimental

evidence for kidney tropism properties among waterfowl-

origin avian influenza viruses. Proceeding American

Veterinary Medical Association, 127: 107.

References

118

Smith, W., Andrewes, C. H., and Laidlaw, P. P. (1933). A

virus obtained from influenza patients. Lancet II, 66-68.

Spackman, E., and Suarez, D. L. (2008). Detection and

Identification of the H5 Hemagglutinin Subtype by Real-

Time RT-PCR. In E. Spackman (Ed.). Avian Influenza

Virus. 1st edn. Humana Press, Totowa, NJ. pp. 27 33.

Spackman, E., Senne, D. A., Myers, T. J., Bulaga, L. L.,

Garber, L. P., Perdue, M. L., ... & Suarez, D. L.

(2002). Development of a real-time reverse transcriptase

PCR assay for type A influenza virus and the avian H5

and H7 hemagglutinin subtypes. Journal of clinical

microbiology, 40(9), 3256-3260.

Spickler, A. R., Trampel, D. W. & Roth, J. A. (2008). The

onset of virus shedding and clinical signs in chickens

infected with high-pathogenicity and low-pathogenicity

avian influenza viruses. Avian Pathol, 37, 555–577.

Stasakova, J., Ferko, B., Kittel, C., Sereinig, S., Romanova,

J., Katinger, H., Egorov, A. (2005). Influenza A mutant

viruses with altered NS1 protein function provoke

caspase-1 activation in primary human macrophages,

resulting in fast apoptosis and release of high levels of

interleukins 1βand 18. J Gen Virol 2005, 86: 185−195.

Steinhauer, D. A. (1999). Role of hemagglutinin cleavage for

the pathogenicity of influenza virus. Virology, 258(1): 1-

20.


References

119

Stevens, J., Blixt, O., Paulson, J. C., Wilson, I. A. (2006).

Glycan microarray technologies: tools to survey host

specificity of influenza viruses. Nat Rev Microbiol, 4:857-

864.

Suarez, D. L. (2008). Influenza A virus. In: Swayne, D.E. (Ed.).

Avian influenza virus. Ames, IA: Blackwell. pp. 3-22.

Suarez, D. L., & Schultz-Cherry, S. (2000). Immunology of

avian influenza virus: a review. Developmental &

Comparative Immunology.

Swayne, D. E. (2007). Understanding the complex pathobiology

of high pathogenicity avian influenza viruses in birds.

Avian Dis, 51, 242–249.

Swayne, D. E. (2009). Avian influenza vaccines and therapies

for poultry. Comp Immunol Microbiol Infect Dis, 32:351-

363.

Swayne, D. E. and Slemons, R. D. (1994). Comparative

Pathology of a Chicken-origin and Two Duck-origin

Influenza Virus Isolates in Chickens: The Effect of Route

of Inoculation. Veterinary Pathology, 31: 237-245.

Swayne, D. E., (2006). Microassay for measuring thermal

inactivation of H5N1 high pathogenicity avian influenza

virus in naturally infected chicken meat. Int. J. Food.

Microbiol., 108, 268–271.

References

120

Taha, S.H., Mehrez, M.A., Sitohy, M.Z., Abou Dawood,

A.G.I., Abd-El Hamid, M.M. and Kilany, W.H. (2010).

Effectiveness of esterified whey proteins fractions against

Egyptian Lethal Avian Influenza A (H5N1). Virology

Journal, vol. 7, p. 330.

Tanaka, H., Park, C. H., Ninomiya, A., Ozaki, H., Takada,

A., Umemura, T., & Kida, H. (2003). Neurotropism of

the 1997 Hong Kong H5N1 influenza virus in

mice. Veterinary microbiology, 95(1), 1-13.

Tang, Y., Wu, P., Peng, D., Wang, X., Wan, H., Zhang, P., ...

& Liu, X. (2009). Characterization of duck H5N1

influenza viruses with differing pathogenicity in mallard

(Anas platyrhynchos) ducks. Avian Pathology, 38(6),

457-467.

Tian, G., Zeng, X., Li, Y., Shi, J. and Chen, H. (2010).

Protective Efficacy of the H5 Inactivated Vaccine against

Different Highly Pathogenic H5N1 Avian Influenza

Viruses Isolated in China and Vietnam. Avian Diseases,

54(s1):287-289.

Tong, S., Li, Y., Rivailler, P., Conrardy, C., Castillo, D. A.

A., Chen, L. M., ... & Donis, R. O. (2012). A distinct

lineage of influenza A virus from bats. Proceedings of the

National Academy of Sciences, 109(11), 4269-4274.

Tong, S., Zhu, X., Li, Y., Shi, M., Zhang, J., Bourgeois, M., ...

& Donis, R. O. (2013). New world bats harbor diverse

influenza a viruses. PLoS pathogens, 9(10), e1003657.

References

121

Tsukamoto, K., Ashizawa, T., Nakanishi, K., Kaji, N.,

Suzuki, K., Shishido, M., ... & Mase, M. (2009). Use of

reverse transcriptase PCR to subtype N1 to N9

neuraminidase genes of avian influenza viruses. Journal

of clinical microbiology, 47(7), 2301-2303.

Tsukamoto, K., Noguchi, D., Suzuki, K., Shishido, M.,

Ashizawa, T., Kim, M. C., Lee, Y. J., Tada, T. (2010).

Broad detection of diverse H5 and H7 hemagglutinin

genes of avian influenza viruses by real-time reverse

transcription-PCR using primer and probe sets containing

mixed bases. Journal of Clinical Microbiology, 48:4275-

4278.

Twu, K. Y., Noah, D. L., Rao, P., Kuo, R. L., Krug, R. M.

(2006). The CPSF30 binding site on the NS1A protein of

influenza A virus is a potential antiviral target. J Virol

2006, 80: 3957−3965.

Van Campen, H., Easterday, B. C. and Hinshaw, V. S.

(1989). Destruction of lymphocytes by a virulent avian

influenza A virus. Journal of General Virology, 70: 467-

472.

Van der Goot, J. A., Van Boven, M., de Jong, M. C. M., &

Koch, G. (2007). Effect of vaccination on transmission of

HPAI H5N1: the effect of a single vaccination dose on

transmission of highly pathogenic avian influenza H5N1

in Peking ducks. Avian diseases, 51(s1), 323-324.

References

122

Van Riel, D., Van Den Brand, J. M. A., Munster, V. J.,

Besteboer, T. M., Fouchier, R. A. M., Osterhaus, A. D.

M. E., & Kuiken, T. (2009). Pathology and virus

distribution in chickens naturally infected with highly

pathogenic avian influenza A virus (H7N7) during the

2003 outbreak in The Netherlands. Veterinary Pathology

Online, 46(5), 971-976.

Vascellari, M., Granato, A., Trevisan, L., Basilicata, L.,

Toffan, A., Milani, A. and Mutinelli, F. (2007).

Pathologic findings of highly pathogenic avian influenza

virus A/duck/Vietnam/12/05 (H5N1) in experimentally

infected Pekin ducks, based on immunohistochemistry

and in situ hybridization. Veterinary Pathology, 44,

635_642.

Verma, S., Lo, Y., Chapagain, M., Lum, S., Kumar, M.,

Gurjav, U., ... & Nerurkar, V. R. (2009). West Nile

virus infection modulates human brain microvascular

endothelial cells tight junction proteins and cell adhesion

molecules: Transmigration across the< i> in vitro</i>

blood-brain barrier.Virology, 385(2), 425-433.

Wang, W. E. I. R. O. N. G., Riedel, K. E. L. L. Y., Lynch, P.

A. T. R. I. C. I. A., Chien, C. Y., Montelione, G. T., &

Krug, R. M. (1999). RNA binding by the novel helical

domain of the influenza virus NS1 protein requires its

dimer structure and a small number of specific basic

amino acids. Rna, 5(2), 195-205.

References

123

Wang, X., Basler, C. F., Williams, B. R., Silverman, R. H.,

Palese, P., Garcia-Sastre, A. (2002). Functional

replacement of the carboxy-terminal two-thirds of the

influenza A virus NS1 protein with short heterologous

dimerization domains. J Virol 2002, 76: 12951−12962.

Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.

A., Garcia-Sastre, A. (2000). Influenza A virus NS1

protein prevents activation of NF-κB and induction of

alpha/beta interferon. J Virol 2000, 74: 11566−11573.

Wasilenko, J. L., Arafa, A. M., Selim, A. A., Hassan, M. K.,

Aly, M. M., Ali, A., ... & Pantin-Jackwood, M. J.

(2011). Pathogenicity of two Egyptian H5N1 highly

pathogenic avian influenza viruses in domestic

ducks. Archives of virology, 156(1), 37-51.

Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T.

M., & Kawaoka, Y. (1992). Evolution and ecology of

influenza A viruses. Microbiological reviews, 56(1), 152-

179.

WHO (2005). Avian influenza (“bird flu”) and the significance

of transmission to humans. Available at: http:// www.

who. int/ mediacentre/ factsheets avian_influenza/en.

WHO (2005). Avian influenza: assessing the pandemic

threat.WHO/CDS/2005.29.

WHO (2011a). World Health Organization. Antigenicand

genetic characteristics of influenza A (H5N1) and

References

124

influenza A(H9N2) viruses for the development of

candidate vaccine viruses for pandemic preparedness.

http:// www. who. int/ csr/ disease/ avian_influenza/

guidelines h5n1 virus/en/index.html (accessed 6th July

2011).

WHO (2011b). World Health Organization. Situation updates—

avian influenzahttp: //www. who.int/csr/ disease/ avian_

influenza / updates/en/index.html (accessed 6 th July

2011).

WHO/OIE/FAO (2009). World Health Organization/World

Organization for Animal Health/Food and Agriculture

Organization H5N1 Evolution Working Group.

Continuing progress towards a unified nomenclature for

the highly pathogenic H5N1 avian influenza viruses:

divergence of clade 2.2 viruses. Influenza Other Respi

Viruses 3:59-62.

Woolcock, P. R. (2008). Avian influenza virus isolation and

propagation in chicken eggs. In E. Spackman (Ed.). Avian

Influenza Virus. 1st edn. Humana Press, Totowa, NJ. pp.

35-46.

Zhao, Y., Lu, M., Lau, L. T., Lu, J., Gao, Z., Liu, J., ... & Gu,

J. (2008). Neutrophils may be a vehicle for viral

replication and dissemination in human H5N1 avian

influenza. Clinical infectious diseases, 47(12), 1575-

1578.

148

VITA

125

VITA

The author was born on June 1987 in Abou-Hammad –

Sharkia - Egypt.

His primary education was completed in El-Gamhouriya

Primary School and graduated in 1998.

His preparatory education was completed in El-Sadat

Preparatory School for boys and graduated in 2001.

His secondary education was completed in Abou-Hammad

secondary School for boys and graduated in 2004.

His undergraduate professional education was completed in

the college of Veterinary Medicine, Zagazig University from

which he received Bachelor Degree of Veterinary Medical

Sciences (BVSc) on 2009 with grade Very Good.

He worked as a teaching assistant at the Department of

Virology, Faculty of Veterinary Medicine, Zagazig University

in 2010.

He received a Post Graduate Diploma of Microbiology on

December 2011.

He has been registered for the degree of Master of Veterinary

Medical Sciences (Virology) since March 2012.

He worked as a Visiting Scholar in Veterinary & Biomedical

Sciences Department, College of Veterinary Medicine,

University of Minnesota, USA, from May, 2013 till

November, 2013.

نبذه عن حياه الباحث

نبذة عن حياة الباحث

محافظة الشرقية -مدينة أبوحماد -1987الباحث من مواليد يونيه–

جمهورية مصر العربية.

حصل الباحث على الشهادة االبتدائية من مدرسة الجمهورية االبتدائية عام

1998.

حصل الباحث على الشهادة االعدادية من مدرسة السادات االعدادية بنين

.2001عام

ل الباحث على شهادة الثانوية العامة من مدرسة أبوحماد الثانوية بنين حص

.2004عام

أتم الباحث شهادته الجامعية في كلية الطب البيطرى جامعة الزقازيق

بتقدير عام 2009وحصل على بكالوريوس العلوم الطبية البيطرية عام

جيد جدا.

جامعة -الطب البيطرى كلية -كلف الباحث للعمل كمعيد بقسم الفيرولوجيا

.2010الزقازيق عام

حصل الباحث على دبلوم الدراسات العليا فى تخصص الميكروبيولوجيا فى

.2011ديسمبر

سجل الباحث للحصول على درجة الماجستير فى العلوم الطبية البيطرية

.2012)تخصص الفيرولوجيا( في مارس

المتحدة األمريكية ابتداء عمل كباحث زائر في جامعة مينيسوتا بالواليات

. 2013حتى سبتمبر 2013من مايو

نبذه عن حياه الباحث

ARABIC SUMMARY

1

الملخص العربىمستوطنا فى H5N1لقد أصبح فيروس انفلونزا الطيور عالى الضراوة

وأثار اهتماما مؤخرا الحتمال تحوره وانتقاله 2006جمهورية مصر العربية منذ عام وس انفلونزا الطيور عالى الضراوة بين البشر. لقد تم قبل ذلك توصيف العدوى بفير

H5N1 فى الطيور المصابة تجريبيا. على أى حال, القدرة االمراضية لفيروسانفلونزا الطيور عالى الضراوة المعزول من مصر, لم يتم توصيفها قبل ذلك فى الدجاج والبط المصابة طبيعيا والتى من الممكن أن تصبح فريدة نظرا الختالف طرق

رعة العدوى. فى هذه الدراسة قمنا بعزل وتعريف وتوصيف فيروس االصابة وجانفلونزا الطيور عالى الضراوة والذى ظهر فى قطعان الدجاج التجارية المحصن مرة واحدة اومرتين والبط المتسأنس والغير محصن. األعراض األساسية التى ظهرت على

العرف والداليات وتجمع الدجاج التجارى كانت تبقع دموى على االرجل وزرقان فى مائى تحت الجلد فى منطقة الرأس والرقبة بينما التى ظهرت على البط المستأنس

-48كانت أعراض عصبية خاصة التفاف الرقبة. أثناء تجميع العينات وفى خالل فى قطعان % 30 – 22.8ساعة بعد ظهور المرض, وصلت نسبة النفوق الى 72

فى قطعان % 40 – 28.5واحدة بينما وصلت الى الدجاج التجارى المحصن مرة البط المتسأنس والغير محصن. تم تجميع عينات االنسجة من الدجاج والبط لعمل اختبارات المناعة الكيميائية للنسيج وتفاعل البلمرة المتسلسل الكمى المسبوق بانزيم

تعقب النسخ العكسى الختبار كمية الحامض النووى الفيروسى فى النسيج. تم الحامض النووى الفيروسى فى جميع أنسجة دجاج التسمين والبياض تقريبا شاملة أنسجة الخصية على عكس نظيرتها فى البط والتى لم تحتوى على الحامض النووى الفيروسى فيما عدا أنسجة القصبة الهوائية والرئتين والكبد والتى كانت على أى حال

لفة. ظهرت أعلى مستويات من الحامض النووى أقل مستوى من الدجاج وبأهمية مختالفيروسى فى الدجاج فى أنسجة المخ والقصبة الهوائية والدم مع وجودأهمية مختلفة

2

ما بين قطعان التسمين والبياض فى نسبة الحامض النووى فى هذه االنسجة خاصة.. ما يوضح بينما تم تعقب الحامض النووى الفيروسى تقريبا فى كل االنسجة والدم م

التكاثر الفيروسى الشامل فى كل األانسجة والدم فانه أيضا تم تعقب األنتجين الفيروسى بكثرة فى كل االنسجة متضمنة النسيج الخصوى وفى مالحظة مثيرة لالهتمام فانه تم تعقب األنتجين الفيروسى فى الخاليا المبطنة لجدار األاوعية الدموية

قصبة الهوائية والمخ وكذلك أيضا تم تعقبه فى ألغلب األنسجة خاصة أنسجة ال الخاليا البالعة أحادية النواة فى معظم األنسجة خاصة النسيج الرئوى.

Hوفى هذه الدراسة أيضا قمنا بمقارنة التتابع الوراثى للبروتين السطحى ما بين الفيروسات المعزولة فى هذه الدراسة NS1والبروتين الغير هيكلي األول

الدائرة فى مصر االن وفى H5N1وسات انفلونزا الطيور عالية الضراوة وفير الماضى باالضافة الى بعض السالالت المستخدمة فى التحصينات التجارية فى

Hمصر. اضافة التحليل المطروح لألحماض األامينية أظهر ان البروتين السطحىالطيور عالية الضراوة يحتوى على البصمات الجزيئية الخاصة بفيروسات انفلونزا

والتى تشمل العديد من األحماض األمينية األساسية فى موقع االنشطار بينما أيضا هذه البصمات الجزيئية والتى يحمل NS1البروتين الغير هيكلى االول

, الذراع الكاربوكسيلى النهاية 92فى الموقع Glutamateتشمل الحامض االمينى E-S-E-V عند اخذ كل هذه 84-80ينية المزالة فى الموقع و األحماض األم .

المعلومات معا فان هذه الدراسة تعد االولى عن توصيف القدرة االمراضية لفيروس فى الطيور المصابة طبيعيا مما يوفر فهم H5N1انفلونزا الطيور عالى الضراوة

لفيروس. فريد للمسار المرضى الفيروسى فى قطعان الدجاج والبط المصابة بهذا ا

3

االستنتاج وفى النهاية فان هذه الدراسة استنتجت التالى:

اوال: ان الوباء الذى ظهر فى قطعان الدجاج التجارية والبط المستأنس فى عام فى جمهورية مصر العربية كان بسبب العدوى بفيروس انفلونزا الطيور 2013

. H5N1عالى الضراوة عند موقع Hالسطحي ليل األحماض األمينية للبروتينثانيا: أن التحليل الجزيئى وتح

االنشطار والبروتين الغير هيكلي للمعزوالت الفيروسية فى هذه الدراسة أوضح انها تحمل البصمات الجزيئية لفيروسات انفونزا الطيور عالية الضراوة مما يؤكد بما ال يدع مجاال للشك أن هذه المرضية التى ظهرت على الطيور كانت بسبب فيروس انفلونزا الطيور عالى الضراوة وليس منخفض الضراوة.

فى موقع (R325K)باالضافة الى ذلك أوضحت وجود طفرة احاللية فى أحد الفيروسات المعزولة من قطعان Hاالنشطارفى البروتين السطحى

والتى تختلف عن , (5J)وأن هذه البروتين ينتمى للعائلة , التسمين التجاريةئالت التى تنتمى لها بعض السالالت المستخدمة فى التحصينات التجارية العا

هذه االونة فى مصر.. ثالثا: أن التحليل الجزيئى وتحليل األحماض األمينية للبروتين الغير هيكلي للمعزوالت الفيروسية فى هذه الدراسة أوضح انها تحمل البصمات الجزيئية لفيروسات

ضراوة. كما أوضح أن هذا البروتين الغير هيكلى ينتمى انفونزا الطيور عالية البدون أى احتمال لوجود خلط جزيئى بين فيروس االنفلونزا من NS1Eللعائلة

واى أنواع أخرى والتى تعتبر مستوطنة االن فى مصر. كما H5N1النوعاستنتجت أيضا ان األحماض األمينية للبروتينات الغير هيكلية األول والثانى

تظهر اى تطور جزيئى شامال احالل, ازالة او اضافة. لم

4

والمستوطن حاليا فى H5N1رابعا: أن فيروس انفلونزا الطيور عالى الضرواة مصر يتكاثروينتشر تقريبا فى جميع أنسجة قطعان الدجاج التسمين والبياض التجارية على عكس طبيعة تكاثره وانتشاره فى قطعان البط المستأنس وذلك

ستخدام اختبارات المناعة الكيمائية للنسيج وتفاعل انزيم البلمرة المتسلسل باالكمى المسبوق بانزيم النسخ العكسى. كما اوضحت ايضا ان الفيروس يوجد بشكل حاسم فى الخاليا المبطنة لجدار االوعية الدموية لمعظم االنسجة

احادية النواة لمعظم خاصة نسيجا القصبة الهوائية والمخ وأيضا الخاليا البالعةاألانسجة خاصة النسيج الرئوى باالضافة الى تتبع الفيروس فى نسيج الخصية. وجود األنتيجن الفيروسى بشكل حاسم فى الخاليا المبطنة لجداراألوعية الدموية والخاليا البالعة أحادية النواة يوضح احتمالية انتشار

يا. عالوة على ذلك فان الفيروس فى جميع األنسجة عن طريق هذه الخالوجود األنتجين الفيروسى فى أنسجة المخ والخاليا العصبية يوضح أن مرضية أنسجة المخ يمكن أن تكون أحد األسباب الرئيسية لنفوق الطيور ان لم تكن

السبب األوحد.وعليه فأن هذه الدراسة تعطى رؤية أوضح لمرضية فيروس انفلونزا الطيور

القطعان المصابة طبيعيا والتى تختلف بالضرورة عن القطعان عالى الضراواة فى المصابة تجريبيا نظرا الختالف جرعة الفيروس وطريقة دخوله باالضافة الختالف عمر الطائر ومناعته واحتمالية وجود عدوى مصاحبة فى جسم الطائر ولذلك فانه

ن هذه الدراسة تقدم يمكن مقارنتها بالدراسات التجريبية لتعزيز النتائج. كما امعلومات عن االصابات الحقلية بالفيروس وطرق تشخيصها مما يمكن استغاللها من قبل األطباء البيطرين لكى يقوموا بالتشخيص الدقيق للعينات الفيروسية المعزولة من

الحقل.

5

جامعه الزقازيق كلية الطب البيطرى يةقسم الكيمياء الحيو

بسم هللا الرحمن الرحيم

الهذين آمنوا )) يرفع اللهمنكم والهذين أوتوا العلم

((درجات صدق هللا العظيم

[11االية :المجادلة]

6

جامعة الزقازيق كلية الطب البيطرى

لوجياقسم الفريو التوصيف الجزيئى للبروتينات غير الهيكلية

نفلونزا الطيورإلفيروس ـة مقدمــــــة منرســـالــ

براهيم محمد ثابت ثابت حجاجإط.ب/

(2009جامعة الزقازيق ) – بكالوريوس العلوم الطبية البيطرية

(2011جامعة الزقازيق ) – دبلوم الميكروبيولوجيا

حتت إ رشإف

ورــكتالد على عبد الرشيد على سالمة

)رحمه هللا( أستاذ الميكروبيولوجيا المتفرغ

قسم الفيرولوجيا

كلية الطب البيطرى-

الزقازيق جامعة

ورـــالدكت محد عبدالسميع حسن عليأ الفيروسات والمناعة الفيروسية أستاذ

ارئيس قسم الفيرولوجي

كلية الطب البيطرى

جامعة الزقازيق

ورــالدكت شيماء حممد جالل حممد منصور

أستاذ مساعد الفيرولوجيا



الزقازيق جامعة

ورـــالدكت مساعيلإحممد البكرى عبدالرحيم

الميكروبيولوجيا المتفرغأستاذ



معة الزقازيقجا

ىلإمقدمـة ة الزقازيقــجامع

ا(ــ)الفريولوجي بية البيطرية ىف العلوم الط املاجستريللحصول على درجة قسم الفريولوجيا

2015

molecular characterization of non structural protiens of avian influenza virus

Documents