materials - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 ·...
TRANSCRIPT
![Page 1: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/1.jpg)
MATERIALS AND METHODS
![Page 2: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/2.jpg)
CHAPTER - 3
MATERIALS AND METHODS
3.1 Materials
All fine chemicals and restriction enzymes were obtalned from Slgma-
Aldrich Corporatlon, USA and New England Biolabs, UK Medla compounds and
biochemicals were purchased from Sisco Research laboratories Pvt Ltd ,
SD-Fine Chemicals and HI-Medla laboratories, India. PCR prlmers, molecular
biologicals and cloning vectors were procured from Life Technologles Inc USA,
Mls.Bangalore Gene1 Itd., India and Promega Corporat~on, USA Taq DNA
polymerase was procured from ether Life Technologles Inc , USA or purlfled
from pTAQ plasmid containing E coli clone available In the Department of
Biotechnology, Pond~cherry University, Pond~cherry Sheet film negatives for
photography were procured from Forte Photochemical Company Vac, Hungary
3.1.1 Instruments
Autoclave
Bioreactor
Deep freezer (-70°C)
Deionlsed water system
Welghlng balance
Mlcrocentrlfuge
York Scientific Instruments, indla
Appl~kon dependable Instruments B V, Holland
Forrna Sclentlf~c, Inc , USA
Mlllr-Q, Mllllpore Corporat~on, USA
Sartorius AG, Germany
Eppendorf Netheler-Hlnz GmBH, Germany
![Page 3: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/3.jpg)
Gel electrophoresis systems
Gel documentation system
Gel drier
High speed refrigerated Centrifuge
Ice flaker
Incubators
Laminar flow hood
ELlSA (Mlcroplate) reader
Phase contrast Microsco~e
PCR Thermal cycler
pH meter
Photography
Sonlcator
Vacuum concentrator
Table top Centrifuge
Trans blot apparatus (semldry)
UV- translllum~nator
UV-VIS Spectrophotometer
Water bath shaker
water bath
Bio-Rad Laborator~es Inc.. USA Biotech, Yercaud ; Broviga Instruments, lndla
Bio-Rad Laboratories Inc., USA.
Bio-Rad Laboratories Inc , USA
Sorvall, Dupont company, USA
Scottsman, Italy
York Scientific Industr~es, lnd~a
Alfa Ilnear, lndla
BIO-Rad Laborator~es Inc , USA
Photom~crograph system H-Ill, Nikon Corporatlon, Japan
Master cycler-Gradlent, Eppendorf Netheler-Hlnz GmBH. Germany
CD Instrumentat~on, Pvt , Ltd , lndla
Poloroid corporatlon, USA
Son~fier 250, Branson Ultrasonics corporatlon, USA
Speed Vac, Savant Instruments Inc., USA
Reml Laboratory equlpments, lndla
BIO-Rad Laborator~es Inc , USA
Fotodyne Inc , USA
Hltach~ Ltd , Japan.
Labllne Instruments Inc , USA
Matri Instruments, lndla
![Page 4: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/4.jpg)
3.1.2 Bacterial strains and plasmids
B. thuringiensis strains were kindly provided by D. Ze~gler, BGSC, Ohio
state university, U.S.A, Nakumara, USDA-ARS, USA and M.Lecadet, inst~tut
pasteur, France. E. coli clones containing hyper expressing cry genes were
klndly provided by Bacillus Genet~c Stock Center, Ohlo state unlvers~ty, USA
Recipient E coli culture (DH5-a) was k~ndly provided by S Muthukrlshnan,
Mlchlgan state Universlty, USA.
L~st of Bacter~al stra~ns
Straln Descr~ption SourceIRef
B thunngiensis HD-29
B thunng~ensis HD-125
B thuringiensfs HD-137
8 thunng~ensls HD-551
E coli (pOS4101)
E coh (pOS4201)
E co11 (pOS4301)
E co11 (psb1407)
E cob (pSB607)
E. cok (pSB1407)
E co11 (pSB1103)
B, thunng~ensfs PBT-372
B thunngiensls PBT-558
B thunngiensis PBT-569
B thunngiensis PBT-574
Serotype 3a3b (kurstaki) PI
Serotype 5a5b (gallehae) USDA-ARS
Serotype 9 (tolworth~] BGSC
Semtype 7 (afzawaq USDA-ARS
USDA-ARS
ClylAa cloned in pKK223-3, In Ampr BGSC E. co11 JM 103 CrylAb cloned in pKK223-3, In Ampr BGSC E, coli JM103 CrylAc cloned In pKK223-3, in Ampr BGSC E coli JMlO3 CrylBa cloned In pTZISR, In Ampr BGSC E, co11 DH5a CrylCa cloned in pTZISR, In Ampr BGSC E coli DH5a ClylDa cloned In pTZISR, In Ampr BGSC E coli DH5a CrylEa cloned In pTZISR, In Amp' BGSC E. coli DH5a Th~s study DBT-PU
Th~s study DBT-PU
Th~s study DBT-PU
This study DBT-PU
![Page 5: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/5.jpg)
Strain Description SourceiRef.
6. thuringiensis PET-688 This study DET-PU
B. thunngiensis PET-689 Thls study DET-PU
thuringiensis PET-690 This study DET-PU
g thuringiensis PET-692 Thls study DET-PU
B. thunngiensis PET-695 This study DET-PU
B thunngiensis PET-705 Thls study DET-PU
B thunngiensis PET-709 Thls study DET-PU
B thunng,ensls PET-71 1 Thls study DBT-PU
B thuringrensis PET-716 This study DBT-PU
B thuringlens~s PET-733 Thls study DET-PU
B thunngiensis PET-738 Thls study DET-PU
B thunngiensis PET-782 This study DBT-PU
B thunngiensis PET-790 Thrs study DET-PU
B. thunngiensis PET-801 This study DET-PU
E coli (o1 C695) CrvlC PCR oroduct of PET-695 DET-PU cldned ~n GEM-T, rn Amp' E coil DH5a
3.1.3 Insect larvae and maintenance:
Bombyx mon eggs were provlded by Department of Ser~culture, Unlverslty
of Agr~cultural Sc~ences, Bangalore F~eld collected larvae of Achaea janata,
Spodoptera i~tura and Helrcoverpa armrgera were reared on castor leaves ~n
sterlle culture room wlth envrronmental s~mulat~on of 27k1° C, RH 60i5% and
16-8 h scootiphotophase reglme Plutella xylostelia and Bombyx mon were fed
wlth fresh leaves of cabbage and mulberry respectively Larvae of H armlgera
were rndlvldually malntalned ~n bottle after thlrd Instar to avold cann~ballsm and
acclrmat~zed to the laboratory condlt~ons
![Page 6: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/6.jpg)
3.1.4 Mlcroblological Media:
3.1.4.1 Katznelzon's Tryptose Broth: (Handasan, 1991)
KTB comprise of 3: l (vlv) of K-minimal salt med~um and tryptose broth
respectively
K-minimal salt medium.
Ammon~um Sulphate 15.00 g
Megnesium Sulphate (heptahydrate) 0 20 g
Sodlum Chlorie 0 1 0 9
Calcium Chloride (d~hydrate) 001 g
Ferrous Sulphate (penta hydrate) 0 01 g
Z~nc Sulphate (penta hydrate) 001 g
Dihydorgen potassium phosphate 0 403 g
Dipotass~um hydrogen phosphate 0.96 g
Manganese Sulphate 0 007 g
Distilled Water 1000 ml
Tryptose Broth
Tryptone
Sodium Chlorlde
Yeast Extract
Dextrose
Distilled Water
![Page 7: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/7.jpg)
3 1.4.2 Luria Bertani Broth: (Parks, 1993)
Tryptone 1 0 0 9
Sodium Chloride 5 0 9
Yeast Extract lOOg
Distilled Water 1000 ml
Before sterilisatlon, pH was adjusted to 7 5 wlth 0 2N Sodurn Hydrox~de
and when solid medlum was requ~red, 2% agar was added
3.1 4 3 CHESS Medium (Ananymous , 1 4 5 8 )
Casein Amino Ac~des 5 9
Yeast Extract 2 0 9
Glucose 4 0 9
Sodium Chloride 5 0 9
Megnesium Chlor~de (Heptahydrate) 100 mg
D~st~lled Water 1000 ml
After sterilisatlon, filter ster~llsed Calc~um chlorlde (dlhydrate) was added
at 500mglml at ambient temperature
3.1.5 Alkaline buffer:
Sodlum bicarbonate o l g
D~th~thre~tol 0 03 g
D~st~lled water to 20 mi
pH adjusted to 10 5 with 2N HCL
![Page 8: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/8.jpg)
3.1.6 Lowry's reagent
Sloution A: 2% Sodium carbonate in 0.1 N NaOH
Solution B: 0.5% Copper sulphate in 1 % Sod~um potassturn tartarate
Lowry's reagent. 50 parts of solution A and 1 part of solut~on B.
3.1.7APAGE Stock solutions:
Acrylam~de stock:
Acrylamide 30 9
BIS-acrylam~de 0 8 g
D~st~lled water 100 ml
Stored in brown bottle after filtering at 4°C
Separat~ng buffer.
Acrylamide solut~on 7 9 ml
Tr~s-HCI (pH 8 8) 6.7 ml
SDS (10%) 0 2 ml
Ammonium persulphate 0 2 ml
TEMED 0 008 ml
D~st~lled water to 20 ml
Staklng buffer
Acrylam~de solution 0 83 ml
Tr~s-HCI (pH 6.8) 0 63 ml
SDS (10%) 0 05 ml
Ammonlum persulphate 0 05 ml
TEMED 0 008 ml
D~st~lled water to 5 ml
![Page 9: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/9.jpg)
Sample buffer
Tris-HCI 1 M (pH6 8)
SDS (10%)
Glycerol
p-mercaptoethanol
Brornophenol blue (1%)
Running buffer (5X)
Tris
Glyclne
SDS
Dlst~lled water to
Stalnlng solut~on
Methanol
Acetic ac~d
Comass~e brtlllant blue
Dist~lled water to
Desta~nlng solut~on
Methanol
Acet~c ac~d
D~st~lled water to
1.25 rnl
4.0 rnl
2 rnl
1 ml
0 5 rnl
50 rnl
10 rnl
O l g
1000 rnl
5 rnl
7 rnl
100 rnl
![Page 10: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/10.jpg)
3.1.7flotal DNA isolation
Washing solut~on.
Sodium Chloride 0 5 8 9
EDTA 0.5 M (pH 8 0) 2 ml
Tr~s-HCI 1 M (pH 8 0) I ml
Dist~lled water to 100 ml
Resuspension Solutlon
EDTA 0 5 M (pH 8 0) 20 ml
Tris-HCI 1 M (pH 8 0) 15 ml
D~st~l led water to 100 mi
Lysis solut~on
EDTA (pH 8 0) 20 ml
Sodium Chloride 0 58 g
SDS 2 9
D~st~l led water to 100 ml
Phenol Chloroform
Buffered phenol and Chloroform were mixed In the ratio 1 1 and stored In
a brown bottle at 4°C along with 0 1 M Tr~s-CI in aqueous phase
TE Buffer
Tr~s-HCI 1 M (pH 8 0) I ml
E D T A O 5 M ( p H 8 0 ) O 2 m l
D~stilled water to 100 ml
![Page 11: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/11.jpg)
3.1.8. Megaplasmid Isolation:
E Bufffer.
Sucrose 15 9
EDTA 0.5 M (pH 8.0) 40 ml
Tr~s-HCI 1 M (pH 8 0) 2 ml
D~stilled water to 100 ml
Lyslng solution
SDS 3 g
Trts 1 M(pH 125) 0 5 ml
D~stilled wate- to I 00 ml
3.1.9 Agarose Gel Electrophoresis
TAE buffer (50X)
Trls base
Glac~al acetlc ac~d
EDTA 0 5 M (pH 8 0)
Dlsttlled water to
TBE buffer (5X)
Tr~s base
Borlc ac~d
EDTA 0 5M (pH 8 0)
Dlst~lled water to
![Page 12: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/12.jpg)
DNA loading dye (6X)
Brornophenol blue 0 25 g
Xylene Cyan01 0 25 g
Glycerol 30 ml
D~st~lled water to 100 ml
3.1 .I0 PCR primers
GAGCCAAGCAGCTGGAGCAGTTTACACC 724 1 TCACTTCGGATCGACATCTACC / 487 1
cry gene
cry1 (f) cry1 (r)
GTCAACCTTATGAGTCACCTGGGCrrC 830 CAACCTCTATTTGGTGCAGGTTC
crv lDal GGTACATTTAGATATTCACAGCCAC c & l ~ a l ' TYIE CTTAGGGATWTGTAGTACAG 883 cry l ( r l l TYlLN.12 ATCACTGAGTCGCTTCGCATGlTGAClTTCTC - cry1 (r2l TY6 GGTCGTGGCTATATCCTTCGTGTCACAGC
Prlmer
gral-cryl(d) gral -cry1 (r)
1 c&lAb I TY14 1 GAATTGCTTTCATAGGCTCCGTC 1 238 1
3.1 .I1 Plasmid isolation
Solut~on I
Glucose 0 9 g
Tr~s-HCI 1M (pH 8 0) 2 5 ml
EDTA 0 5 M (pH 8 0) 2 rnl
D~st~lled water to 100 ml
Solut~on II
SDS 10 % 10 ml
Sod~urn hydrox~de (10 N) 2 rnl
D~st~lled water to 100 rnl
Sequence
TGGAmACAGGTGGGGATAT TGAGTCGCTTCGCATATTTGACT
PCR product
slze (bp) 560-590
1
![Page 13: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/13.jpg)
Solution Ill
Potassium acetate (5 M) 60 ml
Acetic acid 11.5ml
Distilled water to '28.5 ml
3.1 . I 2 Over expression of E. coli clones:
Lysis Buffer
Tris-HCI 1 M (pH 8 0) 0 5 ml
EDTA 0.5 M (pH 8.0) 10 ml
Sucrose 15 9
D~st~lled water to 100 ml
Crystal wash I
Sodium Chloride 0.3 g
Tr~ton XI 00 2 ml
Distilled water to I00 ml
Crystal wash II
Sod~um Chlor~de 0 3 9
D~st~lled water to 100 ml
3.1 . I 2 lmmunoblotting
Transfer buffer
Tr~s base
SDS
Methanol
Distilled water to
![Page 14: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/14.jpg)
Tris-HCI 1M (pH 7.5) 0 1 ml
Sodium Chlor~de 0.1 g
Distilled water to 100 ml
TTBS
0 1 % vlv Tween-20 In TBS
~ l o c k ~ n g buffer
10% Non fat dry m~lk In TTBS
3.1.13 Media Optimisation
Basal salts (1OX) (Faloc~ et a1 , 1990)
Ammon~um Sulphate 1.Og
Potasslum d~hydorgen phosphate 3 0 g
D~potassrum hydrogen phosphate 3.0 g
Megnes~um sulphate (heptahydrate) 0 2 g
Manganese sulphate (hydrated) 0 5 g
Calcium chlor~de (d~hydrate) 0 08 g
D~stilled water to 1000 ml
![Page 15: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/15.jpg)
3.2. Methods
3.2.1. Strerilization
All the media, buffers, glassware and reagents were sterllrzed by
autoclaving at 121°C for 20 min. unless otherwise stated Antrbiotic solutions
were filter sterilised (0.2~) .
3.2.2. Sample collection:
Soil sample collection kits, consisting of numbered sterile polythene bags,
forms for recording the type and ongin of the samples along with self-addressed
envelopes and an accompanying letter were sent to various contacts In lndla and
the soil samples received in reinforced envelopes provlded by the senders
lnstructlons to avoid collection of soil samples from places where B. thuringtensts
was sprayed were also sent Morlbund lepidopteran larvae collected In sterlle
microfuge tubes from crop fields in and around Pondrcherry were transported to
the lab and stored frozen at -20°C untll further use
3.2.3. Isolation of 0. thuringiensis:
Ten gram of so11 sample was suspended In 25 ml of sterlle dlstllled water
In conlcal flasks and shaken v~gorously for 2 mln. After lncubat~on at 60°C for 10
min, the suspension was serlally dlluted and spread on Katznelson tryptose broth
agar plates (Harrdasan, 1991) and ~ncubated for 3 days at 30% (Chllcott and
Wlgley, 1993 and Bernhard e t a / , 1993) Insect cadavers were homogenized In 1
![Page 16: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/16.jpg)
ml of sterile distilled water in a sterile glass tissue grinder and the homogenate
was plated.
13. thuringiensis strains were observed under phase contrast mlcroscope
or under bright field microscope after am~do black (10%) stalning for the
presence of crystal protein inclusions. After growth in KTB agar 6. thuringlensls
were examined period~cally under phase contrast mlcroscope until at least 95%
of population has lysed releasing spores and crystals
From each sample up to 20 colonles were m~croscop~caily examined for
such inclusions to be classified as B thunngiensls Only colonies from each so11
sample showing different morphology, crystal shape or size were stored in 50%
glycerol at -20% for further study. For convenience, spore impregnated filter
paper dlscs were also prepared and stored In sterile vials
3.2.4. Total cell protein preparation (Chak et a/., 1994)
The spore-crystal mixture was washed thnce w~th 0 5 M NaCI, followed by
three washlngs In cold sterlle water and resuspended In sterlle water contaln~ng
phenyi methyl sulfonyl fluonde (PMSF) at a concentrat~on of 1 mM and were
stored at -20% untll further use
3.2.5. Solubilisation of PCPs and digestion with trypsin,
Crystals were solubilised In alkal~ne buffer overn~ght at 37'and and stored
at -20°C for further use Solubilised protein was d~gested w~th trypsln
(protoxins:trypsin::10.1 wlw) for 1 hour at 37 '~.
![Page 17: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/17.jpg)
3.2.6. Estirnatlon of Protein (Lowry et a/., 1951)
Protein sample (100pI) was made up to 1 ml with distilled water and 5 ml
of Lowry's reagent was added. The mixture was vortexed and kept at room
temperature for 10 min Then 0 5 ml of two fold diluted Fohn C~ocalteau reagent
was added, vortexed and incubated In dark for 30 min The absorbance was
measured at 640nm Bovine serum (lmglml) was used as the standard
3.2.7. SDS-Polyacrylarnide gel electrophoresis (Laemmli, 1970)
The resolving gel was poured in between sealed clean glass plates,
allowing space for stacklng gel Water saturated n-butanol was layered gently on
the top of separat~ng gel to obtaln an even surface After the separat~ng gel got
polymerised, the upper butanol layer was removed completely and rinsed with
water Water was removed completely using a blotting paper Stack~ng gel
solut~on was poured onto the separating gel upto the top A su~tabie comb was
~mmediately Inserted Into the cassette and polymerisat~on was allowed to take
place After removlng the comb, the slots were cleaned by rlnslng w~th Running
gel buffer
The protein preparat~ons (100pg) were m~xed w~th equal volume of 2X
Load~ng dye, kept on bolllng water for 5 mln and electrophoresed on a 10% gel
using M I ~ I Protean II Electrophores~s cell or Brov~ga min~ vert~cal electrophoresis
system
Electrophoresis was carried out at 15mA constant current till the dye front
reached near the bottom of the gel. Gels were stalned uslng coomasie brill~ant
![Page 18: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/18.jpg)
blue (R-250) stain for one hour and destalning was carrled out for a minimum of
2 h with gentle agitation. The gels were stored In 7% acetlc ac~d solut~on pending
documentation or drying.
3.2.8. Spore crystal formulation (Anonymous, 1998)
Spore crystal mlxture from sporulated culture was adjusted to pH 7 0
uslng HCI prlor to harvesting by centrifuging at 6000 rpm for 10 mln, at 4% The
cells were resuspended In 0 1 volume of 6% Lactose solut~on and stlrred at room
temperature for 30 mln To the contents 0 4 volume of acetone was added and
stirred again for 30 mln. Flnally the contents were allowed to stand for 5-10 min
Wlthout disturbing, the solvent was decanted slowly To the remalnlng deposits,
one volume of acetone was added and the sediments were collected Thls was
repeated twlce and finally passed through Whatman No 4 filter paper uslng
Buchner funnel fitted onto a slde- arm flask connected to vacuum llne The
deposits were drled In desiccator and the fine powder rlch In PCPs was stored at
room temperature untll further use
3.2.9. Bioassays: (Dulmage e t a / , 1976)
Fresh leaves were thoroughly washed In clean water and drled under
shade or lamlnar flow and then coated wlth B thunngiensis formulation
(2pg/cm2). After proper drylng in shade, the leaves were transferred to sterlie
petridishes of 10 mm dlameter and second tnstar larvae of test Insect was
released @ lO/dlsh, TO avoid drylng of the feed material, a thln layer of 1% agar
![Page 19: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/19.jpg)
was poured up to 3-5 mm thickness before placing the leaf Thirty such insects
were subjected to test for each 6, thuringiensis straln and mortallty levels were
recorded @ 12 h intervals. Mortality data were recorded up to 5 days of exposure
and where necessary fresh leaves were replenished
Median lethal time (LTso) was calculated for B thunng~ensls strains and
the regression equations were derlved with chl-square tests Among all the
stralns tested, those strains that gave more than 50% mortallty alone were taken
for estimation of LTsa values based on Probit analysis (Flnney, 1971)
Appropriate corrections were carrled out where necessary (Abbott, 1925) The
data glven are the mean of two Independent experiments
3.2.10. Field performance
Field evalutatlon of natlve 8 thuringiensis stralns agalnst A. janata
and S liturn, was conducted In Castor (TMV-5) and peanut (VRI-2) at Vanur
taluk of Vlllupuram district (Tamilnadu) during Kharlf and Rabl, 1999 respectively.
The experimental des~gn was Randomlsed Complete Block Des~gn w~th a plot
slze of 5x4m (20m2)
The field trial on the management of A. janafa In castor cornprlsed of B
thuringiensis stralns PBT-372, PBT-574, PBT-689, PBT-716, PBT-782 and
standard HD-1 along wlth untreated control In three repllcat~ons Tr~ton X-100
was added at 0.001% as surfactant In all the sprays 8 thunng~ensls stralns
were applied four tlmes as hlgh volume spray uslng hand operated Knapsack
sprayer at fortnightly ~ntervals. Number of l~ve larvae present ln 10 plants,
![Page 20: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/20.jpg)
selected randomly, in each replication on th~rd and seventh day after spraying
were recorded.
To evaluate the efficacy of B. thuringiens~s In peanut, PBT-372, PBT-574,
PET-716, PBT-782 and PBT-801 were sprayed along wlth appropriate controls
Three sprays were glven at weekly Intervals and the number of l~ve larvae
present in 10 plants, selected randomly, in each repl~cat~on on third and seventh
day after spraying were recorded.
3.2.11. Total DNA isolation (Kronstad eta/ , 1983)
Cells grown In 25 ml LB medium (12-16 h)were harvested by
centrifugation at 4000 rpm for 5 mln at 4OC. The supernatant was d~scarded and
the cells were washed with washing solut~on. The pellet was resuspended ~n
500~1 of resuspenslon solut~on conta~nlng 0.5 mglml lysozyme After gentle
vortex~ng, the cells were incubated at 37°C for 30 min To the contents, 62511 of
lys~s buffer was added and m~xed gently by ~nvert~ng the tubes 4-5 t~mes before
Incubating at 60°C for 30 mln The lysate was then extracted four t~mes w~th
phenol~chloroform (1.1) and precip~tated w~th twlce the volume of ethanol Then
the pellet was washed wlth 70% ethanol, dr~ed and red~ssolved ~n 50p1 of TE
buffer
3.2.12. Megaplasmid isolation (Jenson el a/. 1995)
The culture was grown In broth overnight (12-16 h) at 30% under shake
culture conditions. A 2ml volume of cells was pelleted and resuspended In 100p1
![Page 21: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/21.jpg)
of E buffer. Cells were lysed by addition of 200p1 of lysing solution. The lysate
was heated at 60°C for 30 mln, and 5U Of proteinase K was added. The solutron
was inverted 20 tlmes and ~ncubated at 37% for 90 mln About 1 ml of
ph~nol:chlorofo~:isOamy~ alcohol (25.24.1) was added and the solut~on was
inverted 40 times After centrifugation, the upper aqueous layer was subjected to
electrophoresis In 0.5% agarose for 3-5 h at 8-1OVlcm
3.2.13. Agarose gel electrophoreseis (Sambrook et a1 , 1989)
Agarose gel electrophoresrs was carried out In a horrzontal matrix of
agarose (0 7-2% wlv) with e~ther TAE or TBE buffer The DNA samples were
mixed w~th 6X load~ng dye and carefully loaded Into the sample wells.
Electrophores~s was carned out at 50V The gel was stained In a lpglml solution
of ethldlum brom~de and the DNA bands vlsual~sed under long wavelength usrng
UV transillumlnator
3.2.14. Photography
Agarose gels and polyacrylam~de gels were photographed usrng Gel
Documentation system Alternat~vely photograph uslng MP4 land camera
employ~ng Polorold or Fort~pan sheet film was carrled out The negatlve films
were developed In the developer solut~on for 1 mln at room temperature The
reaction was stopped by rmmerslng the film in 5% acet~c acid for few seconds
and soaked in F ~ x ~ n g solution for 5 mln All the steps were carr~ed out in dark
![Page 22: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/22.jpg)
Finally the film Was washed several times in tap water and dried for making
positive prints
3.2.15. PCR Analysis
Identification of cryl type genes from nat~ve 8. thuringiensis stra~ns was
done by using primers suggested by Kalman et a/. (1993) and Bravo et a1 (1998)
The react~on mixture employed for ldentifylng known cry genes In a PCR reactlon
(50~1) contained the following:
Template DNA 200ng
Taq DNA polymerase 0 5 unit
dNTPs 1 25 mM
Forward primers 0 1pM
Reverse prlmers 0 1pM
MgCh 1 5 m M
PCR assays were performed w~th a Mastercycle@ (Eppendorf) uslng cryl
famlly primers wlth ln~t~al 4-m~n denaturatlon at 94OC followed by 30 cycles of
amplificat~on conslstlng of 1-mln denaturatlon at 94"C, I-min anneallng at 52°C
and I-mln of extenslon at 72°C After 30 cycles, an extra extenslon step of 10
mln at 72°C was Included The experimental condltlons for the PCRs done w~th
other prlmers were slmilar, except that the anneallng temperatures were set at
60°C w~th 25 cycles
After the completion of the PCR react~on the products were separated and
analysed on an agarose gel (2%)
![Page 23: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/23.jpg)
3.2.16. PCR Cloning:
Ligation reactions were set up using pGEM-T Easy vector system
(promega) Each reaction was made up to a final volume of 10111 whlch consisted
of the following.
2X Rapid ligation buffer 5!J1
pGEM-T Easy vector 1 111
PCR product 2111
T4 DNA L~gase 1 PI
Sterlle deionlsed water 1 PI
The mlx was incubated for I h at room temperature (2527°C) or overnight
at 4°C.
3.2.17 Preparation of competent cells
Overnight grown E cob cells were sub-cultured In 25 ml of LB and grown
for -4h (A,joo=O 6-0.9). The cells were chilled on Ice for 30 min and centr~fuged at
4000 rpm for 5 mln at 4°C The pellet was resuspended In 10 rnl of cold CaC12
(0 1M) and kept on ice for 20 mln The cells were centrifuged at 5000 rpm for 5
mln at 4% The pellet was resuspended In 1 ml of cold CaClz solutlon and kept
on Ice An allquo! of 200~1 of cell suspension was used for transformat~on
![Page 24: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/24.jpg)
3.2.18 Transfonnatlon of E. coll cells:
The CaC12 treated cells were used ~mmediately or stored at -70% unt~l
further use. Plasmid DNA was mixed w~th 200~1 of competent cells and kept on
Ice for 20 rnin The mixture was then kept at 42°C for 45-50 sec The mixture was
diluted in 1 ml of LB and kept on a shaker at 37°C for 90 mln for the expression
of genes encoding drug resistance. All~quots of the cells were plated on LB agar
containing 100pM IPTG120ml, 20pM X-gall20 mi and Amplcril~n 5Opgiml The
plates were Incubated at 37OC overnight and the wh~te colon~es were screened
for recombinant clones
3.2.19. DNA Sequence analysis:
PCR products were sequenced with Automated DNA sequencer
employing SP3 and T7 standard prlmers. Sequencing react~ons were carr~ed out
In the Department of Blochemistry, lnd~an Institute of Sc~ence, Bangalore
Sequence analys~s was performed by uslng Gene Tool L~te ver 1 0 (Advanced
Blolnformat~cs Solut~on, B~otools Inc.) package The partla1 nucleot~de sequence
of the crylCaxgene of straln PBT-695 was subm~tted to GenBank (AF354640)
3.2.20. Isolation of plasmld (Sambrook et a1 , 1989)
Late log-phase E coh culture (1 5 mi) was transferred to rnicrofuge tube
and centr~fuged at 6000 rpm for 5 min The cells were resuspended In IOOul of
Solution I. The cells were lysed, thereafter, by the addltlon of 200 p1 of Solutlon 11,
mlxed thoroughly by inverting the tubes 4-6 tlmes, and ~ncubated at room
![Page 25: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/25.jpg)
temperature for 5 min. After addition of 150~1 of Solution Ill, the tubes were
gently mixed by inverting the tubes, incubated on ice for 5 min and centrifuged at
10000 rpm for 15 min at 4°C The supernatant was once extracted with
ph~nol~chlorof~rm and the aqueous layer wntainlng DNA was removed after
centrifugat~on at 12000 rpm for 10 min at 4°C To this content, twlce the volume
of dehydrated ethanol was added and the tubes were kept at -20% for 15 min
The DNA was precipitated and washed in 70% ethanol by centrifugation at 12000
rpm for 10 rnin at 4°C The DNA pellet was dried in Speed Vac and resuspended
in 4 0 ~ 1 of TE buffer
3.2.21. Preparation of cry proteins from E. coli clones (Albert et el, 1989)
Overnight grown E coli strains containing hyper expressing recombinant
plasmid pKK223-3 or pTZ19R containing crylAa, crylAb, crylAc, crylBa,
crylCa, crylDa and crylEa were inoculated in LB containing appropriate
antibiotic(s) and incubated on a rotary shaker at 37% for 4 h Durlng early growth
phase (A6oo=O 6-0.8) IPTG was added to a final concentration of I rnM After 2 h
the cells were harvested at 7000 rpm for 5 rnin at 4°C. The resultant cell pellet
was resuspended in lysls buffer containing 2mgIml of lysozyme and incubated at
37°C with slow shaklng for 2h Then the contents were centrifuged at 12000 rpm
for 5 rnin at 4"C, which was resuspended in 1 ml of crystal wash soiutlon I This
Was then subjected to ultrasonic d ls~pt lon with a sonicator for three 15 s periods
at 40W w~th 45s Interval between per~ods on Ice. After sonlcatlon the mixture was
centrifuged at lOOOOrpm for 5 min at 4°C and the pellet was washed thrice with
![Page 26: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/26.jpg)
wash solution I followed by crystal wash solution II. After centr~fugat~on,
the pellet was subjected for solubilizat~on.
3.2.22. Preparation o f 65- kDa antigen
Total cell protein after solubilisation was separated on a 10% preparative
acrylamide gel. The gel was stained with Ice cold potassium chlor~de (KCI,
0 25M) for 10 min As soon as the white bands appeared, 65- kDa band was
identified and the piece of the gel carrying it was cut uslng sterile blades. The gel
plece was nnsed In d~stllled water many times to remove KC1 and then
transferred to a dlalysls bag containing 0.5X SDS-PAGE runnlng buffer. The
protern was electroeluted at 40mA for 12 h The proteln sample was removed
from the bag and used as ant~gen after proteln est~mation
3.2.23. Preperation of mouse Anti 65- kDa antibody
Antiserum rarsed agalnst 65- kDa antlgen In mouse was used as ant1 65-
kDa ant~body One hundred pI of proteln sample contaln~ng 100cg of 65- kDa
prote~n was m~xed w~th equal volume of Freund's complete adjuvant and was
Injected subcutaneously into balb C mlce Thirteen days after prlmary
Immun~zat~on, a booster contalnlng Freund's incomplete adjuvant rnstead of
complete adjuvant was glven Four days after the first booster, the mlce were
bled through retro-orbital bleedlng using capillary coated w~th heparln The titre of
antiserum was estimated by ELlSA and when necessary, a second booster dose
was admlnlstered after 15 days
![Page 27: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/27.jpg)
3.2.24. ELISA
Enzymed linked imrnunosorbant assays were performed by all~quoting
10opL of antigen solution (5pglml) in carbonate-bicarbonate buffer in each well of
flat bottom ELSA plates. The plate was kept at 37°C for I h or 4°C overn~ght The
antigen solutton was poured off and the wells were washed w~th PBS-T thrrce
Blocking was done by adding 200p1 of PBS-T containing 1% BSA at 37°C for I h
Then the plate was washed with PBS-T and 100p1 of different dilutions of primary
antibody (anti 65- kDa) were added and ~ncubated at 37°C for I h The prtmary
antibody solution was poured off and the wells were washed w~th PBS-T thrtce
Secondary antibody (Anti-mouse IgG) conjugated with Horse Raddlsh
perox~dase was added (100p1) to each of the wells and Incubated at 37% for I h
Then the secondary antibody solution was poured off and wells were washed
w~th PBS-T three times. Finally, substrate solut~on (TMBIH202) was added to
each of the wells and the plate was kept at 37°C for 20 mln The reactton was
stopped by addtng 100p1 of 2N HzS04 and absorbance read at 490 nm uslng
Microplate reader
3.2.25. Western Blotting (Ausubel eta/., 1992)
Protein samples were resolved on polyacrylarntde gel and the transfer
Onto n~trocellulose (NCP) membrane was done after pretreatment by soaklng rnto
transfer buffer for 15 rnin. Three sheets of prewet Whatman No.1 filter paper cut
to the size of the gel and saturated with transfer buffer were placed on anode Alr
bubbles were removed by rolling a clean glass rod onto the layer. The pretreated
![Page 28: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/28.jpg)
NCP membrane was then placed on top of the filter stack taking care not to dry
at any step. The gel was placed on the top of the NCP and stacked w~th filter
paper as described earlier. The cathode lid was placed onto the transfer stack
and the apparatus was connected to the power pack. Western transfer was done
at 3mA/cm2 constant current mode for lh . The membrane was removed and
subjected to immunoblotting lmmed~ately or stored dry at 4°C unt~l use.
3.2.26. lmmunodetection
The membrane after transfer was blocked w~th 3% sklm m~lk In TBS-T for
2 h at room temperature or 4°C overnight The block~ng solution was poured off
and primary (mouse anti-65- kDa) antibody (1500) In TBS-T contalnlng 3% sk~m
milk was added and kept on a shaker for 2 h After 2h, the prlrnary ant~body
solution was removed and the membrane was washed thrlce each w~th TBS-T
and TBS Secondary (Rabb~t Ant~mouse IgG) antibody conjugated w~th alkal~ne
phosphatase (1~1000) in PBS-T was added and kept on a rockrng platform for 90
mln. After wash~ng thnce each wlth TBS-T and TBS, BCIP-NBT solut~on was
added and kept In dark unt~l colour developed The react~on was termmated by
washlng membrane In water and alr dried
3.2.27 Selection of suitable naturally occurring raw materials for media optimisation
F~ve naturally occurring raw mater~als after pretreatment, where
necessary, were employed to optlrnise the cultural cond~t~ons for maxlmurn
![Page 29: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/29.jpg)
biomass production of PBT-372. After pre-treatment, the final total sugar
of each of the raw material was adjusted to 0.8% final Paddy
straw was soaked in tap water for 3 h and then filtered through country filter
paper Sago was boiled in tap water for 15 min and then filtered through cheese
cloth. The filtrates thus obtained were used In med~a preparation The medla
were dispensed @ 100 ml in 250 ml Erlenmeyer flasks and basal salts were
added as recommended by Faloci et a1.(1990) The flasks were plugged wlth
non-absorbent cotton wool and sterlllsed by autoclavlng at 121°C for 20 mln.
Overnight grown PBT-372 was ~noculated (2%) and Incubated on rotary shaker
(180 rpm) at 30% for 72 h.
3.2.28. Multivatttate optimisation of process variables
PBT-372 cells were ~noculated into 250 ml Erlenmeyer flask contalnlng
100 ml of appropnately dlluted molasses med~um. The flasks were Incubated as
described elsewhere A 23 factorlal central composite des~gn (CCD) for 3
Independent varlables each at two levels wlth 4 star (a) points (af1.682) and five
replicates at the centre polnt as glven below was used to optlmlse biomass
production pH, ~noculum slze (%) and sugar concentration (gll) were chosen as
Independent varlables as in a series of batch fermentations
Parameter -a -1 0 + 1 +a
PH 3 636 5 7 9 10 4
Inoculum(%) 0 977 2 3 5 5 0 6 023
Sugar (gll) 1.59 5 o 10.0 15 o 18.0
![Page 30: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/30.jpg)
The variables were coded according to the equatlon 1:
XI = (X, - Xa)' hXI ................... Equation 1
Where XI is the coded f o m of the test variable, Xr IS the uncoded value or actual
value of the same variable, X, is actual value of the same variable at central
point and and AX1 is the step change of the variable.
At the end of 72 h, the OD (%w) was estimated and taken as dependent
variable, Y, The biomass productlon was optlmlsed wlthin the levels of the
variables using Monte Carlo optlmisation techn~que and confirmed from the
response surface contour plots
3.2.29 Effect of optirnised pH, inoculurn size and sugar concentration on biomass production of PET-372 in a bioreactor:
In order to study the blomass production at satlstlcally optlmlsed fermentor
condlt~on, pH, lnoculum slze and sugar concentratlon as above, a 5 1 reactor was
run uslng molasses as cheaf carbon source supplemented wlth basal salts The
values of pH, lnoculum slze and sugar concentratlon were adjusted
appropriately and the reactor was run at an agltatlon of 180 rpm and malntalned
at 30t I0C The biomass productlon was monitored up to 72 h following
lnoculat~on of PBT-372
3.2.30. Software and Statistical analysis
Phylogenetic relationships of cry protelns of different molecular welght
were analysed using Quantity one (ver 4 0) developed by BIO-Rad iaboratorles,
USA
![Page 31: MATERIALS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/743/8/08... · 2012-01-17 · biochemicals were purchased from Sisco Research laboratories Pvt Ltd , SD-Fine Chemicals](https://reader035.vdocuments.mx/reader035/viewer/2022070917/5fb7c168e8a51609e11af398/html5/thumbnails/31.jpg)
Medlan lethal time (LT5o) was derived from log dose probit calculations
performed using SYSTAT package (ver 8.0). Field data were analysed uslng
~RR~STAT (ver. 3.0) applying arc sine transformatlons.
Sequence homology analysis was done onllne using BLAST software
(-1.
The MINITAB (ver. 12) software was used for regression and graph~cal
analyses of the data obtained from biomass maxlmlsatlon studles employing
response surface methodology.