loblolly pine (pinus taeda l.) contains multiple expressed genes

Plant Cell Physiol. 39(8): 795-806 (1998)JSPP © 1998

Loblolly Pine (Pinus taeda L.) Contains Multiple Expressed Genes EncodingLight-Dependent NADPHrProtochlorophyllide Oxidoreductase (POR)

Jeffrey S. Skinner1 and Michael P. Timko2

Department of Biology, University of Virginia, Charlottesville, VA 22903 U.S.A.

NADPHrprotochlorophyllide oxidoreductase (POR)catalyzes the light-dependent reduction of protochlorophyll-ide (Pchlide) to chlorophyllide (Chlide), a key regulatorystep in chlorophyll biosynthesis. In most angiosperms,POR is encoded by a small nuclear gene family, containingat least two differentially-expressed genes designated porAand porB. We have demonstrated that the PORs of loblollypine (Pinus taeda L.), a gymnosperm, are encoded by alarge multigene family, composed of two distinct subfam-ilies encoding porA and porB genes similar to those previ-ously described in angiosperms. DNA gel blot analysis ofgenomic DNA showed that the two por subfamilies ofloblolly pine have duplicated at different rates, with theporA subfamily containing two members, and the porBsubfamily containing at least 11 potential members. DNAsequence analysis and gel blot hybridization studies alsoshowed that a subset of the por genes present in the loblollypine genome are pseudogenes. Based on the results of 5'-and 3-RACE analysis, it appears that multiple porA andporB genes are expressed in loblolly pine cotyledons andstems during development. Using gene specific probes, nodifference was observed in the steady-state levels of thedifferent porA and porB transcripts in cotyledons of dark-grown seedlings before and following illumination. How-ever, the steady state levels of the porA and porB tran-scripts were found to increase at different rates in the stemsof dark-grown seedlings following illumination. The phylo-genetic relationship between the por gene family membersin P. taeda and other pine species and the potential signifi-cance of the two por subfamilies to the evolution of porgene function are discussed.

Key words: Chlorophyll — Loblolly pine — Molecularevolution — Pinus strobus — Pinus taeda — Protochloro-phyllide oxidoreductase (EC 1.6.99.1).

Loblolly pine (Pinus taeda L.) is the major forest tree

Abbreviations: UTR, untranslated region.The nucleotide sequences reported in this paper have been

submitted the GenBank under accession numbers AF027337through AFO27356.1 Current address: Department of Forest Science, Oregon StateUniversity, Corvallis, Oregon 97331-7501, U.S.A.2 Author to whom correspondence should be addressed.

utilized commercially in the United States for the produc-tion of wood and paper products (Moffat 1996). Because ofits economic importance, loblolly pine has been the focusof intensive biochemical and genetic investigation in recentyears. Studies are currently underway in a large number oflaboratories aimed at denning the structure and organi-zation of gene families within the loblolly pine nucleargenome and the factors required for their differential regu-lation throughout development. Despite this effort, relative-ly little is known about the mechanism(s) for temporal,spatial, and environmental (i.e., light, temperature, etc.)regulation of gene expression in this and other gymno-sperm species, and how the mechanisms for regulationpresent in gymnosperms compare to those described for an-giosperms. To begin addressing these questions, we havebeen examining the structure and expression characteristicsof gene families in loblolly pine involved in the biosynthesisand accumulation of chlorophyll and its derivatives.

Our understanding of how chlorophyll biosynthesis isregulated in angiosperms and the role its formation and ac-cumulation play in the regulation of chloroplast develop-ment and overall plant photomorphogenesis have advanc-ed considerably in recent years (Reinbothe and Reinbothe1996a, b, Fujita 1996). It is now generally accepted thatchlorophyll formation is regulated, at least in part, by thereduction of protochlorophyllide (Pchlide) to chlorophyll-ide (Chlide). Two distinct biochemical routes for Pchlidereduction have evolved in nature. One mechanism, foundin cyanobacteria, green algae, non-vascular plants, gym-nosperms, and angiosperms, is catalyzed by the enzymeNADPH:protochlorophyllide oxidoreductase (POR, EC1.6.99.1). POR is completely dependent on light for its ac-tivity and is the dominant pathway for chlorophyll forma-tion in plants. The second mechanism to evolve reducesPchlide to Chlide in a light-independent manner. Thismechanism is thought to be evolutionarily older because ofits occurrence in the purple bacteria (Bauer et al. 1993,Fujita 1996), as well as the cyanobacteria, green algae,non-vascular plants, and gymnosperms. Light-independentPchlide reduction is conspicuously absent in angiosperms.Although the biochemistry of light-independent chloro-phyll formation is unknown, at least three distinct geneproducts encoded in the choroplast DNA in photosyntheticeukaryotes have been identified that are required for thisprocess (Fujita 1996).

When grown in total darkness, most angiosperms accu-

795

Downloaded from https://academic.oup.com/pcp/article-abstract/39/8/795/1835287by gueston 01 February 2018

796 Multiple expressed por genes in loblolly pine

mulate large amounts of Pchlide in their cotyledons andprimary leaves as part of a ternary complex formed byPOR and its cofactor NADPH in the prolamellar body ofetioplasts. It has been known for many years that PORabundance and activity decreases rapidly upon exposureof etiolated tissues to light (Santel and Apel 1981). Thisdecline is regulated in part by proteolytic turnover ofthe enzyme following Pchlide photoconversion (Kay andGriffiths 1983, Griffiths et al. 1985), and is correlated withboth a phytochrome-controlled loss of translatable mRNAencoding the protein and decreased rates of por gene tran-scription (Apel 1981, Batschauer and Apel 1984, Mosingeret al. 1985). The loss of POR protein and activity inetiolated tissues following illumination appears to be analmost universal response among vascular plants, althoughvariation in the extent and rapidity of the decline has beenobserved among monocot, dicot, and gymnosperm species(Reinbothe and Reinbothe 1996a, b, Reinbothe et al.1996a). The accumulation of por mRNA and protein hasalso been shown to be influenced by developmental ageand/or stage of plastid differentiation (Spano et al. 1992a,He et al. 1994).

The rapid disappearance of POR protein and en-zymatic activity during light-induced development wasenigmatic, since it was inconsistent with the observed con-tinued formation of chlorophyll after extended periods ofillumination and chlorophyll synthesis in mature, fullygreened tissues (Mapleston and Griffiths 1980, Kay andGriffiths 1983, Griffiths et al. 1985). This apparent con-tradiction was resolved by the demonstration that twoforms of the enzyme are present in most plants. Theseforms, termed PORA and PORB, differ in their expressionpattern, abundance, and activity during light-induced devel-opment (Holtorf et al. 1995, Armstrong et al. 1995, Rungeet al. 1996). PORA is the predominant form of the enzymepresent in etiolated tissues and along with its substrates,Pchlide and NADPH, accumulates to high levels in the pro-lamellar bodies of etioplasts. Since the amounts of PORAprotein and the mRNA that encodes it decrease dramatical-ly upon illumination, it is thought that PORA functionsonly during the very early stages of greening. PORB isthought to be responsible for the reduction of Pchlide dur-ing the later stages of greening, and for chlorophyll forma-tion in mature, green tissues. PORB is present only inminor amounts in the thylakoid membranes of developingand mature chloroplasts and its expression appears to beconstitutive throughout development. In contrast, tran-scription of the por A gene is negatively regulated by phyto-chrome (Holtorf et al. 1995, Armstrong et al. 1995). Inaddition to differing in their expression pattern and abun-dance during light-induced development, in vitro importstudies performed with radioactively-labeled PORA andPORB precursor polypeptides from barley have shown thatimport of prePORA, but not prePORB, is Pchlide-depend-

ent (Reinbothe et al. 1995a, b, 1996b).We have previously reported the isolation and charac-

terization of a nuclear gene (LP2) encoding a POR fromloblolly pine (P. taeda L.) and two expressed cDNAs en-coding this protein from white pine {P. strobus L.) (Spanoet al. 1992a). Two forms of POR have also been reported inmountain pine (P. mugo) (Forreiter and Apel 1993). In thislatter study, the two por genes were reported to be differen-tially regulated in response to light treatment in a mannersimilar to that observed for the porA and porB genespresent in angiosperms. The identification of two differenti-ally expressed por genes in pine species suggests that thedivergence of the por A and porB genes, or their predeces-sors, may have occurred prior to the divergence of gymno-sperms and angiosperms. This has been suggested to be thecase for several other gene families in pine whose homologswere first identified in angiosperms (e.g., cab (Jansson andGustafsson 1990, Chinn and Silverthorne 1993, Yamamotoet al. 1993, Chinn et al. 1995, Peer et al. 1996) and phy(Thummler and Dittrich 1995)).

In this present study, we report our results on the fur-ther characterization of the por gene family in loblollypine. We demonstrate that multiple por genes are presentin the loblolly pine genome and that a subset of these aredifferentially expressed in the cotyledons and stem duringseedling development. Our studies suggest that the gene du-plication events that subsequently led to specialized func-tions for various por gene family members in angiospermsmay have already occurred in pines, a less evolutionarily ad-vanced species. The phylogenetic relationship between thepor gene family members in P. taeda and other pine speciesand the potential significance of the two por subfamilies tothe evolution of por gene function are discussed.

Materials and Methods

Plant growth and tissue sample preparation—Seeds of loblol-ly pine (Lots WV103 and WV116, kindly provided by WestvacoCorp., Summerville, SC) were vernalized for a minimum of 6weeks in the cold (6-8°C), disinfected with 1% (v/v) H2O2 for 1 h,and planted in moistened vermiculite. Seedlings were grown at 25-28CC in complete darkness or under constant white light (150 Wcm"2; 8,000 lux) for 14 d post-germination. Under our growthconditions, germination usually occurred within 7-10 d after plant-ing. For light regulation experiments, 14 day-old dark-grownseedlings were transferred to constant white light for the varioustime periods specified in the Results prior to harvesting. For allgrowth conditions, the harvested tissue was frozen immediatelyin liquid N2, processed immediately or stored at — 80°C untilutilized. Dark-grown tissue was harvested under dim greensafelights.

Genomic DNA isolation and gel blot analysis—Loblolly pinegenomic DNA was prepared by the method of Devey et al. (1991),with the following modifications: insoluble polyvinylpolypyrroli-done (Sigma) was added to 1.5% (w/v) in the extraction bufferand chloroform : isoamyl alcohol (24 : 1) was used for organic ex-tractions. Needles of a single one year-old greenhouse grown


Multiple expressed por genes in loblolly pine 797

plant, that had been dark-adapted for three days to decrease carbo-hydrate content, was used as starting material.

Total genomic DNA was digested with Dral, EcoRl, Hindlll,Nsil, or Xbal for 8-12 h using 10 units of restriction enzyme perfig of DNA. Electrophoretic separation of the digested genomicDNA (20 tig lane"1) was done in 0.8% agarose/1 x TAE gels andthe resolved DNA was transferred to Nytran nylon membrane(Schleicher and Schuell) under alkaline conditions (Sambrook etal. 1989). Blots were prehybridized, hybridized, and washed as de-scribed in Devey et al. (1991). Following the final wash, blots werescanned using a Molecular Dynamics phosphorimager. For reprob-ing, the blots were stripped according to the manufacturer's pro-tocol (Schleicher and Schuell), then prehybridized, hybridized andwashed as above.

5'- and 3'-RACE analysis of mRNA transcripts—Total RNAwas isolated from dark-grown cotyledons by the method of Changet al. (1993). The 5'- and 3'-ends of the por transcripts were deter-mined by rapid amplification of cDNA ends (RACE). For 5-RACE analysis, the 5-RACE System (Gibco-BRL) was used ac-cording to the manufacturers protocol. First strand cDNA syn-thesis was carried out on 1 fig of total RNA from 14 d olddark-grown cotyledons using a gene-specific primer [PINE.027;5 -CCCGGATCCAGTCTGTGCCCTTATTCT-3'). Following firststrand cDNA synthesis, reaction products were purified and tailedwith dCTP. A portion of the cDNA was then amplified in reac-tions containing 2 fil cDNA, 1 x Taq Polymerase reaction buffer(Boehringer Mannheim), 200 fiM dNTPs, 2.5 units Taq poly-merase (Boehringer Mannheim), and 125 ng each of the poly-(dC)-adapter primer (Gibco-BRL) and the PINE.027 primer. Onemicroliter of a 100-fold dilution of the amplification productswere reamplified as above except that a different gene-specificprimer (PINE.020; 5'-CCTAGAAAAGCTGAATCCTT-3') wasused to nest the reactions. Both the first and second roundamplifications were done as follows: 6 min at 94°C followed by35 cycles of denaturation at 94°C for 45 s, annealing at 50°C for60 s, and extension at 72°C for 90 s, and a final extension periodof 5 min at 72°C. A portion of the reaction was subjected to DNAgel blot analysis (Sambrook et al. 1989) using an4/?III/.PvMlI frag-ment derived from the LP2 genomic clone (Fig. 1) as probe. Theremaining portion of the reaction was treated with the Klenowfragment of DNA Polymerase I and an aliquot of the reactionseparated on a 1% (w/v) low-melting agarose gel (FMC Bio-Products). The hybridizing bands were excised and subcloned intothe Smal site of pBluescript KS(—) (Stratagene). Individual posi-tive clones were identified under high stringency conditions by acolony screen (Sambrook et al. 1989), isolated, and sequenced.

To determine the 3' end of the transcripts, the same dark-grown cotyledon total RNA was used in a 3-RACE protocol(Frohman et al. 1988) using a poly-d(T)-adapter primer [5'-G-GTCGACGCGGCCGCTCTAGA(T)17-3l for first strand cDNAsynthesis. First round amplifications were done as described aboveusing a gene-specific primer (PINE.016; 5-GAGAAGCTTGTTG-GACT-31 and the poly-d(T)-adapter primer in the reaction. Sec-ond round amplifications were done using the same primer set ornested using the PINE.014 primer (5-TACCCAGGATGCAT-TGC-31 instead of PINE.016. Amplified fragments were purifiedby electrophoresis, cloned into a pBluescript plasmid, and ana-lyzed by sequencing.

Gel blot analysis of total RNA— Total RNA was isolatedfrom pine tissues by the method of Chang et al. (1993). For gelblot analysis, either 20 ng (blots hybridized with por coding regionprobe) or 40//g (blots hybridized withpoM and porB specific pro-bes) of total RNA was fractionated on formaldehyde-agarose gels

and transferred to Nytran nylon membranes (Schleicher andSchuell) by the method of Fourney et al. (1988). Filters were prehy-bridized in 50% (v/v) formamide, 5 x SSPE, 0.1% (w/v) SDS, 5 xDenhardt's medium, and 100 fig ml" ' salmon sperm DNA at 42°Cfor 1-2 h, then hybridized in the same buffer containing 32P-dCTPlabeled probe at 42°C for 16-24 h. Blots were washed twice in 1 xSSC, 0.1% (w/v) SDS at 23°C, then twice in 0.1 xSSC, 0.1%(w/v) SDS at 23°C or 37°C.

Nucleic acid sequencing and analysis—Dideoxynucleotide se-quencing was carried out using Sequenase Version 2.0 accordingto the manufacturer's protocol (United States Biochemical) ondouble-stranded plasmid DNA templates. Plasmid DNA for se-quencing was prepared either by the method of Stephen et al.(1990) or utilizing the Qiaprep Spin Plasmid Kit (Qiagen).

Preparation of probes—For RNA and DNA gel blot analysis,a 1.67 kb i?coRI-///rtdIII fragment of the LP2 gene encompassingExons III through V (see Fig. 1) was prepared. This fragmentshould be capable of detecting all possible por family members. A350 bp EcoKl fragment encoding a portion of the P. taeda 18SrRNA (A. J. Spano, unpublished) was used as control in the RNAgel blot analyses. Restriction fragments used as probes were puri-fied by electrophoresis through low melting agarose gel (FMC Bio-Products) and radiolabeled with 32P-dCTP using the RandomPrimed DNA Labeling Kit (Boehringer Mannheim). Single-strand-ed hybridization probes specific for the porA and porB genes/sub-families were prepared from the 3-UTRs of the por A and porBcDNAs contained on plasmids pPt3"UTR.2 and pPt3tJTR.l, re-spectively, and the corresponding 3-UTR of LP11 contained onthe plasmid pLPGENll-lF (see Fig. 1) using the Prime-A-ProbeDNA labeling system (Ambion) and gene-specific antisenseprimers. To verify probe specificity, sense RNAs were synthesizedin vitro using gene-specific sense primers and 3H-UTP for the pur-pose of transcript quantification (Sambrook et al. 1989).

Phylogenetic analysis—PILEUP alignments, parsimony anal-ysis, Fitch and Margoliash plots, and the neighbor-joining meth-od of tree construction were performed using the PHYLIP 3.5program available through the GCG package (University ofWisconsin, Madison WI). For alignments a GapWeight of 1.0 anda GapLengthWeight of 0.2 were used.

Results

Multiple expressed cDNAs encode POR in loblollypine—We reported previously the isolation and characteri-zation of a nuclear gene (LP2) from loblolly pine (P. taeda)encoding a POR protein in this species (Spano et al.1992a). In this same study, we also showed that white pine(P. strobus) expressed a homolog of LP2 (represented bythe cDNA pWPnPCR-373) and at least one other highly-related por gene product (represented by the cDNApWPnPCR-901). The two white pine cDNAs, pWPnPCR-373 and pWPnPCR-901, are 91% identical at the nucleo-tide level within their protein coding regions, but differwithin their 3'-UTR. To further analyze the number of ex-pressed genes present in the loblolly pine genome, a seriesof 5'- and 3'-RACE experiments were carried out and theresulting cDNAs generated in these studies isolated andcharacterized. Oligonucleotide primers, designed to recog-nize conserved regions in Exons I and II of the LP2 gene(Fig. 1,2A), were used to prime 5-RACE reactions contain-



51 RACE

1kb

por Coding Region

porA-specific

porS-specific

LPU-spedfic

Fig. 1 Structure, organization, and partial restriction map of the loblolly pine LP2 gene encoding POR. The open boxes denote the 5'-and 3-UTRs, the shaded boxes indicate the transit peptide coding portion, and the black boxes indicate the coding portion of the maturePOR protein. The location of the sequences used for the preparation of the coding region, porA-, porB-, and LP11-specific hybridiza-tion probes used in the various genomic DNA and RNA hybridization analyses are indicated in the figure relative to their position on theLP2 gene. The approximate location of the 5- RACE products are also shown.

ing total RNA isolated from the cotyledons of dark-grownseedlings as template. Following amplification and electro-phoresis of the reaction products, the amplified fragmentswere isolated and cloned into pBluescript KS(—) vectors.Twenty independent recombinants were chosen and the nu-

5Obp

n i i 1

CAAT TATA-UloBox Boxes

porB-l I

B.porW

LP2 ACTCATATTTTOTCaMCCTOTCACCGTOTTAOCAOOTTCAAOTACATAAGTOAOAGTAOAC

porB-l : : : : ! ! : : : t : ::•••• : : : r :

p o r f l - I I C: : : : : : : : : : : :J : : : : : : : = ! : : : :G: : : :

LP2 GOOAACAOATTCTCATCCACKOGAGOAAAATrcAAAGTTTOaATTACTACGCCAGCJAGGAOO

p o r S - I : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :

p o r f l - U :••: : : : : ; : : : : : :C : : : : : : : : :

L P 2 AGGAACCTCGAGGCAGCTTCGCTTCGTCTTCAATTATGCGGACACTCCTTCAAACACACATA

p o r f l - I : : : : : : : : 1 : : : : : : : : : : : : : : : : : : : : : i : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :

p o r B - I I : : • :C : : : : : : : : ! : : : > : : :

L P 2 I G G C T L l l V r m C A T T T C C T C T G C A A A A A G A G » I n t r o n I«GGAGGACATAGTGCTTCTGCA

porB-1 : : : : : : : : : : : : ! : : : : : : : : : : : : : : : : • • • : : : : : : : : : : : : : : : :p o r B - H : : : : : : : : : C : : : : : : : : : : : : : : : : : : :

Fig. 2 Sequence and organization of the 5'-UTR of loblolly pineporB cDNAs. Representative porB-l and porB-ll cDNAs appearin the GenBank Nucleotide Sequence Database under the acces-sion numbers AF027338-AF027347. (A) Diagram of the 5' flank-ing region of the LP2 gene indicating the location of potential tran-scriptional control sequences (CAAT box and TATA box) andstructure of the porB-l and porB-ll cDNAs. The stippled boxpreceding Exon I represents the 29 bp region missing in the porB-ll clones. The location of the oligonucleotide primer (PINE.020)used for 5-RACE is shown. Note in the figure Intron I is notshown and only the relevant portion of Exon II is included. (B)Alignment of the relevant portions of the 5'-UTRs and coding se-quences of the LP2 gene and representative porB-l and porB-llcDNAs. The coding portion of the LP2 sequence is underlined.The position of Intron I is indicated and (••) denote this process-ed portion of the 5'-RACE cDNAs. Colons denote conservedbases.

cleotide sequences of the cloned cDNAs completely deter-mined. The various cDNAs differed in length, as well as nu-cleotide sequence, and could be easily grouped into twocategories based upon the presence (designated porB-l) orabsence (designated porB-ll) of a short (29 nucleotide)insertion/deletion immediately upstream of the startingmethionine codon when compared to the LP2 gene se-quence (Fig. 2A, B). The porB designation was used in nam-ing these two groups since in our earlier analysis of LP2mRNA accumulation we found that its expression moreclosely resembled that observed for porB genes in angio-sperms (Spano et al. 1992a, Skinner and Timko, manu-script in preparation). Based on nucleotide substitutionsand end points of the cDNAs, six different porB-l and fivedifferent porB-ll forms were found. All of the porB-llcDNAs contained the same subset of base substitutionsrelative to the porB-l cDNAs and the LP2 gene (Fig. 2B).

The 5' ends of the longest of the porB-l and porB-llcDNAs initiated 28 nucleotides 3' with respect to the mostdistal TATA-like element present in the LP2 gene promot-er region (Fig. 2). A transcription initiation site at thislocation is within the appropriate distance for RNA Poly-merase H-transcribed genes (Joshi 1987). All twenty of the5-RACE products examined lacked sequences correspond-ing to the first intron present in the LP2 sequence, in-dicating that they had arisen from processed mRNA. Theshorter cDNAs were most likely the result of incomplete ex-tension during the RACE procedure. We cannot rule outthe possibility that they arose as a result of alternate tran-scription start sites from other por family members in theloblolly pine genome.

The 29 nucleotide insertion/deletion located withinthe 5'-UTR does not contain any apparent intron/exonborder sequences. Therefore, we believe it is unlikely thatthis region is a mini-intron that has failed to be splicedfrom the mRNA (Mount 1982). Whether the presence orabsence of this region in the 5'-UTR influences the post-transcriptional properties of the messages is not known.



The sequence itself does not show any tendency to adopta stable secondary structure. However, immediately up-stream of this region are four direct AGG trinucleotiderepeats of unknown functional significance.

On the basis of the 5'-RACE data described above, itappears that at least one other por gene, closely related toLP2 is transcribed in loblolly pine. Since the primer usedfor these studies was likely to be biased towards transcriptsclosely related to LP2, we also carried out experiments us-ing oligonucleotide primers based on the coding sequencesof the LP2 gene in the conserved regions in Exon IV(primer PINE.016) and Exon V (primer PINE.014). Theseprimers were then used in 3'-RACE reactions containingtotal RNA from the cotyledons of dark-grown seedlings astemplate as described in the Materials and Methods.

Following PCR amplification and electrophoresis ofthe reaction products, fragments of the expected sizes wereisolated and subcloned into pBluescript KS(—) vectors.Following initial characterization, four clones were chosenand their nucleotide sequence determined. These cloneswere divided into two classes based on the sequence of their3'-UTR and their similarity to the white pine cDNAs encod-ed in pWPnPCR-373 and pWPnPCR-901 (Fig. 3). All ofthe reaction products amplified using the PINE.016 primercontained a portion of Exon IV and had the intron betweenExon IV and Exon V spliced out, indicating that they hadarisen from mRNA. Two of the cDNAs, p3T<:R.3 andp3'PCR.4, were identical to each other and homologous toboth the LP2 genomic sequence and the white pine cDNApWPnPCR-373. In keeping with our designation of the 5'-RACE products, these were classified as porB types. Thecoding sequences contained in p3'PCR.3/p3'PCR.4 areidentical to that of LP2, whereas five mismatches are foundbetween the sequences of the p3'PCR.3/p3'PCR.4 clonesand the LP2 gene in the 3'-UTR. These mismatches mayindicate the presence of a highly related LP2 homolog inthe loblolly pine genome, or they may reflect polymorphicdifferences between seed lots, since the genomic libraryused to isolate LP2 by Spano et al. (1992a) was preparedfrom a different lot of loblolly pine seed than that utilizedfor this present work. Alternatively, they could be theresult of cloning artifacts.

The two other cDNAs cloned, p3'PCR.l andp3'PCR.2, were nearly identical, except that p3'PCR.l con-tained an additional 12 nucleotides in its 3'-UTR justbefore the poly (A)n tail. These cDNAs likely represent tran-scripts from the same gene which have used different sitesof polyadenylation (Li and Hunt 1995). They share only74% similarity in nucleotide sequence in their 3'-UTR withthe porB type of cDNAs described above. The most ob-vious structural feature distinguishing the two classesof transcript is the presence of a 10 nucleotide insertionin the p3'PCR.l and p3'PCR.2 transcripts (Fig. 3). Thetwo cDNAs are homologous to the white pine cDNA

LP2 TGCTTGAAGT TCTCCTATAT TGTCAAGATT ATGTGTACAT3PCR3 TGCTTGAAGT TCTCCTATAT TGTCAAGATT ATGTGTACAT3PCR1 TGCATGAAAT TCTCCAACGT TGTCAAGATT AT. . .AGCAT3PCR2 TGCATGAAAT TCTCCAACGT TGTCAAGATT AT...AGCAT

LP2 TAGGTAGGTC AAGATGCCAA ATATTGGTGT G . . TTTTGTA3PCR3 TGGGTAGGTC AAGATGCCAA ATATTGGTGT G..CTTTGTA3PCR1 TAGTTAACTC .AGCTGCCAT ATCTTTGTAT GCATTTCGTA3PCR2 TAGTTAACTC .AGCTGCCAT ATCTTTGTAT GCATTTCGTA

LP2 GGGTGGAGGA TTTAGTTTCA TGTAGAAAAA TCAGAAGAGA3PCR3 GGGTGGAGGA TTTAGTTTCA TGTAGAAAAA TCAGAAGAGA3PCR1 GGGTGGAGGA TCTAGTTTCA GGTAGAAATA TGAGAAGAGA3PCR2 GGGTGGGGGA TCTAGTTTCA GGTAGAAATA TGAGAAGAGA

LP2 AACAGATCTA AATTACTCTG GACTTTTGTG CATGTTTTCA3PCR3 AACAGATATA AATTACTCTG GACTTTTGTG CATGTTTTCA3 PCR1 CATGGAAATA AATTACTC GG CATGCTTTCA3 PCR2 CATGGAAATA AATTACTC GG CATGCTTTCA

LP2 TTGCAGCGCT TACTTCGGTA CTGAGTGGTC ATTGAAAAAT3PCR3 TTGCAGCGCT TACTTCGGTA GTGAGTGGTC ATTGAAAAAT3PCR1 TTGCAGAGCC TACTTTTGTA GCGACTGGTA ATTCAAAAGA3PCR2 TTGCAGAGCC TACTTTTGTA GCGACTGGTA ATTCAAAAGA

LP2 TTTCTTTGAT TGTGTAATC3PCR3 TTTCTTTGAT TGTGTAATC3PCR1 TTTCTTGCAA TGCGTAATG3PCR2 TTTCTTGCAA TGCGTAATG

AGGTTAAATT GAGGTTAAATT GAGGTTAAATT GAGGTTAAATT G

3TCGCAGTT5TCACAGTT^TCGGAGGTVTCGGAGGT

LP2 TATATTCTTT TGACTCTCAA TT3PCR3 TATATTCA3PCR1 TATATCGTTC TAGA.3PCR2 TA.

Fig. 3 Alignment of the 3-UTRs of the various por cDNAs andLP2 gene. The nucleotide sequences of the LP2 gene and var-ious cDNAs (pS'PCR.l—3PCR1, accession number AF027348;p3"PCR.2—3PCR2, accession number AF027349; and p3'PCR.3—3PCR3, accession number AF027350) derived from the 3-RACE analysis using the PINE.014 primer are shown. Sequencesgiven extend to the poly (A)n tail. The termination codon of thePOR coding region is shown in bold and the potential polyadenyla-tion signal is boxed. The beginning of the poly (A)n tail is designat-ed by the bold underlined A. The asterisks denote the conservedgaps observed between all known pinepoM and porB 3-UTRs.

pWPnPCR-901 (Spano et al. 1992a). We have assigned thisgroup of loblolly pine cDNAs the porA designation. Thepor A and porB type transcripts not only differ structurally,but also show subtle differences in their expression inyoung loblolly pine seedlings (see below). Such a designa-tion would also seem appropriate based on our observationthat the porB transcripts (e.g., p3TJCR.3/p3'PCR.4) ac-count for the majority of the mRNAs encoding POR inmature needles of 1-2 year-old loblolly pine trees, whereaspor A transcripts (e.g., p3'PCR.l and p3"PCR.2) constituteonly a small fraction of the total mRNA in these tissues(Skinner and Timko, manuscript in preparation).



The combined results of the 5'- and 3'-RACE analysisclearly show that multiple por genes are expressed in loblol-ly pine, consistent with the earlier observations of Spano etal. (1992a). Our studies also show that like angiosperms thepor genes in loblolly pine can be divided into two subfam-ilies which we have assigned the designation of porA-typeandporB-type. At least one por A and two porB genes arebeing expressed in dark-grown pine cotyledons.

Complexity of the por A and porB gene families inloblolly pine—To estimate the complexity of por gene fam-ily in loblolly pine, genomic Southern blot analysis was car-ried out using hybridization probes capable of recogniz-ing either coding sequences within most or all por familymembers or genomic fragments containing the 3'-UTRs ofporA- or porB-type genes (see Fig. 1). To avoid possibleconfounding effects that could arise as a result of polymor-phisms in genomic structure among individual plants(Devey et al. 1991), the total genomic DNA used in thesestudies was isolated from the cotyledons of a single one-year old loblolly pine tree. As shown in Fig. 4A, when theSouthern blots were hybridized with a coding region probecapable of detecting por coding sequences, multiple hybrid-izing bands were identified under high stringency washingconditions. A large number of hybridizing fragments per-sist regardless of which enzyme was used to restrict theDNA. The size of the por LP2 gene is approximately 3.8 kb

including the immediate 5- and 3'-UTR and introns. Basedon the EcoRl digest, at least eleven hybridizing bands arepotentially large enough to encode full-length por genes.Whether all of these contain full length genes is unknown.Reducing the stringency of the washing conditions did notreveal additional bands (data not shown).

To discern which of the hybridizing bands also containsequences specifying the por A and porB subfamilies,single-stranded hybridization probes were generated thatwere 69% identical and capable of only detecting the 3'-UTRs of either the porA- or porB-type genes (Fig. 1, 4).The porB-specific probe hybridized to a large subset of thebands hybridizing with the coding region probe (Fig. 4B).Since there is no overlap between the por coding region pro-be and the porB-specific probe, the hybridization patternvaried depending on the particular enzymes used to digestthe DNA. Using the EcoRl digested DNA sample as aguide, eleven bands hybridized to the porB probe, all ofwhich are potentially large enough to contain full lengthgenes. When the same blot was hybridized with a probecapable of specifically detecting porA -type sequences, onlytwo hybridizing bands were observed, suggesting that thissubfamily is by comparison smaller (Fig. 4C). This differ-ence can not be attributed to cross hybridization betweenthe probes, since control blots of in vitro synthesized senseRNAs prepared from the porA- and /?ori?-specific se-

Coding porB

•a 3 iD W £

i rporA LPll

' 'X !

a 2 2s

X

23'

9.4

6.6

4.4

23'-2.0"

0.6

Fig. 4 Genomic DNA hybridization analysis of the por gene family in loblolly pine. Total genomic DNA from loblolly pine (20 nglane~') was digested with the restriction enzymes indicated, fractionated by agarose gele electrophoresis and transfrered to nylon mem-branes as indicated in the Materials and Methods. The membranes were then hybridized with 32P-labeled probes capable of detecting allPOR coding sequences (Panel A—Coding), only the porB ox porA subfamilies (Panel B—porif-specific and Panel C—porA-specific, re-spectively), or the 3-UTR of the LPll pseudogene (Panel D—LPll) as indicated in Figure 1. Size markers in kb are indicated.



quences showed no cross hybridization between the twoprobes under conditions identical to those used for thegenomic Southern blot analysis (data not shown). Whilethe bands hybridizing with the porA-type gene specificprobe were of equal intensity, those detected by the porB-specific probe displayed different intensities. The observedvariations in hybridization intensity most likely reflect thedegree of nucleotide sequence divergence among the sub-family members and/or differences in gene copy numbers.Similar observations have been made in the analysis ofother pine gene families (Kinlaw et al. 1990, 1994).

In the process of screening the loblolly pine genomiclibrary for additional por genes, a phage (designated LP11)was isolated that contains sequences 87% similar to the Ex-on V coding region of LP2. In LP11, the Exon V coding se-quences contain a base substitution that introduces a pre-mature stop codon into the open reading frame encodingthe POR homologous sequences and a nucleotide insertionthat causes a frameshift mutation resulting in two addition-al stop codons in succession (Fig. 5). Although the remain-ing portion of Exon V sequence is unaltered, the nucleotide

LP2 V V S N P S L T K S G V Y W

L P l l V V N D P S L T K S G V Y W

LP2 GTTGTGAGTAATCCAAGTTTGACCAAGTCCGGTGTATATTGG

L P 1 1 GTTGTTAATGATCCAAGTTTGACCAAGTCCGGTGTATATTGG

LP2 S W N N N S A S F E N Q L S

L P l l S W N N D S T S F E N Q L S

LP2 AGCTGGAATAACAACTCGGCTTCCTTTGAGAATCAGTTATCT

L P l l AGTTGGAACAACGATTCAACTTCCTTTGAGAACCAGTTATCT

L P l l * I W E

LP2 E E A S D P E K A K K L W E

L P l l E Z A S D P G K A K K N M G

LP2 GAAGAAGCCAGTGATCCCGAGAAAGCTAAAAAAT-TATGGGA

L P l l GAATAAGCCAGTGATCCAGGCAAAGCTAAAAAAAATATGGGA

L P l l * S S E K L V G L A Z

LP2 V S E K L V G L A Z

L P l l K ^ ^ E A C R T C L R

LP2 AGTTAGTGAAAAGCTTGTTGGACTTGCTTGA

L P l l AAGTAGTGAGAAGCTTGTCGGACTTGCTTGA

Fig. 5 Coding sequences in the loblolly pine LPll pseudogene.Shown is an alignment of the nucleotide and derived amino acid se-quences of the LPll pseudogene (GenBank accession numberAF027337) with Exon V of the LP2 gene. Stop codons are notedin bold and underlined. The single base insertion in LPll is dou-ble underlined. LP11* shows the shifted reading frame affected bythe base insertion that is still highly conserved to por.

insertion changes the reading frame such that the normaltermination codon is no longer used. No similarity toknown por sequences or any other gene present in theGenbank/EMBL database was found in the 2.2 kb regionupstream of the LP11 Exon V homologous regions, and noobvious sequence homology to either of the por subfam-ilies isolated and described above was found for the se-quences located downstream of this region (i.e., the analo-gous 3 -UTR). Therefore, we concluded that LP11 must bea por pseudogene. To confirm that LPl l arose from se-quences present in the loblolly pine genome and not as acloning artifact during construction of the genomic library,Southern blot analysis was carried out with a hybridizationprobe prepared from the LPl l clone that containedsequences analogous to the 3-UTR of the LP2 gene(see Fig. 1). When this probe was hybridized to the samegenomic Southern blots used in the studies describedabove, 2-4 hybridizing bands were observed (Fig. 4D), in-cluding fragments of identical size to those found in the

porB porA

Pml

Pt3PCR:

Ps373

Pt3012s

Fig. 6 Parsimonious unrooted phylogenetic tree showing rela-tionship among thepor genes from three pine species. The relation-ship among the por genes from three pine species is shown basedupon a comparison of nucleotide sequences in their 3-UTRs. Thevalues at the nodes indicate the number of times a particular bran-ching occurred out of 100 bootstrap datasets. In the tree, se-quences derived from P. taeda, P. strobus, and P. mugo are desig-nated as Pt, Ps, and Pm, respectively. Abbreviations andreferences are: Pt3PCRl, Pt3PCR2, and Pt3PCR3 {P. taedacDNA clones 3TPCR.1, 3 * ^ . 2 , and 3'PCR.3, respectively, thiswork); PtLP2, Ps373, and Ps901 (P. taeda genomic clone LP2,P. strobus cDNA clones pWPnPCR-373 (GenBank accession num-ber AF027355), and pWPnPCR-901 (GenBank accession numberAF027356), respectively, Spano et al. 1992a); PsCT clones(P. strobus cDNA clones, A.J. Spano, unpublished, GenBank ac-cession numbers AF027351-AF027354); Pt3012s (P. taeda cDNAclone PtIFG-3012s, C.S. Kinlaw, GenBank accession numberH75262); and Pml and Pm2 {P. mugo cDNA clones pPml andpPm2; Forreiter and Apel 1993).



phage DNA. Hybridization of the LP11 probe to RNA pre-pared from the cotyledons and stems of pine seedlings didnot detect any expressed RNA (data not shown), suggestingthat this is an unexpressed pseudogene. Therefore, it is pos-sible that some of the bands hybridizing with the porprobes in the Southern analysis may not contain full-length functional and/or expressed genes.

Phylogenetic analysis of genes encoding POR in pine—Nucleotide sequence information is now available for anumber of expressed por genes from three different pinespecies: loblolly pine (Spano et al. 1992a, S. Kinlaw, an ex-pressed sequence tag: PtIFG-3012s, Genbank AccessionNumber H75262, and this present study), white pine(Spano et al. 1992a, A. Spano, unpublished data), andmountain pine (Forreiter and Apel 1993). Using the nu-cleotide sequences of the 3'-UTRs from the various pinecDNAs and the loblolly pine LP2 gene, a phylogenetic par-simony tree was generated (Fig. 6). Two major phylogenet-ic groups are found, consistent with our above analyses.One grouping consists of porB-type genes, the other isformed by por A -type genes. A topography identical to thatshown in Fig. 6 was also obtained using a Kimura two pa-rameter DNA distance tree (Kimura 1980) constructed ac-cording to either the Fitch and Margoliash (1967) or theneighbor-joining method (Saitou and Nei 1987) of tree con-struction (data not shown).

A GCG PILEUP alignment of all of the known por 3'-UTR from pine revealed that the same nucleotide substitu-tions, insertions and/or deletions found to distinguish theloblolly pine porA and porB cDNAs also distinguish thetwo types of por genes in other pine species. Within theporA-type, the three white pine cDNAs (PsCT5, PsCT6,

and PsCT9) form a small sidebranch on the tree. PsCT5,PsCT6, and PsCT9 contain the same nucleotide substitu-tions, insertions and/or deletions observed for the porA-type sequences of loblolly pine, but also some additionalchanges. However, since no outgroup is available, it isdifficult to unambiguously identify this as a separatebranch within the porA subfamily.

Expression of the porA and porB in dark- and light-grown seedlings—In angiosperms, porA and porB showdistinct patterns of expression during light-induced plantdevelopment (Reinbothe and Reinbothe 1996a, b, Rein-bothe et al. 1996a). To determine whether the two differentpor gene subfamilies observed in loblolly pine show distinctpatterns of temporal and spatial expression during develop-ment, RNA gel blot analysis was carried out using totalRNA prepared from cotyledons of dark-grown seedlingsand seedlings grown in the dark and then exposed to whitelight for various lengths of time. As shown in Fig. 7, an ap-proximately 1.5 kb transcript can be detected in RNA isolat-ed from either dark- or light-grown cotyledons hybridizedwith a 32P-radiolabeled probe prepared against a conservedcoding region of the por gene. The steady-state levels ofpor transcript increased slightly in cotyledons following illu-mination.

The effect of light on por message abundance wasmore evident in stem tissue. The steady-state level of pormRNA is low in dark-grown stem tissue, whereas upon ex-posure of dark-grown seedlings to light a steady increase inpor mRNA is observed with por mRNA levels approach-ing that observed in tissue grown under continuous whitelight (Fig. 7A). Since the relative abundance of the pormRNA was lower in the stems than in the cotyledon, it

A.por Coding

Cotyledon Stem| D 6 12 24 48 L | | P 6 12 24 48 L [

c. Probe:

lOfmoles j

2.5fmoles j

0.625 fmoles

Fig. 7 Effect of light and tissue type on por mRNA levels in loblolly pine seedlings. Loblolly pine seedlings were grown for 14 d post-germination in constant dark (D) or constant light (L) and total RNA was prepared for RNA gel blot analysis as described in theMaterials and Methods. For light-induction studies, dark-grown seedlings were transferred to constant light and tissue harvested after 6h (6), 12 h (12), 24 h (24) and 48 h (48). The RNA blots were then hybridized with 32P-labeled probes capable of detecting all por en-coding transcripts (Panel A), or messages specific for porB or porA cDNAs (Panel B). Hybridization probes were identical to those de-scribed in the legend to Figure 4. The 18S rRNA probe is as described in the Materials and Methods. Each lane contains 20//g (Panel A)or 40 fig (Panel B) total RNA. The fluorographs showing hybridization to total stem RNA shown in Panels A and B were given a slightlylonger exposure time relative to cotyledon samples to enhance the quality of the low abundance signals. Panel C shows the results of con-trol hybridizations of the gene specific probes to in vitro transcribed sense porA and porB transcripts in order to verify probe specificity.



was necessary to use longer exposures to obtain the com-parative hybridization profiles shown in the figure. Even un-der prolonged exposures, no por gene expression was ob-served in root tissue (data not shown).

When hybridization probes specific for the por A- andporB-type transcripts were used (Fig. 7C), patterns of ex-pression similar to that observed with the coding region pro-be were found (Fig. 7B). The change in steady-state levelsof the porB-type transcripts in greening stem tissue wasequivalent to that observed for the coding region probe,whereas it appeared to take a longer amount of time follow-ing illumination for porA-type transcript levels to reachlevels observed in light-grown stem tissue. Thus, while bothpor A- and porB-type transcripts are expressed, the kineticsof their accumulation differ in some tissues under thelimited set of growth conditions reported here. In a morecomprehensive analysis of por gene expression during devel-opment in loblolly pine, RNA gel blot analysis showed thatporB-type transcripts constitute of majority of por messagein the needles of light-grown mature plants (Skinner andTimko, manuscript in preparation). Along with the ob-served divergence in nucleotide sequence, such subtle differ-ences in the expression of por gene family members inloblolly pine, further support our interpretation that theLP2 gene corresponds to the porB-type gene described inangiosperms, and that the loblolly pine homologs ofpWPnPCR-901 correspond to the possible predecessors ofporA-type genes.

Discussion

In both dicotyledonous and monocotyledonous angio-sperms the size of the por gene family appears to be rela-tively small with 2-4 members present in those plantspecies examined thus far (He 1994, Spano et al. 1992b,Armstrong et al. 1995, Holtorf et al. 1995, Kuroda et al.1996). Based upon their differential expression during pho-tomorphogenesis, the structure of their encoded proteins,and the ability of these proteins to be imported into devel-oping chloroplasts in the absence of substrate (Pchlide),the por genes present in angiosperms have been separatedinto two forms, designated as porA and porB (Armstronget al. 1995, Runge et al. 1996, Reinbothe and Reinbothe1996a, b). In contrast, the results of our genomic DNA hy-bridization analysis and 5'- and 3-RACE experiments showthat a large gene family encodes the PORs in loblolly pine.This gene family consists of two distinct subfamilies that,by analogy to the terminology developed in angiosperms,we have designated as por A and porB. A substantial differ-ence exists in the complexity of the two subfamilies inloblolly pine. While the por A subfamily appears to consistof two or a relatively small number of genes, the porB sub-family contains 10 or more members. We have also foundthat pseudogenes may account for a small portion of the

complexity of the por gene family in loblolly pine.Multiple expressed forms of POR have been reported

previously in other pine species, including white pine(P. strobus L.) and mountain pine (P. mugo) (Spano et al.1992a, Forreiter and Apel 1993). In Norway spruce, twoPOR proteins were detected immunologically follow-ing fractionation of whole cell extracts by SDS-PAGE,whereas six immunoreactive POR proteins could be foundusing two-dimensional PAGE (Stabel et al. 1991). Al-though it is not possible to exclude the possibility that suchPOR isoforms derive from differential modification of asingle gene product, it is more likely that they represent theproducts of distinct genes.

The larger size of the por gene family in loblolly pineand other conifers relative to that found in angiosperm spe-cies is not suprising. In general, gene families in angio-sperms are reported to have fewer members than the corre-sponding gene families in gymnosperms (Kinlaw et al. 1990,1994, Kvarnheden et al. 1995, Kinlaw and Neale 1997). Forexample, approximately 29% of randomly selected cDNAprobes used in mapping studies of the loblolly pine genomehave been shown to detect 10 or more bands in DNAgenomic blots, indicating that these transcripts arise frommembers of multigene families (Devey et al. 1991, 1994,Ahuja et al. 1994, Kinlaw et al. 1994). A subset of thesecDNAs also cross-hybridized with multiple fragments fromgenomic DNA from other pine and conifer species sug-gesting that gene duplication is not unique to loblolly pine.

It has been previously suggested that pseudogenesmight contribute substantially to the formation of thelarger gene family sizes in pines and other gymnosperms.For example, Kvarnheden et al. (1995) reported that in Nor-way spruce, genomic Southern hybridization analysis de-tected at least ten potential family members using a codingregion probe to the cdc2 gene encoding P34cdc2 proteinkinase. However, additional studies using PCR amplifica-tion-based analysis of genomic DNA showed that a substan-tial fraction (50% or more) are likely to be nonfunctionalsince they have characteristics of processed retrospeudo-genes. Similarly, Voo et al. (1995) have reported the pres-ence of a 4-coumarate:CoA ligase pseudogene in loblollypine following cleavable amplified polymorphism analysisof the genome. Kinlaw et al. (1990) have also noted that,while genomic DNA hybridization analysis indicates that alarge gene family encodes alcohol dehydrogenase (ADH) inPinus radiata (Monterey pine), only 2-4 ADH isoformshave been observed by gel electrophoretic analysis.

The presence of two por subfamilies in pine suggeststhat gene duplication and perhaps specialization of func-tion within the por gene family likely occurred prior to thedivergence of angiosperms and gymnosperms. A numberof multigene families have been characterized in gymno-sperms, the composition of which suggests that gene dupli-cation and specialization of family members occurred prior



to the split of gymnosperms and angiosperms (Jansson andGustafsson 1990, Karpinski et al. 1992, Yamamoto et al.1993, Chinn and Silverthorne 1993, Chinn et al. 1995,Kolukisaoglu et al. 1995, Peer et al. 1996). For example,homologs of angiosperm genes encoding type I and type IICAB proteins have been characterized in a number ofgymnosperms, and cab genes encoding all three CAB iso-forms found in angiosperms (i.e., type I, type II, and typeIII CAB proteins) have been identified in Ginkgo biloba(Jansson and Gustafsson 1990, Yamamoto et al. 1993,Chinn and Silverthorne 1993, Chinn et al. 1995, Peer et al.1996). Genes encoding three distinct phytochrome isotypeshave been identified in Norway spruce (Thummler and Dit-trich 1995). Phylogenetic analysis indicated that the phyAand phyB genes likely diverged prior to the evolutionof gymnosperms, whereas phyC likely originated later(Kolukisaoglu et al. 1995). In Scots pine (Pinus sylvestrisL.), distinct gene families encoding cytosolic and chloro-plast isoforms of CuZn-superoxide dismutases (CuZn-SOD) have been found, an organization similar to that ob-served in angiosperms (Karpinski et al. 1992).

The functional significance of having two different porgene subfamilies in gymnosperms remains to be deter-mined. In angiosperms, PORA accumulates to high levelsin etiolated tissues but is absent in mature, fully greened tis-sues. It is thought that PORA functions only at the initialstages of light-induced development, during the transitionfrom etiolated to de-etiolated growth. On the other hand,PORB is constitutively expressed during development andis presumed to be responsible for the reduction of Pchlideduring the later stages of greening, and for chlorophyll for-mation in mature, green tissues (Armstrong et al. 1995,Holtorf et al. 1995). We have assigned the por A or porBdesignation to the various pine cDNAs based on our obser-vation that porB transcripts account for the majority of themRNAs encoding POR in mature needles of 1-2 year-oldloblolly pine trees, whereas por A transcripts constituteonly a small fraction of the total mRNA in these tissues(Skinner and Timko, manuscript in preparation). A lack ofPORA and the presence of PORB in mature, green tissuesis consistent with what has been reported in most angio-sperms. However, other aspects of porA and porB expres-sion in gymnosperms did not follow the general pattern ofexpression observed in angiosperms during light-induceddevelopment. Exposure of dark-grown loblolly pine seed-lings to continuous white light resulted in a small increasein total por transcript abundance in cotyledons and amarked increase in dark-grown stem tissue. Both por A andporB transcript levels were affected similarly, suggestingthat the two gene subfamilies are not under grossly differ-ent regulatory mechanism. Our observation that it takeslonger for por A mRNAs to attain their maximum levels ofaccumulation in the stems of dark-grown seedlings transi-tioned to light compared to porB mRNAs under identical

conditions may reflect the observed difference in size ofthe two subfamilies and/or number of expressed familymembers.

The expression pattern of por A and porB in the cotyle-dons and stems of loblolly pine was essentially identical tothat previously reported in white pine (Spano et al. 1992a),but differed from that observed in mountain pine (Forreiterand Apel 1993). Using a gene-specific probe, Forreiter andApel (1993) reported that the Pml gene of mountain pineencoded a product that decreased upon exposure of dark-grown cotyledon tissue to light. Based on the nucleotide se-quence of its 3-UTR (see Fig. 6), Pml is aporB-type geneand nearly identical to Pt3'PCR-3. The difference in expres-sion observed for Pml and PtS'PCR-S may represent aspecies-specific difference in the manner is which thesetwo highly homologous genes are regulated. Alternatively,since PtS'PCR-S is only one of many porB-type genes inloblolly pine, we may be observing the combined expres-sion of several highly homologous genes in the loblolly pinegenome not distinguishable by this specific probe.

Like most other gymnosperms, loblolly pine has the ca-pacity to form chlorophyll in both a light-dependent andlight-independent manner. The light-independent forma-tion of chlorophyll in dark-grown loblolly pine cotyledonsaccounts for approximately 25% of the total chlorophyllformed in light-grown cotyledons (Spano et al. 1992a).Despite the ability to form substantial amounts of chloro-phyll in the dark, some gymnosperms buildup pools ofPchlide and form prolamellar bodies within etiochloro-plasts, in a manner similar to that found in angiosperms(Selstam and Widell 1986). Since Pchlide and other metallo-porphyrins are known to be extremely susceptible to photo-oxidation when free in solution, it has been proposed thatone possible driving force behind the evolution of two sepa-rate POR enzymes was the necessity to secure the largepools of Pchlide accumulated in angiosperm etioplasts in astate that prevented rapid photooxidative damage duringde-etiolation, but allowed for continued chlorophyll forma-tion in mature tissues in the light (Reinbothe et al. 1996c).The pattern of PORA expression in angiosperms is thoughtto reflect its evolved primary role in preventing photooxida-tive damage during early light-induced development. Al-though gymnosperms are capable of chlorophyll formationin the dark, substantial amounts of Pchlide can still accu-mulate. Therefore, selective pressures would also have ex-isted in these less evolutionarily advanced organisms to de-velop mechanisms for stabilizing the accumulated Pchlide.Accomodating such a need might have contributed to theobserved duplication and divergence in the por gene familyin gymnosperms.

In angiosperms, the expression of many nuclear genesinvolved in photomorphogenesis, including por A, is underthe control of a complex phytochrome-mediated signaltransduction pathway (Reinbothe and Reinbothe, 1996a,



b, Reinbothe et al. 1996a). In gymnosperms, the role ofphytochrome in controlling light-regulated processes isthought to be less dominant. What factors control por ex-pression in loblolly pine and other gymnosperms are notknown at present. Further studies are also necessary todetermine how the light-dependent and light-independentmechanisms for chlorophyll formation are coordinated inorganisms where they operate concurrently. The studiespresented here provide a basis for designing experiments toanswer these questions.

We wish to thank Anthony Spano and Graham Teakle fortheir helpful- suggestions during the course of this work,Mollianne McGahren for her excellent technical assistance,Howard Goodman and Jacques Retief for their help with thephylogenetic analysis, and Bruce Cahoon and Nikolai Lebedevfor their comments on the manuscript. This work was supportedby a grant from the US Department of Energy (DEFG05-94ER20144) awarded to M.P.T. J.S.S. was the recipient of a UVAGraduate School of Arts and Sciences Dissertation YearFellowship.

References

Ahuja, M.R., Devey, M.E., Groover, A.T., Jermstad, K.D. and Neale,D.B. (1994) Mapped DNA probes from loblolly pine can be used forrestriction fragment length polymorphism mapping in other conifers.Theor. Appl. Genet. 88: 279-282.

Apel, K. (1981) The protochlorophyllide holochrome of barley (Hordeumvulgare L.). Phytochrorne-induced decrease of translatable mRNAcoding for the NADPH-protochlorophyllide oxidoreductase. Eur. J. Bio-chem. 120: 89-93.

Armstrong, G.A., Runge, S., Frick, G., Sperling, U. and Apel, K. (1995)Identification of NADPH:protochlorophyllide oxidoreductases A andB: a branched pathway for light-dependent chlorophyll biosynthesis inArabidopsis thaliana. Plant Physiol. 108: 1505-1517.

Batschauer, A. and Apel, K. (1984) The inverse control by phytochrome ofthe expression of two nuclear genes in barley (Hordeum vulgare L.).Eur. J. Biochem. 143: 593-597.

Bauer, C.E., Bollivar, D.W. and Suzuki, J.Y. (1993) Genetic analysis ofphotopigment biosynthesis in eubacteria: a guiding light for algae andplants. / . Bacteriol. 175: 3919-3925.

Chang, S., Puryear, J. and Cairney, J. (1993) A simple and efficientmethod for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11:113-116.

Chinn, E. and Silverthorne, J. (1993) Light-dependent chloroplast develop-ment and expression of a light-harvesting chlorophyll a/6-binding pro-tein gene in the gymnosperm Ginkgo biloba. Plant Physiol. 103: 727-732.

Chinn, E., Silverthorne, J. and Hohtola, A. (1995) Light-regulated andorgan-specific expression of types 1, 2 and 3 light-harvesting complex bmRNAs in Ginkgo biloba. Plant Physiol. 107: 593-602.

Devey, M.E., Fiddler, T.A., Liu, B.-H., Knapp, S.J. and Neale, D.B.(1994) An RFLP linkage map for loblolly pine based on a three-genera-tion outbred pedigree. Theor. Appl. Genet. 88: 273-278.

Devey, M.E., Jermstad, K.D., Tauer, C.G. and Neale, D.B. (1991) In-heritance of RFLP loci in a loblolly pine three-generation pedigree.Theor. Appl. Genet. 83: 238-242.

Fitch, W.M. and Margoliash, E. (1967) Construction of phylogenetic trees.Science 155: 279-284.

Forreiter, C. and Apel, K. (1993) Light-independent and light-dependentprotochlorophyllide-reducing activities and two distinct NADPH-proto-chlorophyllide oxidoreductase polypeptides in mountain pine (Pinusmugo). Planta 190: 536-545.

Fourney, R.M., Miyakoshi, J., Day III, R.S. and Paterson, M.C. (1988)

Northern blotting: efficient RNA staining and transfer. Focus 10: 5-7.Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production

of full-length cDNAs from rare transcripts: amplification using a singlegene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002.

Fujita, Y. (1996) Protochlorophyllide reduction: a key step in the greeningof plants. Plant Cell Physiol. 37: 411-421.

Griffiths, W.T., Kay, S.A. and Oliver, R.P. (1985) The presence and photo-regulation of protochlorophyllide reductase in green tissues. Plant Mol.Biol. 4: 13-22.

He, Z.-H. (1994) Molecular structure of pea NADPHprotochlorophyllideoxidoreductase and its regulation during development. Ph.D. Thesis,University of Virginia.

He, Z.-H., Li, J., Sundqvist, C. and Timko, M.P. (1994) Leaf develop-mental age controls expression of genes encoding enzymes of chlorophylland heme biosynthesis in pea (Pisum sativum L.). Plant Physiol. 106:537-546.

Holtorf, H., Reinbothe, S., Reinbothe, C , Bereza, B. and Apel, K. (1995)Two routes of chlorophyllide synthesis that are differentially regulatedby light in barley (Hordeum vulgare L.). Proc. Natl. Acad. Sci. USA 92:3254-3258.

Jansson, S. and Gustafsson, P. (1990) Type I and Type II genes for thechlorophyll a/6-binding protein in the gymnosperm Pinus sylvestris(Scots pine): cDNA cloning and sequence analysis. Plant Mol. Biol. 14:287-296.

Joshi, C.P. (1987) An inspection of the domain between putative TATAbox and translation start site in 79 plant genes. Nucl. Acids Res. 15:6643-6653.

Karpinski, S., Wingsle, G., Olsson, O. and Hallgren, J.-E. (1992) Charac-terization of cDNAs encoding CuZn-superoxide dismutases in Scotspine. Plant Mol. Biol. 18: 545-555.

Kay, S.A. and Griffiths, W.T. (1983) Light-induced breakdown ofNADPH-protochlorophyllide oxidoreductase in vitro. Plant Physiol.72: 229-236.

Kimura, M. (1980) A simple model for estimating evolutionary rates ofbase substitutions through comparative studies of nucleotide sequences./ . Mol. Evol. 16: 111-120.

Kinlaw, C.S., Gerttula, S.M. and Carter, M.C. (1994) Lipid transfer pro-tein genes of loblolly pine are members of a complex gene family. PlantMol. Biol. 26: 1213-1216.

Kinlaw, C.S., Harry, D.E. and Sederoff, R.R. (1990) Isolation and charac-terization of alcohol dehydrogenase cDNAs from Pinus radiata. Can. J.For. Res. 20: 1343-1350.

Kinlaw, C.S. and Neale, D.B. (1997) Complex gene families in pinegenomes. Trends Plant Sci. 2: 356-359.

Kolukisaoglu, H.O., Marx, S., Wiegmann, C , Hanelt, S. and Schneider-Poetsch, H.A.W. (1995) Divergence of the phytochrome gene familypredates angioserm evolution and suggests that Selaginella andEquisetum arose prior to Psilotum. J. Mol. Evol. 41: 329-337.

Kuroda, H., Masuda, T., Ohta, H., Shioi, Y. and Takamiya, K. (1996)Effects of light, developmental age and phytohormones on the expres-sion of NADPH-protochlorophyllide oxidoreductase in Cucumissativus. Plant Physiol. Biochem. 34: 17-22.

Kvarnheden, A., Tandre, K. and Engstrom, P. (1995) A cdc2 homologueand closely related processed retropseudogenes from Norway spruce.Plant Mol. Biol. 27: 391-403.

Li, Q. and Hunt, A.G. (1995) A near-upstream element in a plant poly-adenylation signal consists of more than six nucleotides. Plant Mol.Biol. 28: 927-934.

Mapleston, E.R. and Griffiths, W.T. (1980) Light modulation of the activ-ity of the protochlorophyllide oxidoreductase. Biochem. J. 189: 125-133.

Moffat, A.S. (1996) Moving forest trees into the modern genetics era.Science 271: 760-761.

Mosinger, E., Batschauer, A., Schafer, E. and Apel, K. (1985) Phyto-chrome control of in vitro transcription of specific genes in isolatednuclei from barley (Hordeum vulgare). Eur. J. Biochem. 147: 137-142.

Mount, S.M. (1982) A catalogue of splice junction sequences. Nucl. AcidsRes. 10: 459-472.

Peer, W., Silverthorne, J. and Peters, J.L. (1996) Developmental and



light-regulated expression of individual members of the light-harvestingcomplex b gene family in Pinuspalustris. Plant Physiol. I l l : 627-634.

Reinbothe, S. and Reinbothe, C. (1996a) The regulation of enzymes in-volved in chlorophyll biosynthesis. Eur. J. Biochem. 237: 323-343.

Reinbothe, S. and Reinbothe, C. (1996b) Regulation of chlorophyll biosyn-thesis in angiosperms. Plant Physiol. I l l : 1-7.

Reinbothe, S., Reinbothe, C , Apel, K. and Lebedev, N. (1996c) Evolutionof chlorophyll biosynthesis—The challenge to survive photooxidation.Cell 86: 703-705.

Reinbothe, S., Reinbothe, C , Lebedev, N. and Apel, K. (1996a) PORAand PORB, two light-dependent protochlorophyllide-reducing enzymesof angiospenn chlorophyll biosynthesis. Plant Cell 8: 763-769.

Reinbothe, S., Reinbothe, C , Neumann, D. and Apel, K., (1996b) Aplastid enzyme arrested in the step of precursor translocation in vivo.Proc. Natl. Acad. Sci. USA 93: 12026-12030.

Reinbothe, S., Reinbothe, C , Runge, S. and Apel, K. (1995b) Enzymaticproduct formation impairs both the chloroplast receptor-binding func-tion as well as translocation competence of the NADPH:protochloro-phyllide oxidoreductase, a nuclear-encoded plast precursor protein. / .CellBioI. 129: 299-308.

Reinbothe, S., Runge, S., Reinbothe, C , van Cleve, B. and Apel, K.(1995a) Substrate-dependent transport of the NADPH:protochlorophyl-lide oxidoreductase into isolated plastids. Plant Cell 7: 161-172.

Runge, S., Sperling, U., Frick, G., Apel, K. and Armstrong, G.A. (1996)Distinct roles for light-dependent NADPH:protochlorophyllide oxidore-ductases (POR) A and B during greening in higher plants. Plant J. 9:513-523.

Saitou, N. and Nie, M. (1987) The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: alaboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, New York.

Santel, H.-J. and Apel, K. (1981) The protochlorophyllide holochrome of

barley (Hordeum vulgare L.). The effect of light on the NADPH:proto-chlorophyllide oxidoreductase. Eur. J. Biochem. 120: 95-103.

Selstam, E. and Widell, A. (1986) Characterization of prolamellar bodies,from dark-grown seedlings of Scots pine, containing light- andNADPH-dependent protochlorophyllide oxidoreductase. Physiol. Plant.67: 345-352.

Spano, A.J., He, Z.-H., Michel, H., Hunt, D.F. andTimko, M.P. (1992b)Molecular cloning, nuclear gene structure and developmental expressionof NADPH:protochlorophyllide oxidoreductases in pea (Pisum sativumL.) Plant Mol. Biol. 18: 967-972.

Spano, A.J., He, Z.-H. and Timko, M.P. (1992a) NADPH:protochloro-phyllide oxidoreductases in white pine (Pinus strobus) and loblolly pine(P. taeda). Evidence for light and developmental regulation of expres-sion and conservation in gene organization and protein structure be-tween angiosperms and gymnospenns. Mol. Gen. Genet. 236: 86-95.

Stabel, P., Sundas, A. and Engstrom, P. (1991) Cytokin treatment of em-bryos inhibits the synthesis of chloroplast proteins in Norway spruce.Planta 183: 520-527.

Stephen, D., Jones, C. and Schofield, J.P. (1990) A rapid method for iso-lating high quality plasmid DNA suitable for DNA sequencing. Nucl.Acids Res. 18: 7463-7464.

Thummler, F. and Dittrich, P. (1995) Phytochrome represents a small genefamily in Picea abies: six partial sequences (Accession No. U38363 toU38368) encoding at least three different phytochrome isotypes. PlantPhysiol. 109: 1498.

Voo, K.S., Whetten, R.W., O'MaUey, D.M. and Sederoff, R.R. (1995) 4-Coumarate:Coenzyme A ligase from loblolly pine xylem. Isolation, char-acterization and complementary DNA cloning. Plant Physiol. 108: 85-97.

Yamamoto, N., Kojima, K. and Matsuoka, M. (1993) The presence of twotypes of gene that encode the chlorophyll a/6-binding protein (LHCPII)and their light-independent expression in pine (Pinus thunbergii). PlantCell Physiol. 34: 457-463.

(Received November 18, 1997; Accepted May 7, 1998)


loblolly pine (pinus taeda l.) contains multiple expressed genes

Documents