maxbac 2.0 baculovirus transfer vectors

MaxBac® 2.0 BaculovirusTransfer Vectors

Version E01041725-0039

MaxBac® 2.0 BaculovirusTransfer Vectors

Catalog nos.: K835-01, K835-02, K875-02, K875-03

United States Headquarters: European Headquarters:Invitrogen Corporation Invitrogen Ltd1600 Faraday Avenue 3 Fountain DriveCarlsbad, CA 92008 USA Inchinnan Business ParkTel: 1 760 603 7200 Paisley PA4 9RF, UKTel (Toll Free): 1 800 955 6288 Tel (Free Phone Orders): 0800 269 210Fax: 1 760 602 6500 Tel (General Enquiries): 0800 5345 5345E-mail: [email protected] Fax: +44 (0) 141 814 6287Web: www.invitrogen.com E-mail: [email protected]

mailto:[email protected]

http://www.invitrogen.com/


iii

Important Information

Contents For vectors included in the Invitrogen MaxBac® 2.0 Baculovirus Expression System,please see list of contents included in the MaxBac® 2.0 Transfection and ExpressionManual.

Shipping/Storage All vectors are shipped at room temperature and should be stored at -20°C upon receipt.

Use ofBaculovirusExpressionVectors

The vectors included in the MaxBac® 2.0 Baculovirus Expression System are sold forresearch purposes only. Please refer to the terms of sale described in the MaxBac® 2.0Transfection and Expression Manual.

Other MaxBac® 2.0Manuals

The following is a list of other manuals to be used in conjunction with this manual for theexpression of recombinant proteins using the MaxBac® 2.0 Baculovirus ExpressionSystem. Please contact Technical Service (see below) if more information is needed.

MaxBac® 2.0 Transfection and Expression ManualGrowth and Maintenance of Insect Cell Lines

v

Table of Contents

Introduction............................................................................................................................. 1Overview........................................................................................................................................................ 1Other Baculovirus Transfer Vectors Available from Invitrogen ............................................................. 2Vector Summary ........................................................................................................................................... 4pBlueBac4.5 Vector ...................................................................................................................................... 5pBlueBac4.5/CAT Control Vector............................................................................................................... 8pVL1392 and pVL1393 Vectors ................................................................................................................ 10

Methods................................................................................................................................. 13Cloning Considerations .............................................................................................................................. 13Cloning Techniques .................................................................................................................................... 14Multiple Cloning Sites ................................................................................................................................ 15Transformation and Analysis .................................................................................................................... 18

Appendix................................................................................................................................ 19Protocol for Chemically Competent Cells................................................................................................. 19Protocol for Electrocompetent Cells ......................................................................................................... 21Recipes ......................................................................................................................................................... 23Technical Service ........................................................................................................................................ 25References.................................................................................................................................................... 26

1

Introduction

Overview

Introduction The information presented in this manual will enable you to successfully clone your geneof interest into the vectors provided with the MaxBac® 2.0 Baculovirus ExpressionSystem. The vectors pBlueBac4.5, pVL1392 and pVL1393 are non-fusion baculovirustransfer vectors used for expression of full-length genes. They provide the elementsnecessary for transcription, but the elements necessary for translation (e.g. a start codonand a stop codon) must be provided by the gene to be expressed.

pBlueBac4.5 The vector pBlueBac4.5 (4940 base pairs) is a non-fusion vector designed to enable youto express a foreign gene in insect cells under the very late AcMNPV polyhedrinpromoter. The lacZ gene is co-expressed under the early to late AcMNPV ETL promoteras a visual marker for recombinant virus (Vialard et al., 1990). The plaques producedfrom viral constructs made with this transfer vector are occ- (occlusion negative) and willproduce blue plaques when a chromogenic substrate is present in the agarose overlay. Thesize of this vector has been greatly decreased versus its precursors (pBlueBac,pBlueBacII, and pBlueBacIII) to provide increased cloning and transformationefficiencies.

pBlueBac4.5/CAT The vector pBlueBac4.5/CAT (5727 base pairs) is a positive control vector that can beused as a control in transfection, PCR verification, and expression studies. A simple assayfor CAT activity can be performed to check for expression. The CAT gene (chloram-phenicol acetyl transferase) is cloned into the pBlueBac4.5 vector at the Hind III site. Theplaques produced from viral constructs made with this transfer vector are occ- and willproduce blue plaques when a chromogenic substrate is present in the agarose overlay.

pVL1392/1393 The vectors pVL1392 and pVL1393 (9636 base pairs) are non-fusion vectors designed toenable you to express a foreign gene in insect cells under the very late AcMNPVpolyhedrin promoter. The plaques produced from viral constructs made with thesetransfer vectors are occ-. The multiple cloning sites of the two vectors are in the oppositeorientation for simplified cloning.

2

Other Baculovirus Transfer Vectors Available from Invitrogen

Introduction The vectors included in the MaxBac® Baculovirus Expression System Kit will allow youto express a non-fusion construct in insect cells. The Invitrogen vectors listed below havespecial features which enable you to purify, secrete, directly clone your gene, orsimultaneously express two proteins.

Purification andDetection:pBlueBacHis2

The vector pBlueBacHis2 A, B, C (4853 base pairs) allows expression of recombinantproteins fused to an N-terminal peptide. Expression is driven by the very late AcMNPVpolyhedrin promoter. The N-terminal fusion tag (Xpress™ tag) includes six tandemhistidine residues for purification over nickel-chelating resins (e.g. ProBond™). Inaddition, the tag includes an epitope for the Anti-Xpress™ Antibody and an enterokinasecleavage site for removal of the tag after purification. pBlueBacHis2 is supplied in threereading frames for simplified cloning. Recombinant virus produced using this transfervector forms occ- plaques that will appear blue when 5-bromo-4-chloro-3-indolyl-β-D-galactosidase (X-gal) or a derivative is present in the agarose overlay.

Product Catalog NumberpBlueBacHis2 A, B, C, 20 µg eachin three reading frames for simplified cloning

V375-20

pBlueBacHis2 Xpress™ Kit K875-01

Anti-Xpress™ Antibody R910-25

EnterokinaseMax™ (250 units) E180-01

EnterokinaseMax™ (1000 units) E180-02

Secretion:pMelBac

The vector pMelBac A, B, C (4819 base pairs) allows you to efficiently secrete yourprotein from insect cells (Sf9, Sf21, and High Five™ cells) using the honeybee mellitinsecretion signal under the very late AcMNPV polyhedrin promoter (Tessier et al., 1991).The vector is supplied in three reading frames for simplified cloning. When cells aregrown in serum-free medium, purification of recombinant, secreted proteins is greatlysimplified.High Five™ cells: High Five™ cells are derived from the native AcMNPV hostTrichoplusia ni and have been shown to produce higher levels of secreted proteins thanSf9 or Sf21 cells (Davis et al., 1993).

Product Catalog NumberpMelBac A, B, C, 20 µg eachin three reading frames for simplified cloning

V1950-02

High Five™ Insect Cells - Frozen B855-02

High Five™ Insect Cells - Log Phase* B855-01

* Log phase cells are not available in Europe or Asia.

continued on next page

3

Other Baculovirus Transfer Vectors, continued

One-Step Cloningof PCR Products:pCR®Bac

The Baculovirus TA Cloning® Kit contains the vector pCR®Bac (4784 base pairs), whichallows direct cloning of PCR products into a baculovirus transfer vector, in the correctorientation for expression. The vector enables you to express your PCR product using thevery late AcMNPV polyhedrin promoter. Recombinant virus produced using this transfervector will form occ- plaques that will appear blue when 5-bromo-4-chloro-3-indolyl-β-D-galactosidase (X-gal) or a derivative is present in the agarose overlay.

Product Catalog NumberBaculovirus TA Cloning®Kit, 20 reactions K4000-20

Baculovirus TA Cloning® Kit, 40 reactions K4000-40

Co-expression ofTwo DifferentProteins: p2Bac

The vector p2Bac (7125 base pairs) allows co-expression of two recombinant proteinssimultaneously. p2Bac carries the enhancer-promoter sequences from the very lateAcMNPV genes p10 and polyhedrin. Recombinant virus produced using this transfervector yields clear, occ- plaques.

Product Catalog Numberp2Bac, 20 µg V1980-10

4

Vector Summary

Introduction The tables below summarize the features of Invitrogen's baculovirus transfer vectors andtheir compatibility with commercially available AcMNPV DNAs. The informationpresented here will enable you to easily select a vector that meets your specificrequirements.

Features/Comparison

The following table summarizes the features of each of Invitrogen's baculovirus transfervectors.

Vector Fusion orNon-Fusion

SecretionSignal?

Blue PlaqueSelection?

PurificationMethod?

Epitope Tag?

pVL1392/1393 Non-Fusion No No No NopBlueBac4.5 Non-Fusion No Yes No NopMelBac Fusion

(Peptidereleaseduponsecretion)

Yes (Honeybee mellitin)

Yes Partial (secreted tothe medium)

No

pBlueBacHis2 Fusion(Peptidereleased withEnterokinasedigestion)

No Yes Yes (Histidinedomain for bindingProBond™ resin)

Yes (Anti-Xpress™

antibody)

p2Bac Non-Fusion No No No NopCR®Bac Non-Fusion No Yes No No

Compatibility withDifferent LinearDNAs

The table below summarizes which Invitrogen vectors recombine with Bac-N-Blue™

DNA, Invitrogen's original Linear AcMNPV DNA, BaculoGold™ DNA (PharMingen), orBacPAK6 DNA (Clontech) and the phenotype of the recombinant plaques.

Vector Recombines withBac-N-Blue™?

Phenotype ofRecombinants

RecombineswithBaculoGold™

or BacPAK6?

Recombines withInvitrogen'soriginal LinearAcMNPV DNA?

Phenotype ofRecombinants

pBlueBac4.5 Yes Blue, occ- No No N/ApBlueBacHis2 Yes Blue, occ- No No N/ApMelBac Yes Blue, occ- No No N/ApVL1392 Yes occ- Yes Yes occ-

pVL1393 Yes occ- Yes Yes occ-

p2Bac Yes occ- Yes Yes occ-

pCR®Bac Yes Blue, occ- No No N/A

5

pBlueBac4.5 Vector

Description Uses: pBlueBac4.5 (4940 bp) is a baculovirus transfer vector designed to allowexpression of your gene of interest in insect cell lines. Expression is driven by the verylate AcMNPV polyhedrin promoter.Construction: The vector pBlueBac4.5 is derived from pJVETL-Z and contains theearly-to-late (ETL) promoter and the very late polyhedrin promoter from AcMNPV(Vialard et al., 1990). All known translational regulatory sequences downstream andupstream of the native ATG of the polyhedrin gene were conserved.ETL Promoter: The ETL promoter directs the synthesis of β-galactosidase as a reportergene (Crawford and Miller, 1988).Polyhedrin Promoter: The polyhedrin promoter controls the synthesis of foreign geneproducts. The 5´ polyhedrin mRNA leader sequence was derived from the baculovirustransfer vector pVL941. The native polyhedrin ATG was removed through site directedmutagenesis.SV40 Polyadenylation Site: The SV40 polyadenylation site has been to shown toincrease transcription termination efficiency and mRNA stability in baculovirusexpression systems (Westwood et al., 1993). It is provided in addition to the nativepolyhedrin polyadenylation signal.Blue Screening: pBlueBac4.5 recombines with Invitrogen's Bac-N-Blue™ DNA to yieldrecombinants that are occ- and form blue plaques when 5-bromo-4-chloro-3-indolyl-β-D-galactosidase (X-gal) or a derivative is present in the agarose overlay.

RecombinationEvents BetweenBac-N-Blue™ DNAand pBlueBac4.5

pBlueBac4.5 contains the 5´ portion of the lacZ gene and ORF1629. Recombinationoccurs between these sequences and lacZ and ORF1629 sequences in Bac-N-Blue™

DNA, forming blue, occ-, recombinant plaques on medium containing X-gal.

Bac-N-Blue™ DNA

Gene of Interest ORF1629

pBlueBac4.5

PPHPETL

5´ lacZ

ORF603

Bsu36 IP603 P1629

3´ lacZ

P1629

5´ ORF1629

Bsu36 I

��pBlueBac4.5 can only be used with Bac-N-Blue™ DNA (Catalog no. K855-01). Thevector cannot be used with Invitrogen's original linear AcMNPV DNA (Catalog no.B825-03), BaculoGold™ (PharMingen) or BacPAK6™ (Clontech) AcMNPV DNA.Because the vector does not contain ORF603, and the lacZ sequences found in otherlinear DNAs are in the opposite orientation, recombination will not occur properly.


6

pBlueBac4.5 Vector, continued

Features ofpBlueBac4.5

The important features of pBlueBac4.5 are summarized in the following table. Allelements have been functionally tested.

Feature BenefitPolyhedrin promoter Allows efficient, high-level expression of

your recombinant protein.Multiple cloning site Allows insertion of your gene.SV40 polyadenylation site Increased transcription termination

efficiency and mRNA stability (Westwood etal., 1993)

ORF1629 recombination sequences Permits recombination of your gene withBac-N-Blue™ linear AcMNPV DNA andrestores the essential ORF1629 forproduction of viable, recombinant virus.

lacZ recombination sequences Permits recombination of your gene withBac-N-Blue™ linear AcMNPV DNA andallows production of blue, recombinantplaques for easy visual selection.

Baculovirus early-to-late (ETL) promoter Allows expression of the intact lacZ gene toproduce blue, recombinant plaques in insectcells.

Small size (4.8 kb, half the size of mostbaculovirus transfer vectors)

Permits efficient and easy cloning of inserts.

Ampicillin resistance gene (β-lactamase) Enables selection of vector in E. coli.

ColE1 origin Yields high-copy number replication andgrowth in E. coli.

Polyhedrin forward and baculovirus (+15)reverse priming sites

Permit sequencing of your insert with thePolyhedrin Forward and Baculovirus (+15)Reverse primers (included in the MaxBac®

2.0 Kit) to confirm that your insert is in thecorrect orientation.

Baculovirus forward and reverse PCRpriming sites

Allows binding of the RecombinantBaculovirus PCR primers (included in theMaxBac® 2.0 Kit) to confirm recombinantplaques.


7

pBlueBac4.5 Vector, continued

Map ofpBlueBac4.5

The figure below summarizes the features of the pBlueBac4.5 vector. The completenucleotide sequence for pBlueBac4.5 is available for downloading from our World WideWeb site (www.invitrogen.com) or by contacting Technical Service (see page 25). Detailsof the multiple cloning site are shown on page 15.

��

�� !"� �#$%�� &�� !"'(��&��)(* '"�� !�!��!+�� !��"�#�,�- ��"�!��!��#�.��/�0��'!#�!�"'��/��&��/��&��1��2�1��3�42+�� !�"'-��-56��'!�

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

�

��


8

pBlueBac4.5/CAT Control Vector

Description Uses: pBlueBac4.5/CAT can be used as a positive control for transfection, plaque assay(blue screening), PCR verification, and expression (see MaxBac® 2.0 Transfection andExpression manual).Construction: pBlueBac4.5/CAT is a 5727 bp control vector containing the gene forchloramphenicol acetyl transferase (CAT). It was constructed by digesting pBlueBac4.5with Hind III and dephosphorylating with calf intestinal alkaline phosphatase (CIAP). AHind III fragment containing the gene for chloramphenicol acetyl transferase was thenligated into pBlueBac4.5. The CAT gene is expressed under the very late AcMNPVpolyhedrin promoter.Blue Screening: pBlueBac4.5/CAT recombines with Invitrogen's Bac-N-Blue™ DNA toyield recombinants that are occ- and form blue plaques when 5-bromo-4-chloro-3-indolyl-β-D-galactosidase (X-gal) or a derivative is present in the agarose overlay.

pBlueBac4.5/CATControl Vector

The pBlueBac4.5/CAT vector is included as a positive control for expression in insectcell lines. In order to test for expression, you will need to co-transfect this vector withBac-N-Blue™ AcMNPV DNA to generate recombinant virus. To do this, you will need toperform the following steps. Please refer to the MaxBac® 2.0 Transfection andExpression Manual for procedures to perform these steps.

Step Action1 Cotransfect pBlueBac4.5/CAT and Bac-N-Blue™ DNA into insect cells.2 Identify blue, recombinant plaques and purify using the plaque assay.3 Verify isolation of pure, recombinant virus by PCR.4 Generate a high-titer stock for expression experiments.5 Infect a suspension culture of Sf9 or the desired insect cell line.6 Assay for CAT expression.

CAT ExpressionAssays

You may assay for the CAT protein by two different methods. There is an enzyme-linkedimmunosorbent assay (ELISA) for levels of CAT protein and a radioactive assay for CATprotein activity. Note that the ELISA method detects the amount of CAT protein whetherit is in the native or the denatured form. It does not determine enzyme activity. If youwish to assay for enzyme activity, use the radioactivity assay.The CAT protein catalyzes the transfer of acetyl groups from acetyl CoA tochloramphenicol. The radioactive assay uses [14C]chloramphenicol, with the addition ofacetyl groups monitored by thin layer chromatography (TLC). [3H]chloramphenicol andbutyryl CoA can also be used in the much simpler and cheaper phase extraction assay.Please refer to Current Protocols in Molecular Biology, Volume 1, Unit 9.6, pages 2-9,for the details of these two assays (Ausubel et al., 1994).


9

pBlueBac4.5/CAT Control Vector, continued

Map of ControlVector

The figure below summarizes the features of the pBlueBac4.5/CAT vector. The completenucleotide sequence for pBlueBac4.5/CAT is available for downloading from our WorldWide Web site (www.invitrogen.com) or by contacting Technical Service (see page 25).

Comments for pBlueBac4.5/CAT: 5727 nucleotides

Polyhedrin promoter (PPH): bases 7-95CAT ORF: bases 222-878SV40 polyadenylation sequence: 986-1113Recombination sequences (ORF1629): bases 2130-1330Ampicillin resistance gene: bases 2517-3374ColE1 origin: bases 3522-41955´ lacZ fragment: bases 5425-4313lacZ sequence homologous to lacZ sequence in Bac-N-Blue™ DNA: bases 5201-4313Early-to-late promoter (PETL): bases 5727-5426

PPH

P ETL

pBlueBac4.5/CAT5.7 kb

5´ la

cZ F

ragm

ent

ColE1Ampicillin

Recombinati on Sequence

CAT SV40 pA


10

pVL1392 and pVL1393 Vectors

Description Uses: pVL1392 and pVL1393 (9632 bp) are baculovirus transfer vectors designed toallow expression of your gene in insect cell lines. Expression of your recombinant proteinis driven by the very late polyhedrin promoter.Construction: The vectors pVL1392 and pVL1393 contain the very late polyhedrinpromoter from AcMNPV. All known translational regulatory sequences downstream andupstream of the native ATG of the polyhedrin gene were conserved.Reverse Polylinkers: The multiple cloning sites in pVL1392 and pVL1393 are in theopposite orientation to facilitate cloning. Otherwise, the two vector sequences areidentical.Polyhedrin Promoter: The polyhedrin promoter controls the synthesis of foreign geneproducts. The 5´ polyhedrin mRNA leader sequence was derived from the baculovirustransfer vector pVL941. The native polyhedrin ATG was removed through site directedmutagenesis.

EcoR I Digestion When digested with EcoR I, pVL1392 and pVL1393 are susceptible to star activityresulting in additional cleavage of the plasmids at base pair 367. Star activity occurs inthe presence of excess enzyme, if glycerol concentrations are greater than 5%, or if pHvalues are greater than 8.0. These conditions should be avoided in order to preventpossible star activity. For more information on star activity, please refer to themanufacturer of the enzyme being used.

RecombinationEvents BetweenBac-N-Blue™ DNAand pVL1392/1393

For vectors that do not contain lacZ sequences (e.g. pVL1392 and pVL1393),recombination occurs at ORF603 and ORF1629. Recombinant plaques (occ-) do notproduce polyhedra and will appear dull and flat in appearance when compared to occ+

(wild-type) plaques which are shiny and crystalline in appearance.

P1629

Gene of Interest ORF1629

pVL1392pVL1393

PPHP603

ORF603 5´ ORF1629

Bac-N-Blue™ DNA

Bsu36 IP603 P1629

3´ end of lacZ

Bsu36 I

ORF603


11

pVL1392 and pVL1393 Vectors, continued

Features ofpVL1392 andpVL1393

The important elements of pVL1392 and pVL1393 are summarized in the following table.All features have been functionally tested.

Feature BenefitPolyhedrin promoter Allows efficient, high-level expression of

your recombinant protein.Multiple cloning sites in oppositeorientation

Facilitates insertion of your gene.

ORF1629 recombination sequences Permits integration of your gene intoAcMNPV DNA. If recombined with Bac-N-Blue™ DNA, it will restore the essentialORF1629 for production of viable,recombinant virus.

ORF603 recombination sequences Permits integration of your gene intoAcMNPV DNA.

Ampicillin resistance gene (β-lactamase) Enables selection of vector in E. coli.

ColE1 origin Yields high-copy number replication andgrowth in E. coli.

Polyhedrin forward and reverse primingsites

Permit sequencing of your insert with thePolyhedrin Forward and Reverse primers(included in the MaxBac® 2.0 Kit) to con-firm that your insert is in the correctorientation.

Baculovirus forward and reverse PCRpriming sites

Allows binding of the RecombinantBaculovirus PCR primers (included in theMaxBac® 2.0 Kit) to confirm recombinantplaques.


12

pVL1392 and pVL1393 Vectors, continued

Map of pVL1392and pVL1393

The figure below summarizes the features of both the pVL1392 and pVL1393 vector. Thecomplete nucleotide sequence for both vectors is available for downloading from ourWorld Wide Web site (www.invitrogen.com) or by contacting Technical Service (seepage 25). Details of the multiple cloning site are shown on page 16 for pVL1392 andpage 17 for pVL1393.

pVL1392/939.6 kb

PPH

Recombination S

equ

ence

Rec

om

bin

atio

n S

eque

nce

ColE1

Amp

Comments for pVL1392/1393: 9632 nucleotides

Recombination sequence (ORF603+): bases 1-3997 Polyhedrin promoter (PPH): bases 3998-4092 Polyhedrin forward sequencing priming site: bases 4017-4034Baculovirus forward PCR priming site: bases 4049-4072Polyhedrin gene: bases 4093-4738Multiple cloning site: bases 4128-4179 Polyhedrin reverse sequencing priming site: bases 4288-4302Recombination sequence (ORF1629+): bases 4738-7002Baculovirus PCR reverse priming site: bases 4777-4797ColE1 origin: bases 8029-7356Ampicillin resistance gene: bases 8965-8177

1

Sac II

Apa I

Xho I

EcoR V

Bgl

IIP

st I

Not

IX

ma

IIIE

coR

IX

ba I

Sm

a I

Bam

H I

Bam

H I

Sm

a I

Xba

IE

coR

IN

ot I

Xm

a III

Pst

IB

gl II

pVL1392

pVL1393



13

Methods

Cloning Considerations

CloningConsiderations:Transcription

Essential Leader Sequence: For optimal transcription of a recombinant mRNA, the vectorused must contain the following untranslated leader sequence in its native, uninterruptedform:

TA-50 AGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAAT-1ATT(G)

pVL1392, pVL1393, and pBlueBac4.5 all contain this essential leader sequence. Thesevectors produce non-fused recombinant proteins.Polyadenylation Signals: All Invitrogen's baculovirus transfer plasmids have an intactpolyhedrin polyadenylation signal. In addition to this, the pBlueBac4.5 vector contains anSV40 polyadenylation signal for more efficient transcription termination and mRNAstability (Westwood et al., 1993).

CloningConsiderations:Translation

The following is a summary of the requirements for a recombinant gene to be optimallyexpressed using a non-fusion vector (e.g. pBlueBac4.5, pVL1392 and pVL1393).ATG Required: The production of nonfused proteins requires DNA inserts containing atranslation initiation ATG. In pBlueBac4.5, pVL1392 and pVL1393, the native ATG ofpolyhedrin has been mutated from ATG to ATT. However, protein translation may initiateat the mutated ATG (ATT) if the recombinant gene is inserted in frame with the polyhedrinopen reading frame (see Multiple Cloning Sites, pages 15-17). This may result in tworecombinant expression products: the nonfused recombinant protein (as the majorexpression product), and the recombinant protein fused with (Beames et al., 1991).Stop Codon Required: A stop codon (TAA, TGA, TAG) is required to ensure translationaltermination of your protein of interest at the end of its open reading frame. Default stopcodons are present in all three reading frames, but they may add additional undesirablesequence to the carboxy terminus of your protein.Minimize Untranslated Sequences: It is recommended that 5´ untranslated DNAsequences contained in the foreign gene be minimized (less than 50 base pairs), if notremoved entirely for optimal protein expression. The effect of 3´ untranslated portionscontained in foreign genes on gene expression is not known.Other Factors: The nature of the foreign DNA sequence (signal sequence, etc.), availablepathways for protein processing, codon preference, and RNA/protein stability may effect thelevels of foreign gene expression.

��

A review of the expression of recombinant proteins using different transfer vectors ispresented in the review articles (Luckow and Summers, 1988; Webb and Summers,1990).


14

Cloning Techniques

General MolecularBiologyTechniques

For help with DNA ligations, E. coli transformations, restriction enzyme analysis, DNAsequencing, and DNA biochemistry, please see Molecular Cloning: A LaboratoryManual (Sambrook et al., 1989) or Current Protocols in Molecular Biology (Ausubel etal., 1994).

Maintenance ofpBlueBac4.5,pVL1392 andpVL1393 in E. coli

In order to propagate and maintain pBlueBac4.5, pVL1392, and pVL1393, werecommend that you resuspend the lyophilized vector in 20 µl sterile water to make a1 µg/ µl stock solution. Store at -20°C.Use this stock solution to transform a recA, endA E. coli strain like TOP10, TOP10F´,INVαF´, DH5α, JM109, or equivalent. Transformants are selected on LB platescontaining 50-100 µg/ml ampicillin.

Ligation If you are having difficulty ligating your clone into any of the MaxBac® 2.0 BaculovirusExpression System vectors, the following steps should be helpful:Molar Ratio: A molar ratio of 1:3 (vector: insert) is recommended for optimal ligationefficiency. This can be easily calculated by the following formula:(ng of insert) = [(ng of vector)(size of insert)/ (size of vector)] x 3For Example: For a 1:3 ratio of a 1000 bp insert into pBlueBac4.5, you would need:(50 ng of pBlueBac4.5)(1000 bp)/ (4940 bp) = 10 x 3 = ~30 ng of insertLarge DNA Fragments: Larger vectors (e.g. pVL1392/1393) or inserts greater than 2 kbcan be difficult to ligate and transform. Using a 1:3 molar ratio in the ligation, cleaning upthe DNA fragments after ligation, maintaining a low ligation volume (e.g. 10-20 µl final)and using a unidirectional (rather than a bidirectional) cloning strategy can all be helpful.

15

Multiple Cloning Sites

Multiple CloningSite ofpBlueBac4.5

Below is the multiple cloning site for pBlueBac4.5. Please note that the multiple cloningsite has been modified from pBlueBac4 to eliminate an Nco I site that contained an ATG.In addition, unique Sma I and Xba I sites have been added between the Kpn I and EcoR Isites. Restriction sites are labeled to indicate the cleavage site. The multiple cloning sitehas been confirmed by sequencing and functional testing.

�� *�7�� $&��$��

1��8��*�7�� ,(��$��

$��05��

1��8��9 ��(8��$&��$��

1��8��(8��,(��$��

7�� +5:�� +55

��

��

��

��

��

��

��

��

��

��

�

��

��

��

��

��

��

��

��

��

��; ��; ��;

��;; �� (�;��;

�� ;

��; ��; ��1�; �� ;;; ��;

$%�� &��

��;


16

Multiple Cloning Sites, continued

Multiple CloningSite of pVL1392

Below is the multiple cloning site for pVL1392. Restriction sites are labeled to indicatethe cleavage site. The multiple cloning site has been confirmed by sequencing andfunctional testing.

w.t. ATG mutated to ATT

Polyhedrin Forward Sequencing Priming Site

BamH I

Bgl II Pst I

Baculovirus Forward PCR Priming Site

Polyhedrin Reverse

Baculovirus Reverse PCR Priming Site

3998

Start ofTranscription

Not I Xma III

Eco RI Xba I Sma I

TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC

GATATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA

GGATTATTCA TACCGTCCCA CCATCGGGCG CGGATCAGAT CTGCAGCGGC

CGCTCCAGAA TTCTAGAAGG TACCCGGGAT CCTTTCCTGG GACCCGGCAA

GATGGATGTT TTCCTTGTTG TCAACATGCG TCCCACTAGA CCCAACCGTT

TGGACCCGCT TCATGGAAGA CAGCTTCCCC ATTGTTAACG ACCAAGAAGT

CGATGAAGCT TGTCGTTGGA TGGAAAGGAA AAGAGTTCTA CAGGGAAACT

GAACCAAAAA CTCACTCTCT TCAAGGAAAT CCGTAATGTT AAACCCGACA

GTTACAAATT CCTGGCCCAA CACGCTCTGC GTTGCGACCC CGACTATGTA

CCTCATGACG TGATTAGGAT CGTCGAGCCT TCATGGGTGG GCAGCAACAA

CGAGTACCGC ATCAGCCTGG CTAAGAAGGG CGGCGGCTGC CCAATAATGA

ACCTTCACTC TGAGTACACC AACTCGTTCG AACAGTTCAT CGATCGTGTC

ATCTGGGAGA ACTTCTACAA GCCCATCGTT TACATCGGTA CCGACTCTGC

TGAAGAGGAG GAAATTCTCC TTGAAGTTTC CCTGGTGTTC AAAGTAAAGG

AGTTTGCACC AGACGCACCT CTGTTCACTG GTCCGGCGTA TTAAAACACG

ATACATTGTT ATTAGTACAT TTATTAAGCG CTAGATTCTG TGCGTTGTTG

ATTTACAGAC AATTGTTGTA CGTATTTTAA TAATTCATTA AATTTATAAT

4048

4098

4148

4198

4248

4298

4348

4398

4448

4498

4548

4598

4648

4698

4748

4798

Sequencing Priming Site


17

Multiple Cloning Sites, continued

Multiple CloningSite of pVL1393

Below is the multiple cloning site for pVL1393. Restriction sites are labeled to indicate thecleavage site. The multiple cloning site has been confirmed by sequencing and functionaltesting.

w.t. ATG mutated to ATT

Polyhedrin Forward Sequencing Priming Site

BamH I Sma I

Baculovirus Forward PCR Priming Site

Polyhedrin Reverse

Baculovirus Reverse PCR Priming Site

3998

Start ofTranscription

Not I Xma III

TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC

GATATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA

GGATTATTCA TACCGTCCCA CCATCGGGCG CGGATCCCGG GTACCTTCTA

GAATTCCGGA GCGGCCGCTG CAGATCTGAT CCTTTCCTGG GACCCGGCAA

GATGGATGTT TTCCTTGTTG TCAACATGCG TCCCACTAGA CCCAACCGTT

TGGACCCGCT TCATGGAAGA CAGCTTCCCC ATTGTTAACG ACCAAGAAGT

CGATGAAGCT TGTCGTTGGA TGGAAAGGAA AAGAGTTCTA CAGGGAAACT

GAACCAAAAA CTCACTCTCT TCAAGGAAAT CCGTAATGTT AAACCCGACA

GTTACAAATT CCTGGCCCAA CACGCTCTGC GTTGCGACCC CGACTATGTA

CCTCATGACG TGATTAGGAT CGTCGAGCCT TCATGGGTGG GCAGCAACAA

CGAGTACCGC ATCAGCCTGG CTAAGAAGGG CGGCGGCTGC CCAATAATGA

ACCTTCACTC TGAGTACACC AACTCGTTCG AACAGTTCAT CGATCGTGTC

ATCTGGGAGA ACTTCTACAA GCCCATCGTT TACATCGGTA CCGACTCTGC

TGAAGAGGAG GAAATTCTCC TTGAAGTTTC CCTGGTGTTC AAAGTAAAGG

AGTTTGCACC AGACGCACCT CTGTTCACTG GTCCGGCGTA TTAAAACACG

ATACATTGTT ATTAGTACAT TTATTAAGCG CTAGATTCTG TGCGTTGTTG

ATTTACAGAC AATTGTTGTA CGTATTTTAA TAATTCATTA AATTTATAAT

4048

4098

4148

4198

4248

4298

4348

4398

4448

4498

4548

4598

4648

4698

4748

4798

Xba I

Eco RI Pst I Bgl II

Sequencing Priming Site

18

Transformation and Analysis

ChemicalTransformation

Chemical transformation can be used to transform any of the baculovirus transfer vectorsinto competent E. coli (e.g. TOP10F´). For more information on chemical transformationof E. coli, see page 19.Note: If the construct size exceeds 10 kb, electroporation may yield higher transformationefficiencies.

Electroporation Electroporation yields higher transformation efficiencies than chemical methods. If youare obtaining no or very few colonies by chemical methods, electroporation may providethe means to obtain a sufficient number of colonies to screen and identify yourrecombinant clone. Electroporation typically yields 10-100 fold higher transformationefficiencies than chemical transformation. For more information on electroporation of E.coli please see page 21.

Selection andAnalysis ofTransformants

1. Plate transformations on LB medium containing 50 to 100 µg/ml ampicillin.2. Pick at least 20 colonies for plasmid isolation and restriction analysis to determine

the presence and orientation of the insert.3. Grow colonies overnight in LB broth containing ampicillin at 50 µg/ml.4. Analyze by restriction mapping or sequencing (see below).5. When you obtain the construct you desire, you are ready to proceed to co-

transfection with Bac-N-Blue™ AcMNPV DNA. Proceed to the Transfectionsection in the MaxBac® 2.0 manual.Note: For cotransfection with linear AcMNPV DNA, you will need 10 µg of highlypurified plasmid DNA for each transfection experiment. We recommend usingresin-based DNA isolation systems or CsCl-ethidium bromide gradientcentrifugation.

(-,)

��-24+5

;)2

We recommend that you sequence your construct with the Polyhedrin Forward Primerand either the Polyhedrin Reverse Primer (pVL1392 and pVL1393) or the Baculovirus(+15) Reverse Sequencing Primer (pBlueBac4.5) included in the kit to confirm that yourgene is in the correct orientation.If you do not have a sequencing protocol in your lab, there are many sequencing kitscommercially available. The following instructions describe how to prepare thelyophilized primers for sequencing.1. Centrifuge briefly the tubes containing the lyophilized primers to bring the material

down to the bottom of the tube.2. Resuspend each primer (2 µg, 0.36 nmoles) in 40 µl TE buffer or water such that the

final concentration is 50 ng/µl (9 µM). While this is a convenient concentration forsequencing reactions, you can resuspend it in any volume you desire.

19

Appendix

Protocol for Chemically Competent Cells

Introduction This protocol is used to make chemically competent cells for transformation with plasmidDNA (Hanahan, 1983). These cells will not substitute for electrocompetent cells forelectroporation. The cells are grown to mid-log phase, then washed with FSB solution,and treated with DMSO. The cells are frozen in a dry ice/ethanol bath and stored at -70°C.

Yield This protocol will yield enough cells for about 60 transformations. The expectedefficiency of chemically competent E. coli cells is ~1 x 108 cfu/µg supercoiled DNA, butefficiencies will vary between strains. This is also the minimum efficiency needed toobtain 100-200 colonies per 100 µl transformation mix.

��Sterile technique is absolutely essential to avoid contamination of the competentcells. Remember to use sterile solutions, medium, and supplies.

Preparation For each preparation, prepare the following solutions (see Recipes, pages 23-24):5 ml SOB medium in a sterile culture tube250 ml SOB in a sterile 500 ml or 1 liter culture flaskFSB solution (~25 ml)Fresh, reagent grade DMSO

Growth of Cells:Day 1

Streak TOP10 on an LB plate, invert the plate, and incubate at 37°C overnight.

Growth of Cells:Day 2

• Inoculate 5 ml of SOB medium in a sterile culture tube with one colony from the LBplate.

• Grow overnight (12-16 hours) in a shaking incubator (200-225 rpm) at 37°C.

Growth of Log-phase Cells: Day 3

1. For each preparation, place the following items on ice or at +4°C.

Two 250 ml sterile centrifuge bottlesTwo 50 ml sterile centrifuge tubesTwo 5 ml sterile pipettes

2. Inoculate 250 ml of fresh SOB medium in a 500 ml or 1 liter culture flask with2.5 ml of the overnight culture.

3. Grow the culture at 37°C at 200-225 rpm in a shaking incubator until the OD550

reaches between 0.55-0.65 (2-3 hours).4. Divide the culture between the two cold (0-4°C), sterile 250 ml centrifuge bottles

and place on ice for 30 minutes.


20

Protocol for Chemically Competent Cells, continued

Preparing theCells

1. Centrifuge the 250 ml bottles at 2000 x g for 10-15 minutes at 0-4°C.2. Decant the medium and resuspend each pellet in 10 ml cold (0-4°C) FSB solution

and transfer to two cold, sterile, 50 ml centrifuge tubes. Incubate on ice for 15minutes.

3. Centrifuge the tubes at 2000 x g for 10-15 minutes at 0-4°C.4. Decant the buffer and resuspend each pellet in 1.8 ml cold FSB solution using a

sterile 5 ml pipette.5. While gently swirling the tubes, slowly add 65 µl of DMSO drop by drop to each

tube. Incubate on ice for 15 minutes.6. While gently swirling the tubes, slowly add an additional 65 µl of DMSO drop by

drop to each tube.7. Combine the cell suspensions from both tubes into one and incubate on ice for 15

minutes. Keep on ice.

Aliquoting andStorage of Cells

1. Prepare a dry ice/ethanol bath.2. For each preparation, place approximately sixty 1.5 ml microcentrifuge tubes on ice.

Keep cell suspension on ice.3. Pipette 50 µl of cell suspension into each tube.4. As soon as all of the cell suspension is aliquoted, quick-freeze the tubes in the dry

ice/ethanol bath and store at -70°C.

21

Protocol for Electrocompetent Cells

Introduction The purpose of this procedure is to prepare cells for transformation with plasmid DNA byelectroporation. The procedure describes the growth of cells and subsequent washing andconcentrating steps. The washing is necessary to ensure that salts are removed to reducethe conductivity of the cell solution. High conductivity may result in arcing duringelectroporation.These cells are only to be used for electroporation. Do not use them for any othertransformation protocol.

Yield The following procedure will yield enough electrocompetent cells for about 30transformations. Remember to use sterile solutions, medium, and supplies.

��The expected efficiency of the electrocompetent TOP10 cells is ~1 x 109 cfu/µgsupercoiled DNA. This is the minimum efficiency needed to obtain 100-200 colonies per100 µl of the transformation reaction.

��Sterile technique is absolutely essential to avoid contamination of the electro-competent cells.

Growing the Cells:Day 1

Streak TOP10 on an LB plate, invert the plate, and incubate at 37°C overnight.Prepare the following:50 ml LB medium in a 250 ml sterile culture flask1 liter of LB medium in a 2 liter or 4 liter sterile culture flaskStore at room temperature50 ml of sterile 10% glycerol1.5 liter of sterile waterStore at +4°C


Inoculate the 50 ml of LB medium in a 250 ml culture flask with a single colony from theLB plate and incubate at 37°C with shaking (200-225 rpm) for 12-16 hours (overnight).


1. For each preparation, pre-chill on ice or at +4°C:Two sterile 500 ml centrifuge bottlesTwo sterile 50 ml centrifuge tubesTwo sterile 25 ml pipettesOne sterile 5 ml pipette

2. Inoculate 1 liter of LB medium in a 2 liter or 4 liter flask with the 50 ml overnightculture. Grow the 1 liter culture in shaking incubator (200-225 rpm) at 37°C untilthe OD550 is between 0.5 and 0.6 (approximately 2-3 hours).

3. Transfer the 1 liter culture to the two chilled, sterile 500 ml centrifuge bottles andincubate on ice for 30 minutes.


22

Protocol for Electrocompetent Cells, continued

Harvesting andWashing the Cells

1. Centrifuge the cultures at 2000 x g for 15 minutes at 0-4°C. Keep the cell pellet anddecant the broth. Place bottles back on ice.

2. Resuspend the cell pellet in each bottle in approximately 500 ml of cold (0-4°C),sterile water.

3. Centrifuge cells at 2000 x g for 15 minutes at 0-4°C. Keep the pellet and decant thewater. Place bottles back on ice.

4. Resuspend the cells in each bottle in approximately 250 ml of cold (0-4°C), sterilewater.

5. Centrifuge cells at 2000 x g for 15 minutes at 0-4°C. Decant the water and placebottles back on ice.

6. Using a pre-chilled, sterile 25 ml pipette, resuspend cells in each bottle in 20 mlcold (0-4°C), sterile, 10% glycerol and transfer each cell suspension to a chilled,sterile, 50 ml centrifuge tube.

7. Centrifuge cells at 4000 x g for 15 minutes at 0-4°C. Decant the 10% glycerol andplace tubes on ice.

8. Resuspend each cell pellet in 1 ml cold (0-4°C), sterile, 10% glycerol. Using a pre-chilled 5 ml pipette, pool the cells into one of the 50 ml tubes. Keep on ice.

Aliquoting andStorage of Cells

1. Prepare a dry ice/ethanol bath.2. For each preparation, place thirty-five to forty 1.5 ml microcentrifuge tubes on ice

and pipette 40 µl of the cell suspension into each tube. Keep cell suspension andtubes on ice until all of the cell solution is aliquoted.

3. After all of the cell suspension is aliquoted, quick-freeze tubes in the dry ice/ethanolbath and store at -70°C until ready for use.

23

Recipes

Low Salt LBMedium

Composition1% Tryptone0.5% Yeast Extract0.5% NaClpH 7.01. For 1 liter, dissolve 10 g bacto-tryptone, 5 g bacto-yeast extract, and 5 g NaCl in

950 ml de-ionized water.2. Adjust the pH of the solution to 7.0 with NaOH and bring the volume up to 1 liter.3. Autoclave for 20 minutes at 15 lb/sq. in.4. Store at room temperature or at +4°C.

Low Salt LB AgarPlates

1. Prepare LB medium as above, but add 15 g/L agar before autoclaving.2. Autoclave for 20 minutes at 15 lb/sq. in.3. After autoclaving, cool to ~55°C, add antibiotic (50-100 µg/ml for ampicillin), and

pour into 10 cm plates.4. Let harden, then invert and store at +4°C.

SOB Medium Composition2% Tryptone0.5% Yeast Extract0.05% NaCl2.5 mM KCl10 mM MgCl2Prepare the following solutions:• 250 mM KCl: Dissolve 1.86 g of KCl in 100 ml of deionized water.• 1 M MgCl2: Dissolve 20.33 g of MgCl2 in 100 ml deionized water. Autoclave solution

at 15 lbs/sq. in. for 20 minutes. Store at room temperature.1. For 1 liter, dissolve 20 g Tryptone, 5 g Yeast Extract, and 0.5 g NaCl in 950 ml

water.2. Add 10 ml of the 250 mM KCl solution to the solution in Step 1.3. Adjust the pH of the tryptone/yeast extract/NaCl/KCl solution to 7.0 with 5 M

NaOH, then bring the volume to 980 ml with deionized water.4. Autoclave solution at 15 lbs/sq. in. for 20 minutes.5. Let the autoclaved solution cool to about 55°C, then add 10 ml 1 M MgCl2 to the

tryptone/yeast extract /NaCl/ KCl solution under sterile conditions to preventcontamination. Store at room temperature or +4°C.


24

Recipes, continued

SOC Medium CompositionSOB Medium20 mM glucosePrepare the following solution:• 2 M glucose: Dissolve 36 g of glucose in a final volume of 100 ml deionized water.

Filter-sterilize this solution.1. Prepare SOB Medium above following Steps 1-4.2. Let the autoclaved solution cool to about 55°C, then add 10 ml of the filter-sterilized

2 M glucose solution and 10 ml 1 M MgCl2 to the tryptone/yeast extract /NaCl/ KClsolution under sterile conditions to prevent contamination. Store at roomtemperature or +4°C.

FSBTransformationSolution

10 mM potassium acetate, pH 7.5 45 mM MnCl2-4H2O 10 mM CaCl2-2H2O100 mM KCl 3 mM hexaamminecobalt chloride (Aldrich #20309-2; 1-800-558-9160 to order) 10% glycerol1. Make 100 ml of 1 M potassium acetate by dissolving 9.82 g in 90 ml deionized

water. Adjust pH to 7.5 with 2 M acetic acid. Bring the volume up to 100 ml.2. For 100 ml of FSB transformation solution combine the following ingredients:

1 ml 1 M potassium acetate, pH 7.5890 mg MnCl2-4H2O150 mg CaCl2-2H2O750 mg KCl 80 mg hexaamminecobalt chloride 10 ml 100% glycerol 80 ml deionized water

3. Carefully adjust pH to 6.4 with 0.1 N HCl. If you go past the correct pH, remakesolution. Do not readjust pH with base.

4. Adjust the final volume to 100 ml with deionized water and filter sterilize. Store at+4°C.

DMSO It is very important to use fresh, analytical grade DMSO. If you routinely transform cellsby chemical means using the method of Hanahan, 1983, you probably have frozenaliquots of DMSO in your laboratory; if not, then follow this procedure:1. Order the smallest amount of analytical grade DMSO.2. When the DMSO arrives, take 5-10 ml and aliquot 200-500 µl per microcentrifuge

tube. You may use the rest of the DMSO for other applications or you may aliquotthe remainder for competent cells. It depends on whether you plan to use the methoddescribed in this manual on a routine basis.

3. Freeze these tubes at -20°C and use one tube per preparation of competent cells.Discard any remaining DMSO in the tube. Use a fresh tube for every preparationof competent cells.

25

Technical Service

World Wide Web Visit the Invitrogen Web Resource using your World Wide Web browser. At the site, youcan:• Get the scoop on our hot new products and special product offers• View and download vector maps and sequences• Download manuals in Adobe® Acrobat® (PDF) format• Explore our catalog with full color graphics• Obtain citations for Invitrogen products• Request catalog and product literatureOnce connected to the Internet, launch your web browser (Netscape 3.0 or newer), thenenter the following location (or URL):

http://www.invitrogen.com...and the program will connect directly. Click on underlined text or outlined graphics toexplore. Don't forget to put a bookmark at our site for easy reference!

Contact us For more information or technical assistance, please call, write, fax, or email.Additional international offices are listed on our web page (www.invitrogen.com).United States Headquarters: European Headquarters:Invitrogen Corporation Invitrogen Ltd1600 Faraday Avenue 3 Fountain DriveCarlsbad, CA 92008 USA Inchinnan Business ParkTel: 1 760 603 7200 Paisley PA4 9RF, UKTel (Toll Free): 1 800 955 6288 Tel (Free Phone Orders): 0800 269 210Fax: 1 760 602 6500 Tel (General Enquiries): 0800 5345 5345E-mail: [email protected] Fax: +44 (0) 141 814 6287Web: www.invitrogen.com E-mail: [email protected]

Limited Warranty Invitrogen is committed to providing our customers with high-quality goods and services. Our goalis to ensure that every customer is 100% satisfied with our products and our service. If you shouldhave any questions or concerns about an Invitrogen product or service, please contact ourTechnical Service Representatives.Invitrogen warrants that all of its products will perform according to the specifications stated on thecertificate of analysis. The company will replace, free of charge, any product that does not meetthose specifications. This warranty limits Invitrogen Corporation’s liability only to the cost of theproduct. No warranty is granted for products beyond their listed expiration date. No warranty isapplicable unless all product components are stored in accordance with instructions. Invitrogenreserves the right to select the method(s) used to analyze a product unless Invitrogen agrees to aspecified method in writing prior to acceptance of the order.Invitrogen makes every effort to ensure the accuracy of its publications, but realizes that theoccasional typographical or other error is inevitable. Therefore Invitrogen makes no warranty ofany kind regarding the contents of any publications or documentation. If you discover an error inany of our publications, please report it to our Technical Service Representatives.Invitrogen assumes no responsibility or liability for any special, incidental, indirect orconsequential loss or damage whatsoever. The above limited warranty is sole and exclusive.No other warranty is made, whether expressed or implied, including any warranty ofmerchantability or fitness for a particular purpose.





26

ReferencesAusubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994).

Current Protocols in Molecular Biology (New York: Greene Publishing Associates and Wiley-Interscience).

Beames, B., Braunagel, S. C., Summers, M. D., and Lanford, R. E. (1991). Translational Initiation from an AUUCodon of a Baculovirus Vector. BioTechniques 11, 378-383.

Crawford, A. M., and Miller, L. K. (1988). Characterization of an Early Gene Accelerating Expression of LateGenes of the Baculovirus Autographa californica Nuclear Polyhedrosis Virus. J. Virology 62, 2773-2781.

Davis, T. R., Wickham, T. J., McKenna, K. A., Granados, R. R., Shuler, M. L., and Wood, H. A. (1993).Comparative Recombinant Protein Production of Eight Insect Cell Lines. In Vitro Cell. Dev. Biol. 29A, 388-390.

Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557-580.

Luckow, V. A., and Summers, M. D. (1988). Trends in the Development of Baculovirus Expression Vectors.Bio/Technology 6, 47-55.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Second Edition(Plainview, New York: Cold Spring Harbor Laboratory Press).

Tessier, D. C., Thomas, D. Y., Khouri, H. E., Laliberte, F., and Vernet, T. (1991). Enhanced Secretion from InsectCells of a Foreign Protein Fused to the Honeybee Melittin Signal Peptide. Gene 98, 177-183.

Vialard, J., Lalumiere, M., Vernet, T., Briedis, D., Alkhatib, G., Henning, D., Levin, D., and Richardson, C. (1990).Synthesis of the Membrane Fusion and Hemagglutinin Proteins of Measles Virus Using a Novel BaculovirusVector Containing the b-Galactosidase Gene. J. Virology 64, 37-50.

Webb, N. R., and Summers, M. D. (1990). Expression of Proteins Using Recombinant Baculoviruses. Technique 2,172-188.

Westwood, J. A., Jones, I. M., and Bishop, D. H. L. (1993). Analyses of Alternative Poly(A) Signals for Use inBaculovirus Expression Vectors. Virology 195, 90-93.

©1997-2001 Invitrogen Corporation. Reproduction forbidden without permission.

maxbac 2.0 baculovirus transfer vectors

Documents