let’s talk about sars-cov-2 related products! · 2020. 4. 6. · w is a/t; r is g/a; m is a/c ;...
TRANSCRIPT
-
Dear customer, Due to the escalating COVID-19 crisis, BioNordika has committed to help authorities and companies doing related research and diagnosing the disease.
What can we offer to help you?
We distribute several products for studying the virus, both for COVID-2019 testing, for vaccine/therapeutic development and in basic research. We want to help as much as we can by keeping you updated on the alternative test methods available and other products currently available in the market. We will secure you the availability of the products you need to carry out the research, in form of reliable, fast deliveries and keep stock if needed. Let us know what you need, and we will do our best to help you and make your grants go longer.
We here present an overview of some of what we can offer.
SARS-CoV-2 primers and probes (Eurogentec)SARS-CoV-2 test kits (LOXO, AusDiagnostics, and GenScript)Proteins and Antibodies for COVID-19 Research (Rockland, Genscript, Origene, CST)Plasmids for SARS-CoV-2 Detection and Research (Origene, Genscript)RNA Extraction kits (NEB MONARCH)qPCR and RT-qPCR kits (NEB Luna)Rapid detection of COVID-19 (NEB LAMP)NGS sequencing (NEBNext)Cell and media solutions to study SARS CoV-2 (Lonza)
If you and your colleagues could be interested in knowing more, please feel free to contact us.
Best regards,
Maria Kam Eriksen, Cand.scient.Product [email protected]: +45 2244 8243
Marianne Møller Brorson, Ph.d., Cand.scient.Product [email protected]: +45 3140 0171
Anja Fjorback, Ph.d., Cand.scient.Area Sales [email protected]: +45 2381 1912
Tram Nguyen, Cand.scient.Product [email protected]: +45 3124 8581
Let’s talk about SARS-CoV-2 related products!
-
Do you need probes and primers for screening of Corona virus?
Eurogentec has a continuous production of pre-IVD grade primers and probes which normally can be shipped within a few days. The primers and probes are according to the reference protocol published by WHO, spanning the E gene, and RdRP gene.
See the protocol here.
All primers and probes are produced in clean room (ISO 8 – class 100 000) and in compliance with ISO13485. Primers and probes are purified using RP-HPLC and checked by QC MS. Tubes are labelled with oligo name, batch number, volume and concentration. Besides the usual QC performed on Eurogentec oligonucleotides, an extra functional assay by qPCR will be per-formed on these specific batches in order to detect any possible contamination.The synthetic E gene as positive control is also available upon request.
All types of overlapping primer pairs that span parts of the entire genome can be custom ordered.Contact us for information about the ordering proces.
Sequences can be seen below:
Assay/Use Oligonucleotide ID Sequence (5’-3’)
RdRP gene RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA
RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ
RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ
W is A/T; R is G/A; M is A/C ; FAM, 6-carboxyfluorescein; BBQ, blackberry quencher
Primers and probes for SARS-CoV-2
https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf?sfvrsn=a9ef618c_2https://secure.eurogentec.com/eu-home.html
-
See all comprehensive services and products which would be useful for your research. Most of them are in-stock and can be shipped immediately once ordered!
SARS-CoV-2 qRT-PCR Detection Assay
The qRT PCR detection assay is based on GenBank Sequence NC_045512.2. This assay has successfully detected SARS-CoV-2 in positive control samples ORF1ab, RdRP, N and E genes.Customized detection primers and probes for all 4 genes.
More details »
SARS-CoV-2 Spike S1-RBD IgG&IgM ELISA Detection Kit
SARS-CoV-2 Spike S1-RBD IgG&IgM ELISA Detection Kit is an indirect ELISA detection tool which can be used for evaluation of IgG or IgM against SARS-CoV-2 Spike S1-RBD in samples. Please download the product manual for more details or contact us.
Plasmids for SARS-CoV-2 Detection and Research
Positive control plasmids of qPCR detection assayGenes encoding the surface glycoprotein nucleocapsid phosphoproteinHomo sapiens angiotensin I converting enzyme 2 (ACE2) gene for vaccine and antibody development
More details »
Proteins and Antibodies for COVID-19 Research
• Customized proteins• Catalog products of antiges and antibodies
Detection kits and antibodies for SARS-CoV-2
https://www.genscript.com/?src=google&gclid=EAIaIQobChMI_Ozih9ew6AIVQeWaCh3e4gRiEAAYASAAEgIGifD_BwEhttps://www.genscript.com/2019-ncov-qrt-pcr-detection-assay.htmlhttps://www.molecularcloud.org/How-to-detect-the-2019-novel-coronavirus.htmlhttp://bionordika.dk/pages/staff.aspxhttps://www.molecularcloud.org/How-to-detect-the-2019-novel-coronavirus.htmlhttps://www.molecularcloud.org/How-to-detect-the-2019-novel-coronavirus.html#SARS-CoV-2https://www.genscript.com/virus_antigens.html
-
We are happy to welcome Ausdiagnostics at BioNordika. Having AusDiagnostics in our portfolio means that Bi-oNordika is now able to offer CE-IVD kits. AusDiagnostics is a large player on the Australian market. They are also starting to become an established player in Europe. BioNordika has recently signed up with AusDiagnostic and we are now able to supply AusDiagnostic products to the Danish Healthcare system. Respiratory pathogens, Enteric infections, Parasites Meningitis, Encephalitis, Sepsis, Bacterial resistance. HPV, STI, Dermatophytes, HPV genotyping. Please contact us for more information.
AusDiagnostics supply RuO panel to detect nCoV
AusDiagnostics has produced a RuO panel that detects and differentiates between NL63, OC43, HKU-1, 229E, SARS MERS and 2019-nCoV.
The kit has been tested in Australia, with real positive samples and it is detecting the Wuhan strain. An AusDiagnostic HighPlex system is placed on Christmas Island in collaboration with the military. All quarantined individuals will be tested using AusDiagnostics kits.
The panel can only be used with AusDiagnostics HighPlex system.
More information about AusDiagnostics
Respiratory pathogens Entheric infections Meningitis Encephalitis Bacterial resistance
Parasites Sepsis HPV STI
New supplier and RUO panel for nCoV
https://www.ausdiagnostics.com/https://www.ausdiagnostics.com/https://www.ausdiagnostics.com/respiratory-pathogens.htmlhttps://www.ausdiagnostics.com/faecal-pathogens.htmlhttps://www.ausdiagnostics.com/encephalitis-menigitis-herpes.htmlhttps://www.ausdiagnostics.com/bacterial-resistance.htmlhttps://www.ausdiagnostics.com/faecal-pathogens.htmlhttps://www.ausdiagnostics.com/bacterial-resistance.htmlhttps://www.ausdiagnostics.com/hpv.htmlhttps://www.ausdiagnostics.com/urinogenital.html
-
Loxo offers a CE marked PCR based test to detect the Corona Virus SARS-CoV-2. Main product features:• Real-time PCR-Kit (art.no. 200109, code #HBRT-COVID-19) 24 tests/kit• Detection of COVID-19 (ORF1ab und N Region)• CE marked (March 2020)• Nasopharyngeal swab and Sputum samples can be used for testing• Runs on any commercial Real-Time PCR instrument with FAM, HEX/JOE (2 channels). If you are interested in this product, please send us an email ([email protected]) and we will send you product specifications and/or a quote. Go to the Loxo website here
SARS-CoV-2 CE-marked test kit
Rockland’s existing antibodies developed for the 2002 SARS strain present opportunities for immediate deploy-ment. Antibodies to SARS, like Anti-SARS-CoV Membrane Protein or Anti-SARS-CoV Nucleocapsid Protein may pro-vide the means of detection with the current strain because of their high homology—particularly the sequences within the membrane and nucleocapsid.
SARS-CoV-2 antibodies
For SARS, the ACE2 receptor was identified as a mecha-nism by which the SARS virus entered cells—and although ACE2 has not been definitively determined as the sole means of entry for the current strain, Rockland’s antibod-ies against ACE2 can play a critical piece in understanding the mechanism of infection.
View all SARS and ACE2 Antibodies here:
http://www.loxo.de/https://www.loxo.de/https://rockland-inc.com/immunology.aspxhttps://rockland-inc.com/immunology.aspxhttps://rockland-inc.com/store/Infectious-Disease-Antibodies-100-401-A55-O4L_3575.aspxhttps://rockland-inc.com/store/Infectious-Disease-Antibodies-200-401-A50-O4L_3382.aspxhttps://rockland-inc.com/ProductSearch.aspx?SearchText=ACE2https://rockland-inc.com/ProductSearch.aspx?SearchText=ACE2https://rockland-inc.com/ProductSearch.aspx?SearchText=SARS&ACE2
-
Euroclone offers a wide range of high-quality PCR consumables, that are suitable for a variety of thermal cyclers, real-time PCR systems and sequencers for optimal cycling performing.
96-well plates384-well plates8-tube stripsAdhesive sealing films and foils
Further features and details are available upon request.All plastic consumables are produced under clean-room conditions and undergo a wide range of QC inspections in order to ensure the absence of contaminants and the integrity of quantitative PCR.
Plastic for PCR and qPCR
96-well plate
Tube strips
Primo qPCR Seal
Primo transparent seal for qPCR
Amplification and detection The combination of reverse transcription and PCR (RT-PCR) allows the detection of low abundance RNAs in a sample, and production of the corresponding cDNA:
• cDNA Synthesis overview and products from NEB: Generate complementary DNA (cDNA) from an RNA template by reverse transcription.
• PCR, qPCR and amplification technologies: Products from NEB includes DNA Polymerases, qPCR and RT-qPCR reagents, Master mixes, nucleotide solution and more.
• NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, #E7645) generates DNA libraries ready for Illumina sequencing from DNA input amount down to 500 pg. The protocol is easy to follow with low hands-on time.
https://www.euroclonegroup.it/https://international.neb.com/The combination of reverse transcription and PCR (RT-PCR) allows the detection of low abundance RNAs in a sample, and production of the corresponding cDNA:• cDNA Synthesis overview and products from NEB: Generate complementary DNA (cDNA) from an RNA template by reverse transcription• PCR, qPCR and amplification technologies: Products from NEB includes DNA Polymerases, qPCR and RT-qPCR reagents, Master mixes, nucleotide solution and more• NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, #E7645) generates DNA libraries ready for Illumina sequencing from DNA input amount down to 500 pg. The protocol is easy to follow with low hands-on timehttps://international.neb.com/products/pcr-qpcr-and-amplification-technologies/pcr-qpcr-and-amplification-technologieshttps://international.neb.com/products/e7645-nebnext-ultra-ii-dna-library-prep-kit-for-illumina#Product%20Information
-
NEB MONARCH (RNA purification kits for processing of samples applied in RT-qPCR based corona tests)
Purification of RNAPurify your RNA quickly and efficiently with Monarch kits from NEB
Monarch® Total RNA Miniprep Kit #T2010S
Quickly and easily purify up to 100 µg of high quality total RNA from multiple sample types – all with one kit!
• For use with blood, cells and tissues• Also works with tough to lyse samples (bacteria, yeast, plant)• Effectively purifies total RNA of all sizes, including small RNAs >20 nt• Efficient genomic DNA removal (column and DNase I-based)• Contains Proteinase K for processing of tissues and blood samples• Includes RNA Protection Reagent for sample preservation• Excellent value• Kit components available separately
Monarch® Total RNA Miniprep Kit
Monarch RNA Cleanup Kits#T2030, #T2040, #T2050
The Monarch RNA Cleanup Kit (10 µg) enables fast and simple purification and concentration of up to 10 µg of RNA from enzymatic reactions.• Ideal for cleanup and concentration of RNA after enzymatic treatments including DNase I, Proteinase K, labeling, capping or in vitro transcription (IVT)• Elute in ≥ 6 µl for concentrated RNA• 70-100% RNA recovery, even with inputs < 20 ng• Efficiently purify RNA ≥ 25 nt (a simple modification enables purification of RNA ≥ 15 nt)• Can be used to purify RNA from the aqueous phase following TRIzol® or similar extractions• Simplified workflow with a single wash buffer• Unique column design prevents buffer carryover and elution of silica particulates• Columns and buffers are available separately• Purified RNA is ready for use in a wide variety of downstream applications
Monarch® RNA Cleanup Kit
https://international.neb.com/products/t2010-monarch-total-rna-miniprep-kit#Product%20Informationhttps://international.neb.com/products/t2030-monarch-rna-cleanup-kit-10-ug#Product%20Informationhttps://international.neb.com/
-
Luna qPCR kitsRapid, sensitive and precise probe-based qPCR detection and quantitation of target RNA targets
Luna® Universal Probe One-Step RT-qPCR Kit#E3006S, #E3006L, #E3006X, #E3006EIncludes everything you need for rapid, sensitive, and precise probe-based qPCR detection and quantitation of RNA targets.
• One product per application simplifies selection• Convenient master mix formats and user-friendly protocols simplify reaction setup• Non-interfering, visible tracking dye helps to eliminate pipetting errors
Luna Universal qPCR Mastermixes #M3004S, #M3004L, #M3004X, #M3004E
Rapid, sensitive and precise dye-based qPCR detection and quantitation of target DNA and cDNA sequences. • One product per application simplifies selection• Convenient master mix formats and user-friendly protocols simplify reaction setup• Non-interfering, visible tracking dye helps to eliminate pipetting errors
Luna Cell Ready One-Step RT-qPCR Kit#E3030SGo direct from cells to RNA quantitation without purification
• Contains reagents for 100 lysis preps and 500 one-step RT-qPCR reactions (dye)• Effective cell lysis preparation from 10 to 100,000 cells across numerous cell lines• Coordinated cell lysis, RNA release, and genomic DNA removal in a fast 15-minute protocol• Features Luna WarmStart® RT paired with Hot Start Taq for increased thermostability and room temperature setup• Additional lysis preps available: Luna Cell Ready Lysis Module (NEB #E3032)
Luna Cell Ready One-Step RT-qPCR Kit
Luna® Universal Probe qPCR Master Mix
Luna® Universal Probe One-Step RT-qPCR Kit
LunaScript™ RT SuperMix Kit#E3010S, #E3010LThe LunaScript® RT SuperMix Kit is optimized for cDNA synthesis in a two-step RT-qPCR workflow.
• Single-tube SuperMix contains random hexamer and oligo-dT primers, dNTPs, Murine RNase Inhibitor, and Luna® Reverse Transcriptase• Non-interfering, visible tracking dye helps to eliminate pipetting errors• Combine with Luna qPCR master mixes for robust RT-qPCR results
LunaScript™ RT SuperMix Kit
https://international.neb.com/https://international.neb.com/products/e3030-luna-cell-ready-one-step-rt-qpcr-kit#Product%20Informationhttps://international.neb.com/products/m3004-luna-universal-probe-qpcr-master-mix#Product%20Informationhttps://international.neb.com/products/e3006-luna-universal-probe-one-step-rt-qpcr-kit#Product%20Informationhttps://international.neb.com/products/e3010-luna-script-rt-supermix-kit#Product%20Information
-
Luna qPCR kitsRapid, sensitive and precise probe-based qPCR detection and quantitation of target RNA targets
Sequencing of the viral genom A useful tool for better understanding the virus pathogenicityand epidemiological surveillance
NEBNext® Single Cell/Low Input RNA Library Prep KitOur NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (NEB, #E6420) generates high quality se-quencing libraries from 2 pg RNA. The kit includes cDNA synthesis and DNA library preparation. Please note that adaptors and primers need to be ordered separately, as these are available in different formats (Index Primers Set 1-4, Dial Index Primers set, 96 Unique Dual Index Primer Pairs, and more). The protocol is easy to follow with low hands-on time. Mouse/Rat) (NEB, #E6310)
Learn more about NGS Sample Prep & Target Enrichment
NEB LAMB (new rapid polymerase based corona test):
Rapid detection of COVID-19One-step solution for visual detection of virus outside of the lab
Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP
Detection of SARS-CoV-2 without the need for expensive analysis instruments!
BioNordika and NEB can offer a Colorimetric LAMP kit which is designed to give a simple one-step solution for visual detection of virus outside of the lab and without the need for advanced testing infrastructure. Positive or negative results are indicated by a shift in color where negative reactions remains pink, while the pos-itive ones turns yellow. The system is designed to enable a quick, visual detection of amplification in the sample based on the production of protons and a consequent drop in pH value as a consequence of DNA polymerase activity in a LAMP reaction. This will in turn cause a color shift in the pH indicator in the solution. Read more about how Colorimetric LAMP was used for quick detection of coronavirus (SARS-CoV-2, covid-19) RNA in the newest publication:
M1800S: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 100 rxns Kr. 1.939,-M1800L: WarmStart Colorimetric LAMP 2X Master Mix (DNA & RNA) - 500 rxns Kr. 7.756,-
For Whole transcriptome RNA Library Preparation we recommend the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7760) combined with rRNA Depletion with NEBNext® rRNA Depletion Kit (Human/
https://international.neb.com/https://international.neb.com/products/ngs-sample-prep-and-target-enrichment/ngs-sample-prep-and-target-enrichmenthttps://international.neb.com/https://www.medrxiv.org/content/10.1101/2020.02.26.20028373v1https://www.medrxiv.org/content/10.1101/2020.02.26.20028373v1https://international.neb.com/products/m1800-warmstart-colorimetric-lamp-2x-master-mix-dna-rna#Product%20Informationhttps://international.neb.com/products/m1800-warmstart-colorimetric-lamp-2x-master-mix-dna-rna#Product%20Information
-
CST has well-validated research antibodies and small molecule compounds, which can help researchers unveil the pathogenesis of viral disease and advance research and development of assays and therapeutic drugs.Such as:
• Antibodies against the host protein.• Potential candidate compounds help understanding of drug effects. Moreover you can find free and printable interactive signaling pathway diagrams, research overviews, relevant antibody products, publications, and other research resources of pathways that may be involved in viral immune response and intracellular signaling.
Tools from CST to research on Covid-19Antibodies, various compounds and pathways
For example:
• Immune Regulating Pathways Involved in Viral and Cytokine Response.
• Fibrosis-related Pathways.• Necrotic Cell Death-Related Pathway.
Go here to view it all!
https://www.cellsignal.com/?utm_medium=cpc&utm_tactic=ppc&utm_region=eu&utm_source=google&utm_content=pep%20%2D%20brand&utm_term=cellular%20signaling&utm_strategy=dif&utm_campaign=pep&utm_research=&utm_research2=&utm_app=&utm_app2=&utm_conv=baw&utm_stage=ase&utm_seg=aca&gclid=EAIaIQobChMI3ZLM35jT6AIVFoGyCh06zwQoEAAYASAAEgLwTfD_BwE&gclsrc=aw.dshttps://blog.cellsignal.com/tools-to-help-researchers-to-fight-sars-cov-2https://blog.cellsignal.com/tools-to-help-researchers-to-fight-sars-cov-2
-
Lonza is committed to providing researchers with the tools for developing the right biological model for drug dis-covery and vaccine development for COVID-19. Lonza can provide >150 authenticated and ethically sourced cell types from numerous donors and from healthy as well as diseased tissue such as chronic obstructive pulmonary disease (COPD) or asthma and specialized media.
Solutions offered by Lonza:
Cell and media solutions to study SARS CoV-2Primary airway and immune cells and specialized media
SARS-CoV-2 research offerings from OrigeneN- and S-Protein, ACE2, Furin, Cytokines
Origene offers a wide range of tools to Investigate SARS-CoV-2 Infection:
• Proteins • Antibodies • ELISA • Expression Plasmids• RNAi • CRISPR Kits
• Airway Epithelial Cells and Media• Air Liquid Interphase Differentiated Epithelial Cells• Other Airway Cell Types and Media• Immune Cells and Media• RAFT for 3D cell culture and ProVero Media (serum free) for vaccine production• And much more. Visit here to get more information!
https://bioscience.lonza.com/lonza_bs/CH/en/https://bioscience.lonza.com/lonza_bs/CH/en/tools-for-covid-19https://www.origene.com/https://www.origene.com/research-areas/covid-19https://bioscience.lonza.com/lonza_bs/CH/en/tools-for-covid-1
-
• PCR / qPCR• NGS library prep• Cloning • Molecular biology enzymes• Antibodies • Primary cells• Cell culture reagents
Areas or applications
BioNordika offers a wide and unique selection of products and services within the areas of Cell- and Molecular Biology, and we only represent the very best suppliers in this field.
Our extensive knowlegde about advanced life science ap-plications gives us the opportunity to guide you to the right choices for your research. In combination with our personal customer service, fast support and delivery you can be sure that we will do our best - every time!
Other offerings
• Endotoxin detection• Custom oligos and peptides• Biochemicals & assay kits• Crystallography• Bioprocess impurity analysis• Protein chemistry
Need help?Let’s talk!
BioNordika Denmark A/S - +45 3956 2000 - [email protected] - www.bionordika.dk
http://bionordika.dk/http://bionordika.dk/pages/staff.aspx