lyn kinase mediates cell motility and tumor growth in...

Cancer Therapy: Preclinical

Lyn Kinase Mediates Cell Motility and Tumor Growth inEGFRvIII-Expressing Head and Neck Cancer

Sarah E. Wheeler1, Elena M. Morariu3, Joseph S. Bednash4, Charlton G. Otte1, Raja R. Seethala2,Simion I. Chiosea2, and Jennifer R. Grandis1,5

AbstractPurpose: EGF receptor variant III (EGFRvIII) has been detected in several cancers in which tumors

expressing this truncated growth factor receptor showmore aggressive behavior. Themolecularmechanisms

that contribute to EGFRvIII-mediated tumor progression that are amenable to targeted therapy are

incompletely understood. The present study aimed to better define the role of Src family kinases (SFKs)

in EGFRvIII-mediated cell motility and tumor growth of head and neck squamous cell carcinomas

(HNSCC).

Experimental Design: HNSCC models expressing EGFRvIII were treated with dasatinib, a pharmaco-

logic inhibitor of SFKs.

Results: SFK inhibition significantly decreased cell proliferation, migration, and invasion of EGFRvIII-

expressing HNSCC cells. Administration of dasatinib to mice bearing EGFRvIII-expressing HNSCC xeno-

grafts resulted in a significant reduction of tumor volume compared with controls. Immunoprecipitation

with anti-c-Src, Lyn, Fyn, and Yes antibodies followed by immunoblotting for phosphorylation of the SFK

activation site (Y416) showed specific activation of Lyn kinase in EGFRvIII-expressingHNSCC cell lines and

human HNSCC tumor specimens. Selective inhibition of Lyn using siRNA decreased cell migration and

invasion of EGFRvIII-expressing HNSCCs compared with vector control cells.

Conclusions: These findings show that Lyn mediates tumor progression of EGFRvIII-expressing

HNSCCs in which strategies to inhibit SFK may represent an effective therapeutic strategy. Clin Cancer

Res; 18(10); 2850–60. �2012 AACR.

IntroductionEGF receptor variant III (EGFRvIII) is the most common

EGFR alteration in many cancers including head and necksquamous cell carcinoma (HNSCC). EGFRvIII lacks exons 2to 7, is constitutively active, and is absent in normal tissue(1, 2). EGFRvIII expression has been shown to contribute toincreased cell survival, proliferation, motility, invasiveness,and treatment resistance (3–5). EGFRvIII has been mostextensively characterized in gliomawhere Src family kinases(SFK) have been implicated in the EGFRvIII oncogenicphenotype. Abrogation of SFK signaling in an in vivo EGFR-vIII-positive glioma xenograft model significantly reduces

EGFRvIII-mediated tumorigenesis (6). Further studies inglioma found the SFKs, Fyn and c-Src, to be keymediators inEGFRvIII signaling (7).

SFKs have been implicated in many normal cellularfunctions such as cell adhesion, migration, proliferation,survival, angiogenesis, and differentiation where deregula-tion of these pathways contributes to tumorigenesis, tumorprogression, and metastasis of cancers-expressing wild-typeEGFR (8). SFKs are rarely mutated in cancer (8) and areactivated in response to stimulation of several cellularfactors including platelet-derived growth factor receptor(PDGFR), EGFR, insulin-like growth factor (IGF)-1R, G-protein–coupled receptors (GPCR), cytokine receptors,integrins, and cell adhesion complexes (9). Activated c-Srcis common in colorectal and breast cancers and elevatedlevels of c-Src protein have been reported in several cancersincluding colon, breast, lung, endometrial, ovarian, pan-creatic, and HNSCCs (8). c-Src has been reported to beactivated in HNSCCs compared with levels in normalmucosa where p-SFK expression correlates with invasive-ness and lymph node metastasis (10). Aberrant c-Src acti-vationhas been shown to contribute toHNSCCprogressionand metastasis (11, 12). SFK blockade inhibited prolifera-tion in several tumor models including breast cancer,HNSCCs, prostate cancer, and glioma (11, 13–15). Treat-ment of cancer cell lines with an SFK inhibitor or siRNA

Authors' Affiliations: Departments of 1Otolaryngology and 2Pathology,University of Pittsburgh and University of Pittsburgh Cancer Institute;3Department of Internal Medicine, University of Pittsburgh Medical Center;4School of Medicine, and 5Department of Pharmacology & ChemicalBiology, University of Pittsburgh, Pittsburgh, Pennsylvania

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: Jennifer R. Grandis, University of Pittsburgh,W912 Biomedical Science Tower, 200 Lothrop Street, Pittsburgh, PA15213. Phone: 412-383-5405; Fax: 412-647-8020; E-mail:[email protected]

doi: 10.1158/1078-0432.CCR-11-2486

�2012 American Association for Cancer Research.

ClinicalCancer

Research

Clin Cancer Res; 18(10) May 15, 20122850

on January 7, 2020. © 2012 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst April 6, 2012; DOI: 10.1158/1078-0432.CCR-11-2486

http://clincancerres.aacrjournals.org/

directed against c-Src abrogated tumor cell invasion andmigration (12, 14, 15). In HNSCCs, c-Src, Lyn, Fyn, and Yesare expressed at detectable levels in cell lines and tumors(16). Given the paucity of EGFRvIII cancer cell models andthe difficulty of detecting EGFRvIII in human tumors, fewstudies have elucidated the role of SFK in cancers charac-terized by EGFRvIII expression.The role of SFK in EGFRvIII-expressing HNSCCs has not

been explored, however, studies in wild-type (wt)EGFR-only HNSCCs have found that SFK can mediate prolifera-tion, invasion, and migration through various pathways(12). Glioma expressing EGFRvIII (as compared withwtEGFR) preferentially signals through the phosphoinosi-tide 3-kinase (PI3K)/Akt and mitogen-activated proteinkinase (MAPK) pathways (17, 18), and we have shownpreviously that inhibition of the PI3K/Akt pathway reducescell proliferation but has no effect on cell motility orinvasion in EGFRvIII-expressing HNSCCs (19). InwtEGFR-expressing HNSCC SFK inhibition reduced cellmotility and invasion by regulating downstream cell adhe-sion molecules such as FAK (12). SFK is part of the focaladhesion complex which functions to link integrins to thecytoskeleton. In this complex, SFK is involved in FAKactivation (at tyrosines 576/577 and 861) and with otherproteins, SFK promotes cellmotility by turnover of the focaladhesion. Reduced cell motility is observed through SFKinactivation by c-Src tyrosine kinase (20). FAK also containsan autophosphorylation site (tyrosine 397) and whenautophosphorylated creates a binding site for SFK via theSH2 domain of SFK which activates SFK by displacing theinhibitory phosphorylation at Y527 (21).EGFRvIII is expressed in 17% to 42% of HNSCCs, always

in conjunction with wtEGFR (22–24). HNSCC cells expres-sing EGFRvIII have been shown to be resistant to apoptosisby cisplatin in vitro and cetuximab tumor inhibition in vivo(22). A phase III clinical trial with the anti-EGFR monoclo-nal antibody cetuximab combined with radiation pro-longed overall survival but did not alter the incidence ofmetastasis (25). We have shown previously that EGFRvIII-expressing HNSCC cells are resistant to cetuximab-mediat-

ed inhibition of cell motility and invasion (19). A recentreport of a phase II trial of cetuximab in combination withdocetaxel in recurrent or metastatic HNSCCs found thatEGFRvIII expression was associated with reduced progres-sion-free survival (24). In EGFRvIII-expressing glioma,genetic, and chemical inhibitionof SFKs in several xenograftmodels have showndecreased tumor growth andmetastasiscompared with controls (6, 7). The role of SFK in EGFRvIII-expressing HNSCCs has not been defined. We undertookthe present study to determine the contribution of SFK inEGFRvIII-expressing HNSCCs, where SFK targeting couldrepresent an alternative therapeutic strategy in the setting ofEGFRvIII-mediated cetuximab resistance. Identification ofalternative therapeutic targets in the setting of EGFRvIIImayimprove treatment responses.

Materials and MethodsCell lines, reagents, and cell culture

Cal33 (site of origin: tongue) andUMSCC1 (SCC1; site oforigin: oral cavity) cells were a kind gift from Dr. GerardMilano (Centre Antoine-Lacassagne, Nice, France) and Dr.Thomas E. Carey (University of Michigan, Ann Arbor, MI),respectively. FaDu (site of origin: pharynx) and 293T cellswere purchased from the American Type Culture Collec-tion. All cells were maintained in Dulbecco’s ModifiedEagle’s medium (DMEM; Mediatech Inc.) with 10% heat-inactivated FBS (Invitrogen). UMSCC1 cells were supple-mented with 0.4 mg/mL hydrocortisone (Invitrogen) andFaDu cells were supplementedwith 1%nonessential aminoacids (NEAA; Invitrogen). Cells were incubated at 37�C inthe presence of 5% CO2. All cell lines were genotyped byshort tandem repeat (STR) profiling by the AmpF‘STRProfiler PCR Amplification Kit (Applied Biosystems).

EGFRvIII-transfectedHNSCC cells (Cal33vIII) and vectorcontrol–transfectedHNSCC cells (Cal33control) have beenpreviously described (19). EGFRvIII was subcloned into thepMSCV Neo plasmid (Clontech). EGFRvIII plasmid DNAswere a kind gift fromDr Frank Furnari (Ludwig Institute forCancer Research, La Jolla, CA). UMSCC1 and FaDu cellswere infected with vector alone (MSCV) or EGFRvIII vector(vIII). Briefly, 293T cells were plated at 80% to 90% con-fluency in a 10-cm dish and reverse transfected with Lipo-fectamine 2000 (Invitrogen), manufacturer’s plasmids andparent vector or EGFRvIII plasmid overnight. Fresh mediawas placed on the cells after 16 hours and virus producedover 48 hours. Target cells were plated in 10-cm dishes at25% confluency 16 hours before treatment to allow cells toadhere. Viral supernatant was collected, centrifuged, fil-tered, supplemented with polybrene, and placed on targetcells for 72 hours. Viral supernatant was replaced withcomplete media for 24 hours and cells were selected with0.5 mg/mL G418 (Invitrogen) for 72 hours. The resultingpopulation of cells were maintained under selection pres-sure and tested for EGFRvIII expression via reverse tran-scription polymerase chain reaction (RT-PCR) as describedpreviously (19, 22). Briefly, total RNA was isolated fromHNSCC cell lines by the RNeasy kit (Qiagen) according to

Translational RelevanceHead and neck squamous cell carcinoma (HNSCC)

expressing the constitutively active altered EGFR variantIII (EGFRvIII) protein is resistant to treatment withcetuximab in preclinical models and a recently reportedclinical trial. EGFRvIII oncogenic signaling inHNSCCs isincompletely understood and further elucidation of thepathways contributing toEGFRvIII-mediated tumorpro-gressionmay allow for identification of druggable targetsto overcome cetuximab resistance. Here, we presentpreclinical in vitro and in vivo evidence that Lyn is theprimary Src family kinase activated by EGFRvIII inHNSCCs, which can be targeted with dasatinib withresulting antitumor effects.

Lyn Mediates Cell Motility and Tumor Growth in EGFRvIII HNSCC

www.aacrjournals.org Clin Cancer Res; 18(10) May 15, 2012 2851




themanufacturer’s protocol. Total RNA (0.5 mg)was reversetranscribed and amplified using SuperScript One-Step RT-PCRwith Platinum Taq (Invitrogen). For EGFRvIII (primerspreviously described; ref. 22) and glyceraldehyde-3-phos-phate dehydrogenase (GAPDH) the following primers andconditions were used: GAPDH: forward, 50-TGGAATTTGC-CATGGGTG-30 and reverse, 50-GTGAAGGTCGGAGT-CAAC-30. Reverse transcription was carried out for 30 min-utes at 50�C followed by 2 minutes at 94�C. PCR amplifi-cation was carried out for 40 cycles of 94�C one minute,67�C oneminute, and 72�C oneminute followed by a finalamplification at 72�C for 5minutes. To detect onlywtEGFR,primers were designed in the exon 2 to 7 region of EGFR.Primers were as follows: forward, 50-ACAAGCTCACG-CAGTTGGGCA-30; reverse, 50-GGCAGACCAGGCAGT-CGCTC-30; conditions were as earlier with denaturationat 62�C.

BCR-Abl/Src inhibitor dasatinib (Das) was a kind giftfrom Bristol-Myers Squibb. Cetuximab was purchasedfrom the research pharmacy at the University of PittsburghCancer Institute.

ImmunoblottingCell lines and tumor pieces were lysed in detergent

containing 1% NP-40, 0.1 mmol/L phenylmethylsulfonylfluoride, 1 mg/mL leupeptin, and 1 mg/mL aprotinin, andprotein levelswere determined by theBio-RadProtein AssayMethod (Bio-Rad Laboratories). Total protein (40 mg) wereseparated on 8% SDS-PAGE and transferred to nitrocellu-lose membranes with the semidry transfer machine (Bio-Rad Laboratories). Membranes were blocked with Odysseyblocking buffer (Li-Cor Biosciences), probed with primaryand subsequently secondary antibodies and visualized withOdyssey Infrared Imaging System (Li-Cor Biosciences)according to manufacturer’s instructions. Quantification ofWestern blotting was conducted with the Li-Cor Odysseysystem to record the near-infrared (NIR) signal according tothe manufacturer’s instructions. Primary antibodies usedfor blotting included b-actin, phospho-Akt (Ser473), Akt,phospho-Src (Y416), Lyn, Fyn, c-Src, and Yes from CellSignaling Technology (also used for immunoprecipita-tions); Src B-12 from Santa Cruz Biotechnology; EGFR fromBD Transduction Laboratories; and anti-phospho-Src Y416clone 9A6 from Millipore. Anti-EGFRvIII antibody 4-5Hwas a kind gift from Dr. Careen Tang (Georgetown Univer-sity, Washington D.C.). Secondary antibodies used forblotting included goat anti-rabbit IRDye 680 or goat anti-mouse IRDye 800CW (Li-Cor Biosciences).

Proliferation assaysTo assay proliferation 5,000 cells per well were plated

in triplicate in a black-walled 96-well plate and allowed toadhere overnight. Following adhesion, cells were treatedwith dimethyl sulfoxide (DMSO; control) or 100 nmol/Ldasatinib for 72 hours and subsequently assayed withCellTiter-Glo Luminescent Cell Viability Assay (Promega)according to manufacturer’s instructions. Breifly, 100 mlCellTiter-Glo reagent was added to each well and the plate

was rocked gently for 2 minutes and the luminescentsignal allowed to stabilize for 10 minutes before the platewas read on a Victor3V 1420 multilabel counter withWallac 1420 software (Perkin Elmer). Values were nor-malized to DMSO vector control cells and plotted inGraphPad Prism (version 4.03; GraphPad Prism Soft-ware, Inc.).

Matrigel invasion assay and cell migration assayCell invasion was evaluated in vitro with Matrigel-coated

semipermeable modified Boyden inserts with a pore size of8 mm (Becton Dickinson/Biocoat). Cell migration wasevaluated in vitro using semipermeable modified Boydeninsertswith apore size of 8mm(BectonDickinson/Biocoat).For both assays, cells were plated in duplicate at a density of1.3� 104 cells per well in serum-free media in the insert. Atthe same time, cells were plated in 24-well plates to serve asloading and cell viability controls. Both the insert and theholding well were subjected to the same medium compo-sition (DMEM with 7 ng/mL EGF; Sigma-Aldrich) with theexception of serum. The insert contained no serum,whereasthe lower well contained 10% FBS that served as a chemoat-tractant. After 24 hours of treatment at 37�C in a 5% CO2

incubator, the cells in the insert were removed by wipinggently with a cotton swab. Cells on the reverse side of theinsert were fixed and stainedwithHema3 (Fisher Scientific)according to themanufacturer’s instructions. Cells plated in24-well plates were subjected to MTT assays, and the cellnumbers across the groupswerenormalized. Thenumber ofinvading or migrating cells was adjusted accordingly.

In vivo studiesNu/nu athymic nude mice (Harlan Sprague-Dawley)

were injected subcutaneously with 5 � 105 cells per flanksuspended in 100 mL serum free media with Cal33controland Cal33vIII in opposing flanks. Tumor volumes weremeasured in 2 dimensions with vernier calipers and calcu-lated using the formula: (length � width2) � 0.52. At theend of the study, mice were killed by cervical dislocationunder anesthesia; the tumors surgically excised and snap-frozen in dry ice. Tumors were allowed to develop and10 days after inoculation tumors were measured and strat-ified randomization conducted dividing the mice into 2groups of 8mice per group.Micewere treatedwith either 80mmol/L citric acid in PBS by oral gavage or dasatinib (50mg/kg daily) by oral gavage. All studies involving animaluse and care were in strict compliance with institutionalguidelines established by the Institutional Animal Care andUse Committee at the University of Pittsburgh.

ImmunoprecipitationHNSCC cells were plated at 50% confluency in a 10-cm

dish for 48 hours and harvested as indicated in immuno-blotting. For immunoprecipitation cells were serum starvedfor 24 hours following cell adhesion. One microgram ofwhole-cell lysate from cell lines or 200 ng from patientspecimens, 2 to 4 mg antibody and 40 mL Protein G beads(Millipore)were combined and allowed to rotate overnight.

Wheeler et al.

Clin Cancer Res; 18(10) May 15, 2012 Clinical Cancer Research2852




Beadswere pelleted the following day by centrifugation andwashed 3 times with fresh lysis buffer. Beads were resus-pended in 1� Western blot loading dye and boiledfor 8 minutes before loading onto a 10% SDS-PAGE. Lyn,Fyn, c-Src, and Yes antibodies were used (Cell SignalingTechnology) for immunoprecipitations and subsequentimmunoblotting.

Patient tissuesTumors were obtained from patients with HNSCCs with

tumors in the oral cavity, oropharynx, hypopharynx, orlarynx who provided written informed consent. Tissueswere collected under the auspices of a tissue bank protocolapproved by the University of Pittsburgh InstitutionalReview Board. Tissues were evaluated by a pathologist toconfirm more than 70% tumor composition and freshfrozen for further studies. RNA was isolated and assayedfor the presence of EGFRvIII by RT-PCR as previouslydescribed (19). EGFRvIII bands were excised from theagarose gel, purified by the QIAquick gel extraction kitaccording to manufacturer’s protocol (Qiagen) and sentfor standard Sanger sequencing at the University of Pitts-burgh Genomics and Proteomics Core Laboratories.

siRNA transfectionsThe siRNA sequences targeting Lyn humanmRNA (sense,

AAUGGUGGAAAGCAAAGUCCCUU; antisense, GGGAC-UUUGCUUUCCACCAUUUU; Sigma-Aldrich) were trans-fected into HNSCC cells for target silencing. The nontarget-ing siRNA (D-001210-01: sense, 50-UAGCGACUAAACA-CAUCAAUU-30; antisense, 50-UUGAUGUGUUUAGUCG-CUAUU-30; Thermo Scientific Dharmacon) was used as acontrol. The siRNA or transfections were conducted withLipofectamine 2000 (Invitrogen) according to manufac-turer’s instructions. HNSCC cells were transfected with800 pmol of siRNA or nontargeting control siRNA per10-cm dish. The transfection medium was replaced withcomplete media after 4 to 6 hours of transfection and cellsincubated for 48 hours before plating for invasion andmigration assays or harvested for Western blotting.

Statistical analysisFor migration and invasion studies, the statistical signif-

icance of differences in the number of invading ormigratingcells was assessed using Wilcoxon–Mann–Whitney exacttest. Statistical analysis and graphs were created in Graph-Pad Prism (version 4.03; GraphPad Prism Software, Inc.).

ResultsEGFRvIII is expressed in engineered HNSCC cell linesIt has been previously reported that EGFRvIII is present in

17% to 42% of HNSCCs (22–24). EGFRvIII is generallylost in vitro for unknown reasons, consequently EGFRvIIImechanistic studies must be conducted on exogenouslytransfected model systems (26). We previously reportedengineering the Cal33 HNSCC cell line to stably expressEGFRvIII (19). For the present study, we also stably

expressed EGFRvIII constructs in 2 additional HNSCC celllines, FaDu and UMSCC1. Differential transfection andinfection efficiencies exist between cell lines and can affectthe level of expression of exogenously introduced con-structs. EGFRvIII expression in these cells was confirmedby immunoblotting whole-cell lysates with an EGFRvIIIantibody and by RT-PCR of isolated RNA (Fig. 1).

SFKsmediate proliferation, invasion, andmigration inEGFRvIII-expressing HNSCC cells

We previously reported that expression of EGFRvIIIenhances HNSCC cell motility and invasion in vitro andtumor growth in vivo (22, 27). Previous reports show thatEGFRvIII does not always increase proliferation in vitro butconsistently augments tumor growth in vivo (28, 29). Inaddition, in EGFRvIII-expressing HNSCC cells cetuximabtreatment did not abrogate cell motility or invasion as it didin control cells (19). EGFRvIII has been most studied inglioma where SFKs have increased phosphorylation down-stream of EGFRvIII compared with parental cell lines andmediate EGFRvIII-induced cell motility and tumor growth(7). We assessed SFK activation in EGFRvIII-expressingHNSCCs by immunoblotting for phosphorylation at theactivation site (Y416). All 3 EGFRvIII-expressing cell linesand vector control cells showed phosphorylation at Y416,which was abrogated by treatment with the SFK inhibitordasatinib (Fig. 2A). Basal phosphorylation levels of SFKsvaried among the HNSCC cell lines used. To assess the roleof SFKs in EGFRvIII-expressing HNSCC cell proliferation,cells were treated with dasatinib and assayed for cell pro-liferation as indicated in materials and methods (Fig. 2B).We found that dasatinib significantly inhibited cell prolif-eration in EGFRvIII expressing and vector control cellscompared with vehicle-treated cells (P < 0.0001). Theseresults indicate that SFK are activated in vector control- andEGFRvIII-expressingHNSCCswhere treatmentwith the SFKinhibitor dasatinib abrogates proliferation.

Wepreviously reported that EGFRvIII increases cellmotil-ity in vitro in HNSCCs where EGFRvIII cells are resistant to

Figure 1. EGFRvIII expression in transfected HNSCC cell lines. EGFRvIIIwas stably introduced into the HNSCC cell lines FaDu and UMSCC1. A,cells expressing the vector alone (labeled "C") or EGFRvIII (labeled "V")were probed for EGFRvIII using the 4-5H antibody to show proteinexpression of EGFRvIII. B, HNSCC cells expressing vector alone (labeled"C") or EGFRvIII (labeled "V") were assayed for EGFRvIII expression byRT-PCR as described in Materials and Methods. The glioma cell lineU87MG EGFRvIII was used as a positive control (labeled "G"). A watercontrol lane is included to ensure no contamination of reagents (labeled"W"),which contains reagents addedwithwater inplaceof transcript. Theexperiment was repeated 3 times with similar results.






cetuximab-mediated inhibition of cell motility (19). Todetermine whether inhibition of SFK could inhibit cellmotility, vector control- and EGFRvIII-expressing HNSCCcells (SCC1) were treated with dasatinib and/or cetuximabfollowed by assessment of migration and invasion. Wefound that dasatinib was effective at inhibiting migration(P¼ 0.0006, Fig. 2C) and invasion (P¼ 0.0009, Fig. 2D) inEGFRvIII-expressing cells as well as vector control cells.Specifically, dasatnib reduced cell migration in EGFRvIII-expressing cells by 72% whereas there was no significantinhibition of cell migration with cetuximab treatment.Combined treatment with cetuximab and dasatinib did notsignificantly enhance the inhibition of cell migration overdasatinib alone in either vector control- or EGFRvIII-expres-sing HNSCC cells. Dasatinib reduced invasion in EGFRvIII-expressing cells by 58% but cetuximab treatment failed tosignificantly inhibit invasion in EGFRvIII-expressing cells asit did in vector control HNSCC cells. Addition of cetuximabto the dasatinib treatment did not have any additionalinhibitory effect on cell invasionover dasatinib alone. Theseresults were confirmed in a second HNSCC cell line, FaDu(Supplementary Fig. S1). TheCal33 cell line did notmigrateor invade in our in vitro model systems.

Dasatinib is known to inhibit several other kinases inaddition to SFKs (30) and EGFRvIII has been shown topreferentially signal through several pathways includingPI3K/Akt and MAPK in glioma (17, 18). To verify thatdasatinib abrogated downstream signaling pathwaysinvolved in cell proliferation and motility, we conductedimmunoblots of dasatinib-treated EGFRvIII-expressingHNSCC cells to evaluate phosphorylation of the active sitesof MAPK, Akt, and FAK. EGFRvIII HNSCC cell lines treatedwith dasatinib showed reduced phosphorylation of Akt andMAPK (Fig. 3A). EGFRvIII-expressing HNSCC cells exposedto dasatinib also showed reduced FAK phosphorylation attyrosine 576/577 and tyrosine 861. Both of these phosphor-ylation sites are phosphorylated by active SFK. As anticipat-ed, phosphorylation of FAK at the autophosphorylation sitetyrosine 397 was unchanged following dasatinib treatmentof EGFRvIII-expressing HNSCC cells. This site, when autop-hosphorylated creates a binding site for SFK via the SH2domain of SFK which activates SFK by displacing the inhib-itory phosphorylation at Y527 (ref. 21; Fig. 3B). Phosphor-ylation of Akt, MAPK, and FAK was significantly reducedby dasatinib in HNSCC cells expressing EGFRvIII as wellas vector control cells (STAT3 was also evaluated,

Figure 2. SFK inhibition decreases proliferation, migration, and invasion in EGFRvIII-expressing HNSCCs. A, dasatinib inhibits phosphorylation of SFKsat tyrosine 416 in HNSCC expressing EGFRvIII. EGFRvIII-expressing clones (V) and vector control (C) were cultured for 24 hours in the presence ofDMSO or 100 nmol/L dasatinib and immunoblotted for SFK activation via phosphorylation at Y416. B, dasatinib inhibits cell proliferation in vector control(open bars) and EGFRvIII (closed bars) HNSCC cells. Cell proliferation was assayed in each cell line following 72 hours of treatment with DMSO or100 nmol/L dasatinib. The experiment was repeated 4 times and the Mann–Whitney test was used to determine statistically significant differencesbetween each cell line's DMSO and dasatinib treatments; P < 0.0001 for all comparisons of DMSO to treatment. C, dasatinib reduces EGFRvIII-mediated cellmigration. UMSCC1 vector control (open bars) and EGFRvIII-expressing (closed bars) cells were assayed for cell motility in the presence of DMSO, 7 mg/mLcetuximab, or 100 nmol/L dasatinib (Das). The experiment was repeated 4 times and assessed for significance by the Mann–Whitney test, P ¼ 0.0006. D,dasatinib reduces EGFRvIII-mediated cell invasion. UMSCC1 vector control (open bars) and EGFRvIII-expressing (closed bars) cells were assayed for cellinvasion in the presence of DMSO, 7 mg/mL cetuximab, or 100 nmol/L dasatinib (Das). The experiment was repeated 4 times and assessed for significance bythe Mann–Whitney test, P ¼ 0.0009.

Wheeler et al.





Supplementary Fig. S2). It appears that biochemically dasa-tinib is equally effective in EGFRvIII and control HNSCCcells.

Dasatinib inhibits tumor growth of EGFRvIII-expressing HNSCC xenograftsWepreviously reported that EGFRvIII-expressingHNSCC

xenografts grow more rapidly than controls and are rela-tively insensitive to cetuximab, the onlyU.S. Food andDrugAdministration approved molecular targeted therapy forHNSCCs (22). Because dasatinib was effective at abrogatingproliferation, migration, invasion, and signaling in EGFR-vIII-expressing cells, we hypothesized that inhibition of SFKwould show antitumor effects in a nonmetastatic subcuta-neous model of EGFRvIII-expressing xenografts in vivo. Totest this hypothesis, we inoculated nude mice with vectorcontrol- or EGFRvIII-expressing HNSCC cells (Cal33) andinitiated treatmentwhen tumorswere palpable andof equalvolume. Mice were treated with vehicle control or dasatinibto assess the effects of SFK inhibition on tumor volume.EGFRvIII-expressing HNSCC xenografts showed increasedtumor volumes over HNSCC xenografts derived from vec-tor-transfected control cells (P¼ 0.019 on day 20, Fig. 4A).In HNSCC xenografts derived from vector-transfected con-trol cells only expressing wtEGFR, SFK inhibition failed tosignificantly reduce tumor volume compared with vehiclecontrol treatment (P¼ 0.19 onday 20, Fig. 4B).However, inEGFRvIII-expressing xenografts, SFK inhibition significantlyreduced tumor volume (P ¼ 0.047 on day 20, Fig. 4C; P ¼0.02 on day 13, Supplementary Fig. S3A), indicating that

SFKmay represent a plausible therapeutic target inHNSCCsexpressing EGFRvIII. These results were also validated in asecond HNSCC xenograft model (FaDu, SupplementaryFig. S3B and S3C). When cetuximab was combined withdasatinib, EGFRvIII-expressing tumor volumes were lowerthan with dasatinib alone (Supplementary Fig. S3D). Dasa-tinib did not significantly increase the efficacy of cetuximabin xenografts derived from vector control cells (data notshown). To verify that SFKs were durably inhibited bydasatinib treatment we immunoblotted lysates preparedfrom control and treated xenografts and probed for phos-phorylated SFK. We found that phosphorylated SFK at theactivation site was significantly decreased in dasatinib-trea-ted xenografts expressing EGFRvIII and vector control (P ¼0.0003, Fig. 4D). We also found no difference in thephosphorylation of SFKs at tyrosine 416 between vectorcontrol- and EGFRvIII-expressing xenografts (Fig. 4D).

Lyn kinase mediates migration and invasion inEGFRvIII-expressing HNSCCs

Assessment of SFK phosphorylation at the active site(Y416) or pharmacologic inhibition of SFK cannot distin-guish the precise role of individual SFKs. Reports in glioma-expressing EGFRvIII indicate that Fyn and c-Src are keyeffectors of EGFRvIII signaling (7). We therefore sought todetermine which SFKs were activated in EGFRvIII-expres-sing HNSCCs. Previous studies in HNSCC expressingwtEGFR indicated that Lyn, Fyn, c-Src, and Yes are allexpressed in HNSCCs (16). We therefore immunoprecipi-tated Lyn, Fyn, c-Src, or Yes followed by immunoblotting

Figure 3. Dasatinib inhibitssignaling pathways for proliferationand cell motility. EGFRvIII-expressing (V) and vector control(C) HNSCC cells were cultured for 24hours in the presence of DMSO or100 nmol/L dasatinib andimmunoblotted for: (A) MAPK andAKT activation via phosphorylationor (B) FAK activation viaphosphorylation at the SFKactivating sitesY576/7 andY861 andthe autophosphorylation site Y397.The experiment was repeated 3times with similar results. NIR signalquantification is provided aspercentage of decreased signal withdasatinib treatment (n ¼ 3). Openbars are vector control HNSCCs;closed bars are EGFRvIII-expressingHNSCCs.






with SFK Y416 and total SFK protein antibodies. Wefound that Lyn was the only SFK showing increasedphosphorylation in EGFRvIII-expressing HNSCC cells(P ¼ 0.019, Fig. 5A). Fyn, while expressed, was notphosphorylated and c-Src and Yes were not differentiallyphosphorylated in HNSCC cells expressing EGFRvIII orwtEGFR. Increased phosphorylation of Lyn in EGFRvIII-expressing HNSCC cells was also detected in 2 other headand neck cell lines expressing EGFRvIII and 3 separateclones of the Cal33 EGFRvIII-expressing cell line (Fig. 5B,SCC1, P ¼ 0.03; Cal33, P ¼ 0.01; Supplementary Figs. S4and S5).

To confirm that increased phosphorylation of Lyn inEGFRvIII-expressing HNSCCs was indeed a clinically rel-evant phenomena we screened a cohort of 52-patientHNSCC tumors for EGFRvIII expression via RT-PCR fol-lowed by sequencing. We found that 12 of 52 (23%)tumors expressed detectable levels of EGFRvIII (Fig. 5C).From this cohort we chose tumors based on tissue avail-ability to conduct Lyn immunoprecipitation. Because ofthe high level of consensus in the active site sequence ofSFKs, there is no pLyn antibody of sufficient specificity forimmunohistochemical analysis. Of 22 specimens ofpatients with HNSCCs, 10 tumors harbored EGFRvIII

and 12 tumors without EGFRvIII expression had suffi-cient tissue for immunoprecipitation. Immunoblottingwith p-SFK Y416 and total Lyn protein showed a modestbut significant increase in phosphorylation of Lyn inpatient tumors with EGFRvIII expression compared withwtEGFR-only tumors (P ¼ 0.035, Fig. 5D) showing thatphosphorylation of Lyn is increased in EGFRvIII-expres-sing human HNSCCs.

We next examined the effects of Lyn knockdown on theEGFRvIII phenotype of cell motility to evaluate the hypoth-esis that phosphorylation of Lyn is a key signaling inter-mediate for EGFRvIII-mediated invasion andmigration.Wetreated SCC1 HNSCC cells for 48 hours with Lyn siRNA(Fig. 6A, siRNA specificity; Supplementary Fig. S6) andsubjected them to migration and invasion assays in vitro.We found that Lyn siRNA significantly reduced invasionand migration in EGFRvIII-expressing cells (P ¼ 0.014 forboth invasion and migration) and vector control cells (P ¼0.014, Fig. 6B and C). These results were confirmed in asecond HNSCC cell line (FaDu, Supplementary Fig. S7). InSCC1EGFRvIII-expressing cells the percentage of inhibitionin migration (68.5%) and invasion (67.2%) was signifi-cantly greater than the percentage of inhibition of vectorcontrol–expressing cells (migration 43.2%, invasion

Figure 4. Dasatinib (Das) inhibits tumor growth in EGFRvIII-expressing cells in vivo. Mice were inoculated with Cal33 cells expressing vector alone(Vector) or EGFRvIII constructs and treated daily with vehicle control (Control; n ¼ 8) or dasatinib (n ¼ 8) as described in Materials and Methods. A, tumorvolumes of Cal33 vector- and EGFRvIII-expressing cells under control treatment plotted by day (day 1, treatment initiation). Final tumor volumes(day 20) were analyzed for statistical significance using the Mann–Whitney test, P ¼ 0.019. B, tumor volumes of Cal33 vector–expressing cells treatedwith vehicle control or dasatinib and plotted by day. Final tumor volumes (day 20) were analyzed for statistical significance using the Mann–Whitney test,P¼ 0.19. C, tumor volumes of Cal33 EGFRvIII-expressing cells treatedwith vehicle control or dasatinib and plotted by day. Final tumor volumes (day 20) wereanalyzed for statistical significance using theMann–Whitney test, P¼ 0.047. D, quantification of the NIR signal ratio is provided for immunoblot of xenograftsprobed for SFKphosphorylation at Y416, and total SFK.Mann–Whitney test,P¼0.0003 for untreated comparedwith treated in both vector control (openbars)and EGFRvIII-expressing (closed bars) xenografts; there were no significant differences between vector control- and EGFRvIII-expressing xenografts.

Wheeler et al.





46.7%; P ¼ 0.029 for both) indicating that Lyn is a likelyintermediate in EGFRvIII-mediated cell motility.

DiscussionEGFRvIII is reportedly more tumorigenic than wtEGFR

(1, 3, 18) despite the fact that there is no difference in thecytoplasmic signaling domain of wtEGFR and EGFRvIII.Differential activation of EGFRvIII signaling pathways com-pared with wtEGFR has been reported. Altered oncogenicphenotypes may be attributed to differential signalingkinetics due to EGFRvIII retention at the plasmamembranewhich results in low level constitutive signaling (31). EGFR-vIII expression is found in 17% to 42%ofHNSCCs (22, 23)in addition to other tumor types including glioma, breast,lung (2, 32), and prostate cancers (33). EGFRvIII has beenshown to contribute to increased oncogenicity throughvarious signaling pathways (34) and a recent study indicatesthat patients with HNSCCs with EGFRvIII have reduceddisease control rates and shortened progression-free surviv-al when treatedwith a cetuximab-containing regiment (24).The mechanisms through which EGFRvIII expressionincreases oncogenicity and confers cetuximab resistance areincompletely understood.EGFRvIII in glioma has been shown in vitro and in human

tumor samples to show constitutive activation of the PI3K/Akt pathway (17, 35). Blockade of this pathway has been

shown to reduce the EGFRvIII-enhanced oncogenic pheno-type (17). We previously reported that in EGFRvIII-expres-sing HNSCCs, inhibition of the PI3K/Akt pathway reducescell proliferationbut has noeffect on cellmotility or invasion(19). In the present study, Akt phosphorylationwas detectedin EGFRvIII-expressing HNSCC cells and was abrogated bySFK inhibition (Fig. 3). There are conflicting reports on therole ofMAPK signaling in EGFRvIII-expressingmodelswheresome studies report activation (18, 36) and others fail tosuggest a role (29). In this study, we found that MAPKphosphorylation in EGFRvIII-expressing HNSCC cells wassignificantly reduced by SFK inhibition (Fig. 3).

Both STAT3 and SFKs have been implicated as key med-iators in the EGFRvIII oncogenic phenotype in glioma. Inglioma specimens there was a significant correlationbetween activated STAT3 levels and EGFRvIII (but notwtEGFR; ref. 37). We have previously shown that STAT3 isrequired for EGFRvIII-expressingHNSCCmotility and inva-sion (19). Many human cancers have shown a role for SFKin constitutive STAT activation and in HNSCCs, STAT3 is aSFK-dependent mediator of EGFR-stimulated growth invitro (38), decreased apoptosis (39), and increased tumorgrowth in vivo (40). SFKs have been shown to contribute toinvasion in EGFRvIII-expressing gliomas where genetic andmolecular inhibition of SFKs reduced invasion (7). InHNSCCs expressing only wtEGFR, it has been reported thatSFK inhibition using dasatinib reduces cell motility and

Figure 5. Increased Lyn phosphorylationin EGFRvIII-expressing HNSCCscompared with wtEGFR-only HNSCCs. A,FaDu vector control or EGFRvIII cells wereserum starved for 24 hours and harvestedfor immunoprecipitation (IP) with an SFKantibody as noted. Following IP, proteinswere immunoblotted for phosphorylation atY416 and subsequently for total protein.NIR signal was recorded. p-SFK wasnormalized to total SFK and graphed as afold increase in EGFRvIII-expressing cellscompared with vector-only cells. Mann–Whitney test, P ¼ 0.019. B, increasedphosphorylation of Lyn Y416 wasconfirmed in Cal33 and UMSCC1 vectorand EGFRvIII-expressing cells as noted in(A; P ¼ 0.01 and 0.03, respectively). C,representative sample of RT-PCR ofspecimens of patients with HNSCC forEGFRvIII positivity. EGFRvIII bands wereexcised and subsequently sequenced.FaDu MSCV (MSCV) was used as awtEGFR-only control, FaDu vIII (vIII) wasused as a EGFRvIII-positive control. D,HNSCC tumor lysates positive (n ¼ 10) ornegative (n ¼ 12) for EGFRvIII wereimmunoprecipitated with a Lyn-specificantibody, immunoblotted forphosphorylation at Y416, andsubsequently for total Lyn protein. NIRsignal was recorded and taken as a ratio ofphosphoprotein to total protein andplotted. Mann–Whitney test, P ¼ 0.035.






invasion by regulating downstream cell adhesionmoleculessuch as FAK (12). In the present study, we found thatdasatinib significantly decreases proliferation, invasion,and cell motility of vector control- and EGFRvIII-expressingHNSCC cells (Fig. 2). Total phosphorylated SFK levels atbaseline do not appear to correlate with the biologic effectsof dasatinib. This has also been noted previously inHNSCCcells expressingonlywtEGFR(12).Wealsodetected reducedAkt and MAPK phosphorylation in addition to decreasedFAKphosphorylation by dasatinib treatment (Fig. 3). p-FAKY397, which is the FAK autophosphorylation site and is adocking site for SFKs appeared to be unchanged with SFKinhibition. Dasatinib treatment of HNSCC cells by Johnsonand colleagues also showed no change in p-FAK Y397 levels(12). This is not surprising as integrins and several RTKsactivate this site (Y397) which can then recruit SFKs (21).While invasion and cellmotility were significantly inhibitedby SFK blockade, it appears that there are othermechanismsthat contribute to EGFRvIII-expressing HNSCC-mediatedinvasion and cell motility as cell motility was not entirelyabrogated in the presence of SFK inhibition. Persistentphosphorylation of FAK at Y397may contribute to invasionand migration even in the setting of dasatinib treatment.

Dasatinib is known to inhibit SFKs as well as Abl, c-kit,PDGFR, and EphA2 (30, 41). Studies in HNSCCs show thattreatment with imatinib (an inhibitor of Abl, c-kit, andPDGFR) did not affect cell-cycle progression or apoptosis(42, 43). EphA2 is inhibited by dasatinib but dasatinibinhibition of EphA2 activation levels did not correlate withthe effects of dasatinib on cell-cycle progression or apopto-sis (12). It is therefore likely that not all of the effectsobserved from dasatinib treatment in HNSCCs are due toSFK inhibition.

In glioma several studies have evaluated the effects ofaltered SFK activity on EGFRvIII-expressing tumors. Geneticdisruption of c-Src using a dominant-negative approach inEGFRvIII-expressing glioma xenografts decreased tumorgrowth rates and significantly increased the efficacy ofEGFRvIII-specific antibody treatment (6). Dasatinib hasalso showed antitumor effects in glioma model systems.In an endogenously expressing EGFRvIII in vivo modeldasatinib has been shown to inhibit growth and increasesurvival and apoptosis (7). SFK inhibition through dasati-nib treatment of HNSCC xenografts has been primarilyreported in the context of downstream signaling markersand the effects of dasatinib on tumor growth in vivo ormetastasis are still being defined (44). We found that in vivotreatment with dasatinib had a more profound inhibitoryeffect on tumor volumes in EGFRvIII-expressing HNSCCxenografts compared with tumors derived from vector con-trol cells expressing wtEGFR only (Fig. 4). This is in agree-ment with a recent report that a wtEGFRHNSCCorthotopicxenograft model treated with dasatinib alone had no effecton tumor volume (45). The cause of the discrepancybetween in vitro and in vivo efficacies in wtEGFR-expressingHNSCCs is as yet unknownbutmaybe related to differencesindrug exposure (in vitro cells receive a single dose for 24–72hourswhereas in vivodosing occurs daily overweeks). Theseresults indicate that tumor growth of EGFRvIII-expressingcells ismediated, at least inpart, by SFK signaling. In glioma,EGFRvIII did not appear to initiate differential expression ofspecific SFKsbut rather preferentially activated Fyn and c-Srccompared with Lyn, Yes, Hck, and Blk (7). Lyn has beenimplicated as a key signaling mediator in several solidcancers including prostate (46), glioma (47), and breast(48). Further experiments showed that while Fyn, c-Src, and

Figure 6. Knockdown of Lyn inhibits EGFRvIII-mediated HNSCCmigration and invasion. A, UMSCC1 vector and EGFRvIII-expressing cells were treated withLyn siRNA for 48 hours and immunoblotted to confirm Lyn knockdown. B, UMSCC1 vector control- (open bars) and EGFRvIII-expressing (closed bars)cells were assayed for cellmotility in the presence of nontargeting siRNAor Lyn siRNA. The experimentwas repeated 4 times and assessed for significance bythe Mann–Whitney test, P ¼ 0.014. C, UMSCC1 vector control- (open bars) and EGFRvIII-expressing (closed bars) cells were assayed for cell invasionin the presence of nontargeting siRNA or Lyn siRNA. The experiment was repeated 4 times and assessed for significance by the Mann–Whitney test,P ¼ 0.014. NTC, nontargeting control.

Wheeler et al.





Yes were phosphorylated equally in EGFRvIII and vectorcontrol–expressing cells, Lyn phosphorylation wasincreased in EGFRvIII cells and human HNSCC tumorsexpressing EGFRvIII. It is therefore plausible that theincreased phosphorylation of Lyn in EGFRvIII-expressingcells contributes to the greater efficacy of SFK inhibition toEGFRvIII-expressing HNSCCs in vivo. Evaluation of patientHNSCC samples showed increased phosphorylation of Lynin EGFRvIII-expressing HNSCCs. Selective targeting of Lynexpression using siRNA inhibited the migration and inva-sion of EGFRvIII-expressing HNSCC cells, implicating afunctional role of increased Lyn activation (Fig. 6). To ourknowledge, this is the first report of a specific role for Lyn inHNSCCs. These results suggest that therapeutic agents thatselectively target Lyn could be effective in this cancer (49).The Lyn/BCR-ABL inhibitor bafetinib is currently underinvestigation in phase II clinical trials for patients withprostate cancer, B-cell chronic lymphocytic leukemia, andbrain tumors (50). To the best of our knowledge there arelimited studies inHNSCCs that have evaluated lymph nodeand distant metastasis. In a wtEGFR orthotopic mousemodel (44) with dasatinib treatment no metastasis of anytype was identified in control or treatment groups. Furtherinvestigation of SFK/Lyn inhibition in metastatic orthoto-pic mouse models is warranted.The majority of reports on EGFRvIII in cancer conclude

that EGFRvIII contributes to increased tumor growth and

poor prognosis. In HNSCCs, EGFRvIII expression has beenassociated with cetuximab resistance in preclinical modelsand now in a human HNSCC cohort (24). Therapeuticstrategies that target SFK, specifically Lyn, may be effectivealternative strategies in these patients.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: S.E. Wheeler, J.R. GrandisDevelopment of methodology: S.E. Wheeler, S.I. Chiosea, R.R. SeethalaAcquisitionofdata (provided animals, acquired andmanagedpatients,provided facilities, etc.): S.E. Wheeler, J.S. Bednash, C.G. Otte, R.R.Seethala, S.I. ChioseaAnalysis and interpretation of data (e.g., statistical analysis, biosta-tistics, computational analysis): S.E. Wheeler, E.M. Morariu, C.G. OtteWriting, review, and/or revision of the manuscript: S.E. Wheeler, S.I.Chiosea, J.R. GrandisAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): E.M. Morariu, R.R. Seethala, S.I.ChioseaStudy supervision: S.E. Wheeler, J.R. Grandis

Grant SupportThe study was supported by P50CA097190, R01CA098372,

U01CA84968, Bristol-Myers Squibb, and the American Cancer Society (toJ.R. Grandis), 1F31DE020223 (to S.E. Wheeler).

Received September 27, 2011; revisedMarch 12, 2012; acceptedMarch 27,2012; published OnlineFirst April 6, 2012.

References1. Batra SK, Castelino-Prabhu S, Wikstrand CJ, Zhu X, Humphrey PA,

Friedman HS, et al. Epidermal growth factor ligand-independent,unregulated, cell-transforming potential of a naturally occurring humanmutant EGFRvIII gene. Cell Growth Differ 1995;6:1251–9.

2. Ekstrand AJ, James CD, Cavenee WK, Seliger B, Pettersson RF,Collins VP. Genes for epidermal growth factor receptor, transforminggrowth factor alpha, and epidermal growth factor and their expressionin human gliomas in vivo. Cancer Res 1991;51:2164–72.

3. Nagane M, Coufal F, Lin H, Bogler O, Cavenee WK, Huang HJ. Acommon mutant epidermal growth factor receptor confers enhancedtumorigenicity on human glioblastoma cells by increasing proliferationand reducing apoptosis. Cancer Res 1996;56:5079–86.

4. Lal A, Glazer CA, Martinson HM, Friedman HS, Archer GE, SampsonJH, et al. Mutant epidermal growth factor receptor up-regulatesmolecular effectors of tumor invasion. Cancer Res 2002;62:3335–9.

5. Mukherjee B,McEllin B, CamachoCV, TomimatsuN, SirasanagandalaS, Nannepaga S, et al. EGFRvIII andDNAdouble-strand break repair: amolecular mechanism for radioresistance in glioblastoma. Cancer Res2009;69:4252–9.

6. JohnsTG,PereraRM,VernesSC,Vitali AA,CaoDX,CaveneeWK, et al.The efficacy of epidermal growth factor receptor-specific antibodiesagainst glioma xenografts is influenced by receptor levels, activationstatus, and heterodimerization. Clin Cancer Res 2007;13:1911–25.

7. Lu KV, Zhu S, Cvrljevic A, Huang TT, Sarkaria S, Ahkavan D, et al. Fynand SRC are effectors of oncogenic epidermal growth factor receptorsignaling in glioblastoma patients. Cancer Res 2009;69:6889–98.

8. Summy JM, Gallick GE. Src family kinases in tumor progression andmetastasis. Cancer Metastasis Rev 2003;22:337–58.

9. Ishizawar R, Parsons SJ. c-Src and cooperating partners in humancancer. Cancer Cell 2004;6:209–14.

10. Mandal M, Myers JN, Lippman SM, Johnson FM,Williams MD, RayalaS, et al. Epithelial to mesenchymal transition in head and neck squa-mous carcinoma: association of Src activation with E-cadherin down-

regulation, vimentin expression, and aggressive tumor features. Can-cer 2008;112:2088–100.

11. Koppikar P, Choi SH, Egloff AM, Cai Q, Suzuki S, Freilino M, et al.Combined inhibition of c-Src and epidermal growth factor receptorabrogates growth and invasion of head and neck squamous cellcarcinoma. Clin Cancer Res 2008;14:4284–91.

12. Johnson FM, Saigal B, Talpaz M, Donato NJ. Dasatinib (BMS-354825) tyrosine kinase inhibitor suppresses invasion and inducescell cycle arrest and apoptosis of head and neck squamous cellcarcinoma and non-small cell lung cancer cells. Clin Cancer Res2005;11:6924–32.

13. Yamaguchi K, Kugimiya T, Miyazaki T. Substance P receptor in U373MG human astrocytoma cells activates mitogen-activated proteinkinases ERK1/2 through Src. Brain Tumor Pathol 2005;22:1–8.

14. ChangYM,Bai L, LiuS, Yang JC,KungHJ, EvansCP.Src family kinaseoncogenic potential and pathways in prostate cancer as revealed byAZD0530. Oncogene 2008;27:6365–75.

15. Jallal H, Valentino ML, Chen G, Boschelli F, Ali S, Rabbani SA. A Src/Abl kinase inhibitor, SKI-606, blocks breast cancer invasion, growth,and metastasis in vitro and in vivo. Cancer Res 2007;67:1580–8.

16. Xi S, ZhangQ,Dyer KF, Lerner EC, Smithgall TE,GoodingWE, et al. Srckinases mediate STAT growth pathways in squamous cell carcinomaof the head and neck. J Biol Chem 2003;278:31574–83.

17. Moscatello DK, Holgado-Madruga M, Emlet DR, Montgomery RB,Wong AJ. Constitutive activation of phosphatidylinositol 3-kinase bya naturally occurring mutant epidermal growth factor receptor. J BiolChem 1998;273:200–6.

18. Moscatello DK, Montgomery RB, Sundareshan P, McDanel H, WongMY, Wong AJ. Transformational and altered signal transduction by anaturally occurring mutant EGF receptor. Oncogene 1996;13:85–96.

19. Wheeler SE, Suzuki S, Thomas SM, Sen M, Leeman-Neill RJ, ChioseaSI, et al. Epidermal growth factor receptor variant III mediates head andneckcancer cell invasion viaSTAT3activation.Oncogene29:5135–45.






20. Rengifo-Cam W, Konishi A, Morishita N, Matsuoka H, Yamori T,Nada S, et al. Csk defines the ability of integrin-mediated celladhesion and migration in human colon cancer cells: implicationfor a potential role in cancer metastasis. Oncogene 2004;23:289–97.

21. Zhao J, Guan JL. Signal transduction by focal adhesion kinase incancer. Cancer Metastasis Rev 2009;28:35–49.

22. Sok JC, Coppelli FM, Thomas SM, Lango MN, Xi S, Hunt JL, et al.Mutant epidermal growth factor receptor (EGFRvIII) contributes tohead and neck cancer growth and resistance to EGFR targeting. ClinCancer Res 2006;12:5064–73.

23. Chau NG, Perez-Ordonez B, Zhang K, Pham NA, Ho J, Zhang T, et al.The association between EGFR variant III, HPV, p16, c-MET, EGFRgene copy number and response to EGFR inhibitors in patients withrecurrent ormetastatic squamous cell carcinomaof the headandneck.Head Neck Oncol 2011;3:11.

24. Tinhofer I, Klinghammer K, Weichert W, Knodler M, Stenzinger A,Gauler T, et al. Expression of Amphiregulin and EGFRvIII AffectOutcome of Patients with Squamous Cell Carcinoma of the Head andNeck Receiving Cetuximab-Docetaxel Treatment. Clin Cancer Res2011;17:5197–204.

25. Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, et al.Radiotherapy plus cetuximab for squamous-cell carcinoma of thehead and neck. N Engl J Med 2006;354:567–78.

26. Bigner SH, Humphrey PA, Wong AJ, Vogelstein B, Mark J, FriedmanHS, et al. Characterization of the epidermal growth factor receptorin human glioma cell lines and xenografts. Cancer Res 1990;50:8017–22.

27. Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, Nguyen-Tan PF,et al. Human papillomavirus and survival of patients with oropharyn-geal cancer. N Engl J Med 2010;363:24–35.

28. Nishikawa R, Ji XD, Harmon RC, Lazar CS, Gill GN, CaveneeWK, et al.A mutant epidermal growth factor receptor common in human gliomaconfers enhanced tumorigenicity. Proc Natl Acad Sci U S A1994;91:7727–31.

29. Luwor RB, Zhu HJ, Walker F, Vitali AA, Perera RM, Burgess AW, et al.The tumor-specific de2-7 epidermal growth factor receptor (EGFR)promotes cells survival and heterodimerizes with the wild-type EGFR.Oncogene 2004;23:6095–104.

30. Lombardo LJ, Lee FY, Chen P, Norris D, Barrish JC, Behnia K, et al.Discovery of N-(2-chloro-6-methyl-phenyl)-2-(6-(4-(2-hydroxyethyl)-piperazin-1-yl)-2-methylpyrimidin-4-ylamino)thiazole-5-carboxamide(BMS-354825), a dual Src/Abl kinase inhibitor with potent antitumoractivity in preclinical assays. J Med Chem 2004;47:6658–61.

31. HuangHS,NaganeM,Klingbeil CK, LinH,NishikawaR, Ji XD, et al. Theenhanced tumorigenic activity of a mutant epidermal growth factorreceptor common in human cancers is mediated by threshold levels ofconstitutive tyrosine phosphorylation and unattenuated signaling. JBiol Chem 1997;272:2927–35.

32. Wikstrand CJ, Hale LP, Batra SK, Hill ML, Humphrey PA, Kurpad SN,et al. Monoclonal antibodies against EGFRvIII are tumor specific andreact with breast and lung carcinomas and malignant gliomas. CancerRes 1995;55:3140–8.

33. Olapade-Olaopa EO, Moscatello DK, MacKay EH, Horsburgh T,Sandhu DP, Terry TR, et al. Evidence for the differential expressionof a variant EGF receptor protein in human prostate cancer. Br JCancer 2000;82:186–94.

34. Huang PH, Xu AM, White FM. Oncogenic EGFR signaling networks inglioma. Sci Signal 2009;2:re6.

35. Choe G, Horvath S, Cloughesy TF, Crosby K, Seligson D, Palotie A,et al. Analysis of the phosphatidylinositol 30-kinase signaling pathwayin glioblastoma patients in vivo. Cancer Res 2003;63:2742–6.

36. Montgomery RB, Moscatello DK, Wong AJ, Cooper JA, Stahl WL.Differential modulation of mitogen-activated protein (MAP) kinase/extracellular signal-related kinase kinase and MAP kinase activitiesby a mutant epidermal growth factor receptor. J Biol Chem1995;270:30562–6.

37. Mellinghoff IK, Wang MY, Vivanco I, Haas-Kogan DA, Zhu S, Dia EQ,et al. Molecular determinants of the response of glioblastomas toEGFR kinase inhibitors. N Engl J Med 2005;353:2012–24.

38. Rubin Grandis J, Drenning SD, Chakraborty A, ZhouM, Zeng Q, Pitt A,et al. Requirement of Stat3 but not Stat1 for EGFR-mediated cellgrowth in vitro. J Clin Invest 1998;102:1385–92.

39. Grandis JR, Drenning SD, Zeng Q, Watkins SC, Melhem MF, Endo S,et al. Constitutive activation of Stat3 signaling abrogates apoptosis insquamous cell carcinogenesis in vivo. Proc Natl Acad Sci U S A2000;97:4227–32.

40. Kijima T, Niwa H, Steinman RA, Drenning SD, Gooding WE, WentzelAL, et al. STAT3 activation abrogates growth factor dependence andcontributes to head and neck squamous cell carcinoma tumor growthin vivo. Cell Growth Differ 2002;13:355–62.

41. Huang F, Reeves K, Han X, Fairchild C, Platero S, Wong TW, et al.Identification of candidate molecular markers predicting sensitivity insolid tumors to dasatinib: rationale for patient selection. Cancer Res2007;67:2226–38.

42. Johnson FM, Saigal B, Donato NJ. Induction of heparin-bindingEGF-like growth factor and activation of EGF receptor in imatinibmesylate-treated squamous carcinoma cells. J Cell Physiol2005;205:218–27.

43. Johnson FM, Yang P, Newman RA, Donato NJ. Cyclooxygenase-2induction and prostaglandin E2 accumulation in squamous cell car-cinoma as a consequence of epidermal growth factor receptor acti-vation by imatinib mesylate. J Exp Ther Oncol 2004;4:317–25.

44. Sen B, Saigal B, Parikh N, Gallick G, Johnson FM. Sustained Srcinhibition results in signal transducer and activator of transcription 3(STAT3) activation and cancer cell survival via altered Janus-activatedkinase-STAT3 binding. Cancer Res 2009;69:1958–65.

45. Sen B, Peng S, Saigal B, Williams MD, Johnson FM. Distinctinteractions between c-Src and c-Met in mediating resistance toc-Src inhibition in head and neck cancer. Clin Cancer Res 2011;17:514–24.

46. Cai H, Smith DA, Memarzadeh S, Lowell CA, Cooper JA, Witte ON.Differential transformation capacity of Src family kinases during theinitiation of prostate cancer. Proc Natl Acad Sci U S A 2011;108:6579–84.

47. DingQ, Stewart J Jr, OlmanMA, KlobeMR,GladsonCL. The pattern ofenhancement of Src kinase activity on platelet-derived growth factorstimulation of glioblastoma cells is affected by the integrin engaged. JBiol Chem 2003;278:39882–91.

48. Choi YL, Bocanegra M, Kwon MJ, Shin YK, Nam SJ, Yang JH, et al.LYN is a mediator of epithelial-mesenchymal transition and a target ofdasatinib in breast cancer. Cancer Res 2010;70:2296–306.

49. KimuraS,NaitoH,SegawaH,Kuroda J, YuasaT, SatoK, et al. NS-187,a potent and selective dual Bcr-Abl/Lyn tyrosine kinase inhibitor, is anovel agent for imatinib-resistant leukemia. Blood 2005;106:3948–54.

50. Santos FP, Kantarjian H, Cortes J, Quintas-Cardama A. Bafetinib, adual Bcr-Abl/Lyn tyrosine kinase inhibitor for the potential treatment ofleukemia. Curr Opin Investig Drugs 2010;11:1450–65.

Wheeler et al.





2012;18:2850-2860. Published OnlineFirst April 6, 2012.Clin Cancer Res Sarah E. Wheeler, Elena M. Morariu, Joseph S. Bednash, et al. EGFRvIII-Expressing Head and Neck CancerLyn Kinase Mediates Cell Motility and Tumor Growth in

Updated version

10.1158/1078-0432.CCR-11-2486doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2012/04/05/1078-0432.CCR-11-2486.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/18/10/2850.full#ref-list-1

This article cites 49 articles, 30 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/18/10/2850.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/18/10/2850To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-11-2486

http://clincancerres.aacrjournals.org/content/suppl/2012/04/05/1078-0432.CCR-11-2486.DC1

http://clincancerres.aacrjournals.org/content/18/10/2850.full#ref-list-1

http://clincancerres.aacrjournals.org/content/18/10/2850.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/18/10/2850


lyn kinase mediates cell motility and tumor growth in...

Documents