Animal Genetics 1992, 23,241-250

Linkage of hyperkalaemic periodic paralysis in Quarter horses to the horse adult skeletal muscle sodium channel gene

J . A. RUDOLPH,* S. J . SPIER,? G. BYRNS? & E. P. HOFFMAN*

*Departments of Molecular Genetics & Biochemistry, Human Genetics and Pediatrics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania and tSchool of Veterinary Medicine, University of California, Davis, California, USA

Summary. A genetic disease observed in certain Quarter horses is hyperkalaemic periodic paralysis (HYPP). This disease causes attacks of paralysis which can be induced by ingestion of potassium. Recent studies have shown that HYPP in humans is due to single base changes within the adult skeletal muscle sodium channel gene. A large Quarter horse pedigree segregating dominant HYPP was studied to determine if mutations of the sodium channd gene are similarly responsible for HYPP in horses. We used cross-species, PCR-mediated, cDNA cloning and sequencing of the horse adult skeletal muscle sodium channel a-subunit gene to identify a polymor- phism, and then used this polymorphism to see if the horse sodium channel gene was genetically linked to HYPP in horses. The sodium channel gene was indeed found to be tightly linked to HYPP (LOD = 2.7, 8 = 0). Our results suggest that HYPP in horses involves the same gene as the clinically similar human disease, and indicates that these are homologous disorders. The future identification of the specific sodium channel mutation causing HYPP in Quarter horses will permit the development of accurate molecular diagnostics of this condition, as has been recently shown for humans. Keywords: hyperkalaemic periodic paralysxs, neuromuscular disease, horse genetics, adult skeletal muscle sodium channel, gene linkage

Introduction

HYPP in horses is an autosomal dominant disorder characterized by episodic attacks of muscle tremors, weakness and paralysis, with associated increased serum potassium concentration. Attacks often occur following diet changes, fasting, stressful circumstances or after the consumption of alfalfa, hay which is high in potassium (Steiss & Naylor 1986; Spier et al. 1990). Attacks can also be precipitated by raising serum potassium, either through ingestion or injection of potassium salt

Correspondence: E.P. Hoffman, Biomedical Science Tower W1211, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, [JSA. Accepted 3 March 1992

241

242 J. A. Rudolph et al.

solution. Between attacks, serum electrolyte concentrations and the horses’ physical appearance and demeanour are normal (Spier ef al. 1990).

A clinically similar disorder in humans was first recognized as an autosomal dominant genetic disease in the 1950s (Gamstorp 1956). HYPP in humans (also called adynamia episodica hereditaria, or Gamstorp’s disease) is also characterized by attacks of paralysis which can be variably precipitated by potassium intake, rest after exercise, fasting or cold temperatures (Rudel 1986). A late-onset progressive myopathy is also a variable finding. Given the clinical heterogeneity, it was not known until very recently that all cases of HYPP in humans are in fact genetically homogeneous.

Electrophysiological studies have shed considerable insight into the basic muscle defect in both the horse and human disease. Electromyographic studies of muscle have demonstrated numerous abnormalities including increased insertional activity and spontaneous activity (myotonic discharges, complex repetitive discharges) in both affected horses and some humans (Spier et al. 1990; Rudel 1986; Steiss & Naylor 1986). During severe attacks, the muscle is unable to elicit either voluntary or electrically induced contractions (Rudel 1986). These clinical electrophysiological findings suggested an abnormality of the muscle membrane conduction system. In vitro studies of biopsied muscle fibres or cultured muscle cells from patients have shown that the resting membrane potential in both horses and humans is different from normal muscle: increased extracellular potassium results in an excessive depolarization of the muscle membrane (Lehmann-Horn et al. 1983,1987; Pickar et al. 1991). The abnormal change in the membrane potential could be abolished in both horse and human muscle with tetrodotoxin, a toxin known to block specifically the adult form of the skeletal muscle sodium channel. Patch-clamp electrophysiolo- gical studies have further implicated the adult skeletal muscle sodium channel in this disease: increased extracellular potassium causes a subpopulation of sodium channels to enter a non-inactivating mode (Lehmann-Horn et al. 1983,1991; Cannon etal. 1991). It has been suggested that the persistent internal Na+ currents conducted by these non-inactivating sodium channels further lower the membrane potential, which causes even more abnormal channels to enter a non-inactivating mode. This process is thought to reduce the membrane potential to a threshold where normal sodium channels become inactive (the dominant nature of the disorder dictates that both normal and abnormal sodium channels exist in the same fibres). Thus, during a fulminant attack, the muscle membrane becomes inexcitable.

Functional sodium channels consist of a single a subunit (Hille 1984). The human adult skeletal muscle sodium channel fy subunit was recently isolated and sequenced by PCR-amplification of human sodium channel mRNA using muscle biopsies as starting material (Wang et al. 1992). Sequence polymorphism of the human sodium channel cDNAs have been found to be tightly linked to hyperkalaemic periodic paralysis in humans in all eight families studied to date (combined LOD = 24.3 at 8 = 0) , suggesting that the disease is genetically homogeneous despite clinical variability (Fontaine et al. 1990; Koch et al. 1991b; Ptacek el al. 1991b). Moreover, paramyotonia congenita, a human autosomal dominant disorder characterized by cold-induced myotonia, has also been shown to be tightly linked to the sodium

HYPP in Quarter horses 243

channel gene in all 18 families studied (combined LOD = 31-3 at 8 = 0) (Koch etal. 1991a; Ptacek et al. 1991a). The mutation causing HYPP in two families has been identified: a single base substitution resulting in a Valine to Methionine change in the sodium channel protein (Rojas et al. 1991).

To determine if the horse disease is similarly caused by mutations of the skeletal muscle sodium channel protein, we have used cross-species PCR from mRNA from horse muscle biopsies to begin to clone and sequence the horse channel. We identified a silent polymorphism in the horse channel which simultaneously created and destroyed specific restriction enzyme sites. We used the presence or absence of the polymorphism to conduct a linkage analysis of a large Quarter horse pedigree segregating hyperkaelaemic periodic paralysis. We present strong evidence suggest- ing that the horse sodium channel is indeed responsible for this dramatic disease.

Methods

Horses Four Quarter horses (one stallion, three mares) with HYPP were donated to the Equine Research Laboratory, University of California, Davis. Diagnosis of HYPP was established by documentation of hyperkalaemia in association with typical clinical signs or by precipitation of (attacks by oral potassium chloride provocative testing. Fifteen offspring were produced from matings of these affected horses to normal horses. The offspring were studied as described (Spier et al. 1992).

Cross-species cDNA cloning The protocol used for cross-species PCR mediated cDNA cloning and sequencing was carried out as previously described (Fontaine etal. 1990; Rojas et al. 1991; Wang et al. 1992). A schematic flow chart summarizing this approach is shown in Fig. 1. Intercostal muscle biopsies were obtained from an HYPP-affected and two normal horses. RNA was isolated and reverse transcribed using avian reverse transcriptase and an oligo dT primer. The muscle cDNA was used as a template for the polymerase chain reaction (PCR) using rat primers designed from the rat sodium channel cDNA sequence (Trimmer et al. 1989). Restriction sites were built into the primers, permitting directional cloning into M13mp18 and M13mp19 vectors. Clones were sequenced enzymatically using the dideoxy chain-termination protocol with 35S- dATP.

Linkage analysis Genomic DNA was extracted from peripheral blood using either the salting out procedure (Miller et al. 1988) or proteinase Wnon-ionic detergent procedure (Higuchi 1989). PCR reactions were carried out with approximately l ~ g DNA, primers flanking the polymorphism, and GeneAmp kits from Cetus Corp, Norwalk,

244 J. A. Rudolph et al.

H Y P P in Quarter horses 245

CT, USA. The primers were specifically designed from 5' and 3' flanking regions directly from the horse sequence and read as follows:

Forward primer: ATCITCTITGTGGTGATCATT?TCC

Reverse primer: CCTTCTCCAGCTCCTCCTGCTGCIT

After amplification, the PCR products were phenolkhloroform extracted and ethanol precipitated. The samples were digested to completion with either Rma I and ScrFI (NE Biolabs, Beverly, MA, USA). RmaI digested samples, with uncut fractions as a control, were run on 1% Sea Kem, 2% NuSieve gels. ScrFI digestions were electrophoresed on 6% acrylamide/TBE native gels.

Results of the digests were scored for the presence of an adenine or guanine nucleotide at the site of the polymorphism. Haplotype results for each horse were entered into the 'Linkage' computer program, and the LOD scores at varying recombination fractions (8) were determined (Lathrop et al. 1984).

Results

Identification of polymorphism A polymorphism was found while sequencing the region of the horse sodium channel cDNA between amino acids 413 and 547: two clone populations of approximately equal frequency at a single nucleotide position were found (Fig. 1). Clones from this region contained either an A or G in the third position of Leu437 codon. Because this substitution was found in both normal and affected horses, and it did not change the amino acid coded by the corresponding codon: this change was a benign polymor- phism. The A to G polymorphism was noted to change restriction enzyme sites: Rma I cut when an A nucleotide was present (cctAg), while ScrFI cut when a G was present (cctGg). PCR primers weire constructed flanking the polymorphism, and a 181 basepair fragment containing the site was amplified from genomic DNA isolated from horse peripheral blood.

-

Genotyping of pedigree and linkage analysis Examples of results of the RmaI and ScrFI digestions of horse PCR products are shown in Fig. 2. Horses homozygous for a G show only the undigested 181-bp PCR product when analysed with Rma I , horses heterozygous ( N G ) show fragments of 181,126 and 55 bp, while horses homozygous for an A show only the 126- and 55-bp digestion fragments. Scr FI completely digests the PCR products of horses homozy- gous for G into fragments of 80,45,30 and 25bp in length, horses heterozygous at

Figure 1. Cross-species cDNA cloning and identification of a horse sodium channel polymorphism. As shown in the sequencing gel in the lower part of this figure, sequencing of cDNA clones revealed two populations of clones: either an A or a G residue is present at Leu 437.

246 J . A. Rudolph et al.

Figure 2. Analysis of the polymorphism in the Quarter horse HYPP pedigree. Panel A . Shown are RmaI digests of PCR products of the indicated horses (see Fig. 3). An example of each of the three genotype possibilities of the Leu 437 polymorphism is shown. 111-1 is the sire in all three cases, and the dam is shown adjacent to the corresponding foal. In each casc. uncut controls art' shown. Panel R . Shown are ScrFI digests of PCR products uf the same individuals in panel A .

this position show an additional band at 75 bp. and horses homozygous for A show only 80-. 75- and 25-bp fragments. The results of genotyping of the entire pedigree are shown in Fig. 3. A total of 10 informative meioses were found. Eight additional horses from four matings were analysed but not shown: these horses were not sired by 111-1, made the pedigree difficult (Fig. 3) to understand, and were uninformative for the polymorphism (data not shown). The disease was always found to be associated with the G allele, with n o recombinants. The pedigree data were analysed using MLINK (Lathrop el ul. 1984) at different recombination fractions (0) . The peak LOD score was determined to be 2.7 at 0 = 0.

The mating of two affected horses resulted in two afflicted offspring (IV-13 and 1V-14 in Fig. 3). Thus, both IV-13 and IV-14 were possible homozygotes for the disease. Our linkage data show that IV-13 must be a heterozygote, while IV-14 may be either a heterozygote or homozygote.

I 11

l1 I i2

I r3

I

a

n,

iii

4

Figu

re 3

. Qua

rter

hor

se p

edig

ree

segr

egat

ing

dom

inan

t HY

PP w

ith g

enot

ypes

of t

he p

olym

orph

ism

at L

eu 4

37. M

atin

gs of

aff

ecte

d ho

rses

111

-1 a

nd I

114

with

un

affe

cted

hor

ses

prod

uced

10

info

rmat

ive

offs

prin

g: I

V-1

, IV

-3, I

V-4

, IV

-5, I

V-6

, IV

-9, I

V-1

0, I

V-1

1, I

V-1

2, a

nd I

V-1

7. T

he d

isea

se i

s al

way

s se

en t

o co

-seg

rega

te w

ith th

e 'G

' alle

le. T

he p

eak

LO

D sc

ore

was

2.7

at 8

= 0

, sug

gest

ing

the

sodi

um ch

anne

l gen

e is

resp

onsi

ble

for

the

dise

ase.

248 J . A. Rudolph et al.

Discussion

We have shown that the mutation responsible for HYPP in Quarter horses probably resides in the adult skeletal muscle sodium channel cx subunit gene. Our results are significant at a number of levels. First, we used a novel strategy to identify quickly a polymorphism which can be used for linkage studies: namely cross-species PCR- mediated cDNA cloning and sequencing. In addition, we were able to conduct successfully a molecular genetic linkage study in horses which localizes the mutation for HYPP in a specific gene, the horse skeletal muscle sodium channel. To our knowledge, this is the first molecular genetic linkage study conducted in horses.

Our results suggest that HYPP in Quarter horses is a true animal model for the same condition in humans. While the human and horse condition are clinically similar, recent studies of homologous disorders in man and animal have shown that the same genetic/biochemical defect does not necessarily show similar clinical findings in different species. To take two dramatic examples, deficiency of the muscle cytoskeletal protein ‘dystrophin‘ causes progressive muscle loss and an early death in humans (Duchenne muscular dystrophy) (Hoffman et al. 1987, 1988). To the contrary, dystrophin-deficiency in mice causes no overt clinical phenotype (Hoffman rt a/. 1987), while it causes dramatic progressive muscular hypertrophy in cats (Carpenter et al. 1989; Gaschen et al. 1992). Dystrophin-deficient dogs show a muscle wasting disease that is even more severe than that of humans (Cooper et al. 1988). A second example is Lesch-Nyhan syndrome (hypoguanine phosphoribo- transferase deficiency). This human disease causes dysmorphic features, mental retardation, and self-mutilatory behaviour. HGPRT-deficient mice, on the other hand, appear normal (Hooper et af . 1987; Kuehn et al. 1987). Thus, genetidbioche- mica1 homology does not necessarily reflect clinical features. Contrary to these examples, we have shown that HYPP in humans and horses is a homologous disorder at both the genetic and clinical levels.

Recently, it has become possible to elucidate the molecular aetiology of human inherited disease using a purely genetic approach, ‘positional cloning’. This approach searches the genome to find DNA probes which show linkage to a disease, and has proven most successful for frequent recessive disorders, such as Duchenne muscular dystrophy (Koenig ef al. 1987), and cystic fibrosis (Rommens et al. 1989), where most mutations completely inactivate the gene. Some of these ‘loss-of- function’ mutations involve easily detectable structural alterations of the gene, which greatly aid the localization and ultimate identification of the responsible gene. Positional cloning for dominant disorders has proven less effective. For example, the gene for Huntington’s chorea was localized in the early 1980s, yet the specific gene has not yet been identified. The problem is that dominant mutations usually involve change-of-function mutations: small alterations in DNA sequence that do not inactivate the gene, but instead alter the function of the resulting protein product in some manner. Thus, most dominant diseases are caused by single point mutations which can be very difficult to find when given only a general localization often involving millions of base pairs.

An alternative to the positional cloning approach is the ‘candidate gene approach’. This approach is based on two assumptions: sequence data already exist

HYPP in Quarter horses 249

for a significant number of genes, and something is known about the pathophysiology of the disorder being studied. We took advantage of the published rat sodium channel sequene, and the electrophysiological data implicating the sodium channel in HYPP, to employ the candidate gene approach in this dramatic horse disease. We were successful in showing that HYPP is most probably caused by mutations of the horse sodium channel gene. At this time, there are 175000000bp of nucleotide sequence data in Genbank. This growing resource of sequence information together with improved techniques of investigating cellular defects in disease states suggest that the ‘candidate gene approach’ will become an increasingly viable method of investigation for genetic disorders, particularly in species which are poorly defined genetically, such as horses.

It can be safely assumed that the identification of the specific mutation in Quarter horses will follow in the very near future. The identification of this mutation will permit rapid and accurate diagnosis of this condition in horses. This will preclude potassium challenge or other clinical tests which are currently required to diagnose this disease.

Acknowledgements

We thank Cecilia Rojas and Jianzhou Wang for valuable discussion and comments on the manuscript. Supported by grants from the NIH (AR41025 to EPH), the Muscular Dystrophy Association (EPH), and the Equine Research Laboratory, University of California, Davis (SJS).

References

Cannon S.C., Brown R.H. & Corey D.P. (1991) A sodium channel defect in hyperkalemic periodic paralysis: potassium induced failure of inactivation. Neuron 6 , 619-26.

Carpenter J.L., Hoffman E.P., Romanul F.C.A., Kunkel L.M., Rosales R.K., Ma N.S.F., Dasbach J.J., Rae J.F., Moore F.M., McAfee M.B. & Pearce L.K. (1989) Feline muscular dystrophy with dystrophin deficiency. American Journal of Pathologji 135, 909-19.

Cooper B.J., Winand N.J., Stedman H., Valentine B.A., Hoffman E.P., Kunkel L.M., Scott M.O., Fischbeck K.H., Kornegay J.N., Avery R.H. , Williams J.R., Schmickel R.D. &Sylvester J.E. (1988) The homologue of the Duchenne locus is defective in X-linked muscular dystrophy of dogs. Narure334, 154-6,

Fontaine B., Khurana T.S., Hoffman E.P., Bruns G.A.P., Haines J.L., Trofatter J.A., Hanson M.P., Rich J. , McFarlane H. , Yasek D.M., Romano D., Gusella J.F. & Brown R.H. (1990) Hyperkalemic periodic paralysis and the adult muscle sodium channel a-subunit gene. Science 250, 1000-2.

Gamstorp I. (1956) Adynamia episodica hereditaria. Acfa Paediafrica Scandinavica (Suppl.), 1-126. Gaschen F.P., Hoffman E.P., Gorospe J .R . , Cardinet G. , Uhl E.W., Senior D.F. & Pearce L.K. (1992)

Dystrophin deficiency in cats causes lethal muscular hypertrophy. Journal of the Neurological Sciences (in press).

Guy H.R. & Conti F. (1990) Pursuing the structure and function of voltage-gated channels. Trends in Neurosciences 13,201-6.

Higuchi R. (1989) Rapid, efficient DNA extraction for PCR from cells or blood. In: Amplifications - A Forum for PCR Users (Issue 2) Cetus Corporation, Norwalk, Connecticut.

Hille B. (1984) Ionic Channels of Excitable Membrane. Sinauer, Sunderland, Massachusetts. Hoffman E.P., Brown R.H. & Kunkel L.M. (1987) Dystrophin: the protein product of the Duchenne

muscular dystrophy locus. Cell 51,919-28. Hoffman E.P., Fischbeck K.H.. Brown R.H., Johnson M., Medori R., Loike J .D. , Harris J .B..

Waterston R., Brooke M., Specht L.. Kupsky W., Chamberlain J . . Caskey C.T., ShapiroF. & Kunkel

250 J . A . Rudolph et al.

L.M. (1988) Dystrophin characterization in muscle biopsies from Duchenne and Becker muscular dystrophy patients. New England Journal of Medicine 318, 1363-8.

Hooper M., Hardy K., Handyside A., Hunter S. & Monk M. (1987) HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326,292-5.

Koch M.C., Ricker K . , Otto M., Grimm T., Bender K . , Zoll B., Lehmann-Horn F. , Rudel R., Harper P.S. &Hoffman E.P. (1991a) Linkage datasuggesting allelic heterogeneity for paramyotoniacongenita and hyperkaemic periodic paralysis on chromosome 17. Human Genetics 88 ,714 .

Koch M.C., Ricker K., Otto M., Grimm T., Hoffman E.P., Rudel R., Bender K., Zoll B . , Harper P.S. & Lehmann-Horn F. (1991 b) Confirmation of linkage of hyperkalemic periodic paralysis to chromosome 17. Journal of Medical Genetics 28, 583-6.

Koenig M., Hoffman E.P., Bertelson C.J. , Monaco A.P., Feener C. & Kunkel L.M. (1987) Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50, 509-17.

Kuehn M.R., Bradley A., Robertson E.J. & Evans M.J. (1987) A potential animal model for Lesch-Nyhan syndrome through introduction of HPRT mutations into mice. Nature, 326,295-8.

Lathrop G.M., Laloeul J.M., Julier C. & Ott J . (1984) Strategies for multilocus linkage analysis in humans. Proceedings of the National Academy of Sciences of the USA 81, 3442-6.

Lehmann-Horn F., Iaizzo P.A., Hatt H. & Franke C . (1991) Altered gating and conductance of Na+ channels in hyperkalemic periodic paralysis. Ppueger’s Archives 418, 297-9.

Lehmann-Horn F.. Kuther G., Ricker K., Grafe P., Ballanyi K. & Rudel R . (1987) Adynamia episodica hereditaria with myotonia: a non-inactivating sodium current and the effect of extracellular pH. Muscle and Nerve 10, 363-74.

Lehmann-Horn F., Rudel R., Ricker K. , Lorkovic H., Dengler R. & Hopf H . (1983) Two cases of adynamia episodica hereditaria: in vitro investigation of muscle cell membrane and contraction parameters. Muscle and Nerve 6 , 113-21.

Miller S.A. , Dykes D.D. & Polesky H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 16, 1215.

Pickar J.G., Spier S.J., Snyder J.R. & Carlsen R.C. (1991) Altered ionic permeability in skeletal muscle from horses with hyperkalemic periodic paralysis. American Journal of Physiology (Cell Physiology) 260, (326-33.

Ptacek L.J., Trimmer J.S., Agnew W . S . , Roberts J.W., Petajan J.H. & Leppert M. (1991a) Paramyotonia congenita and hyperkalemic periodic paralysis map to the same sodium channel gene locus. American Journal of Human Genetics 49,851-4.

Ptacek L.J., Tyler F. , Trimmer J.S., Agnew W.S. & Leppert M. (1991b) Analysis in a large hyperkalemic periodic paralysis pedigree supports tight linkage to a sodium channel locus. American Journal of Human Genetics 49, 37G82.

RojasC.V., Wang J., Schwartz L.S., Hoffman E.P., Powell B.R. & Brown R.H. (1991) A methionine to valine mutation in the skeletal muscle sodium channel a-subunit in human hyperkalemic periodic paralysis. Nature 354, 387-9.

Rommens J.M., Iannuui M.C., Kerem B., Drumm M.L., Melmer G., Dean M., Rozmahel R., Cole J.L., Kennedy D., Hidaka N. , Zsiga M., Buchwald M., Riordan J.R., Tsui L. & Collins F.S. (1989) Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245, 1059-65.

Rudel R. (1986) The pathophysiologic basis of the myotonias and the periodic paralyses. In: Myologyc Basic and Clinical (ed. by A.G. Engel & B.Q. Banker), pp. 1297-311. McGraw-Hill, New York.

Spier S.J., Carlson G.P., Harrold D., Bowling A , , Byrns G . , Hughes J.P. & Bernoco D. (1992) Hyperkalemic periodic paralysis (HYPP) in horses: genetic studies. Submitted.

Spier S.J., Carlson G.P., Holliday T.A. etal. (1990) Hyperkalemic periodic paralysis in horses. Journal of the American Veterinary Medical Association 1 9 7 , 1 W 1 7 .

Steiss J .E. & Naylor J.M. (1986) Episodic muscle tremors in a Quarter Horse: resemblance to hyperkalemic periodic paralysis. Canadian Veterinary Journal 27, 332-5.

Trimmer J.S., Cooperman S.S . , Tomiko S. A., Zhou J . , Crean S.M., Boyle M.B., Kalien R.G., Sheng Z., Barchi R.L., Sigworth F.J., Goodman R.H., Agnew W.S. & Mandel G. (1989) Primary structure and functional expression of a mammalian skeletal muscle sodium channel. Neuron 3, 33-49.

Wang J. , RojasC.V., Zhou J . , Schwartz L.S., NicholasH. &Hoffman E.P. (1992)Seqenceandgenomic structure of the adult skeletal muscle sodium channel a subunit gene on 17q. Biochemical and Biophysical Research Communications 182,794-801.