MOLECULAR AND CELLULAR BIOLOGY, June 1990, p. 3232-32380270-7306/90/063232-07$02.00/0Copyright C 1990, American Society for Microbiology

NOTES

Molecular and Developmental Characterization of the Heat ShockCognate 4 Gene of Drosophila melanogaster

LIZABETH A. PERKINS,'* JOHN S. DOCTOR,2t KANG ZHANG,' LESLIE STINSON,2 NORBERT PERRIMON,1AND ELIZABETH A. CRAIG2

Howard Hughes Medical Institute, Department of Genetics, Harvard Medical School, 25 Shattuck Street, Boston,Massachusetts 021151 and Department of Physiological Chemistry, University of Wisconsin, Madison, Wisconsin 537062

Received 5 October 1989/Accepted 6 February 1990

The Drosophila heat shock cognate gene 4 (hsc4), a member of the hsp7O gene family, encodes an abundantprotein, hsc7O, that is more similar to the constitutively expressed human protein than the Drosophilaheat-inducible hsp7O. Developmental expression revealed that hsc4 transcripts are enriched in cells active inendocytosis and those undergoing rapid growth and changes in shape.

The cells of nearly all organisms have a conserved re-sponse to environmental stresses, consisting of the synthesisof several heat shock proteins (hsps) (for review, see refer-ence 15). The most prominent stress protein in the majorityof species, hsp70, is highly conserved among procaryoticand eucaryotic species. The hsp7O gene is a member of afamily of closely related genes that includes both stress-inducible genes (hsp's) and genes expressed constitutivelyduring normal development, the heat shock cognate genes(hsc's).The heat shock cognate proteins appear to be important

for normal cellular function (reviewed in references 5, 15, 21,and 27). A number of recent results indicate that the hsp70-like proteins act in an ATP-dependent manner in severalcellular compartments. They may function to alter the con-formations of proteins or affect protein-protein interactions(9, 18, 25). Additionally, they may play a role in thetranslocation of polypeptides across specific membranes (4,7). The abundant cytoplasmic heat shock cognate protein inmammalian cells, hsc70, is involved in the ATP-dependentuncoating of clathrin from endocytotic vesicles (26, 31).

In Drosophila melanogaster, the hsp70 multigene familyincludes five copies of the heat-inducible hsp70 gene, onecopy of the heat-inducible hsp68 gene, and seven heat shockcognate genes, hscl through hsc7, that are expressed duringnormal growth (6, 13, 15, 19). The Drosophila hsc70 protein,encoded by hsc4, is a very abundant polypeptide in alltissues and cells and is localized to a meshwork of cytoplas-mic fibers concentrated around the nucleus (19).Sequence and structure of the Drosophila hsc4 gene. The

hsc4 gene of D. melanogaster was originally isolated on arecombinant plasmid, pMG34 (Fig. 1A and 2), followinghybridization with a Drosophila hsp7O gene (6). The DNAsequence of hsc4 revealed a single open reading frame of1,953 base pairs (bp) that potentially encodes a 651-amino-acid polypeptide with an estimated molecular weight of71,108. Si nuclease analysis indicated that the protein cod-ing and the 5' untranslated regions were not contiguous and

* Corresponding authort Present address: McArdle Laboratory, University of Wiscon-

sin, Madison, WI 53706.

that an intron was located 5' of the initiating ATG (data notshown). To confirm the position of this intron, a cDNA,cD12, was isolated and the sequence of the 5' end wasdetermined. The cDNA sequence diverged from the genomicDNA sequence at the ATG (Fig. 1B). The protein coding and5' untranslated regions of the hsc4 gene were interrupted bya 1.6-kilobase (kb) intron.The deduced amino acid sequence of the hsc4 gene (Fig. 3)

was 73% identical to that of the Drosophila heat-induciblehsp70 (12) and 85% identical to that of the human hsc70polypeptides (8). Furthermore, Drosophila hsc70 was 80%identical to Caenorhabditis elegans hsp70A, which is abun-dant throughout development and only marginally heat in-ducible (29). An unresolved question is whether constitu-tively expressed hsp7O-related genes, such as hsc4, andthose induced by stress, e.g., hsp70, have identical ordifferent functions. The fact that Drosophila hsc4 is moreclosely related to vertebrate hsc70-like genes than an induc-ible gene from D. melanogaster suggests that the constitu-tively expressed proteins may be functionally distinct fromthe stress-induced proteins.

In situ hybridization to embryos reveals stage- and tissue-specific enrichment of hsc4 transcripts. Northern (RNA blot)analysis demonstrates that the major 2.3-kb hsc4 transcriptis expressed throughout embryonic, larval, pupal, and adultdevelopment at relatively constant levels (6) (data notshown). In situ hybridization to wild-type embryos wasperformed as described by Hafen and Levine (11) or Tautzand Pfeifle (30). Radioactive DNA probes were labeled bynick translation with [35S]dCTP (New England NuclearCorp.) to a specific activity of approximately 5 x 107cpm/,Lg, and the autoradiograms were developed after 2 to 3days. Nonradioactive probes were prepared essentially bythe protocol provided with the nonradioactive labeling anddetecting kit (Boehringer Mannheim, catalog no. 1093657).hsc4 transcripts were localized in a complex spatial andtemporal pattern during embryogenesis (Fig. 4 and 5), whichwas superimposed onto a basal level of expression apparentin virtually all cells of the developing embryo.Enrichment of hsc4 transcripts was first observed during

late syncytial and cellular blastoderm stages and during earlygastrulation in the cytoplasmic compartment between the

3232

Vol. 10, No. 6

NOTES 3233

0

exon_

o OO v

U

U I

k 'lP

exon 2 ,

Bg Xh BgI I I

kB

- c321

cHsc4

cD 12

5' consensus splice AAGGTAAGT

Exon 1 junction AAGAAACAACACACAAGGTAAGCGTTTATTTACATT

AAGAAACAACACACAAGATGTCTAAAGCTCCTGCTG

Exon 2 junction GTTGTAATTCTTTCCAGATGTCTAAAGCTCCTGCTG* @ -- @

TTNCAG 3' consensus spliceA

FIG. 1. (A) Restriction map of pMG34, a recombinant plasmid containing the entire Drosophila hsc4 gene. The direction of transcription,positions of the intron and exons 1 and 2, start (ATG) and stop (TAA) codons of translation, and relevant restriction sites are included (B,BamHI; Bg, BglII; Hc, HinclI; P, PstI; Xb, XbaI; Xh, XhoI). Below the restriction map, the approximate extents of three hsc4 cDNAs are

depicted. cDNA clone c321 was isolated from a 3- to 12-h embryonic cDNA library (23) in a differential screen designed to identify genespreferentially expressed in neuroblasts rather than differentiated neurons (L. A. Perkins, A. P. Mahowald, and N. Perrimon, submitted forpublication) and was determined to encode hsc4 sequence based op its localization to 88E on the salivary gland polytene chromosomes,Southern blot analysis with pMG34 as a probe, and partial DNA sequence analysis. cDNA clone cHsc4 was isolated at high stringency froma size-selected 9- to 12-h embryonic library with c321 as a probe (35). cDNA clone cD12 was isolated from an embryonic cDNA libraryprovided by M. Goldschmidt-Clermont with pMG34 as a probe. (B) Location of the intron/exon boundaries in the Drosophila hsc4 gene. Thiscomparison shows the nucleotide sequence from cDNA cD12 aligned with the genomic DNA sequence from pMG34. This alignment does notpermit the unambiguous determination of the precise boundaries of exons 1 and 2, but the predicted splice site ( A), based on the eucaryoticconsensus (17), is shown.

blastoderm nuclei and the yolk (Fig. 4A and B). These stagesare characterized by the rapid assembly of cellular mem-branes to compartmentalize the nuclei. Tissue enrichmentwas next observed in neuroblasts of both the head andextending germ band (Fig. 4C, D, and E). Unlike transcriptsfrom Delta and members of the achaete-scute gene complex,which are enriched in subsets of neuroblasts enlarging withinthe neurogenic ectoderm (2, 24, 32), hsc4 transcripts were

only observed in newly segregated neuroblasts internal tothe ectoderm. Enrichment was clearly observed in neuro-blasts from the procephalic neurogenic ectoderm (Fig. 4Cand D) and continued to be enriched in specific derivatives ofthis region (Fig. 4H). Enrichment of hsc4 transcripts was

observed in cells of the embryonic gut from anterior andposterior midgut invagination to hatching (Fig. 4F to H) andtransiently in developing mesodermal cells (Fig. 4F and G).Enrichment in the gut occurred while the cells were under-going numerous cellular processes: mitoses, expansions,stretching, and volumetric growth (3). Enrichment in themesoderm occurred as the somatic and splanchnic meso-

derms became separate layers (Fig. 4F and G) and wasreadily apparent as the somatic muscles formed and singlecells fused into syncytial myotubes and differentiated intosomatic muscles (3).During late embryogenesis, hsc4 transcripts were most

abundant in the garland gland (Fig. 4G and H), an organpostulated to segregate and store waste products (34). Cellsfrom the garland gland are very active in endocytosis viacoated vesicles. In fact, electron microscopy reveals thecortex of these cells to be a labyrinth of endocytotic pits orchannels that "pinch off" to form clathrin coated vesicles(14; C. Poodry, personal communication). Since a clathrin"uncoating ATPase" activity has been detected in Droso-phila cells (28), we propose that hsc70 in the garland glandfunctions in the uncoating of clathrin triskelions.

In conclusion, hsc4 transcripts are present in most if notall cells during embryonic development but are enriched incells active in endocytosis and those undergoing rapidgrowth and changes in shape. Studies in other organismshave demonstrated high levels of hsc70 in rapidly growing

A

Bg -

I I

I IB X P

1 kb

B

cDNA

I I 9 I n I

VOL. 10, 1990

C' U) C'. 0% W.4 C') LO r~- 0% ,-4 C') Ul) C' 0% ,.4 C' U) w0cN m' q. U) '- OD 0) 0 ,.4 c') q. LO %O C- 0) 0 f.4 ,-4,.4 ,.4 '-4 ,.4 V-4 '..4 '.4 ,4 C4N C14 C.4

O 0 8.

004

0 E-.4 '*

[E4C) w

0 H

V V E-

X < 9E-4 E E-4

E-4 V E-4

D E-4 C HE- E-4 E- E

V E-4 s

HD H HC)

V E- O

C) E4 E

E- U E-4

H C

Hs C) C) uq

V E-4 E E-4

H H

E-4 E-4 EV EU:E E-4

E- E-4 E-4 UEz : E-4 E-Ez E E-4 E-

Ez E-4 Eq

C)C)EsE

u E-4:Ez 4V

HE C) H

0- H 0

E- E-4

V E-4<

C) C) H

.0 0E

H . .a;Ez E-4E4 Eg- E-4

Ez 9

4I4.)4.,4.)

4.)

4.)4.)

0

E4.E4.

4.

PC)E-JC0.0Cl

EC)

E-0

EC)

E-00

EC)H-H-

0 ,C)'

C) 00d ( 4.)

od

0 4.

C) 0

4. 0C) 4.)

0 C

0i 0

0 C)

4. 04.)

0

4.)

C)

0

4.)4.)4.) C

0C) 4.)

04.)C)'

Es

4.4.)4.)4.)4.) C)4.) CC) 4.)4.)

0 0

4.) C)'0d 4.)

0d 4.)

4.) 4.)4.) 0d4.) C)

0o 4.)4.) 0d

0d 0

0a 4.)0a 4.)C)' 0

C) 0

4.) 4.)

0

0d 4.)4.) 4.)

C) 0

4.) 0

0 0

C)' 0

4.) C)

0d 0

0 C0 4.

0 4.)

4.) 0J

4.) 4.)

4.) 4.)

4.0 C)4.)s

H.-U0 HO U. 0 0C OH .0 C) 0 0C)00 C0C)0 H H -C)C)OU

H HC) 0 C) C)~~~~~00 )C )C C) C C) 0

00 C H Q C) C)C 00 C) 00 C) OH C)

) C) 0 H H C) H H 0 C)0 H 00 .

000u C) O C) 00 C) C)C)C0 HC)0 H0C .aH 0 0. C) .0. H C) C) 00

u

8u 80tut08HC)C) 0 C)

U0UH U0 P U P U0 C)C).0C

uu u 0 H go~~~~~~~~~ C

OH6 C) C) C) C) H C)C C) 00tCC)uC) H .0. ).0 H0C) H .0 C) . 0 CE- 004 H .0.0 H 000. HO 0.0

u ~ H .0 H .0 pE-

H- C) C) 4 0C) E4

E-CD C)C H . 0HC)H ) C.H8 HH

H 00 C) C)0C H HC 0 C

u H OH .0000

~~~g~~~C)C)C)C)C)~~~~~~~~~~~~5 0C)u

HC)O C)C) C)C HE-H ) )CC)H. C 0HC .00 . 0.0..

3234

C') C') C'qw C14 0C' C14 '.41

H 8Eq a EE-, DH E '

C) 0

C) 4

HE-4

NOTES 3235VOL. 10, 1990

zn C) Co

a: a C) 0:0pn *) 0

to * X to0

H@H@H

H OHSO-4

CnOO 0

~0000J* OG) 0

to to.

0 0

C) * G)> 0 ) 0

060

'0* 0

En 06C)0

U) * EnO

060S0

'00

' 0 <00:t

004000

t4 CM

CoDO 1<

U) Ca

-4 -6H04

C*0 C=O3t

3 6 Z36'<6<6<06060-C

.MOU'.b0X 1-DO1-

0OCCl -t O CC.*.C=(4 O4 (4G0> O G-tnOC-. -cn0Sc

q(Q -J-j

CD 0

~i00.X ,

OD0o o

_.CD(1

CJ0

o -_ =

020

C: m CD

p 0

O0

CD

0 g

C) uz CD

CD 0

o -o3

CO

O oo Q

CC

0

Cl -.1 CD

3n -3

CD

o 0

CD CD

°Cb ;:r

-o3

0,5.U-

_._ _

C-D

D

k0.C)

3. n

>

CD

o 0

0 to

1-46-0"-4H a1-3

-36* F3 >'z6z6zZ *

U* Z

a* C 6 C/E:ri * S* :to0n 0nOtT:3 00t'3614* l:

o z.z236 143 6143]

NOW :0'

> zoo

:1 ZOO

A: OX ON:

o0 so 0oto

ootoD

00*II w

A G0:n0En O pC O :00<0at- 01C/)t

tn 0 pn0t

En~n

< 0I-4 0t

0 0 <

M 06 0 0

<01-40<

Z* z *0

tn 0t00ZCnrq * 0 * tn

3 1-3 Co1-45140<tF *t- tn

coezoc

461-4 OH*

:NZ >03

tZ tn4 t-

> C/)z.z6z100 '-3

AX * PC * :Nrn * tn * n

n * tn * tq)

Z0 :X OX:

w:- t-4 0t:

Ht13

to301<0to3

%Da F

0 t00 'V

060 to

CDo O CoN

N C O' -

0 *0 3--4 *~>: t0 *

6cn-)6C)

CG aC)a G

C)aC)a )

F3cn F3

1-4646-

a6*3614p361-3

zoze-

H * F0 A

X6t1-l

06060

Po * Po :to

06060

.<60< a <t-4 t-4 1-41361.3 0

F36* 3 Uo

'- tn3 006060

pq06A0 xq

to360to36:to3

t-4 4 -4

GH C)aG)

H6NHH

ror cn C/

06060Z6z6z

Po Po a to

H00 60H<6<6<

Po Po Cl)P

1-461-461I-4

06K060

>X * X: a :tIO

<6<6<

t-61-46t

ZozozNo't 'to

Hor6H06060

-3 0 a IIH C)St)

1-6-46-4

te* o* o

to*etoe* o06060S1-461-461143*143*t'<6<6<H-H-H"let,."060601-46H0t4

06060:3466:1z6Z6Z060601-461-461.I'S H61

ror-

cn3613 tn-Z6Z >

oW0C -' -3

00*u *tt3-43-4G. Z C(4: (4 (40- 0 -

0 o o

;43 613613~

z6z 0

> * > * >

t- * t- * t-

C- 0X* U o

0600r

3toa t 3

O*N a A

00CO ) Z

a361436 143

a*

06060

t: * t-: * :X:

C/ En13000<0o1- z61-a1

06060

1-461-461 -4

t<* * t06*: 'r a a o<

06060

1- -4 6 t-4O

0 U * U)

c*< a c4

tn a tn * cn

1 0106t)1'6 t'61ra4 * t-a* t

t) O U tnUr * r * r

06060

teo0to P

CoU*c o6 l

1461-461-4

Coeoston

06060*14*61436143<6<6<)*C:1:6* <6* <06060or * r * rz *1 *<6<6<X:

Coto

Co * C/) * G)140 0Z0143 C<6<01-406060*06060roror401'tn : tnG1 * C6* GI' 610<06060ic<6<6<)H6H :1'C-OHtet1' 616t

C -' -'

(4 (4 (4@t

0 o o

Cf) *GEn GZ06060t3 6 "3 6 "3

Cl * Cl * Co1-41-4OHtn * tn * tn

G6t4 61't

HC/) H3

06pn001';n O: 0:*

*n a*n tni

H 6 t-4 0tO

"3 6 a36

HUH- OH

tOt4 6t4

tn * Utn * tn3

F23 a P3 * p3

0X60606060

cn * W

0 t4 * t4Wo-Me

Z6*436*4Zt30ror6o06060

to4 0 1'4 6 t1<6<6<

Z H6H3*F

t 0 t 0Stwmore"36to010t4

t74 t*>: *t-

:o * :001

H0t46t4cn H Co

W '3 to

H aH OH

Z * Z * Z

06:t0:1 6 :1S*

CAa En 6'

:X: a p: * p:

En *tCAt

1-3 * -.3 * t

HU*H *OH

CAI~tA

CC=C=C * HCa*H

0 *U*1461-464

H 63 10

06060

1<03 63-3tn3* 361:3

HU*H OHC1-3 *- 1-3nCD CD CD

CD CD -I

0 0

0 0n 0

0 o o

tGstmOet:N *N ON*X<OH-H

W143HW'C)O0 n 0 )

00000

F0"3 cn

toetoen to136 1X 6t'

<OH OH0t-4

HHH

H H6'-3z :1' 0 V

<O <14O0O163tn:1'6:1

:00 * :0: * :10

H1 oF3 Sol

m->em

<6<OH

H6H6H

ZOWZO

zez-z

HUH 0 H-

< * t-OH

1<61<61<

< O H <

'3 6 "3 "-3ZSZSZ06060

CSCoS-0606006060

In 'S:1'HSHSIVHa06060

:006-0

C)a -iG

GD C) -G

H4*H *HS*H *H

Z-Z-Z606060ta * *4ZOZOZ-F<6<6<t4tot4:13:13:1HSHSH>HOHSH-FGZSZOZGror-r314too oetHO HUH76:1:* :1c'S6:r:1'Sc6:1'H6OGt-GwOe6-11<61<610606016161'06060'3613

:1'006

13 6146t':16361ZSZSZ0<6<6<o' o' 6o

XUCocn *En

C) 0 .10C

HOHOH06060

1-3 *HF3 *HF1<01<61<tncn (A

06060<6<6<

06000tootooto00060

G) a G) * G)

HOH Z

ZSZ 1<

t:oa*0 a06060ZOZSz

F-3 * e U)-

to atooto

GnC)* GZ* )HHOHG

HOH z060600 600 143n~:1l6:Co0toz6z:W*OK so

1333

.< *a .0zSzSz

toZ Po aH6 1,1-3 * F3 * -3<OHO<t13 5to35ao

HSHOHG) * C) * a)

"3 O"30ON

060 H

aeaC :11 0@ 1)0 >

cnl * tn cet

06060

13613:10"3 SWoeto:Po U 0 c<6<6<<6<6<Z CoSCo0 C0C> OOC4J

0 0;a 0 0P

C C_ -_

=3.r =r =.

CA cn up0 0 -.0-4 -4 -.30 0 0

MOL. CELL. BIOL.

V#.a C

- .4 nu

:y

-iII;,tv

b. i

,T'av

.M

.-

y

Wpm

E F

it I h~Assm,h,

99

spin

pH mg

99vnc

FIG. 4. Expression of hsc4 transcripts during embryogenesis. (A) Transverse section with ventral at the bottom; (H) parasagittal sectionwith anterior to the left and ventral at the bottom; (B to G) whole-mount embryos labeled with nonradioactive probes (30). From fertilizationthrough the early stages of cleavage, expression of hsc4 transcripts is uniformly distributed in the embryo (not shown). During the latesyncytial and cellular blastoderm stages through early gastrulation, most of the hsc4 transcript is observed between the peripherallypositioned nuclei (nu) and the central yolk (y), i.e., in the cytoplasmic compartment (cy) (A and B). hsc4 transcripts remain essentially uniformin distribution at the basal level in all embryonic tissues until the germ band is almost fully extended. At this time a punctate band of moreintense hybridization internal to the region of the ectoderm (ec) and exterior to the mesoderm (ms), where neuroblasts (nb) have segregated(D, enlarged in E), is detected. With development the intensity of the band increases, presumably due to either increased numbers of cellsbecoming enriched for the hsc4 transcript or increased expression of the transcript in the enriched cells. Enrichment is also observed in theprocephalic neurogenic regions (D, enlarged in C). Throughout the remaining stages of embryogenesis, the lining of the developing gut is

A

0

- !mdl&2mL-- ,;-

.N

3236 NOTES

Cy

u

---AMNWR"ht-'NY

,- 'j,.4. .--

NOTES 3237

0 2 4 6 8 1 18 20 h h our ofI I I I I I II- I I I I I I I I I I I I_ omfiyogflwls

bml to nucldi

* rnuroblesl

. . pcphslc lobe &fronscls

musebs

I ' * * ~~~~od" glo

FIG. 5. Schematic summary of tissue-specific enrichment forhsc4 transcripts during embryonic development. The top scalerepresents hours of embryogendsis with hatching (h) occurring at 22h of embryonic development. The solid lines indicate the times atwhich enrichment was observed in the tissues indicated at the right.The dashed line for the pharynx indicates that hsc4 transcriptionwas below the basal level of transcription observed in other nonen-riched tissues.

embryonic and transformed cells and in some secretory cells(1, 10, 16, 22), suggesting that hsc4 is a homolog of themammalian hsc7O gene. Consistent with this interpretation isthe fact that hsc4 is more closely related to the mammalianhsc70 than to the heat-inducible Drosophila hsp70 protein.In addition, like the mammalian hsc70 protein, the Droso-phila hsc4 protein product translocates to the nucleus afterthermal stress (19, 33).

We are indebted to Beth Noll for excellent technical assistance, toMike Slater and Jeff Shilling for assistance in the compilation andanalysis of hsc4 sequence, and to Karen Palter for advice andsharing unpublished results. cDNA clone 321 was isolated byL.A.P. while a postdoctoral fellow in the laboratory of A.P. Ma-howald. We thank K. Palter and M.L. Pardue for critical readingand suggestions on an early version of this manuscript.

J.S.D. was supported by a postdoctoral fellowship (GM 10131)from the National Institutes of Health (NIH). This work wassupported by the Howard Hughes Medical Institute and a grant fromthe American Chemical Society to N.P. and by Public HealthService grant GM27870 to E.A.C. from NIH.

LITERATURE CITED1. Bensaude, O., and M. Morange. 1983. Spontaneous high expres-

sion of heat shock proteins in mouse embryonal carcinoma cellsand ectoderm from day 8 mouse embryos. EMBO J. 3:173-177.

2. Cabrera, C. V., A. Martinez-Arias, and M. Bate. 1987. Theexpression of three members of the achaete-scute gene complexcorrelates with neuroblast segregation in Drosophila. Cell 50:425-433.

3. Campos-Ortega, J. A., and V. Hartenstein. 1985. The embryonicdevelopment of Drosophila melanogaster, p. 85-165. Springer-Verlag, New York.

4. Chirico, W. J., G. Waters, and G. Blobel. 1988. 70K heat shockrelated proteins stimulate protein translocation into mi-crosomes. Nature (London) 332:805-810.

5. Craig, E. A. 1985. The heat shock response. Crit. Rev. Bio-chem. 18:239-280.

6. Craig, E. A., T. D. Ingolia, and L. J. Manseau. 1983. Expression

of Drosophila heat-shock cognate genes during heat shock anddevelopment. Dev. Biol. 99:418-426.

7. Deshaies, R. J., B. D. Koch, M. Werner-Washburne, E. Craig,and R. Schekman. 1988. A subfamily of stress proteins facili-tates translation of secretory and mitochondrial precursor poly-peptides. Nature (London) 332:800-805.

8. Dworniczak, B., and M. E. Mirault. 1987. Structure and expres-sion of a human gene coding for a 71 kd heat shock 'cognate'protein. Nucleic Acids Res. 15:5181-5197.

9. Flynn, G. C., T. G. Chappell, and J. E. Rothman. 1989. Peptidebinding and release by proteins implicated as catalysts ofprotein assembly. Science 245:385-390.

10. Giebel, L. B., B. P. Dworniczak, and E. K. F. Bautz. 1988.Developmental regulation of a constitutively expressed mousemRNA encoding a 72-kDa heat shock-like protein. Dev. Biol.125:200-207.

11. Hafen, E., and M. Levine. 1986. The localization of RNAs inDrosophila tissue sections by in situ hybridization, p. 139-158.In D. B. Roberts (ed.), Drosophila: a practical approach. IRLPress, Washington, D.C.

12. Ingolia, T. D., E. A. Craig, and B. J. McCarthy. 1980. Sequenceof three copies of the gene for the major Drosophila heat shockinduced protein and their flanking regions. Cell 21:669-679.

13. Ingolia, T. D., and E. A. Craig. 1982. Drosophila gene related tothe major heat shock-induced gene is transcribed at normaltemperatures and not induced by heat shock. Proc. Natl. Acad.Sci. USA 79:525-529.

14. Kosaka, T., and K. Ikeda. 1983. Reversible blockage of mem-brane retrieval and endocytosis in the garland cell of thetemperature-sensitive mutant of Drosophila melanogaster,shibire"s. J. Cell Biol. 97:499-507.

15. Lindquist, S., and E. A. Craig. 1988. The heat-shock proteins.Annu. Rev. Genet. 22:631-677.

16. Morange, M., A. Diu, 0. Bensaude, and C. Babinet. 1984.Altered expression of heat shock proteins in embryonal carci-noma and mouse early embryonic cells. Mol. Cell. Biol. 4:730-735.

17. Mount, S. M. 1982. A catalog of splice junction sequences.Nucleic Acids Res. 10:509-518.

18. Munro, S., and H. R. B. Pelham. 1986. An Hsp7O-like protein inthe ER: identity with the 78 kd glucose-regulated protein andimmunoglobulin heavy chain binding protein. Cell 46:291-300.

19. Palter, K. B., M. Watanabe, L. Stinson, A. P. Mahowald, andE. A. Craig. 1986. Expression and localization of Drosophilamelanogaster hsp70 cognate proteins. Mol. Cell. Biol. 6:1187-1203.

20. Pelham, H. 1985. Activation of heat-shock genes in eucaryotes.Trends Genet. 1:31-35.

21. Pelham, H. R. B. 1986. Speculations on the functions of themajor heat shock and glucose-regulated proteins. Cell 46:959-961.

22. Pinhasi-Kimhi, O., D. Michalovitz, A. Ben-Zeev, and M. Oren.1986. Specific interaction between the p53 cellular tumourantigen and major heat shock proteins. Nature (London) 320:182-185.

23. Poole, S. J., L. M. Kauvar, B. Drees, and T. Kornberg. 1985.The engrailed locus of Drosophila: structural analysis of anembryonic transcript. Cell 40:37-43.

24. Romani, S., S. Campuzano, and J. Modolell. 1987. The achaete-scute complex is expressed in neurogenic regions of Drosophilaembryos. EMBO J. 7:2085-2092.

25. Rothman, J. E. 1989. Polypeptide chain binding proteins: cata-

highly enriched. By germ band shortening and extending through dorsal closure, the developing somatic (som) and splanchnic (spm)musculature become enriched (F and G). Finally, late in embryogenesis hsc4 tissue enrichment is observed in the proventriculus, gut (mg),the garland gland (gg), and that region of the frontal sac dorsal to the pharynx which is derived from the procephalic lobe (H). Note that atthis stage the lining of the pharynx (ph) shows hybridization below background. This is the only tissue observed during embryogenesis to haveless than basal-level hybridization. Other abbreviation: vnc, ventral nerve cord. That the hybridization observed is specific for hsc4 and notother hsp7o-related genes was supported by the fact that a 0.8-kb PstI-SalI fragment taken from the highly divergent 3' end of hsc4 (K. Palter,unpublished observations) (panels B to G) showed patterns of hybridization identical to that with cDNAs c321 and cHsc4, which extend intothe less divergent 5' end (panels A and H).

VOL. 10, 1990

MOL. CELL. BIOL.

lysts of protein folding and related processes in cells. Cell59:591-601.

26. Rothman, J. E., and S. L. Schmid. 1986. Enzymatic recycling ofclathrin from coated vesicles. Cell 46:5-9.

27. Schlesinger, M. J. 1986. Heat shock proteins: the search forfunctions. J. Cell. Biol. 103:321-325.

28. Schlossman, D. M., S. L. Schmid, W. A. Braell, and J. E.Rothman. 1984. An enzyme that removes clathrin coats: purifi-cation of an uncoating ATPase. J. Cell Biol. 99:723-733.

29. Snutch, T. P., M. F. P. Heschl, and D. L. Bailie. 1988. TheCaenorhabditis elegans hsp70 gene family: a molecular charac-terization. Gene 64:241-255.

30. Tautz, D., and C. Pfeifle. 1989. A nonradioactive in situ hybrid-ization method for the localization of specific RNAs in Droso-phila embryos reveals a translational control of the segmenta-tion gene hunchback. Chromosoma 98:81-85.

31. Ungewickell, E. 1985. The 70-kd mammalian heat shock proteinsare structurally and functionally related to the uncoating protein

that releases clatherin triskelia from coated vesicles. EMBO J.4:3385-3391.

32. Vassin, H., K. A. Bremer, E. Knust, and J. A. Campos-Ortega.1987. The neurogenic gene Delta of Drosophila melanogaster isexpressed in neurogenic territories and encodes a putativetransmembrane protein with EGF-like repeats. EMBO J. 6:3431-3440.

33. Welch, W. J., and J. P. Suhan. 1985. Morphological study of themammalian stress response: characterization of changes occur-ring in intracellular membraneous organelles, cytoskeletal ele-ments, nucleus and nucleoli and appearance of intranuclearactin containing inclusion bodies in rat fibroblasts following heatshock. J. Cell Biol. 101:1198-1211.

34. Wigglesworth, V. B. 1972. The principles of insect physiology,7th ed., p. 440-442. Chapman and Hall, London.

35. Zinn, K., L. McAllister, and C. S. Goodman. 1988. Sequenceanalysis and neuronal expression of fasciclin I in grasshopperand Drosophila. Cell 53:577-587.

3238 NOTES