loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in...

Q1

lable at ScienceDirect

Experimental Eye Research xxx (2010) 1e14

YEXER5575_proof ■ 21 July 2010 ■ 1/14

123456789

10111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455

Contents lists avai

Experimental Eye Research

journal homepage: www.elsevier .com/locate/yexer

5657585960616263646566676869

Loss of photoreceptor potential from retinal progenitor cell cultures,despite improvements in survival

Fiona C. Mansergh a,*, Reaz Vawda a,b, Sophia Millington-Ward a, Paul F. Kenna a, Jochen Haas c,Clair Gallagher d, John H. Wilson e, Peter Humphries a, Marius Ader a,c, G. Jane Farrar a

aOcular Genetics Unit, Smurfit Institute of Genetics, Trinity College Dublin, Lincoln Place Gate, Dublin 2, Irelandb Fighting Blindness Vision Research Institute, 1 Christchurch Hall, Dublin 2, IrelandcDFG-Center for Regenerative Therapies Dresden, Cluster of Excellence/TU Dresden, c/o MTZ, Fiedlerstr. 42, 01307 Dresden, GermanydNational Institute of Cellular Biotechnology (NICB), Dublin City University, Glasnevin, Dublin 9, IrelandeDepartment of Biochemistry and Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA

707172737475767778798081

a r t i c l e i n f o

Article history:Received 6 May 2010Accepted in revised form 7 July 2010Available online xxx

Keywords:retinal progenitor cellscell cultureFACSrhodopsinphotoreceptorretina

* Corresponding author. Tel.: þ353 1 8962484; fax:E-mail addresses:[email protected] (F.C. Mansergh), r

ie (R. Vawda), [email protected] (S. [email protected] (J. Haas), [email protected] (J.H. Wilson), [email protected] (P. Hdresden.de (M. Ader), [email protected] (G.J. Farrar).

0014-4835/$ e see front matter � 2010 Elsevier Ltd.doi:10.1016/j.exer.2010.07.003

Please cite this article in press as: Manseimprovements in survival, Exp. Eye. Res. (20

8283848586878889

a b s t r a c t

Retinal degeneration (RD) results from photoreceptor apoptosis. Cell transplantation, one potentialtherapeutic approach, requires expandable stem cells that can form mature photoreceptors whendifferentiated. Freshly dissociated primary retinal cells from postnatal day 2e6 (PN2e6) mouse retinacan give rise, post-transplantation, to photoreceptors in adult recipients. Unfortunately, incorporationrates are low; moreover, photoreceptor potential is lost if the same PN2e6 cells are cultured prior totransplantation. We investigated the identity of the cells forming photoreceptors post-transplantation,using FACS sorted primary postnatal day (PN) 3e5 Rho-eGFP retinal cells. Higher integration rates wereachieved for cells that were expressing Rho-eGFP at PN3e5, indicating that post-mitotic photoreceptorprecursors already expressing rhodopsin form the majority of integrating rods. We then investigatedimprovement of cell culture protocols for retinal progenitor cells (RPCs) derived from PN3e5 retinal cellsin vitro. We succeeded in improving RPC survival and growth rates 25-fold, by modifying retinaldissociation, replacing N2 supplement with B27 supplement minus retinoic acid (B27� RA) and coatingflasks with fibronectin. However, levels of rhodopsin and similar photoreceptor-specific markers stilldiminished rapidly during growth in vitro, and did not re-appear after in vitro differentiation. Similarly,transplanted RPCs, whether proliferating or differentiated, did not form photoreceptors in vivo. CulturedRPCs upregulate genes such as Sox2 and nestin, markers of more primitive neural stem cells. Use of thesecells for RD treatment will require identification of triggers that favour terminal photoreceptor differ-entiation and survival in vitro prior to transplantation.

� 2010 Elsevier Ltd. All rights reserved.

90
9192 93949596979899
100101

1. Introduction

Retinal degeneration (RD) involves the gradual loss of photo-receptors by apoptosis, causing visual impairment and eventualblindness. Inherited RD is genetically heterogeneous. To date, over190 loci have been identified (RetNet; http://www.sph.uth.tmc.edu/Retnet/). The disability associated with various forms of RDcarries a great social and economic cost. Retinitis pigmentosa (RP)affects 1 in 3000 people, while age related macular degeneration

þ353 1 8963848.eaz.vawda@fightingblindness.), [email protected] (P.F. Kenna),u.ie (J.H. Gallagher), jwilson@umphries), marius.ader@crt-

All rights reserved.

rgh, F.C., et al., Loss of pho10), doi:10.1016/j.exer.2010.0

102103104105106107108

(AMD) affects as many as 1 in 10 over-65s. Gene therapy-basedapproaches have shown therapeutic promise in clinical trials(Maguire et al., 2008, 2009; Bainbridge et al., 2008; Cideciyan et al.,2008), but require some surviving cells in order to work. Celltherapy for advanced disease may provide a complimentaryapproach.

A variety of stem cell sources have been identified, includingciliary epithelial cells (CE), retinal progenitor cells (RPCs, derivedfrom embryonic or early postnatal neural retinas), embryonic stem(ES) cells, and induced pluripotent stem (iPS) cells. Ciliary epithelialcells (CE) are derived from the ciliary margin and can generatespheres in culture which upregulate neuro-retinal genes (Tropepeet al., 2000; Coles et al., 2004; Das et al., 2005), However, recentreports note that these cells fail to form bona fide retinal neuronsand glia (Cicero et al., 2009; Gualdoni et al., 2010); this source ofstem cells has therefore not been investigated further here.

toreceptor potential from retinal progenitor cell cultures, despite7.003

109110

http://www.sph.uth.tmc.edu/Retnet/


mailto:[email protected]













www.sciencedirect.com/science/journal/00144835

http://www.elsevier.com/locate/yexer

http://dx.doi.org/10.1016/j.exer.2010.07.003



Q2

Q3

F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e142

YEXER5575_proof ■ 21 July 2010 ■ 2/14

111112113114115116117118119120121122123124125126127128129130131132133134135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175

176177178179180181182183184185186187188189190191192193194195196197198199200201202203204205206207208209210211212213214215216217218219220221222223224225226227228229230231232233234235236237238239240

Transplantation studies have shown that a sub-fraction of freshlydissociated cells from PN2e6mouse retinas can integrate into adulthost retina, show morphology characteristic of photoreceptors andcan ameliorate symptoms of RD (MacLaren et al., 2006; Bartschet al., 2008; West et al., 2008, 2009). Similar transplants usingcultured cells derived from embryonic to postnatal day 6 retinas(RPCs) (or, indeed, freshly dissociated primary retinal cells fromembryonic retinas or retinas older than the first postnatal week) donot result in photoreceptor morphology. Optimal integrationcoincides with the birth of rod photoreceptors. Integrated cells arethought to be post-mitotic (MacLaren et al., 2006; West et al.,2009). Moreover the frequency of integration is low even at PN4(0.6%), and transplantation is less successful in diseased retinas,perhaps because of the gliosis that accompanies RD (West et al.,2009). Disruption of the outer limiting membrane (OLM; a barrierbetween the subretinal space and the outer nuclear layer) canincrease the proportion of integrating cells; however, percentagesare still small (West et al., 2008, 2009).

Primary retinal cells dissociated from late embryonic (E14.5 andsubsequent) and early postnatal mouse retinas can be expanded intissue culture. Adherent cultures are established within a few days,can be passaged after 1 month, and can be grown indefinitely(Klassen et al., 2004; Angénieux et al., 2006; Merhi-Soussi et al.,2006). These cells are described here as retinal progenitor cells(RPCs). RPCs are typically expanded in serum-free media optimizedfor neural cultures with N2 supplement (or similar), epidermalgrowth factor (EGF) and fibroblast growth factor 2 (FGF2), whichhave both been shown to have a proliferative effect on these cells(Kelley et al., 1995; Chacko et al., 2000; Das et al., 2005). Moreover,there are indications that EGF, which biases towards glial cell fate inneural stem cell cultures, can act as a potent neuralizing factor inretinal cells (Angénieux et al., 2006). Plating on laminin, sometimeswith poly-L-ornithine, and sequential withdrawal of EGF, then FGF2five days later, is used to differentiate RPCs in vitro, followed byaddition of B27 supplement. Adherent RPCs, classified variously asretinal stem cells, retinal progenitor cells, retinal precursor cells,radial glial cells and/or proliferatingMueller glia, showa capacity togenerate retinal neurons, including those expressing photoreceptormarkers (Klassen et al., 2004; Merhi-Soussi et al., 2006; Canolaet al., 2007). Cultured RPCs transplanted either subretinally orintravitreally can integrate into the retina and have been shown togenerate some level of therapeutic effect (Klassen et al., 2004).However, reports of photoreceptor morphology arising fromtransplantation of postnatal rodent RPC cultures are discordant(Klassen et al., 2004; Reh, 2006; Canola et al., 2007; Lamba et al.,2008; West et al., 2009), with the majority now suggesting thatsuch events are rare or non-existent (West et al., 2009).

Retinal differentiation protocols have been developed for RPCs,embryonic neural stem cells, ES and iPS cells (Zhao et al., 2002;Merhi-Soussi et al., 2006; Aoki et al., 2008; Meyer et al., 2006,2009; Lamba et al., 2006, 2010; Ikeda et al., 2005; Osakada et al.,2008; Jagatha et al., 2009; Hirami et al., 2009). ES or iPS-derivedcells also give relatively low integration rates of 0.1e0.5% of cellsinitially transplanted, although some photoreceptor morphology isachieved (Osakada et al., 2008; Lamba et al., 2009, 2010). The abilityto generate pure expandable cultures fromwhich larger numbers ofphotoreceptors can be obtained is a pre-requisite for RD cellulartherapies.

Firstly, we have investigated the identity of the primary retinalcells that can integrate and give rise to photoreceptors. We havefound that PN3e5 Rho-eGFP primary retinal cells already expressingrhodopsin at PN3e5 are more likely to integrate into the outernuclear layer (ONL) and form morphologically mature photorecep-tors after transplantation than those Rho-eGFP cells not expressingrhodopsin at the point of transplantation. Cells expressing rhodopsin

Please cite this article in press as: Mansergh, F.C., et al., Loss of phoimprovements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.0

at PN3e5 are almost certainly post-mitotic, as rhodopsin is a productof terminal rod differentiation. Rhodopsin expression is thereforea good marker for photoreceptor potential post-transplantation;however, this is rapidly lost from RPC cultures.We hypothesized thatsub-optimal initial culture conditions may result in poor survival ofphotoreceptor precursors. However, we have achieved a 25-foldimprovement in growth rate via extensive protocol changes, but noincreases were observed in rhodopsin expression levels or integra-tion rates post-transplantation, regardless of whether proliferatingor differentiated RPCs were analysed. Expression patterns of markergenes in proliferating RPCs show that they are undifferentiated;hence, we are losing cells that have already chosen a photoreceptorcell fate. Rapid loss of rhodopsin expression after introduction of thecells to tissue culture indicates that the majority of post-mitotic cellsare dying within 3 days. Identifying cues by which retinal progeni-tors are specified in vivo, and culture conditions that promotesurvival in vitro after specification, but prior to injection, will benecessary for therapeutic use of these cells in RD. However, theimprovements in isolation and growth rates described here will beuseful to anyone who might wish to investigate the therapeuticpotential of these cells for disorders such as glaucoma, Leber’shereditary optic neuropathy, or retinoschisis, where the defect doesnot lie within the photoreceptor layer.

2. Materials and methods

2.1. Retinal dissociation and FACS analysis

For FACS experiments, we used postnatal PN3e5 rhodopsin-eGFP(Rho-eGFP; Chan et al., 2004) heterozygote mice as donors for FACSand subsequent transplantation. These mice express a human Rho-eGFP fusion protein that is visible in rod outer segments followingtransplantation. Heterozygotes were used in our experiments ashomozygotes show symptoms of retinal degeneration (Chan et al.,2004). Retinas were dissected and placed in 1 ml HBSS (Lonza). Theciliary margin was removed from all retinas prior to dissociation.Retinal cells were analysed by FACS as previously described (Palfiet al., 2006). Following FACS analysis, cells were spun at 2000 rpmfor 5 min and resuspended such that the approximate concentrationof cells was 200,000 per 3 ml (cell count obtained from FACS).Following subretinal injection (see below), residual cell sampleswerecounted using a haemocytometer in order to assess the actualnumber and viability of cells injected (given the time elapsed, thiscould vary substantially from FACSfigures). For each time point, FACSsortingwas carried out 3 times and for each repetition, at least 3 eyeswere injected with positive and 3 eyes with negative cells. Unsortedcells were also transplanted as a control. Animals were sacrificed 3months post-transplantation, eyes were sectioned as describedbelow. Given the fact that eGFP, in Rho-eGFP cells, is expressed asa rhodopsin-eGFP fusion protein, positive cells were identified viaeGFP positive, morphologically correct outer segments adjacent tothe RPE.

2.2. Animals, transplantation, cryosectioning, eGFPtransplantation cell counts

For transplantation studies involving cultured RPCs, cells wereisolated at PN3e5 from transgenic mice ubiquitously expressingeGFP (Okabe et al., 1997). Recipients for all transplantations wereC57Bl6/J mice between 2 and 6 months of age. For tissue culturestudies, PN3e5 Rho-eGFP, eGFP, C57Bl6/J and Rho�/� donor mice(Humphries et al., 1997) were used. Subretinal injections werecarried out in strict compliance with EU and Irish law (Cruelty toAnimals Act 2002) and with the ARVO statement for animal use inophthalmic research. Anaesthesia and subretinal injections were


4

F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 3

YEXER5575_proof ■ 21 July 2010 ■ 3/14

241242243244245246247248249250251252253254255256257258259260261262263264265266267268269270271272273274275276277278279280281282283284285286287288289290291292293294295296297298299300301302303304305

306307308309310311312313314315316317318319320321322323324325326327328329330331332333334335336337338339340341342343344345346347348349350351352353354355356357358359360361362363364365366367368369370

carried out as previously described (Chadderton et al., 2009). Fixa-tion, cryosectioning and staining were carried out as previouslydescribed (Kiang et al., 2005). All sections were cut at 12.5 mmthickness and were DAPI stained. Cells were counted on a fluores-cent microscope (Zeiss, Axioplan 2); channels specific for RFP werechecked for each positive cell to ensure omission of false positivesdue to autofluorescence. eGFP-positive cells were counted indifferent categories, depending on retinal location andmorphology.Cells were counted as either unincorporated (balls of unintegratedcells adjacent to the injection site, for example), retinal (havingmigrated into the retina but with no evidence of integration),integrated (visible evidence of axons, dendrites etc), or possessingphotoreceptor morphology (see above). Photoreceptor morphologywas not seen following transplantation of cultured RPCs, only aftertransplantation of fresh retinal cells. In every instance, the entire eyewas sectioned and all 12.5 mm sections obtained were mounted,DAPI stained and counted. Following sectioning and counting,numbers of correctly integrated cells were divided by the originalnumber injected (haemocytometer figures used for FACS cells) andmultiplied by 100 to give the percentage of integrated cells,photoreceptors etc. Resultswere graphed usingGraphPadPrism3.0.

2.3. Retinal dissociation for subsequent tissue culture

Retinaswere placed in 1 ml PBS or HBSS following dissection. Theciliary margin was removed from all retinas prior to dissociation, inorder to avoid contamination by CE cells in subsequent cultures. Olddissociationmethod: Retinas were placed in 1 ml HBSS (Lonza) and100 ml 10 mg/ml trypsin (Sigma) was added. Retinas were incubatedfor 10 min at 37 �C, after 5 min, 10 ml 10 mg/ml DNase1þ100 ml20 mg/ml trypsin inhibitor were added and samples were trituratedwith a P1000 pipette (Gilson). Cells were spun for 5 min at 2000 rpm(Thermo Microlite microcentrifuge) and cells were resuspended in1 ml growth medium. New methods: 100 ml 0.25% trypsin/EDTA(Lonza/Biowhittaker) or 100 ml Accutase (Sigma)were added, retinaswere incubated for 5 min at 37 �C, allowed to settle to the bottom ofthe tube and most of the supernatant was aspirated away. 1 mlgrowth medium was then added and retinas were dissociated bytrituration with a fire polished Pasteur pipette. Retinas prepared viamechanical dissociation followed the same procedure, but omittingenzymatic digestion. Following dissociation, cells were counted fourtimes using a haemocytometer.

2.4. Tissue culture

2.4.1. Media, supplements, growth factorsNeurobasal medium, B27 and B27 without Vitamin A (B27� RA)

were obtained from Invitrogen; DMEM/F12, embryonic and post-natal stem cell media were from Sigma. Growth medium for RPCswas composed of DMEM/F12 supplemented with 1� N2, 1� B27,1� B27� RA or a combination thereof. 1� L-glutamine (Lonza), 1�penicillin/streptomycin (Lonza), 5 mg/ml heparin (Sigma), 20 ng/mlfibroblast growth factor 2 (FGF2) and 20 ng/ml epidermal growthfactor (EGF) were also added. RPCs were grown in Sarstedt T25flasks; other plastics were less conducive to growth. Neurobasaland other media were supplemented as for DMEM/F12.

2.4.2. DifferentiationCells were differentiated in vitro by plating cells on laminin

coated T25s or poly-L-lysine and laminin coated glass cover slips.After 2e4 days, EGF was withdrawn from the medium for 5 days,followed by use of final growth medium supplemented withB27þ RA and no growth factors for 5e7 days. Glial differentiationcan be enhanced by adding 1% fetal calf serum (FCS) to the finalgrowth medium.


2.4.3. SubstratesCollagen, fibronectin, laminin, poly-L-ornithine, poly-L-lysine,

poly-D-lysine and vitronectin were obtained from Sigma, whilegelatinwas obtained fromMillipore. All were applied at 0.1% for 2 hat room temperature or overnight at 4 �C. Flasks were rinsed in 1�PBS (Lonza) twice before addition of media and cells.

2.4.4. DissociationCells were placed in T25 flasks at a noted cell density in 5 ml

growth medium and incubated at 37 �C and 5% CO2. After initialplating, the medium was replaced completely after 5e7 daysinitially, then every 2e7 days depending on density.

2.4.5. PassagingCells were passaged when 80e90% confluent. 0.5 ml 0.25%

trypsin/EDTA (Lonza) or Accutase (Sigma) were added to each T25flask, following removal of medium and rinsing with 1� PBS. Flaskswere incubated for 5e10 min until cell monolayers lifted off. Cellswere resuspended in 3 ml DMEM/F12, counted four times and spunat 1000 rpm. The supernatant was removed, pellets were resus-pended in growthmedium and replated, frozen, or treated with TRIreagent (Sigma).

2.4.6. CalculationsInitial cell density and date of plating were noted for each flask.

The number of days to reach 80e90% confluence was also noted.Cells were counted at each passage (p) and the rate of cell growthwas calculated as follows:

Increase in cell no: per day

¼ ððCell no: at pNþ 1Þ � ðCell no: at pNÞÞNo: of days between pNþ 1 and pN

2.4.7. FreezingCells were resuspended in 1 ml freeze medium (7.5% glucose,

10%BSA or 1% B27� RA,10% DMSO,made up in DMEM/F12medium(Sigma)), placed in a Mr Frosty and frozen at �70 �C. Thawed cellswere placed in 5 ml DMEM/F12 and spun before replating.

2.5. RNA extraction

Cell pellets were resuspended in 1 ml TRI reagent (Sigma) andtriturated using a P1000, while retinas were homogenized in 1 mlTRI reagent using a Dounce homogenizer (Fisher). RNA wasprepared according to the manufacturer’s protocol. RNA sampleswere assayed for concentration and quality using a NanodropND1000 (NanoDrop Technologies) spectrophotometer.

2.6. RT-PCR

Reverse transcription was carried out as previously described(Mansergh et al., 2009). Primers were obtained from Sigma-Genosys(see Table 1). PCRs were carried out using Crimson Taq and buffer(NEB) according to themanufacturer’s instructions. A “no RT” controlcorresponding to each sample was included. Housekeeping genes(beta-actin, Gapdh, 18S rRNA) were also tested by DNA based Q-PCRto ensure that CT values for each gene were within a similar range(<1.5CT difference from an average obtained for all samples).

2.7. Q-PCR

HPLC purified primers were obtained for one step real-timeQ-PCR (Sigma-Genosys). 5 Qml of each RNA sample was treated withDNAfree (Ambion) in a volume of 30 ml according to the


5

Table 1Primer sequences for PCRQ8 .

18Smm F: GTAACCCGTTGAACCCCATT18Smm R: CCATCCAATCGGTAGTAGCGGapdh F: ACCACAGTCCATGCCATCACGapdh R: TCCACCACCCTGTTGCTGTAB-actin F: CGTGGGCCGCCCTAGGCACCAB-actin R: TTGGCCTTAGGGTTCAGGGGGBrn3b F: TGGTGCTTACTCTGCTGGATTCTBrn 3b R: CCTATTTGTGTGTGTGCTCCAARpf1 F: CCTACCACAGGAAGCCCAAGRpf1 R: TGGATGGCTCACTCCCAATAAThy1 F: CCTGTAGTGAGGGTGGCAGAThy1 R: GGATCAGGGACAGCAAGAGGIsl1 F: CACAGAGCGGAAGAAACCAGIsl1 R: GGGAGGAGAGGCAAACGTAAAtoh7 F: CCAGGACAAGAAGCTGTCCAAAtoh7 R: CCCATAGGGCTCAGGGTCTABsn F: ATCCCTGGCCCTTATGTTGABsn R: GTTCACCCTGCCCAAAGAACNr2e3 F: TTGGGAAATTGCTCCTCCTGNr2e3 R: CCTGTGGACACTTGGCACTCArr3 F: CTGGATGGCAAACTCAAGCAArr3 R: AGGAGATGGCTTTGGATGGACcnD1 F: TCTGCTTGACTTTCCCAACCCcnD1 R: TGGTCCCACCTTCACCTCTTmKi67 F: CAACCATCCAGGGAAACCAGmKi67 R: GGCATCTGTGTGGGTCCTTTTh F: TTCGAGGAGAGGGATGGAAATh R: CGACGCACAGAACTGAGGAGChAT F: TCTGCTGTTATGGCCCTGTGChAT R: AGATTGCTTGGCTTGGTTGGGad1 F: AAGCAACTACAGGGCGGATGGad1 R: GGGTACTAACAGGGAGGGTGTGGabbr1 F: TGTGTGTGTGTTGCCCTGACGabbr1 R: CAAAGTGGGACGCATGAGAASyp F: ATGGTTGGGAGCTGTGAGGTSyp R: AGGGAGAGGGCAGAGAAAGGOct4 F: GAGCACGAGTGGAAAGCAACOct4 R: CGCCGGTTACAGAACCATACBrachyury F: CATGTACTCTTTCTTGCTGGBrachyury R: GGTCTCGGGAAAGCAGTGGCKDR F: TTTGGCAAATACAACCCTTCAGAKDR R: GCAGAAGATACTGTCACCACCFgf5 F: TGTGTCTCAGGGGATTGTAGGFgf5 R: AGCTGTTTTCTTGGAATCTCTCCGscF: CAGATGCTGCCCTACATGAACGscR: TCTGGGTACTTCGTCTCCTGGGapdh F F: ACCACAGTCCATGCCATCACGapdh R: TCCACCACCCTGTTGCTGTAB-actin F: CGTGGGCCGCCCTAGGCACCAB-actin R: TTGGCCTTAGGGTTCAGGGGGNodal F: TTCAAGCCTGTTGGGCTCTACNodal R: TCCGGTCACGTCCACATCTTMash1 F: CCACGGTCTTTGCTTCTGTTTMash1 R: TGGGGATGGCAGTTGTAAGAGfap F: AAAACCGCATCACCATTCCTGfap R: ACGTCCTTGTGCTCCTGCTTDcx F: GGCCAAGAGTTTCTGCCAAGDcx R: TAATGCAGGGATCAGGGACANest F: ATGGGAGGATGGAGAATGGANest R: GTGCCAGAGGGGCAGTTTCTChx10 F: AAGGAGCCATGTTGGACTGAAChx10 R: GCCTGGGAATACAGGAGCAGSox2 F: CTAGACTCCGGGCGATGAAASox2 R: TGCCTTAAACAAGACCACGAAAOtx2 F: GGTCCATCAACCAGCAACCTOtx2 R: ACACCGGATCACCTCTGCTTPax 6 F: GAGAAATGGCGGTTAGAAGCAPax 6 R: CAACCACATGAGCAACACAGAMitf F: GATGGACGATGCCCTCTCACMitf R: CTGGGCTACTGATAAAGCACGAAmGluR6 F: CCGTGAATTGTCTTGTTGCTGmGluR6 R: CCACCTTTCATGTTGGTGCTCnga1 F: TTGGGAGAAAGAGTCGTCTGGCnga1 R: GAACATCGGTGGGGAAGAAACrx F: CTCCAGACACACCAGGAAAGGCrx R: GTGGGAGTGCAACAGGGTTT

Nrl F: CAGCAGTTGATTGTTTGCCTAATCNrl R: TGAGACCTGGAGGACAGCTACARecov F: CAGAAAAGCGGGCTGAGAAGRecov R: TTACCCAGCAATCCCCAAAGRho F: TGTGGGGACAAACAGTCCAGRho R: GGCTCCATCCCATTCTTTTG

Q-PCR HPLC purified primersQactin F: CCACCATGTACCCAGGCATTQactin R: ACAGTGAGGCCAGGATGGAGQNrl F: ATGCAAGTGGATTGGAGGAGQNrl R: CATGGCAACTGTGAGACCTGQCrx F: TCTTCCGTAAAGGTGCTGAGAQCrx R: TGCTGGGATTATGACCATTGAQRho F: CTGAGGGCATGCAATGTTCAQRho R: CATAGCAGAAGAAGATGACG


YEXER5575_proof ■ 21 July 2010 ■ 4/14


371372373374375376377378379380381382383384385386387388389390391392393394395396397398399400401402403404405406407408409410411412413414415416417418419420421422423424425426427428429430431432433434435

436437438439440441442443444445446447448449450451452453454455456457458459460461462463464465466467468469470471472473474475476477478479480481482483484485486487488489490491492493494495496497498499500

manufacturer’s protocol. Q-PCRs were carried out using either RNAor DNA with the appropriate one step or two step QuantiTect kits(Qiagen) as described previously (O’Reilly et al., 2007). Slopes wereobtained for all Q-PCR primers used with respect to beta-actin. Allwere <0.1; allowing use of the DDCt method to calculate foldchanges.

2.8. Immunocytochemistry

Cells were allowed to attach to poly-L-lysine and laminin coated10e13 mm diameter cover slips placed in 12 or 24 well tissueculture plates, in growth medium. For differentiated cells, differ-entiation medium was applied after 24 h, followed after 5 days byfinal differentiationmedium, for a further 5 days. Cells were treatedwith 4% PFA for 10 min, rinsed with 1� PBS 4 times, then treatedwith blocking solution (0.1% Triton, 10% donkey serum, 1% BSA) for15 min. Primary antibodies GFAP (1/1000 dilution, Sigma), nestin,(1/100 dilution, DSHB), b-III-tubulin (1/4000 dilution, Convance Q),Pax6 (1/500 dilution, Convance), glutamine synthetase (1/250, BDBiosciences), rhodopsin (1/100, Chemicon) and synaptophysin(1/300, Sigma) were added at the stated dilutions for 30e60 min atroom temperature. 3 washes of 1� PBS were carried out, followedby one of 3% BSA. Secondary antibody (1/100e1/1000 Cy3 anti-mouse, Cy3 anti-rabbit, Cy2 anti-mouse as appropriate, JacksonImmuno-Research) was then applied for 1 h. 2� washes of 1� PBS,1 wash of 1� PBSþDAPI and a final 1� PBS wash were then carriedout. Slides were inverted on poly-L-lysine coated slides usingAquaPolyMount (PolySciences), dried at 4 �C overnight and pho-tographed on a fluorescent microscope (Zeiss, Axioplan 2).

3. Results

3.1. FACS analysis and transplantation

In order to investigate the identity of cells that can integrate andgive rise to photoreceptors, we used FACS sorting with primaryretinal cells from Rho-eGFP mice. Rhodopsin expressing, eGFP-positive cells from PN3e5 Rho-eGFP donor mice were separatedfrom non-rhodopsin expressing, eGFP-negative PN3e5 Rho-eGFPcells from the same retinas, using FACS. PN3e5 cells expressingrhodopsin were then transplanted into 2e6 month old C57Bl/6Jrecipients separately from FACS sorted Rho-eGFP cells notexpressing rhodopsin. Animals were sacrificed after 3 months,longer than the 2e4 week intervals used in previous studies, inorder to assess long-term graft survival. NOTE: It is possible tocount eGFP-positive photoreceptors following transplantation fromthe Rho-eGFP-negative pool, despite the fact that re-analysis of theFACS pool immediately post-sorting indicates that it is indeed 99%negative. The presence of positive cells in the recipient retina 3



YEXER5575_proof ■ 21 July 2010 ■ 5/14

501502503504505506507508509510511512513514515516517518519520521522523524525526527528529530531532533534535536537538539540541542543544545546547548549550551552553554555556557558559560561562563564565

566567568569570571572573574575576577578579580581582583584585586587588589590591

months later occurs as a result of the fact that rhodopsin isincreasingly expressed in rod photoreceptors as rod cells mature.We have found that some cells that were Rho-eGFP negative at thepoint of FACS analysis at PN3e5 go on to express rhodopsin later(and therefore also the Rho-eGFP fusion protein). These can then bevisualized when counting. Indeed, the purpose of this experimentwas to determine whether the Rho-eGFP-positive cells that end upwith photoreceptor morphology post-transplantation were pre-specified as rods (and therefore Rho-eGFPþve) at PN3e5 orwhether the rod specification came later, after transplantation ofcells that were Rho-eGFP negative at the point of FACS sorting, butbecame Rho-eGFP positive after transplantation. Our findingsindicate the former to be the case, but not exclusively so; some Rho-eGFP-positive photoreceptor morphology is obtained after trans-plantation of cells that are Rho-eGFP negative at PN3e5.

At both PN3 and PN5, Rho-eGFP positive, sorted cells integratedat a higher frequency than Rho-eGFP-negative sorted cells and thisdifference was more significant in PN5 cells than PN3. t-Tests gavevalues of p¼ 0.165 for PN3, p¼ 0.050 for PN5, and p¼ 0.014 forboth data sets combined (Fig. 1). Integration rates are lower thanthe 0.6% value reported previously (MacLaren et al., 2006; Bartschet al., 2008), probably as a result of negative impacts on cellsurvival of harsh enzymatic digestion followed by FACS analysis, orthe longer period of time elapsed between injection and sacrifice.We conclude that rhodopsin expression is a marker of the ability ofprimary retinal cells to form photoreceptors post-transplantation.

592593594595596597598599600601602603604605606607608609610611

3.2. Transplantation of cultured RPCs

In contrast, transplantation of cultured RPCs resulted in lowerpercentages of integrated cells and no photoreceptor morphology.Multiple injections of proliferating and differentiated RPCs, passages1e3, derived from PN2e5 eGFP transgenic mice, were transplantedinto 2e6month old C57Bl/6J recipients. We used lower passage cellsas there is evidence that karyotypic instability can occur in neonatalRPCs after passage 9 (Djojosubroto et al., 2009). Transplanted RPCssurvived in the retina at a rate of 0.022%, while integrated cells wereonly 0.005% of cells transplanted initially. None gave photoreceptormorphology (Fig. 1). This contrasts with approximately 0.2% cellswith photoreceptor morphology for freshly dissociated retinal cells(see Fig. 1A, B). No consistent differences in survival or integrationrates betweenproliferating and differentiated RPCswere noted; bothwere uniformly low. Integration occurs primarily in the inner plexi-form and ganglion cell layers; a majority of integrated cells are GFAPpositive (Fig. 1CeE).

612613614615616617618619620621622623624625626627628629630

3.3. Optimisation of cell culture conditions

Previous protocols resulted in high cell death rates in the firstfew days following initial plating of dissociated cells. In order toobtain confluent cells from RPCs within 3e4 weeks, platingdensities of 1e2�105 cells/cm2 had been used (2.5e5 million cellsper T25). Existing protocols recommend the digestion of retinas for10e20 min in trypsin, collagenase, hyaluronidase, kynerunic acid orcombinations thereof (Klassen et al., 2004; Canola et al., 2007). Thisresults in a single cell suspension, however, the effect on the cellsmay be excessively harsh, given the levels of cell death.

Previously we had incubated retinas with trypsin for 20min at37 �C, with addition of DNase1 after 5 min and trypsin inhibitor after20 min. Samples were triturated using a p1000 pipette, spun andresuspended in growth medium. This protocol yields a single cellsuspension and requires plating of a minimum 1�105 cells/cm2.Growth to 80e90% confluence takes a month, and at minimum celldensity, a majority of cultures do not survive.


We then tried 10� dilutions of Accutase and tissue cultureformulated trypsin/EDTA to digest the retinas for 5e10 min, followedby dissociation with a fire polished and narrowed borosilicate glasspipette. Some samples were dissociated mechanically without anyenzymatic digestion. Comparison of the numbers of resulting cellsgained by these methods gave a p value of 0.027, which underesti-mates the significance of this result; of 12 cultures plated using theold method, only 4 survived to be included in data processing. Allcultures plated using minimal digestion or mechanical dissociationalone survived (Fig. 2A). Furthermore, with optimized tissue cultureconditions (see below), plating densities of 100,000 cells per T25(4�103 cells/cm2) will reliably give rise to cultures within 10e20days (Fig. 2B). Growth times from initial plating to 80e90% conflu-ence varied between 19.3 days for 100,000 cells to 10.75 days for 1.5million cells per T25. Differences in the rate of cell division caused byinitial cell density are not statistically significant.

We also tested the growth rates of RPCs derived from differentmouse strains (Fig. 2C), in order to verify that the cells being trans-planted (eGFP, Rho-eGFP) did not behave differently from wild-typecells. We tested rhodopsin knockout derived PN3e4 cells (Rho�/�,Humphries et al., 1997), to determine whether lower percentages ofphotoreceptor precursors would influence growth rates; photore-ceptors in these mice start to degenerate from birth. Differences inthe rate of cell division (increase in cell #/day) caused by straindifference, genetic modification or the presence of eGFP are notstatistically significant. Notably, RPC growth is not influenced by theabsence of functional rhodopsin expression, since rhodopsinknockout cells grew at indistinguishable rates from wild type.

3.4. Cell culture media and supplements

Initial protocols used DMEM/F12 medium with 1% pen-icillinestreptomycin and L-glutamine, supplemented with N2, FGF2,EGF and heparin. We decided to test the effect of replacing N2supplement with B27 supplement, or B27 minus Vitamin A (alsoknown as retinoic acid, RA). RA is a potent morphogen and is used toeffect neural differentiation in ES cells (Bain et al., 1995). Derivativesof RA (all-trans-retinol and 11-cis-retinal) are vital components inthe visual transduction cycle. We reasoned that B27� RA mightbetter support proliferation of stem cells and prevent differentiation,allowing better growth in culture.We also tested the addition of fetalcalf serum (FCS), which is known to bias neural stem cells towardsa glial cell fate, but which often promotes cell survival. Finally,DMEM/F12 was replaced variously with neurobasal medium, post-natal neural stem cell medium or embryonic neural stem cellmedium (Sigma). In each case, mediawere supplementedwith N2 orB27, with EGF, FGF2 and heparin as usual (Fig. 2D).

Postnatal and embryonic stem cell media did not support thegrowth of RPCs. Neurobasal medium permitted growth, but ata slower rate thanwithDMEM/F12. In terms of increased survival andgrowth, DMEM/F12 with B27� RAwere by far the best combination(N2 vs B27� RA; p¼ 0.0062). Predictably, B27þ RA slowed growthin comparison to N2 supplemented media and increased the likeli-hood of spontaneous differentiation. Addition of FCS caused a rapidmorphological transition such that flat fibroblast type cells wereobserved after a number of days; subsequent passages resulted ina decrease in cell number. We also tested various combinations ofN2B27, N2B27� RA, and N2B27 where BSA had been omitted fromthe N2 supplement. None were superior to B27� RA alone.

3.5. Cell attachment

Wetested the influence of cell attachmenton growth.Neural stemcells can be grown as neurospheres, which contain mixtures ofdifferentiated and undifferentiated cells. However, RPCs show


Fig. 1. Transplantation. (A) Cell integration and survival rates, 3 months post-transplantation (FACS sorted Rho-eGFP derived photoreceptors, columns 1e6 and cultured eGFP RPCs,column 7). Cells counted 3 months post-transplantation. Rho-eGFP cells that were eGFP positive at the point of FACS analysis (PN3e5, columns 4e6), show a higher integration ratethan Rho-eGFP cells that were eGFP negative at the point of FACS analysis (columns 1e3). Counts were obtained from transplantation of Rho-eGFP cells that were eGFP negative atthe point of FACS sorting, but began to express rhodopsin, and therefore the eGFP fusion protein, subsequently. The number of integrated cells is expressed as a percentage of thoseinjected. For comparison, an integration rate is also given for transplanted cultured RPCs, but in the case of RPCs, none integrated as photoreceptors (Column 7, grey). (B) PrimaryeGFP mouse retinal cells transplanted into adult C57Bl6/J wild-type mouse retina. (CeE) Integrated cells derived from RPCs. C and D were photographed at the same magnificationas B. E (higher magnification) shows integrated cells counterstained with GFAP after counting. (FeI) FACS sorting of C57Bl6/J and Rho-eGFP cells, days 1 and 4. Note shift in Rho-eGFP expression at day 4 in comparison to day 1, denoting upregulation of rhodopsin (and therefore eGFP) expression.


YEXER5575_proof ■ 21 July 2010 ■ 6/14

631632633634635636637638639640641642643644645646647648649650651652653654655656657658659660661662663664665666667668669670671672673674675676677678679680681682683684685686687688689690691692693694695

696697698699700701702703704705706707708709710711712713714715716717718719720721722723724725726727728729730731732733734735736737738739740741742743744745746747748749750751752753754755756757758759760

a strong preference for attachment to tissue culture flasks and eventend to attach to bacterial Petri-dishes. Concern was expressed thatattached cells may be biased towards a glial lineage and growth asa monolayer may preclude the culture of photoreceptor precursors.We therefore tried to establish “retinospheres” in culture in ultra-low


attachment plates (Corning). To encourage initial sphere formation,we used mechanical dissociation alone to disrupt the cells and leftthem in larger clumps than is typical. While the cells could be grownas spheres using these methods, cell numbers declined over time,indicating that cell renewal is not adequately supported under these


Effects of Substrate on RPC Proliferation

Unctaoed

,-72B

AR

nUc

taoe

2N,dNF LLP

LDP PNRO GEL

LMA VN LLOC

MAL+NF F

LDP+N

NF+LLOC ALM

LLP+L

LEG+MA

0.0×10-00

2.5×1005

5.0×1005

7.5×1005

1.0×1006

1.3×1006

1.5×1006mean p0mean p1mean p2

ll

eC

ni

es

ae

rc

nI

ya

Dr

ep

re

bm

uN

Effects of Mouse Strain

on RPC Proliferation

c57 eGFP rho-eGFP Rho -/-0.0×10 -00

2.0×10 05

4.0×10 05

6.0×10 05

8.0×10 05

1.0×10 06

1.2×10 06Passage 0

Passage 1

Passage 2

Mouse Strain of Origin

lle

Cni

es

ae

rc

nI

ya

Dr

ep

re

bm

uN

Effect of Initial Cell Seeding

Density on RPC Proliferation

0 1 20.0×10

2.0×10

4.0×10

6.0×10

8.0×10

1.0×10

1.2×10

1.4×10

1.6×101 x 105

2.5 x 105

0.5 x 106

1 x 106

1.5 x 106

Passage Number

ya

Dr

ep

re

bm

uN

lle

Cni

es

ae

rc

nI

Effects of Dissociation

Method on RPC Proliferation

Old

ohteM

d

yrTspin/

ETDA

Ac

esatuc

Me

cinahc

al

taicossiD

ion-50000

0

50000

100000

150000

lle

Cni

es

ae

rc

nI

ya

Dr

ep

re

bm

uN

A CB

Effects of Medium Composition on RPC Proliferation

R+72B

A AR-72B

2N AR+72B2N N22B7

AR-

N2B27 R-

ASB-A 2B,BN

7AR-

B72

R-A +

%1FCS

B

AR-72

+

SCF%5

N2 +%1

SCF

N5+2%

FCS

0.0×10-001.0×10052.0×10053.0×10054.0×10055.0×10056.0×10057.0×1005 mean p0

mean p1mean p2

Ie

sa

er

cn

in

Ce

ll y

aD

re

pr

eb

mu

N

D

E

Fig. 2. Effects of protocol improvements and mouse strain of origin on survival and growth rates of proliferating RPCs.(A) Effects of dissociation method on RPC growth rate. 4�104 cells/cm2 were plated per T25 flask, cells were grown to 80e90% confluence. The increase in cell number per day wascalculated as follows: (final cell #� initial cell #)/# days between plating and passaging. (B) Influence of initial cell plating density on RPC growth. Cells were grown using optimizedculture conditions and plated on FN-coated flasks. Growth times from initial plating to 80e90% confluence were calculated as in A above. (C) Influence of mouse strain on RPCgrowth. RPCs were derived fromwild type (C57Bl6/J), eGFP transgenic mice (for routine transplantation of RPCs), Rho-eGFP knock-in mice (FACS and transplantation) and rhodopsinknockout mice (rho�/�) There are no statistically significant differences between wild-type derived RPCs and those from any of the other strains. This means that they canlegitimately be used interchangeably (t-tests; C57 vs eGFP,p0, p¼ 0.39, C57 vs Rho-eGFP, p0, p¼ 0.20, C57 vs Rho�/�, p0, p¼ 0.11). (D) Effects of different combinations of mediaand growth supplements on increase in cell number per day. p¼ passage number; effects for p0, p1 and p2 cells are given. Cells were harvested and counted once 80e90%confluence was achieved; in the case of p0, this typically took 10e20 days from initial plating. Intervals from plating to confluence were typically 3e7 days in subsequent passages.Growth medium¼DMEM/F12 (Sigma), unless otherwise stated. NB¼ neurobasal medium. FCS¼ fetal calf serum, N2, B27 and B27� RA are media supplements. N2B27¼N2þ B27supplement. N2B27� RA¼N2þ B27� RA. N2B27� RA� BSA¼N2 without BSA and B27� RA. All samples were grown in the presence of FGF2, EGF and heparin. Note maintenanceof higher growth rate with B27� RA beyond p0. (E) Influence of cell substrate on RPC growth. Untreated¼ Sarstedt T25 flasks with no further coatings applied. N2¼ untreatedflasks where RPCs were grown with N2 (all other samples in this graph were grown supplemented with B27� RA). Fn¼ fibronectin, pll¼ poly-L-lysine, pdl¼ poly-D-lysine,porn¼ poly-L-ornithine, gel¼ gelatin, lam¼ laminin, Vn¼ vitronectin, coll¼ collagen.


YEXER5575_proof ■ 21 July 2010 ■ 7/14

Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despiteimprovements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003

761762763764765766767768769770771772773774775776777778779780781782783784785786787788789790791792793794795796797798799800801802803804805806807808809810811812813814815816817818819820821822823824825

826827828829830831832833834835836837838839840841842843844845846847848849850851852853854855856857858859860861862863864865866867868869870871872873874875876877878879880881882883884885886887888889890

Effects of Medium Composition on

Rhodopsin Expression Levels

72B

0pAR+

0pAR-72B

0p2N FNp0 0p

MAL

0pLEGNROP

0p

NB,72B-

pAR0

72B-

0pSCF%1+AR

0pSCF%5+AR-72B

0.000

0.005

0.010

0.015

tr

we

gn

ah

Cdl

oF

ani

te

R4

NP

Effects of Differentiation on

Rho mRNA Levels

gnitarefilorP

D

nereffi

t

yaD5(gnitai

s

)FGE-noitaitnereffiDlaniF

0.00

0.05

0.10

0.15

eg

na

hC

dl

oF

an

it

eR

4N

Pt

rw

B

A

Fig. 3. Real-time Q-PCR of rhodopsin levels in selected RPC cultures.(A) Rho mRNA levels in selected proliferating RPC cultures once confluent (p0; 10e20days post-plating). Fold change is expressed with respect to (wrt) Rho expressionlevels obtained from PN4 retina (PN4 retina¼ 1). Selected samples are shown above;Q-PCR readings for all varying growth conditions tested were obtained (see Figs. 2e4),for passage (p) 0e2 in each case. Only p0 is shown here; levels of Rho decline furtherthereafter in subsequent passages. p0¼ initial growth period from plating to conflu-ence, mRNA samples taken at confluence, typically 10e20 days post-plating. B27 andN2 are media supplements, �RA orþ RA denotes the presence or absence of retinoicacid in the B27 supplement, FCS¼ fetal calf serum, NB¼ neurobasal medium, usedinstead of the default DMEM/F12 in one case above. Fn¼ fibronectin, lam¼ laminin,gel¼ gelatine, porn¼ poly-L-ornithine. (B) Comparison of Rho mRNA levels in prolif-erating, differentiating and finally differentiated RPCs, passage 1. No significantdifferences in Rho levels were noted between proliferating and differentiated cells.Some differences in Rho expression levels were noted between sets of experimentalrepeats carried out at different times (note difference between B27� RA and prolif-erating in graphs A and B). Values graphed here are skewed upwards as PCRs showingno rhodopsin expression at all could not be included in calculations.


YEXER5575_proof ■ 21 July 2010 ■ 8/14

891892893894895896897898899900901902903904905906907908909910911912913914915916917918919920921922923924925926927928929930931932933934935936937938939940941942943944945946947948949950951952953954955

956957958959960961962963964965966967968969970971972973974975976977978979980981982983984985986987988989990991992993994995996997998999

100010011002100310041005100610071008100910101011101210131014101510161017101810191020

conditions. Growth of retinospheres was tested with a number ofdifferentmedia and supplements. No combination gave rise to robustproliferation; plating of single cell suspensions resulted in cell death.

We tested the influence of substrate on monolayer growth. Cellswere grown in optimized RPC growth medium, in uncoated T25flasks and in those coated with one of the following; poly-L-lysine(PLL), poly-D-lysine (PDL), poly-L-ornithine (PORN), gelatin (GEL),laminin (LAM), fibronectin (FN), vitronectin (VN) and collagen(COLL) (Fig. 2E). Fibronectin provided the best growth advantage atp0 (B27� RA vs fnþ B27� RA; p¼ 0.001; N2 vs fnþ B27� RA;p¼ 0.0009), but this was only significant between initial platingand passage 0 (p0). Fibronectin solutions could only be reuseda maximum of 3 times, before efficacy diminished.

3.6. Real-time Q-PCR, immunohistochemistry, and use of Rho-eGFPtransgenic cells to track rhodopsin expression

Using improved growth conditions, we used real-time Q-PCR tocompare rhodopsin levels in cells grown under conditions outlinedabove, with those grown using older methods. All conditions weretested; a selection of results is shown in Fig. 3. Rhodopsin levelsdropped dramatically when comparing fresh retinal tissue withpassage 0 confluent plates (which had undergone 10e20 daysgrowth post-isolation to reach confluence); furthermore,rhodopsin levels dropped again in subsequent passages, often toundetectable levels. This drop was so dramatic that we had toanalyse results using the DDCt method; standard curves did notencompass the wide range of rhodopsin levels detected. This dropwas noted in “retinosphere” cultures (results not shown), prolif-erating adherent RPCs, and cells differentiated in vitro. Notably, thepresence of retinoic acid in B27 supplement (B27þ RA, Fig. 3A) didnot stimulate rhodopsin expression, despite prior evidence that RAcan do this in both dissociated retinal cells, retinal explantsculturedwithout the RPE, and differentiatingmouse ES cell cultures(Soederpalm et al., 2000; Osakada et al., 2008).

We then studied rhodopsin levels in the days immediately afterplacing the cells in culture. Dramatic reductions in rhodopsinexpression levels were detected shortly after initial plating. Weplated cells at a density of 2e6�104 cells/cm2 on fibronectin-coatedT25 flasks. We harvested the cells on days 1e3, 4e6, 6e9, 9e12, and12-confluence. Cells were counted, their RNA extracted andrhodopsin levels determined by real-time Q-PCR. We also platedtransgenic Rho-eGFP cells on poly-L-lysine and fibronectin-coatedglass slips and tracked the reduction in rhodopsin levels via Rho-eGFPfluorescence (Fig. 4) and separately, via immunohistochemistry, atthe intervals stated above. Cell counts indicated an initial dramaticdrop in the number of eGFP-positive cells, followed by the slowgrowth of eGFP-negative cells to confluence fromday 3 to day 10e20.Q-PCR, counting of Rho-eGFP-positive transgenic cells and immu-nohistochemistryall separately indicate that rhodopsin-positive cellsare largely lost from the cultures over the first 3 days (Fig. 4). More-over, rhodopsin-positive rod precursors were not necessary forestablishment of healthy RPC cultures; RPCs from Rho�/� mice hadgrowth rates indistinguishable fromwild-type cells (Fig. 2C).

3.7. Gene expression profiles

We used RT-PCR and immunocytochemistry to further charac-terize RPCs. Previous studies have suggested some ganglion cellpotential post-transplantation (Canola et al., 2007) or suggested thatRPCs are radial/Mueller glia. We amplified RNA from PN3e5 retinasand passage 0e2 RPCs derived from C57Bl6/J, Rho-eGFP, EGFP andRho�/� mice (Fig. 5). While differences between whole retinas andRPCsweredramatic,within theRPC samples, passagenumber,mousestrain of origin, presence/absence of eGFP and the developmental


stage of isolation (PN3e5) had no consistent effect (Fig. 5). Genesassociated with photoreceptor differentiation (rhodopsin, recoverin,Cnga1, Nrl, Crx, N2re3) were downregulated in RPCs. Similarly, genesassociated with ganglion cells (Chd5, Islet1, Atoh7) were alsodownregulated, with the exception of Thy1. Some genes associatedwith eye specification (Pax6, Otx, Chx10) and neurotransmission(Th, ChAT)were also downregulated. Notably, Mitf, Gad1 and Gabbr1remained at similar levels to those seen in retinal samples. Genesassociated with neural stem cells (nestin, sox2, mash1) and cell cycleassociated genes such as Ki67 and Ccd1 were upregulated in RPCs,particularly in later passages. Gfap, the signaturemarker of glial cells,was expressed at similar levels in retina and in RPCs.

3.8. Cell morphology and immunocytochemistry

RPCs form a characteristic fusiform morphology, indicative ofneural progenitors, after approximately 1 week in culture; this ismaintained in subsequent passages (Fig. 6A). Despite plating of


Fig. 4. Decreasing Rho mRNA and protein levels in proliferating RPCs after initial dissociation and plating. A) Cell counts taken at daily intervals following initial plating of 1�106

cells per T25. There is a dramatic decrease in cell number in the initial 3 days, followed by a gradual increase in cell number as surviving cells attach and divide. B) Real-timerhodopsin Q-PCR of samples taken at daily intervals post-plating of 1�106 cells per T25. Rho mRNA levels drop dramatically in the first 2 days. C) Levels of Rho protein levelsassessed from counting of DAPI-stained transgenic Rho-eGFP cells that were still expressing eGFP, expressed as a % of the total Dapi-stained cells present at daily intervalspost-plating (unbroken line). Cells were also counterstained using antibodies against rhodopsin (Chemicon MAB5356), labelled with Cy3 (short dashed line). Combined results fromRho-eGFP, eGFPþve and rho-immunocytochemistry are also presented (long dashed line). D). Photomicrograph of DAPI-stained Rho-eGFP cells, 1 day post-plating, E¼DAPI-stainedRho-eGFP cells, 7 days post-plating. F¼DAPI-stained Rho-eGFP cells, 10 days post-plating, G¼DAPI-stained Rho-eGFP cells, 15 days post-plating (80e90% confluent). Note greeneGFP-positive cells in the middle of the Rho-eGFP cell clumps 24 h after plating (D), which disappear by 7 days and do not re-appear subsequently (EeG).


YEXER5575_proof ■ 21 July 2010 ■ 9/14

10211022102310241025102610271028102910301031103210331034103510361037103810391040104110421043104410451046104710481049105010511052105310541055105610571058105910601061106210631064106510661067106810691070107110721073107410751076107710781079108010811082108310841085

10861087108810891090109110921093109410951096109710981099110011011102110311041105110611071108110911101111111211131114111511161117111811191120112111221123112411251126112711281129113011311132113311341135113611371138113911401141114211431144114511461147114811491150

retinal cells, many of which have already adopted differing cellfates, the uniform morphology would indicate that tissue cultureconditions select for a single cell type. Notably, we have beensuccessful in isolating RPCs from ages E14.5 to postnatal day 46inclusive (results not shown). The morphology of cultured cellsdoes not vary according to the developmental age from which thecells were derived, although RPCs proliferate a lot more slowlyinitially when isolated after PN6. Cells grow faster between initialplating and first passage if plated on fibronectin, where a slightlyflatter morphology is noted (Fig. 6B). Cells can survive as “retino-spheres”, however, cell numbers decline with time, indicative ofa failure to proliferate and/or higher rates of cell death (Fig. 6C).Staining of proliferating cells (Fig. 6DeL) showed low staining forb-III-tubulin (6D) and Gfap (6E) and stronger staining with Pax6,nestin and glutamine synthetase (6FeH). RDS/peripherin andrhodopsin antibodies (6I, J) are negative, similarly, Rho-eGFPderived RPCs (6K) are usually eGFP negative, but staining of theoccasional cell is sometimes seen in some cultures, correlating withPCR results (Fig. 5). Differentiated RPCs show strong glutaminesynthetase staining (6Q) and strong staining of some, but not all,cells for B-TubIII (6M), and Gfap (6N). Addition of 1% serum duringfinal differentiation results in 80e90% Gfap staining (6T).


Differentiated RPCs show negligible staining for Rds/peripherin,Rho (6R,S) and synaptophysin (not shown); current differentiationmethods do not favour photoreceptor or photoreceptor precursorformation.

4. Discussion

FACS analysis and subsequent transplantation indicate thatrhodopsin is a goodmarker for integration potential and generationof morphologically mature photoreceptors post-transplantation.These data also support the conclusion that integrating cells withphotoreceptor morphology, derived from fresh retinal material, arepost-mitotic; rhodopsin is a tightly regulated gene that is onlyexpressed in maturing rod photoreceptors and has been used asa marker of terminal rod differentiation (Humphries et al., 1997).Some rhodopsin-negative cells do integrate; the likelihood is thatthese are photoreceptor precursors that have just been specified,are not yet expressing enough rhodopsin to be sorted as positives,but increase expression of the Rho-eGFP reporter transgene aftertransplantation. FACS also does not give 100% pure separation;negatives are typically 99% pure while positives are only 80e90%positive.



YEXER5575_proof ■ 21 July 2010 ■ 10/14

Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despiteimprovements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003

11511152115311541155115611571158115911601161116211631164116511661167116811691170117111721173117411751176117711781179118011811182118311841185118611871188118911901191119211931194119511961197119811991200120112021203120412051206120712081209121012111212121312141215

12161217121812191220122112221223122412251226122712281229123012311232123312341235123612371238123912401241124212431244124512461247124812491250125112521253125412551256125712581259126012611262126312641265126612671268126912701271127212731274127512761277127812791280


YEXER5575_proof ■ 21 July 2010 ■ 11/14

12811282128312841285128612871288128912901291129212931294129512961297129812991300130113021303130413051306130713081309131013111312131313141315131613171318131913201321132213231324132513261327132813291330133113321333133413351336133713381339134013411342134313441345

1346134713481349135013511352135313541355135613571358135913601361136213631364136513661367136813691370137113721373137413751376137713781379138013811382138313841385138613871388138913901391139213931394139513961397139813991400140114021403

Expansion of RPCs in culture eliminates photoreceptormorphology after transplantation. This could occur for a number ofreasons hypothetically: the photoreceptor precursors might undergocell death, the post-mitotic nature of the cells might mean that theyare “diluted out” of the cultures as other cells divide, or their cell fatemight be altered by the tissue culture environment.We succeeded inimproving survival and/or growth rate of RPCs in culture 25-fold,however, photoreceptor precursors are still lost shortly after plating.Using cell counts, real-time Q-PCR, semi-quantitative PCR, immu-nohistochemistry and tracking of reporter expressing Rho-eGFPtransgenic cells in the days after plating, we note that sharp reduc-tions in cell numbers within the first 3 days post-plating coincidewith loss of rhodopsin expression, while culture conditions thatpromote slower RPC growth do not contain higher proportions ofrhodopsin-positive cells. We conclude therefore that the mechanismfor the loss of photoreceptor precursors from cell culture is cell deathin the first 3 days after introduction of the cells to tissue culture, nottransdifferentiation or dilution.

As previously hypothesized (MacLaren et al., 2006; West et al.,2009), photoreceptor precursors are post-mitotic, cannot adapt totissue culture conditions and are dying shortly after plating. Thisconclusion is supported by separate culturing of FACS sorted Rho-eGFP positive and negative cells (results not shown). Negative cells(99% pure) establish more easily in culture than positives (80e90%pure). However, once cultures are established, morphology ofpositive and negative cultures is identical, and rhodopsin levels arelow to non-existent, as is typical for RPCs derived from unsortedcells. Notably, less severe dissociation conditions do not improverhodopsin levels at p0, suggesting that the problem is not merelyone of fragility. There is an interesting shift in cell behaviourbetween initial plating and establishment of the cells as prolifer-ating RPCs. Plating the cells as small clumps initially (small enoughto be counted, but not a single cell suspension), is the biggestcontributor to the increased survival rates noted in this study. Thesecells grow rapidly if plated at a reasonably low density(4�103 cells/cm2). We have also found that, where cells wereplated at too high a density initially, passage before day 10 results inan increased risk of cell death. However, after confluence is ach-ieved (10e20 days), use of 0.25% trypsin or 1� Accutase for 5 minand trituration with a 5 or 10 ml pipette will reliably generatea single cell suspension that can be replated at 4�103 cells/cm2 ormore without significant trauma to the cells. A process of adapta-tion to tissue culture conditions is obviously causing large changesin cellecell and cellesubstrate attachment behaviour.

Previous analyses considered the possibility that RPCs couldhave ganglion cell potential and/or represent immature radial/Mueller glia (Angénieux et al., 2006; Canola et al., 2007). RPCsmigrated to the ganglion cell layer and expressed ganglion cellmarkers when transplanted into models of RD (Canola et al., 2007).However, ganglion cells are amongst the first to have their cell fatedetermined, they are “born” during embryogenesis, while rods andMueller glia are locked into their respective cell fates during thefirst few days after birth (Andreazzoli, 2009; MacLaren et al., 2006).Mueller glia can regenerate the injured retina in fish, amphibiansand even to some extent in chick. They have a limited potential,even in mammals, to give rise to cells with some of the character-istics of retinal neurons (Andreazzoli, 2009; Karl et al., 2008).Furthermore, glial cells have the capacity in RD to proliferate,

Fig. 5. Semi-quantitative PCR analysis of gene expression profiles from freshly dissociated PPN3 C57Bl6/J mouse retinas at passages 0, 1 and 2 (p0, p1 and p2, middle right hand column)respectively. Three housekeeping genes are shown, giving equal levels of expression in all saroughly equal, they were also amplified by Q-PCR from the same samples; variation was indannealing temperature of 62 �C, cycle numbers are indicated beside the gene name.


possibly in an attempt to ameliorate some of the pathogenic effects,resulting in gliosis (West et al., 2009). Our transplantation resultsalso show RPC integration primarily in the inner plexiform andganglion cell layers (Fig. 1CeE), correlating with previous results. Amajority of cells are GFAP positive.

Results of RT-PCR and immunohistochemistry on a panel ofgenes indicate that products of terminally differentiated retinalcells, whether they are ganglion cells, other retinal neurons orphotoreceptors, are largely downregulated, as would be expectedin progenitor cells. GFAP, a glial marker, maintains expression levelsin culture similar to those seen in PN3e5 retina, but is not upre-gulated. Interestingly, markers of neural stem cells/progenitorssuch as nestin, Sox2 andMash1 are upregulated slightly, along withcell cycle markers such as Ccd1 and Ki67.

While we cannot rule out glial identity, it is also possible thatRPCs represent a pool of retinal progenitors, which are capable ofestablishing themselves in culture. It may be the case that buildinga retina occurs from a pool of unspecified stem cells, according topositioning within the retina and mechanical cues provided by theintercellular matrix and cellecell junctions (Andreazzoli, 2009).Removing cells from this structure may allow the division andestablishment in culture of only those that are not yet specified.Without the correct mechanical stimuli or positional cues, it may bedifficult to specify the desired cell fate in these cells. However, theymay yet be shown to be capable of generating the desired retinalcell types, given correct mechanical cues or as yet unidentifiedsignals. Interestingly, the more robust cell growth achieved byprotocol changes described in this paper may assist in resolvingsome of the differing results obtained with RPCs to date. We havenoted that sub-optimally isolated RPCs go through a slow growinginitial stage in which it is obvious morphologically that somedifferentiation has occurred. Optimization of the culture conditionsensures that this no longer occurs, allowing, possibly, moreconsistent gene expression results to be obtained from differentisolates of RPCs. This may in turn resolve the question of whetherdifferences in potential between embryonic and postnatally iso-lated RPCs actually exist (Yang, 2004).

RPCs are certainly capable of generating abundant glial cells ifallowed to differentiate via sequential withdrawal of growth factorsand application of 1% FCS in B27þ RA containing media. This doesnot by itself indicate that these cells are solely glial precursorsthough, just that we can positively influence glial differentiation.Even after treatment with FCS, some beta-III-tubulin positive, GFAPnegative cells remain (Fig. 6T). Some migration of RPCs to theganglion cell layer after transplantation may perhaps indicatea degree of neuronal multipotentiality (Canola et al., 2007, Fig. 1D, E).Investigation of these cells in treatment of retinal disorders such asLHON or glaucoma, where the defect does not reside within thephotoreceptor cell layer, might be warranted. Better differentiationprotocols with improved cell survival and further characterization ofresulting cell populations, in vitro and post-transplantation, wouldbe helpful in investigating the true potential of RPCs.

RPCs can be cultured from late embryonic stages until approxi-mately PN6, before they become more difficult (but not impossible)to grow. These cells probably represent an undifferentiated cell poolfrom which, in vivo, unknown mechanical, hormonal or positionalcues are used to sequentially differentiate thediverse cell types foundin adult retina. Notably, cells acquire a uniform morphology during

N3e5 retina (left hand column) and cultured proliferating RPCs originally derived from. p0¼ approx 10e20 days post-isolation, p1¼3e7 days after p0, p2¼ 3e7 days after p1mples. However, in order to check that levels of these housekeeping genes were indeedeed minimal (see Materials and methods). All amplifications were carried out using an


1404140514061407140814091410

Fig. 6. Live RPCs (AeC), antibody stained proliferating RPCs (DeL) and stained differentiated RPCs (MeU).Live cells: RPCs grown on tissue culture coated T25s alone (A), T25s coated with fibronectin (B), and spheres grown on low adherence plates are shown (C). Cells acquire char-acteristic (and uniform) morphology after 10e14 days in culture. This does not change during subsequent passaging.Immunocytochemistry: proliferating cells (red font: DeL) shownwere plated after 2e3 passages and stained after 3e4 days of growth on glass slips. Differentiated cells were platedin growth medium for 2 days, then differentiated for 10 days via sequential withdrawal of growth factors, before staining (see Materials and methods) (blue font, MeU).DeL: proliferating RPCs; beta-III-tubulin (D), GFAP (E), nestin (F), Pax6 (G), glutamine synthetase (H), rhodopsin (I), RDS/peripherin (J), Rho-eGFP cells showing rare eGFPþve cells(K), PBS control (L).MeU: beta-III-tubulin (M), GFAP (N), nestin (O), Pax6 (P), glutamine synthetase (Q), rhodopsin (R), RDS/peripherin (S), cells differentiated in the presence of 1% FCS, showing GFAP(red) and beta-III-tubulin (green) staining (T), PBS control (U).Rho-eGFP cells usually show no eGFP-positive cells, but very occasionally 1e2% are seen, correlating with real-time Q-PCR results, which show low to non-existent Rho levels (K).The majority of proliferating RPCs are nestin/Pax6 positive and following differentiation with 1% FCS are Gfap or b-III-tubulin positive. Differentiation without serum gives rise tolower percentages of glia (N). Nuclei are counterstained with DAPI.


YEXER5575_proof ■ 21 July 2010 ■ 12/14

14111412141314141415141614171418141914201421142214231424142514261427142814291430143114321433143414351436143714381439144014411442144314441445144614471448144914501451145214531454145514561457145814591460146114621463146414651466146714681469147014711472147314741475

14761477147814791480148114821483148414851486148714881489149014911492149314941495149614971498149915001501150215031504150515061507150815091510151115121513151415151516151715181519152015211522152315241525152615271528152915301531153215331534153515361537153815391540

the initial period of growth post-plating; this morphology does notchangewith subsequent passages, suggesting expansion of a uniformstem cell type. Photoreceptor precursor cells are a post-mitotic cellpopulationwithin the neonatal retinawhich are capable of becomingmature photoreceptors post-transplantation. These cells die offrapidly when placed in a tissue culture environment. This is prob-lematic, as therapeutic strategies for RD may need to focus onexpansion of undifferentiated progenitors (currently possible) andthen application of unidentified triggers in order to obtain photore-ceptor precursors. Differentiation of RPCs in vitro does not currentlyresult in significant increases in rhodopsin levels, but does give rise tohigh levels of cell death (which may indicate death of cells choosinga photoreceptor fate at the point of differentiation). In support of thispoint, attempts by this group to transfect various cell lines withrhodopsin in the past has not met with success; cells expressing thetransgene tend to die (S.M-W, unpublished results). Unless occurringin a very structured environment, rhodopsin expressionmay well bevery toxic to the cell.

We therefore need to identify the triggers that promote terminaldifferentiation of rod and cone photoreceptor cells in vivo. We may


then be able to adapt tissue culture protocols such that these newtriggers can be applied in vitro and the resulting cells can bepersuaded to survive for as long as it takes to inject them intoa recipient. Identification of the key points in retinal developmentwill require detailed analysis of the transcriptome and epigeneticstructure of differentiating retinal cells in vivo, in conjunction withfurther use of transgenics such as Crx-, Nrl- or Rho-eGFPmice, wherecells can be sorted prior to transplantation, microarray analysis orproteomics. Development of robust methods for photoreceptorspecification in vitro are likely to be useful in improving methods forES and iPS cell differentiation as well as RPCs.

Uncited references

Meshorer et al., 2006; Qiu et al., 2004.

Acknowledgements

This work was funded by Fighting Blindness Ireland (in collab-oration with the Fighting Blindness Vision Research Institute),


6

7


YEXER5575_proof ■ 21 July 2010 ■ 13/14

15411542154315441545154615471548154915501551155215531554155515561557155815591560156115621563156415651566156715681569157015711572157315741575157615771578157915801581158215831584158515861587158815891590159115921593159415951596159715981599160016011602160316041605

1606160716081609161016111612161316141615161616171618161916201621162216231624162516261627162816291630163116321633163416351636163716381639164016411642164316441645164616471648164916501651165216531654165516561657165816591660166116621663166416651666166716681669

Health Research Board Ireland (HRB), Science Foundation Ireland(SFI) and the Deutsche Forschungsgemeinschaft (DFG). We wouldlike to thank Dr. Alfonso Blanco of the Conway Institute, UCD, forassistance with FACS sorting, Chris Egan for use of CHD5 primersand Drs Matt Campbell and Michael Wride for constructivecomments with regard to this manuscript.

Appendix A. Supplementary data

Supplementary data associated with this article can be found inthe online version, at doi:10.1016/j.exer.2010.07.003.

References

Andreazzoli, M., 2009. Molecular regulation of vertebrate retina cell fate. BirthDefects Res. 87, 284e295.

Angénieux, B., Schorderet, D.F., Arsenijevic, Y., 2006. Epidermal growth factor isa neuronal differentiation factor for retinal stem cells in vitro. Stem Cells 24 (3),696e706.

Aoki, H., Hara, A., Niwa, M., Motohashi, T., Suzuki, T., Kunisada, T., 2008. Trans-plantation of cells from eye-like structures differentiated from ES cells in vitroand in vivo regeneration of retinal ganglion-like cells. Graefes Arch. Clin. Exp.Ophthalmol. 246 (2), 255e265.

Bain, G., Kitchens, D., Yao, M., Huettner, J.E., Gottlieb, D.I., 1995. Embryonic stemcells express neuronal properties in vitro. Dev. Biol. 168 (2), 342e357.

Bainbridge, J.W., Smith, A.J., Barker, S.S., Robbie, S., Henderson, R., Balaggan, K.,Viswanathan, A., Holder, G.E., Stockman, A., Tyler, N., Petersen-Jones, S.,Bhattacharya, S.S., Thrasher, A.J., Fitzke, F.W., Carter, B.J., Rubin, G.S., Morre, A.T.,Ali, R.R., 2008. Effect of gene therapy on visual function in Leber’s congenitalamaurosis. N. Engl. J. Med. 358 (21), 2231e2239.

Bartsch, U., Oriyakhel, W., Kenna, P.F., Linke, S., Richard, G., Petrowitz, B.,Humphries, P., Farrar, G.J., Ader, M., 2008. Retinal cells integrate into the outernuclear layer and differentiate into mature photoreceptors after subretinaltransplantation into adult mice. Exp. Eye Res. 86 (4), 691e700.

Canola, K., Angénieux, B., Tekaya, M., Quiambao, A., Naash, M.I., Munier, F.L.,Schorderet, D.F., Arsenijevic, Y., 2007. Retinal stem cells transplanted intomodels of late stages of retinitis pigmentosa preferentially adopt a glial ora retinal ganglion cell fate. Invest. Ophthalmol. Vis. Sci. 48 (1), 446e454.

Chacko, D.M., Rogers, J.A., Turner, J.E., Ahmad, I., 2000. Survival and differentiationof cultured retinal progenitors transplanted in the subretinal space of the rat.Biochem. Biophys. Res. Commun. 268, 842e846.

Chadderton,N.,Millington-Ward, S., Palfi, A., O’Reilly,M., Tuohy, G., Humphries,M.M.,Li, T., Humphries, P., Kenna, P.F., Farrar, G.J., 2009. Improved retinal function ina mouse model of dominant retinitis pigmentosa following AAV-delivered genetherapy. Mol. Ther. 17 (4), 593e599.

Chan, F., Bradley, A., Wensel, T.G., Wilson, J.H., 2004. Knock-in human rhodopsin-EGFP fusions as mouse models for human disease and targets for gene therapy.Proc. Natl. Acad. Sci. U.S.A. 101 (24), 9109e9114.

Cicero, S.A., Johnson, D., Reyntjens, S., Frase, S., Connell, S., Chow, L.M., Baker, S.J.,Sorrentino, B.P., Dyer, M.A., et al., 2009. Cells previously identified as retinalstem cells are pigmented ciliary epithelial cells. Proc. Natl. Acad. Sci. U.S.A. 106(16), 6685e6690.

Cideciyan, A.V., Aleman, T.S., Boye, S.L., Schwatrz, S.B., Kaushal, S., Roman, A.J.,Pang, J.J., Sumaroka, A., Windsor, E.A., Wilson, J.M., Flotte, T.R., Fishman, G.A.,Heon, E., Stone, E.M., Byrne, B.J., Jacobson, S.G., Hauswirth, W.W., 2008. Humangene therapy for RPE65 isomerase deficiency activates the retinoid cycle ofvision but with slow rod kinetics. Proc. Natl. Acad. Sci. U.S.A. 105 (39),15112e15117.

Coles, B.L., Angénieux, B., Inoue, T., Del Rio-Tsonis, K., Spence, J.R., McInnes, R.R.,Arsenijevic, Y., van der Kooy, D., 2004. Facile isolation and the characterizationof human retinal stem cells. Proc. Natl. Acad. Sci. U.S.A. 101 (44), 15772e15777.

Das, A.V., James, J., Rahnenführer, J., Thoreson, W.B., Bhattacharya, S., Zhao, X.,Ahmad, I., 2005. Retinal properties and potential of the adult mammalian ciliaryepithelium stem cells. Vision Res. 45 (13), 1653e1666.

Djojosubroto, M., Bollotte, F., Wirapati, P., Radtke, F., Stamencovic, I.,Arsenijevic, Y., 2009. Chromosomal number aberrations and transformationin adult mouse retinal stem cells in vitro. Invest. Ophthalmol. Vis. Sci. 50(12), 5975e5987.

Gualdoni, S., Baron, M., Lakowski, J., Decembrini, S., Smith, A.J., Pearson, R.A., Ali, R.R.,Sowden, J.C., 2010. Adult ciliary epithelial cells, previously identified as retinalstem cells with potential for retinal repair, fail to differentiate into new rodphotoreceptors. Stem Cells 28 (6), 1048e1059.

Hirami, Y., Osakada, F., Takahashi, K., Okita, K., Yamanaka, S., Ikeda, H.,Yoshimura, N., Takahashi, M., 2009. Generation of retinal cells from mouse andhuman induced pluripotent stem cells. Neurosci. Lett. 458 (3), 126e131.

Humphries, M.M., Rancourt, D., Farrar, G.J., Kenna, P., Hazel, M., Bush, R.A., Sieving, P.A.,Sheils, D.M., McNally, N., Creighton, P., Erven, A., Boros, A., Gulya, K., Capecchi,M.R.,Humphries, P., 1997. Retinopathy induced in mice by targeted disruption of therhodopsin gene. Nat. Genet. 15 (2), 216e219.


Ikeda, H., Osakada, F., Watanabe, K., Mizuseki, K., Haraguchi, T., Miyoshi, H.,Kamiya, D., Honda, Y., Sasai, N., Yoshimura, N., Takahashi, M., Sasai, Y., 2005.Generation of Rxþ/Pax6þ neural retinal precursors from embryonic stem cells.Proc. Natl. Acad. Sci. U.S.A. 102 (32), 11331e11336.

Jagatha, B., Divya, M.S., Sanalkumar, R., Indulekha, C.L., Vidyanand, S., Divya, T.S.,Das, A.V., James, J., 2009. In vitro differentiation of retinal ganglion-like cellsfrom embryonic stem cell derived neural progenitors. Biochem. Biophys. Res.Commun. 380 (2), 230e235.

Kelley, M.W., Turner, J.K., Reh, T.A., 1995. Regulation of proliferation and photore-ceptor differentiation in fetal human retinal cell cultures. Invest. Ophthalmol.Vis. Sci. 36 (7), 1280e1289.

Kiang, S., Palfi, A., Ader, M., Kenna, P.F., Millington-Ward, S., Clark, G., Kennan, A.,O’Reilly, M., Tam, L.C., Aherne, A., McNally, N., Humphries, P., Farrar, G.J., 2005.Toward a gene therapy for dominant disease: validation of an RNA interferencebased mutation independent approach. Mol. Ther. 12, 555e561.

Karl, M.O., Hayes, S., Nelson, B.R., Tan, K., Buckingham, B., Reh, T.A., 2008. Stimu-lation of neural regeneration in the mouse retina. Proc. Natl. Acad. Sci. U.S.A. 105(49), 19508e19513.

Klassen, H.J., Ng, T.F., Kurimoto, Y., Kirov, I., Shatos, M., Coffey, P., Young, M.J., 2004.Multipotent retinal progenitors express developmental markers, differentiateinto retinal neurons, and preserve light-mediated behavior. Invest. Ophthalmol.Vis. Sci. 45 (11), 4167e4173.

Lamba, D.A., Karl, M.O., Ware, C.B., Reh, T.A., 2006. Efficient generation of retinalprogenitor cells from human embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A.103 (34), 12769e12774.

Lamba, D.A., Karl, M.O., Reh, T.A., 2009. Strategies for retinal repair: cell replace-ment and regeneration. Prog. Brain Res. 175, 23e31.

Lamba, D.A., McUsic, A., Hirata, R.K., Wang, P.R., Russell, D., Reh, T.A., 2010. Gener-ation, purification and transplantation of photoreceptors derived from humaninduced pluripotent stem cells. PLoS One 5 (1), e8763. 1e9.

Maguire, A.M., Simonelli, F., Pierce, E.A., Pugh Jr., E.N., Mingozzi, F., Bennicelli, J.,Banfi, S., Marshall, K.A., Testa, F., Surace, E.M., Rossi, S., Lyubarsky, A.,Arruda, V.R., Konkle, B., Stone, E., Sun, J., Jacobs, J., Dell’Osso, L., Hertle, R., Ma, J.X.,Redmond, T.M., Zhu, X., Hauck, B., Zelenaya, O., Shindler, K.S., Maguire, M.G.,Wright, J.F., Volpe, N.J., McDonnell, J.W., Auricchio, A., High, K.A., Bennett, J., 2008.Safety and efficacy of gene transfer for Leber’s congenital amaurosis. N. Engl. J.Med. 358 (21), 2240e2248.

Maguire, A.M., High, K.A., Auricchio, A., Wright, J.F., Pierce, E.A., Testa, F.,Mingozzi, F., Bennicelli, J.L., Ying, G.S., Rossi, S., Fulton, A., Marshall, K.A.,Banfi, S., Chung, D.C., Morgan, J.I., Hauck, B., Zelenaia, O., Zhu, X., Raffini, L.,Coppieters, F., DeBaere, E., Shindler, K.S., Volpe, N.J., Surace, E.M., Acerra, C.,Lyubarsky, A., Redmond, T.M., Stone, E., Sun, J., McDonnell, J.W., Leroy, B.P.,Simonelli, F., Bennett, J., Lamba, D.A., Retina, L., 2009. Age-dependent effects ofRPE65 gene therapy for Leber’s congenital amaurosis: a phase 1 dose-escalationtrial. Lancet 374 (9701), 1597e1605 Q.

Mansergh, F.C., Daly, C.S., Hurley, A.L., Wride, M.A., Hunter, S.M., Evans, M.J., 2009.Gene expression profiles during early differentiation of mouse embryonic stemcells. BMC Dev. Biol. 9 (1), 5.

MacLaren, R.E., Pearson, R.A., MacNeil, A., Douglas, R.H., Salt, T.E., Akimoto, M.,Swaroop, A., Sowden, J.C., Ali, R.R., 2006. Retinal repair by transplantation ofphotoreceptor precursors. Nature 444 (7116), 203e207.

Merhi-Soussi, F., Angénieux, B., Canola, K., Kostic, C., Tekaya, M., Hornfeld, D.,Arsenijevic, Y., 2006. High yield of cells committed to the photoreceptor fatefrom expanded mouse retinal stem cells. Stem Cells 24 (9), 2060e2070.

Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., Misteli, T., 2006.Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stemcells. Dev. Cell 10 (1), 105e116 Q.

Meyer, J.S., Katz, M.L., Maruniak, J.A., Kirk, M.D., 2006. Embryonic stem cell-derivedneural progenitors incorporate into degenerating retina and enhance survival ofhost photoreceptors. Stem Cells 24 (2), 274e283.

Meyer, J.S., Shearer, R.L., Capowski, E.E., Wright, L.S., Wallace, K.A., McMillan, E.L.,Zhang, S.C., Gamm, D.M., 2009. Modeling early retinal development withhuman embryonic and induced pluripotent stem cells. Proc. Natl. Acad. Sci. U.S.A. 106 (39), 16698e16703.

Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., Nishimune, Y., 1997. ‘Green mice’as a source of ubiquitous green cells. FEBS Lett. 407 (3), 313e319.

O’Reilly, M., Palfi, A., Chadderton, N., Millington-Ward, S., Ader, M., Cronin, T.,Tuohy, T., Auricchio, A., Hildinger, M., Tivnan, A., McNally, N., Humphries, M.M.,Kiang, A.S., Humphries, P., Kenna, P.F., Farrar, G.J., 2007. RNA interference-mediated suppression and replacement of human rhodopsin in vivo. Am. J.Hum. Genet. 81, 127e135.

Osakada, F., Ikeda, H., Mandai, M., Wataya, T., Watanabe, K., Yoshimura, N.,Akaike, A., Sasai, Y., Takahashi, M., 2008. Toward the generation of rod and conephotoreceptors from mouse, monkey and human embryonic stem cells. Nat.Biotechnol. 26 (2), 215e224.

Palfi, A., Ader, M., Kiang, A.S., Millington-Ward, S., Clark, G., O’Reilly, M.,McMahon, H.P., Kenna, P.F., Humphries, P., Farrar, G.J., 2006. RNAi-basedsuppression and replacement of RDS-peripherin in retinal organotypic culture.Hum. Mutat. 27, 260e268.

Qiu, G., Seiler, M.J., Arai, S., Aramant, R.B., Sadda, S.R., 2004. Alternative cultureconditions for isolation and expansion of retinal progenitor cells. Curr. Eye Res.28 (5), 327e336.

Reh, T., 2006. Right timing for retinal repair. Nature 444, 156e157.RetNet. http://www.sph.uth.tmc.edu/Retnet/.


1670




YEXER5575_proof ■ 21 July 2010 ■ 14/14

1671167216731674167516761677

167816791680168116821683

Soederpalm, A.K., Fox, D.A., Karlsson, J.-O., van Veen, T., 2000. Retinoic acidproduces rod photoreceptor selective apoptosis in developing mammalianretina. Invest. Ophthalmol. Vis. Sci. 41 (3), 937e947.

Tropepe, V., Coles, B.L., Chiasson, B.J., Horsford, D.J., Elia, A.J., McInnes, R.R., van derKooy, D., 2000. Retinal stem cells in the adult mammalian eye. Science 287(5460), 2032e2036.

West, E.L., Pearson, R.A., Tschernutter, M., Sowden, J.C., MacLaren, R.E., Ali, R.R.,2008. Pharmacological disruption of the outer limiting membrane leads to


increased retinal integration of transplanted photoreceptor precursors. Exp. EyeRes. 86 (4), 601e611.

West, E.L., Pearson, R.A., MacLaren, R.E., Sowden, J.C., Ali, R.R., 2009. Cell trans-plantation strategies for retinal repair. Prog. Brain Res. 175, 3e21.

Yang, X.-J., 2004. Roles of cell-extrinsic growth factors in vertebrate eye patternformation and retinogenesis. Semin. Cell Dev. Biol. 15, 91e103.

Zhao, X., Liu, J., Ahmad, I., 2002. Differentiation of embryonic stem cells into retinalneurons. Biochem. Biophys. Res. Commun. 297 (2), 177e184.


1684

loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in...

Documents

pn3e5 retinal cells

retinal progenitor cells

pn2e6 cells

retinal dissociation

expandable stem cells

photoreceptor apoptosis

cell transplantation

terminal photoreceptor