keratocyte phenotype mediates proteoglycan structure: a ...collagen fibrils required for corneal...

Funderburgh et al page 1

Keratocyte Phenotype Mediates Proteoglycan Structure:

A Role for Fibroblasts in Corneal Fibrosis

James L. Funderburgh*, Mary M. Mann, Nirmala Sundarraj, Martha L.

Funderburgh

Department of Ophthalmology

University of Pittsburgh

Pittsburgh, PA

Supported by: National Institutes of Health Grant EY09368 (to JLF), EY003263 (to

NS), 30-EY08098 (University of Pittsburgh, Department of Ophthalmology

Core Grant), Research to Prevent Blindness, and Eye and Ear Foundation

of Pittsburgh. JLF is a Jules and Doris Stein Research to Prevent

Blindness Professor.

* Corresponding Author: Department of Ophthalmology, University of Pittsburgh,

1011 Eye and Ear Institute, 203 Lothrop Street, Pittsburgh, PA 15213-

2588. Telephone: 412 647 3853. FAX 412 647 5880. Email:

[email protected]

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on August 20, 2003 as Manuscript M303292200 by guest on July 13, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


Running Title: Glycosaminoglycans and Keratocyte Phenotype

Abbreviations: Gal, galactose; Gn, N-acetylglucosamine; TGFß, transforming growth

factor beta; FACE, fluorophore assisted carbohydrate electrophoresis; ALDH, aldehyde

3 dehydrogenase, RT-PCR, reverse transcriptase polymerase chain reaction; SLRP,

small leucine-rich proteoglycan; ß-D-xyloside, 4-nitrophenyl- ß-D-xylopyranoside

Key Words: cornea, fibrosis, scar, wound healing, keratan sulfate, dermatan sulfate,

TGFß, glycosaminoglycans, proteoglycans, alpha smooth muscle actin

Acknowledgements: The authors appreciate the advice and collaboration of Dr. Anna

Plaas in development of the FACE analysis experiments and of Dr. R. Lindahl for the

gift of antibodies to ALDH.

by guest on July 13, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Summary:

In pathological corneas, accumulation of fibrotic extracellular matrix is characterized by

proteoglycans with altered glycosaminoglycans that contribute to the reduced

transparency of scarred tissue. During wound healing, keratocytes in the corneal

stroma transdifferentiate into fibroblasts and myofibroblasts. In this study, molecular

markers were developed to identify keratocyte, fibroblast, and myofibroblast phenotypes

in primary cultures of corneal stromal cells, and the structure of glycosaminoglycans

secreted by these cells was characterized. Quiescent primary keratocytes expressed

abundant protein and mRNA for keratocan and aldehyde dehydrogenase class 3, and

secreted proteoglycans containing macromolecular keratan sulfate. Expression of these

marker compounds was reduced in fibroblasts and also in TGFß-induced

myofibroblasts, which expressed high levels of a-smooth muscle actin, biglycan, and

the EDA (EIIIA) form of cellular fibronectin. Collagen types I and III mRNAs were

elevated in both fibroblasts and in myofibroblasts. Expression of these molecular

markers clearly distinguishes the phenotypic states of stromal cells in vitro.

Glycosaminoglycans secreted by fibroblasts and myofibroblasts were qualitatively

similar and differed from those of keratocytes. Chondroitin/dermatan sulfate abundance,

chain-length, and sulfation were increased as keratocytes became fibroblasts and

myofibroblasts. Fluorophore-assisted carbohydrate electrophoresis (FACE) analysis

demonstrated increased N-acetylgalactosamine sulfation at both 4- and 6- carbons.

Hyaluronan, absent in keratocytes, was secreted by fibroblasts and myofibroblasts.

Keratan sulfate biosynthesis, chain length, and sulfation were significantly reduced in

both fibroblasts and myofibroblasts. The qualitatively similar expression of

glycosaminoglycans shared by fibroblasts and myofibroblasts suggests a role for

fibroblasts in deposition of non-transparent fibrotic tissue in pathological corneas.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


The corneal stroma is a dense connective tissue with a highly organized

extracellular matrix responsible for the remarkable strength and light transparency of the

cornea. A notable feature of this matrix is its unique proteoglycan content, consisting of

proteins of the small leucine-rich proteoglycan (SLRP) family. Lumican, a SLRP protein

abundant in the stroma, has been implicated in formation of the small and highly regular

collagen fibrils required for corneal transparency (1). The glycosaminoglycans

modifying SLRPs also appear to have a role in corneal transparency. Keratan sulfate in

cornea is of higher polymer length and at least an order of magnitude more abundant

than the keratan sulfate found in other tissues (2). Corneal chondroitin/dermatan

sulfate, conversely, is low in abundance and sulfate content compared to the dermatan

sulfate of skin and sclera (3). This unusual glycosaminoglycan composition has long

been considered important in corneal transparency, an hypothesis consistent with

several heritable disease conditions. Individuals with macular corneal dystrophy, for

example, develop cloudy corneas as a result of an inability to produce keratan sulfate

(4,5). In Hurler’s and Scheie’s syndromes, lack of glycosaminoglycan-degradative

enzymes results in accumulation of highly sulfated dermatan sulfate in the cornea,

causing corneal opacity at an early age (6,7).

Corneal proteoglycans are also implicated in the pathology of corneal scarring.

As a result of trauma or chronic corneal inflammation the stroma develops fibrotic

deposits that disrupt visual acuity. Such corneal scars are long-lasting and often

constitute the cause for corneal transplantation. A number of early studies showed that

corneal wound healing resulted in a reduction of keratan sulfate and in accumulation of

highly sulfated chondroitin/dermatan sulfate in the scar (3,8-14). More recent studies on

scars developing during the chronic stress associated with keratoconus showed a

glycosaminoglycan profile similar to that occurring in acute healing (15-19).

Corneal wound healing is associated with appearance in the stroma of cells with

phenotypes clearly distinct from those of the normal tissue. In the normal cornea

keratocytes are flattened, quiescent, neural crest-derived cells with a stellate

morphology. Extensive cellular processes link adjacent cells via gap junctions (20).

Filamentous actin is confined to the cortical region and is not organized into stress

fibers (21). In response to wounding, keratocytes become motile and mitotic and

develop actin cytoskeletal fibers associated with fibronectin in the extracellular matrix


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


(21). These fibroblastic cells also secrete metalloproteinases, thought to initiate tissue

remodeling (22). In latter stages of healing, keratocyte-derived fibroblasts express a-

smooth muscle actin incorporated into cytoplasmic stress fibers (23-27). These cells,

known as myofibroblasts, exhibit reduced motility and cell division compared to the

repair fibroblasts and may contribute to the contractile force involved in wound closure

(28,29). Myofibroblastic cells appear in response to transforming growth factor beta

(TGFß) and are associated with secretion of fibrotic extracellular matrix both in the

cornea and in other tissues.

In vitro, primary keratocytes can be maintained in serum-free or low-

mitogen serum-containing culture media in a quiescent state exhibiting a cellular

morphology and matrix secretion similar to keratocytes in vivo (21,30). When stromal

cells are subjected to serial passage in media containing fetal bovine serum they lose

the dendritic morphology typical of keratocytes, develop actin stress fibers, and begin

secretion of metalloproteinases (31,32). In response to endogenous or exogenous

TGFß, stromal fibroblasts become myofibroblasts, expressing a-smooth muscle actin

(33,34).

Cultures of quiescent primary keratocytes secrete proteoglycans similar to those

found in vivo, including all three of the proteoglycans bearing keratan sulfate- lumican,

keratocan, and mimecan (30,31,35). It has long been observed that keratan sulfate

secretion is greatly reduced or absent in serially passaged corneal fibroblasts (36) and

we recently demonstrated that freshly isolated primary bovine keratocytes exhibit a loss

of sulfated keratan sulfate-proteoglycans and an increase in sulfated

chondroitin/dermatan sulfate-containing proteoglycans during transdifferentiation from

keratocytes to myofibroblasts (35). That previous study showed that myofibroblasts

exhibit reduced expression of keratocan, a keratan sulfate-linked proteoglycan and

upregulate biglycan, a dermatan sulfate proteoglycan. These proteins, however,

represent minor components of the total cellular proteoglycan, and the overall

expression of core proteins modified by keratan sulfate and chondroitin/dermatan

sulfate was not greatly altered in myofibroblasts compared to keratocytes. Incorporation

of labeled sulfate into proteoglycans, however, did exhibit marked differences between

the two phenotypes with chondroitin/dermatan sulfate increased and keratan sulfate

decreased. This observation lead to the hypothesis that a major feature of the alteration


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


in corneal proteoglycan profile during the phenotypic transition in wound healing arises

via modulation of the structure of the glycosaminoglycan chains modifying the core

proteins.

The present study addresses this hypothesis by characterization of keratan

sulfate and chondroitin/dermatan sulfate chains modifying proteoglycans secreted by

stromal cells of different phenotypes. Primary, non-passaged keratocyte cultures were

characterized using molecular markers to identify the keratocyte, fibroblast, and

myofibroblast phenotypes. Structural analyses of glycosaminoglycans secreted by the

three cell types demonstrated a marked increase in chain length and sulfation of

chondroitin/dermatan sulfate in both fibroblasts and myofibroblasts and a reduction in

both sulfation and chain length of the keratan sulfate secreted by fibroblasts and

myofibroblasts. These results establish the key link between cells observed in

pathological corneas and specific alterations in biosynthesis of corneal

glycosaminoglycans.

Experimental Procedures

Cell culture. Primary keratocytes were obtained from fresh bovine corneal

stromae by collagenase digestion as previously described (35). The cells were diluted

in serum-free DME/F12 medium containing antibiotics and cultured on tissue culture-

treated plastic at 4 x 104 cells/cm2 (keratocytes) or 1 x 104/cm2 (fibroblasts and

myofibroblasts) in a humidified atmosphere containing 5% CO2. Culture medium was

changed after 24 hr (day 1) to DMEM/F12 with antibiotics (35) for keratocytes, or the

same containing 2% fetal bovine serum for fibroblasts and 2% fetal bovine serum with 2

ng/ml recombinant human TGFß1 (Sigma-Aldrich, Inc.) to induce myofibroblast

formation. These media were changed at day 4 and cultures were harvested at day 5

or 6 as noted in the figure legends.

Glycosaminoglycans. Cultures were labeled with 100 µCi/ml carrier-free 35S-

sulfate (DuPont/NEN) added on day 5 and the medium collected on day 6. In some

experiments 0.5 mM 4-nitrophenyl-ß-D-xylopyranoside (Sigma-Aldrich, #N2132) was

added 1 hr before labeling. Proteoglycans in the culture medium were purified by ion

exchange chromatography, dialyzed against water, and lyophilized. For

chondroitin/dermatan sulfate quantitation, glycosaminoglycans from 6 identical 9.5 cm2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


cultures were dissolved and combined to make triplicate samples of 100 µl in 0.1M Tris-

acetate pH 8. These were digested with 2 µl of chondroitinase ABC (Sigma-Aldrich

#C3667), 10 units/ml, for 2 hr at 37º C. Digested products were recovered by

ultrafiltration with Microcon YM-3 microfiltration devices (Millipore). Keratan sulfate was

digested in a similar manner using a mixture of 0.2 mU of E Freundii endo-ß-

galactosidase and 0.2 mU keratanase II (Seikagaku) in 0.05 M sodium acetate, pH 6.5,

at 37º C, overnight. The amount of labeled fragments liberated by digestion was

determined by scintillation counting, corrected for non-digested controls, and normalized

to protein content of the cells as described below.

For size determination, chondroitin/dermatan sulfate proteoglycans were

separated from total 35S-labeled proteoglycans by selective alcohol precipitation without

enzymatic digestion of keratan sulfate (37). Protein was hydrolyzed with 20 µg/ml

proteinase K twice for 30 minutes at 45º C in 0.1M Tris-HCl, pH 7.4, containing 0.1%

SDS. Chondroitin/dermatan sulfate from xyloside-treated cultures were analyzed in the

same manner. Keratan sulfate chains were obtained from total 35S-proteoglycans by

treatment with chondroitinase ABC (as above), dialysis, lyophilization, and proteinase K

digestion in a similar manner. The protein-free 35S-glycosaminoglycan chains were

subjected to SDS-PAGE on 4-20% gels (chondroitin/dermatan sulfate) or 10-20% gels

(keratan sulfate), electrotransferred in buffer without methanol to Genescreen Plus

charged nylon membranes (DuPont NEN), and subjected to autoradiography as

previously described (35).

FACE analysis of glycosaminoglycans. Non-labeled proteoglycans were purified

from media of triplicate 75 cm2 cultures, conditioned on days 4-6 as described above.

These were digested with chondroitinase ABC in 0.1M ammonium acetate, pH 7.5 or

with combined keratanase II and endo-ß-galactosidase in 0.1M ammonium acetate, pH

6.5, followed by collection of the products by ultrafiltration as described above. Dried

aliquots of the digestion products were fluorescently labeled with 5 µl of 0.1M 2-

aminoacridone in 3:17 acetic acid:dimethylsulfoxide for 15 min followed by 5 µl of

freshly dissolved cyanoborohydride 1M at 37º overnight (38). Borohydride was

quenched with 30 µl of 25% glycerol and 2 µl of 1 mg/ml bromphenol blue. The

derivitized digestion products were separated on 8 x 10 x 0.05 cm gels of 28.5%

acrylamide: 0.76% bisacrylamide containing 0.1 M Tris-HCl, pH 8. The running buffer


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


was 0.089 M Tris-borate, 2 mM EDTA, pH 8.4, chilled to 4º C. This formulation

duplicates the separation previously described for gels from Glyco Corp (38) which are

no longer available. Electrophoresis was carried out on ice at 5 watts constant power

per gel. Fluorescent bands were immediately photographed using a 12 bit BioRad

FluorS Max imaging system and quantification was accomplished with Biorad Quantity

One software. FACE bands generated by chondroitinase were identified by co-

electrophoresis with purified standards of fragments from chondroitin sulfate and

hyaluronan (Sigma-Aldrich, Inc.). Monosaccharide standards for keratan sulfate

analysis were purchased from Sigma. Disaccharide standards were produced by

digestion of purified bovine corneal keratan sulfate (Seikagaku) with endo-ß-

galactosidase or keratanase II, purified by size exclusion chromatography on a

Superdex-Peptide column (Pharmacia), and identified by FACE analysis as previously

described (38). Molecular mass of the disaccharide keratan sulfate standards was

confirmed by MALDI/TOFF mass spectroscopy (39).

Histology. Cellular morphology was observed after 2 days in cultures fixed in

100% methanol, 20 min and then stained with 1% crystal violet in 20% ethanol for 30

minutes followed by destaining in water. The cells were photographed by brightfield

optics with a 20x objective. For cytoskeletal analysis, cells after 2 days culture were

fixed in room temperature paraformaldehyde (35) and double-stained with Alexa-488

labeled phalloidin (Molecular Probes) and with anti-vinculin clone hVIN-1 (Sigma-

Aldrich, Inc) followed by goat anti-mouse labeled with Alexa-546 (Molecular Probes)

using procedures previously described (35). Six-day cultures were similarly fixed and

stained for a-smooth muscle actin with anti-smooth muscle actin (clone asm-1, Sigma-

Aldrich) followed by Alexa-546-goat anti-mouse antibody in a similar manner.

Cytoskeletal photographs were acquired on a Biorad Laser Scanning Confocal

microscope using a 60x oil objective.

Real-time Reverse Transcriptase PCR. Cells were collected by centrifugation

after scraping into cold saline and RNA isolated using RNeasy Mini kit (Qiagen). RNA

was treated with DNase I (Ambion) according to supplier’s protocol and then

concentrated by alcohol precipitation in the presence of GlycoBlue (Ambion). RNA was

quantified by fluorimetry using RiboGreen (Molecular Probes).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


RNA (400 ng) was transcribed to cDNA in a 100ul reaction containing 1X PCR II

buffer (Roche), 5mM MgCl2, 800 µM dNTP mix, (Roche); 2.5 µM random hexamers

(Invitrogen), 0.4 U RNase inhibitor, and 125 U SuperScript II reverse transcriptase

(Invitrogen). PCR was carried out for 40 cycles of 15’ @ 95º, 60’ @ 60º after an initial

incubation at 95º for 10 min in an ABI7700 thermocycler. Reaction volume was 50 µl

containing 1 x TaqMan Buffer A (Applied Biosystems), 5 mM MgCl2, 300 µM each

dNTP, 0.025 U/ml AmpliTaq Gold polymerase and 5 µl of cDNA. Forward and reverse

primers and fluorescent internal hybridization probes for each gene, as shown in Table

I, were used at optimized concentrations. Sequences for these genes were obtained

from GenBank except for that of the EDA form of bovine fibronectin. This information

was obtained by direct sequencing of RT-PCR amplification products obtained from

myofibroblast cDNA using primers based on published flanking sequence data. The

bovine EDA sequence thus obtained was deposited in GenBank with accession number

AY221633. Amplification efficiency for each of the primer pairs shown was determined

to be >90%.

For each gene/cDNA combination, amplifications without reverse transcriptase

were carried out as negative controls. Amplification of 18S ribosomal RNA was carried

out for each cDNA (in triplicate) for normalization of RNA content. Threshold cycle

number (Ct) of amplification in each sample was determined by ABI software. Relative

mRNA abundance was calculated as the Ct for amplification of a gene-specific cDNA

minus average Ct for 18S, expressed as a power of 2; i.e., 2DCt

. Three individual gene-

specific values, thus calculated, were averaged to obtain standard errors.

Immunoblotting. Proteoglycans from culture media collected at days 4-6 were digested

with chondroitinase ABC or keratanase II and endo-ß-galactosidase as described

above. Samples from the digests, normalized for cell number (by total cell DNA

content), were separated on 10% SDS-PAGE gels and transferred to PVDF

membranes, subjected to immunoblotting as previously described. Keratan sulfate,

biglycan and keratocan were detected in proteoglycans pooled from 3-4 individual

cultures. Biglycan was examined in chondroitinase digests and keratocan after digestion

of keratan sulfate. Cell layers were lysed directly in 1% SDS sample buffer. Protein


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


was determined using the Micro BCA assay (Pierce) and DNA by fluorimitry with

PicoGreen (Molecular Probes). Equal amounts of protein were separated by SDS-

PAGE, 10% gels for ALDH and a-smooth muscle actin, 4-20% for keratan sulfate and

fibronectin. Proteins were either stained with Coomassie Blue (40) or alternately

electrotransferred to PVDF membranes and subjected to immunodetection (35) with

antibodies to cellular fibronectin (clone IST-9, Accurate Chemical), ALDH (41), antibody

J36 against keratan sulfate (37), a peptide antibody to biglycan (42), or monoclonal

antibody to a-smooth muscle actin (Clone 1A4, Sigma-Aldrich, Inc.). Keratocan was

detected using an antibody generated against a mixture of 10 synthetic peptides each

encoding a unique amino acid sequence of bovine keratocan linked to KLH carrier. This

antiserum was prepared and affinity purified as described for anti-lumican peptide

antibodies (43).

Results

Morphology of corneal phenotypes in vitro. Primary bovine keratocytes isolated from

fresh stroma by collagenase digestion and cultured in absence of serum, exhibited a

dendritic (stellate) morphology (Figure 1A) with multiple extended processes

interconnecting individual cells. Phalloidin staining (Figure 1D) revealed filamentous

actin in the cortical region and associated with the cell-cell contacts at the intersection of

the cell processes. Vinculin staining was weak, diffuse, and mostly perinuclear in

localization. When cells prepared in a similar manner were exposed to 2% fetal bovine

serum for 2 days the cells became larger, flattened with a reduction in processes

(Figure 1B). Many cells were polarized with pseudopodial extensions (arrows)

indicating motility. In these cells, filamentous actin formed stress fibers traversing the

cell body (Fig 1E). Vinculin was focally localized at the terminus of the actin fibers as is

typical for matrix-adherent fibroblasts. Keratocyte cultures exposed to both fetal bovine

serum and TGFß1 contained larger, less refractile cells with a polygonal appearance.

Fewer obviously motile cells were observed (Figure 1C). Filamentous actin fibers were

thicker and fewer in number than in fibroblastic cells (Fig 1F). Vinculin accumulation in

focal adhesion was denser and larger than in fibroblasts. After 5 days of culture

numerous cells were observed in which actin fibers stained with antibodies to a-smooth


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


muscle actin (Figure 1G). Cells in serum free medium (keratocyte phenotype) or grown

in the fibroblastic phenotype did not exhibit a-smooth muscle actin staining (not shown).

Expression of Phenotypic Markers. Primary stromal cells in conditions similar to

those in Figure 1 exhibited differential expression of a number of marker molecules.

a-Smooth muscle actin, cellular fibronectin, and biglycan are associated with

myofibroblasts in vitro and in vivo. Immunoblotting showed a marked abundance of

these three proteins in TGFß-induced myofibroblasts compared with keratocyte and

fibroblast cultures (Figure 2A, 2B, 2C). Accumulation of ALDH was recently reported to

be a distinguishing feature of keratocytes in vivo (44). This protein, described as a

corneal crystallin, represents one of the major soluble proteins in keratocytes but is

reduced in fibroblasts populating healing wounds. ALDH was detected in all of the

cultured bovine stromal cells but its concentration was markedly elevated in cells

maintained in the keratocyte morphology (Fig 2D). The immunostained ALDH band

corresponded to a major protein of about 54 kDa, visualized by Coomassie blue

staining, prominent in keratocyte cell lysates but not apparent in lysates from fibroblasts

and myofibroblasts (Fig 2E).

Keratan sulfate glycosaminoglycan chains and keratocan, a SLRP core of

corneal keratan sulfate proteoglycan, are extracellular products highly enriched in the

corneal stroma. Immunoblotting using monoclonal antibody J36 to keratan sulfate

revealed heterogeneous high molecular weight keratan sulfate in proteoglycans isolated

from keratocyte culture media (Fig 2F). In fibroblasts, J36 epitopes were reduced in

molecular size to a band of 50-60 kDa. In myofibroblasts the J36 keratan sulfate epitope

was not detected. Keratan sulfate-linked proteins secreted by keratocytes also

contained abundant keratocan in the proteoglycans isolated from quiescent cultures of

keratocytes (Fig 2G). Keratocan was decreased in fibroblasts and almost undetected in

myofibroblast cultures.

Real-time quantitative RT-PCR analysis assays were designed to detect mRNA

for the five proteins identified in Figure 2. Relative abundance of the transcript pools for

these five proteins (Table II) showed that the protein expression levels detected by

Western blotting was consistent with differences in mRNA pools for these proteins.

Pools for a-smooth muscle actin, biglycan and cellular fibronectin were increased 12 to

39 fold in myofibroblasts compared to keratocytes. Fibroblasts, however, had little


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


increase in these mRNAs compared to keratocytes. Keratocan transcripts were

decreased 15 fold in fibroblasts and 50 fold in myofibroblasts as compared to

keratocytes. Similarly, ALDH transcript abundance was 700- and 2000 -fold lower in

fibroblasts and myofibroblasts, respectively, compared to keratocytes. These assays

link gene expression associated with in vivo cell phenotypes with the cell culture model.

Collagen Expression. Collagen type I represents the major fibrillar collagen of

the cornea, but synthetic levels of collagen I are low in adult non-wounded corneas (45).

Collagen III is a fibrillar cornea present in fetal and wounded cornea but only a very

minor component of adult corneal stroma (45). We previously found by that mRNA and

protein for collagen I and III were upregulated in myofibroblasts compared to

keratocytes (35). Real-time PCR analysis of the mRNA pools for these collagens

(Table II) confirmed these increases in myofibroblasts. These assay also showed that,

unlike other myofibroblastic markers, mRNA pools for collagens are upregulated in

fibroblasts as well as myofibroblasts.

Glycosaminoglycan biosynthesis by corneal cells. Proteoglycans were

metabolically labeled for 18 hr with 35S-sulfate and isolated from culture media by ion

exchange chromatography. In initial experiments greater than 95% of sulfated

glycosaminoglycan isolated from the media of the cultures was determined to be

keratan sulfate and chondroitin/dermatan sulfate (data not shown). Thus heparan

sulfate does not constitute a significant fraction of the soluble glycosaminoglycan

secreted by these cultures. Keratan sulfate in the labeled proteoglycans, determined by

sensitivity to endo-ß-galactosidase and keratanase II, was reduced by about 40% in

fibroblasts and about 60% in myofibroblasts compared to keratocytes (Figure 3A).

Conversely, 35S-labeled chondroitin/dermatan sulfate, measured by sensitivity to

chondroitinase ABC, was increased 3-3.5 fold in fibroblasts and myofibroblasts

compared with keratocytes. In the presence of nitrophenyl-ß-D-xyloside, a synthetic

initiator of chondroitin polymerization, chondroitin/dermatan sulfate biosynthesis was

increased >5 fold in all cultures as compared to cultures without this initiator (data not

shown) suggesting that (as with many cell types) chain initiation represents a rate-

limiting step in chondroitin and dermatan sulfate synthesis. In the presence of ß-

xyloside, fibroblasts continued to incorporate about 3-fold more sulfate than keratocytes


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


(Figure 3C) but myofibroblasts increased the relative biosynthesis to almost 6-fold that

of keratocytes.

The size of the 35S-labeled glycosaminoglycan chains was determined by

polyacrylamide gel electrophoresis after proteolytic removal of the core proteins.

Keratan sulfate produced by fibroblasts and myofibroblasts decreased compared to that

of keratocytes, whereas chondroitin/dermatan sulfate chain length increased (Figure 4A

and 4B). Chondroitin/dermatan sulfate made in the presence of ß-xyloside was smaller

than that without this initiator, but did not increase in fibroblasts and myofibroblasts

(Figure 4C). These results suggest a relationship between rate of chain initiation and

final chain length in chondroitin/dermatan sulfate.

Analysis of non-labeled chondroitin/dermatan sulfate secreted by the keratocyte

cultures was carried out by FACE analysis after chondroitinase digestion. As shown in

Figure 5A, keratocyte cultures contained sulfated and non-sulfated disaccharides in

about a 3:2 ratio. Sulfation was primarily on the 4 position of the N-acetylgalactosamine.

In fibroblasts the non-sulfated component was significantly lower and both 4-O and 6-O

sulfation increased. In myofibroblasts 4-O sulfation represented the majority of the

moieties and unsulfated chondroitin disaccharide was reduced to <5% of the total.

Quantitation of chondroitin disaccharides is depicted in Figure 5B. Hyaluronan was also

detected in this analysis, and quantitation of hyaluronan secreted by the different

cultures is shown in Figure 5C. As shown, hyaluronan was not detected in keratocyte

culture media, but hyaluronan represented 1.5% and 4.5% of the chondroitinase-

sensitive glycosaminoglycan in fibroblast and myofibroblast cultures.

A large number of fragments is generated by enzymatic depolymerization of

keratan sulfate (46-48). Characterization of these has employed a variety of analytical

approaches including FACE, a technique which can be used to quantitate major

components of corneal keratan sulfate (38,49). Digestion of keratan sulfate from

keratocyte culture media with mixed keratanase II and endo-ß-galactosidase generated

eleven major bands visualized on FACE (Figure 6A). Of these, mono- and

disaccharides involved in keratan sulfate chain extension constituted about 60% of

fragments secreted by keratocyte cultures (Fig 6B – black bars). The abundance of this

set of fragments dropped about 5-fold in the media from fibroblast and myofibroblast

cultures. The abundance of these chain extension fragments as a proportion of the total


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


fragments was also reduced in the fibroblasts and myofibroblasts. Based on previous

studies of keratan sulfate structure, it seems likely that most of the unidentified bands

(Fig 6B- gray bars) released by enzyme digestion represent moieties capping the non-

reducing terminus of keratan sulfate. A variety of such capping structures has been

documented in corneal keratan sulfate by NMR and these components also are present

in FACE analysis of keratan sulfate (38). These components showed no significant

decrease in fibroblasts and myofibroblasts compared to keratocytes (Fig 6B). Reduction

of keratan sulfate chain length would reduce the ratio of chain extension moieties to

capping fragments. Thus the altered ratio of chain extension moieties to total

degradation products in fibroblasts and myofibroblasts shown in Fig 6B is consistent

with a reduced keratan sulfate chain length as seen in Fig 4.

Discussion

For more than half a century the unique glycosaminoglycan composition of the

cornea has been thought to be important to corneal transparency. Studies of

pathological corneas, hereditary diseases, and knockout mouse mutations have helped

confirm this hypothesis. During the last decade, studies have identified distinct

phenotypes of stromal cells present in healing wounds (50). In the current study we set

out to manipulate primary cultures of stromal cells to reproduce these phenotypic

characteristics observed in vivo, and to characterize their glycosaminoglycan

biosynthesis. Although there are numerous previous studies of glycosaminoglycan

biosynthesis in cultured corneal cells, an important aspect of this study is the use of

primary cells without subculture, and the linking of cultured cells to in vivo phenotypes

using molecular markers. Previous studies have not employed such stringent criteria,

thus comparisons extracellular matrix biosynthesis in our model system are likely to

reflect the pathological process more accurately than earlier studies.

The phenotype of the cultured cells was clearly distinguishable by the molecular

markers they expressed. The ALDH family of proteins is highly expressed in corneal

epithelium and stroma and may serve a non-enzymatic function (44,51). ALDH is

downregulated during wound healing making it a marker for the quiescent keratocyte in

vivo (44,52). In our study, both ALDH protein and mRNA were dramatically

downregulated as quiescent keratocytes were activated by serum to become


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


fibroblastic. Keratocan, a SLRP protein highly expressed in the corneal stroma, served

as a second marker of the keratocyte phenotype. Both protein and mRNA pools for this

protein were reduced in the fibroblasts and myofibroblasts suggesting regulation of

expression at the nucleic acid level. A third marker of importance is the use of a

monoclonal antibody to keratan sulfate. Although many such antibodies have been

described, none yet has proved useful for detection of corneal keratan sulfate made in

vitro. The finding that antibody J36 can serve such a function provides an important tool

for non-disruptive screening of cultured keratocytes. It should be noted that expression

of the J36 epitope does not correlate with total abundance of keratan sulfate chains as

determined in Figs 3,4,6. As with previously described monoclonal antibodies(53) J36

probably recognizes a series of sulfated disaccharides in the some keratan sulfate

chains. In the shorter, less highly sulfate chains these structures may be absent. Thus

the J36 antibody is valuable as a qualitative but not quantitative assessment of keratan

sulfate expression.

Fibroblasts were readily distinguished from keratocytes by the development of

actin cytoskeleton, focal adhesions and the loss of keratocyte gene marker expression.

Myofibroblasts share these characteristics with fibroblasts but, in addition, express

protein and mRNA for a-smooth muscle actin. Such expression serves as a de facto

definition of myofibroblasts. The alternately spliced form of cellular fibronectin that

contains the type III extra domain A (EDA or EIIIA) is associated with healing wounds

and fibrosis in cornea and other tissues (54-56). Expression of this matrix molecule

serves as a marker of fibrotic extracellular matrix that is closely linked to intracellular a-

smooth muscle actin expression in granulation tissue myofibroblasts (57). Biglycan, a

SLRP protein that is modified with chondroitin/dermatan sulfate, similarly, is associated

with tissue fibrosis, corneal scars, and was previously identified as a product of corneal

myofibroblasts (19,35,58,59). The combination of a-smooth muscle actin, biglycan, and

cellular fibronectin provides a powerful set of tools for distinguishing myofibroblasts from

fibroblasts.

The availability of these three well-characterized phenotypes of primary cells

from corneal stroma allows us to pose important questions regarding extracellular

matrix synthesis by these cells. A long-time observation regarding healing corneal

wound and corneal scar tissue is the reduction or disappearance of stromal


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


proteoglycans containing keratan sulfate. This change may be key to corneal

transparency in view of recent studies linking loss of a keratan sulfate-specific

sulfotransferase to macular corneal dystrophy (60). Our previous work has

demonstrated that the corneal SLRP proteins to which keratan sulfate is attached

continue to be expressed by keratocytes both in vivo and in vitro. In spite of dramatic

changes keratocan, total keratan sulfate-linked protein does not change dramatically as

keratocytes become myofibroblasts (35) suggesting changes in the keratan sulfate

chains. Earlier studies typically expressed keratan sulfate biosynthesis as a proportion

of the total glycosaminoglycan biosynthesis. Our current data documents that keratan

sulfate and chondroitin/dermatan biosynthetic rates are independent and altered in

opposite directions. These results are consistent with the data showing these

glycosaminoglycans to be synthesized by different glycosyl- and sulfotransferases and

implies that activity of the enzymes is regulated independently.

Metabolic labeling with sulfate and western blotting with anti-keratan sulfate

antibodies suggested that keratan sulfate chains produced by fibroblasts and

myofibroblasts are shorter and contained less sulfate than the keratan sulfate made by

keratocytes. FACE analysis supported these conclusions. Figure 6 shows a reduction in

the ratio of sulfated disaccharides involved in chain elongation and components

associated with non-reducing terminus of the chains. This ratio is consistent with shorter

keratan sulfate chains observed directly by electrophoresis in Figure 4. Keratan sulfate-

linked SLRP proteins are not greatly reduced in myofibroblasts, nor are the compounds

in the FACE gels in Figure 6 representing non-reducing termini of these chains. The

conclusion from these observations is that alteration of keratan sulfate in fibroblasts and

myofibroblasts (and be implication, in corneal scars) is due almost entirely to a

shortening of the keratan sulfate length and not a reduction in the number of chains.

Corneal keratan sulfate biosynthesis exhibits a strong link between glucosamine

sulfation and chain elongation (38,60). Chick stromal cells in culture exhibit a loss in

chain elongation associated with decreased sulfotransferase activity (61). Our results

are consistent with a similar alteration in bovine keratocytes as they become fibroblasts.

Increases in chondroitin/dermatan sulfate have been reported in corneal scar

tissue, a change that appears to be stable for extended periods of time beyond active

wound healing (10-12,19). Here we observed increases in chondroitin/dermatan


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


sulfation and chain length in both fibroblasts and myofibroblasts. The differential in

sulfate incorporation was maintained in the presence of saturating levels of ß-D-xyloside

suggesting that differences between the cell phenotypes result from an altered

biosynthetic capacity in the fibroblastic and myofibroblastic cells rather than an increase

in the availability of core protein initiation sites. The fact that differences in

chondroitin/dermatan sulfate molecular size were eliminated in the presence of xyloside

suggests that the chain length may be a function both chain elongation capacity and the

abundance of initiation sites.

Relative sulfation of the chondroitin/dermatan chains increased in addition to the

chain length. The ratio between 4-O and 6-O sulfation was not altered and there was

no detection of disulfated disaccharides in the chondroitin/dermatan sulfate from

fibroblastic and myofibroblastic cells. Simultaneous sulfation of 4-O and 6-O moieties in

chondroitin/dermatan sulfate is unusual (62). Our current data do not distinguish if the

4-O and 6-O sulfation is in same molecule of the or of a mixture of chains modified only

on one site. The relative sulfation was increased in fibroblasts and myofibroblasts in

both untreated and xyloside treated cultures (data not shown). Thus unlike keratan

sulfate, chain extension and sulfation in chondroitin/dermatan may be regulated

independently.

Increased amount and sulfation of chondroitin/dermatan sulfate in corneal scars

has been reported in several studies but the finding of increased molecular size is

novel. Presence of larger chondroitin/dermatan sulfate molecules in scar tissue is

consistent with the appearance of exceptionally large chondroitinase-sensitive cuprolinic

blue stained filaments in the interfibrillar spaces fibrotic regions of pathological corneas

(63). Because chondroitin/dermatan proteoglycans bind water more tightly than

keratan sulfate an accumulation of these large more highly sulfated molecules could

disrupt critical stromal collagen spacing due to their hydrodynamic volume.

Hyaluronan has been characterized in healing corneas but the source has not

been identified (3,10,14,64). The current study suggests that keratocytes activated into

the fibroblastic or myofibroblastic phenotypes could be a source of the wound-healing

hyaluronan. The identification of diverse biological effects of hyaluronan including

stimulation of cell motility lends a potential importance of this observation to cellular

events in healing wounds.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Overall both fibroblasts and myofibroblasts exhibited a qualitatively similar

alteration in glycosaminoglycan biosynthesis compared to keratocytes. Keratan sulfate

was reduced in amount, chain length, and sulfation whereas chondroitin/dermatan

sulfate was increased in abundance, chain length and sulfation. The differences

between fibroblasts and myofibroblasts were quantitative rather than qualitative. This

pattern was similar to that observed with collagen mRNA pool. This observation is

significant in terms of the concept of the myofibroblast as a fibrogenic phenotype.

Transforming growth factor ß and the myofibroblastic cells that appear in response to

this cytokine are generally recognized to be associated with connective tissue

deposition, scar tissue formation and fibrosis (65,66). Fibroblasts, conversely have

been associated with metalloproteinase secretion and tissue remodeling (22,50). Our

results suggest that neither myofibroblasts nor TGFß is required for stromal cells to

secrete glycosaminoglycans and collagens similar to those of scar tissue. Thus

myofibroblastic cells may not be the sole source of all the molecular components of scar

tissue.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


References

1. Chakravarti, S., Petroll, W. M., Hassell, J. R., Jester, J. V., Lass, J. H., Paul, J., and

Birk, D. E. (2000) Invest Ophthalmol Vis Sci 41, 3365-3373

2. Funderburgh, J. L., Caterson, B., and Conrad, G. W. (1987) J Biol Chem 262,

11634-11640

3. Hassell, J. R., Cintron, C., Kublin, C., and Newsome, D. A. (1983) Arch Biochem

Biophys 222, 362-369

4. Hassell, J. R., Newsome, D. A., Krachmer, J. H., and Rodrigues, M. M. (1980) Proc

Natl Acad Sci U S A 77, 3705-3709

5. Nakazawa, K., Hassell, J. R., Hascall, V. C., Lohmander, L. S., Newsome, D. A.,

and Krachmer, J. (1984) J Biol Chem 259, 13751-13757

6. Huang, Y., Bron, A. J., Meek, K. M., Vellodi, A., and McDonald, B. (1996) Exp Eye

Res 62, 377-387

7. Quantock, A. J., Meek, K. M., Fullwood, N. J., and Zabel, R. W. (1993) Can J

Ophthalmol 28, 266-272

8. Cintron, C., Gregory, J. D., Damle, S. P., and Kublin, C. L. (1990) Invest Ophthalmol

Vis Sci 31, 1975-1981

9. Anseth, A. (1969) Exp Eye Res 8, 310-314

10. Anseth, A., and Fransson, L. A. (1969) Exp Eye Res 8, 302-309

11. Anseth, A. (1969) Exp Eye Res 8, 438-441

12. Anseth, A. (1972) Isr J Med Sci 8, 1543-1544

13. Funderburgh, J. L., Cintron, C., Covington, H. I., and Conrad, G. W. (1988) Invest

Ophthalmol Vis Sci 29, 1116-1124

14. Funderburgh, J. L., and Chandler, J. W. (1989) Invest Ophthalmol Vis Sci 30, 435-

442

15. Funderburgh, J. L., Funderburgh, M. L., Rodrigues, M. M., Krachmer, J. H., and

Conrad, G. W. (1990) Invest Ophthalmol Vis Sci 31, 419-428

16. Yue, B. Y., Sugar, J., and Schrode, K. (1988) Curr Eye Res 7, 81-86

17. Wollensak, J., and Buddecke, E. (1990) Graefes Arch Clin Exp Ophthalmol 228,

517-523


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


18. Rodrigues, M., Nirankari, V., Rajagopalan, S., Jones, K., and Funderburgh, J.

(1992) Am J Ophthalmol 114, 161-170

19. Funderburgh, J. L., Hevelone, N. D., Roth, M. R., Funderburgh, M. L., Rodrigues, M.

R., Nirankari, V. S., and Conrad, G. W. (1998) Invest Ophthalmol Vis Sci 39, 1957-

1964

20. Watsky, M. A. (1995) Invest Ophthalmol Vis Sci 36, 2568-2576

21. Jester, J. V., Barry, P. A., Lind, G. J., Petroll, W. M., Garana, R., and Cavanagh, H.

D. (1994) Invest Ophthalmol Vis Sci 35, 730-743

22. Girard, M. T., Matsubara, M., Kublin, C., Tessier, M. J., Cintron, C., and Fini, M. E.

(1993) J Cell Sci 104 ( Pt 4), 1001-1011

23. Jester, J. V., Rodrigues, M. M., and Herman, I. M. (1987) Am J Pathol 127, 140-148

24. Garana, R. M., Petroll, W. M., Chen, W. T., Herman, I. M., Barry, P., Andrews, P.,

Cavanagh, H. D., and Jester, J. V. (1992) Invest Ophthalmol Vis Sci 33, 3271-3282

25. Ishizaki, M., Zhu, G., Haseba, T., Shafer, S. S., and Kao, W. W. (1993) Invest


26. Jester, J. V., Petroll, W. M., Barry, P. A., and Cavanagh, H. D. (1995) Invest


27. Latvala, T., Barraquer-Coll, C., Tervo, K., and Tervo, T. (1996) J Refract Surg 12,

677-683

28. Jester, J. V., Barry-Lane, P. A., Petroll, W. M., Olsen, D. R., and Cavanagh, H. D.

(1997) Cornea 16, 177-187

29. Vaughan, M. B., Howard, E. W., and Tomasek, J. J. (2000) Exp Cell Res 257, 180-

189.

30. Beales, M. P., Funderburgh, J. L., Jester, J. V., and Hassell, J. R. (1999) Invest


31. Long, C. J., Roth, M. R., Tasheva, E. S., Funderburgh, M., Smit, R., Conrad, G. W.,

and Funderburgh, J. L. (2000) J Biol Chem 275, 13918-13923

32. Cook, J. R., Mody, M. K., and Fini, M. E. (1999) Invest Ophthalmol Vis Sci 40, 3122-

3131

33. Jester, J. V., Barry-Lane, P. A., Cavanagh, H. D., and Petroll, W. M. (1996) Cornea

15, 505-516


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


34. Masur, S. K., Dewal, H. S., Dinh, T. T., Erenburg, I., and Petridou, S. (1996) Proc

Natl Acad Sci U S A 93, 4219-4223

35. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., Corpuz, L., and Roth, M. R.

(2001) J Biol Chem 276, 44173-44178

36. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., Prakash, S., and Conrad, G.

W. (1996) J Biol Chem 271, 31431-31436

37. Sundarraj, N., Chao, J., Gregory, J. D., and Damle, S. P. (1986) J Histochem

Cytochem 34, 971-976

38. Plaas, A. H., West, L. A., and Midura, R. J. (2001) Glycobiology 11, 779-790

39. Harvey, D. J. (2000) J Am Soc Mass Spectrom 11, 900-915

40. Funderburgh, J. L., and Conrad, G. W. (1990) J Biol Chem 265, 8297-8303

41. Boesch, J. S., Lee, C., and Lindahl, R. G. (1996) J Biol Chem 271, 5150-5157

42. Roughley, P. J., White, R. J., Magny, M. C., Liu, J., Pearce, R. H., and Mort, J. S.

(1993) Biochem J 295 ( Pt 2), 421-426

43. Funderburgh, J. L., Funderburgh, M. L., Mann, M. M., and Conrad, G. W. (1991) J

Biol Chem 266, 14226-14231

44. Jester, J. V., Moller-Pedersen, T., Huang, J., Sax, C. M., Kays, W. T., Cavangh, H.

D., Petroll, W. M., and Piatigorsky, J. (1999) J Cell Sci 112, 613-622.

45. Chen, C., Michelini-Norris, B., Stevens, S., Rowsey, J., Ren, X., Goldstein, M., and

Schultz, G. (2000) Invest Ophthalmol Vis Sci 41, 4108-4116

46. Huckerby, T. N., Tai, G. H., and Nieduszynski, I. A. (1998) Eur J Biochem 253, 499-

506.

47. Tai, G. H., Huckerby, T. N., and Nieduszynski, I. A. (1996) J Biol Chem 271, 23535-

23546.

48. Tai, G. H., Nieduszynski, I. A., Fullwood, N. J., and Huckerby, T. N. (1997) J Biol

Chem 272, 28227-28231.

49. Plaas, A. H., West, L. A., Thonar, E. J., Karcioglu, Z. A., Smith, C. J., Klintworth, G.

K., and Hascall, V. C. (2001) J Biol Chem 276, 39788-39796

50. Fini, M. E. (1999) Prog Retin Eye Res 18, 529-551.

51. Piatigorsky, J. (2000) J Ocul Pharmacol Ther 16, 173-180.

52. Stramer, B. M., Cook, J. R., Fini, M. E., Taylor, A., and Obin, M. (2001) Invest

Ophthalmol Vis Sci 42, 1698-1706.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


53. Mehmet, H., Scudder, P., Tang, P. W., Hounsell, E. F., Caterson, B., and Feizi, T.

(1986) Eur J Biochem 157, 385-391

54. Perez-Santonja, J. J., Linna, T. U., Tervo, K. M., Sakla, H. F., Alio y Sanz, J. L., and

Tervo, T. M. (1998) J Refract Surg 14, 602-609

55. Tuori, A., Virtanen, I., Aine, E., and Uusitalo, H. (1997) Graefes Arch Clin Exp

Ophthalmol 235, 222-229

56. Koukoulis, G. K., Shen, J., Virtanen, I., and Gould, V. E. (1995) Ultrastruct Pathol

19, 37-43

57. Dugina, V., Fontao, L., Chaponnier, C., Vasiliev, J., and Gabbiani, G. (2001) J Cell

Sci 114, 3285-3296.

58. Venkatesan, N., Ebihara, T., Roughley, P. J., and Ludwig, M. S. (2000) Am J Respir

Crit Care Med 161, 2066-2073

59. Venkatesan, N., Roughley, P. J., and Ludwig, M. S. (2002) Am J Physiol Lung Cell

Mol Physiol 283, L806-814

60. Akama, T. O., Nishida, K., Nakayama, J., Watanabe, H., Ozaki, K., Nakamura, T.,

Dota, A., Kawasaki, S., Inoue, Y., Maeda, N., Yamamoto, S., Fujiwara, T., Thonar,

E. J., Shimomura, Y., Kinoshita, S., Tanigami, A., and Fukuda, M. N. (2000) Nat

Genet 26, 237-241.

61. Nakazawa, K., Takahashi, I., and Yamamoto, Y. (1998) Arch Biochem Biophys 359,

269-282

62. Cheng, F., Heinegard, D., Malmstrom, A., Schmidtchen, A., Yoshida, K., and

Fransson, L. A. (1994) Glycobiology 4, 685-696

63. Sawaguchi, S., Yue, B. Y., Chang, I., Sugar, J., and Robin, J. (1991) Invest


64. Fitzsimmons, T. D., Molander, N., Stenevi, U., Fagerholm, P., Schenholm, M., and

von Malmborg, A. (1994) Invest Ophthalmol Vis Sci 35, 2774-2782

65. Badid, C., Mounier, N., Costa, A. M., and Desmouliere, A. (2000) Histol Histopathol

15, 269-280

66. Powell, D. W., Mifflin, R. C., Valentich, J. D., Crowe, S. E., Saada, J. I., and West,

A. B. (1999) Am J Physiol 277, C1-9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Figure Legends

Figure 1. Morphology and cytoskeletal organization of cultured corneal keratocytes,

fibroblasts and myofibroblasts. Primary cultures of bovine keratocytes were established

under conditions that either maintain the keratocyte phenotype or that initiate

transdifferentiation to fibroblast or myofibroblastic phenotypes as described under

Experimental Procedures. Micrographs A,B,C illustrate morphology of cells after

staining with crystal violet. Panels D, E, F show cells stained with phalloidin (green) and

anti-vinculin (red). In G myofibroblasts were stained with antibodies to a-smooth

muscle alpha actin. Keratocytes and fibroblasts were negative for a-smooth muscle

alpha staining. White bars in C and F are 50 µm.

Figure 2. Immunoblotting of phenotypic marker proteins. Cellular fibronectin, 200 kDa,

A; a-smooth muscle alpha actin, 44 kDa, B; and aldehyde 3 dehydrogenase, 54 kDa, D

from cell lysates and keratan sulfate, F; keratocan, 50 kDa, G; and biglycan, 49 kDa, C

from conditioned media of cultured keratocyte (K), fibroblast (F) and myofibroblasts (M)

were detected by immunoblotting after separation on SDS-PAGE as described in

Experimental Procedures. Panel E shows a Coomassie stained separation of cell

extracts similar to that immunoblotted for ALDH in D. Arrow marks a prominent 54kDa

band in keratocytes corresponding to ALDH in the blot.

Figure 3. Incorporation of 35S-sulfate into keratocyte glycosaminoglycans as a function

of cell phenotype. Incorporation of 35S-sulfate into keratan sulfate and

chondroitin/dermatan sulfate during an 18 hr labeling period was determined by

digestion of a purified proteoglycan fraction with keratanase II + endo-ß-galactosidase

(A) or chondroitinase ABC (B and C) as described in Experimental Procedures. Values

are corrected for cell protein, and error bars represent standard deviation of assays on

triplicate cultures. Values are normalized so that keratocyte = 100 in each assay. In C,

cultures were labeled in the presence of 0.5 mM 4-nitrophenyl-ß-D-xyloside.

Figure 4. Glycosaminoglycan chain size in cultured corneal cells. Proteoglycans from

culture media after labeling with 35S-sulfate under conditions similar to Figure 3, were


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


separated into keratan sulfate proteoglycans using chondroitinase digestion (A) or

chondroitin/dermatan sulfate using fractional alcohol precipitation (B and C) and then

glycosaminoglycan chains were released by proteinase digestion as described in

Experimental Procedures. Free glycosaminoglycan chains were separated SDS-PAGE

and detected by autoradiography. Molecular size markers represent protein standards

run in the same gels. In C, labeling was carried out in the presence of 0.5 mM 4-

nitrophenyl-ß-D-xyloside.

Figure 5. Analysis of hyaluronan and chondroitin/dermatan sulfate by fluorophore-

assisted carbohydrate electrophoresis (FACE). A. Unlabeled glycosaminoglycans were

digested with chondroitinase ABC and fragments derivitized with 2-aminoacridone,

separated by gel electrophoresis and visualized by fluorescence as described in

Experimental Procedures. Fragments were identified by co-electrophoresis with

standards. Di-HA, hyaluronan unsaturated disaccharide; Di-0S, chondroitin/dermatan

unsulfated unsaturated disaccharide; Di-4S, chondroitin/dermatan 4-O-sulfated

unsaturated disaccharide; Di-6S, chondroitin/dermatan 6-O-sulfated unsaturated

disaccharide. Di-diS, chondroitin/dermatan 4,6,-O-disulfated disaccharide. B. Relative

abundance of chondroitin/dermatan fragments was determined by quantitative image

analysis of fluorescent gels similar to those in A. The total chondroitin/dermatan

fragments in each lane was normalized to 100. Error bars show standard deviation of

analyses of triplicate cultures. White bars: Di-0S, Black bars, Di-6S; Gray bars, Di-4S.

C. Hyaluronan fragments were calculated as in B as a percentage of

chondroitin/dermatan sulfate in the same sample.

Figure 6. Analysis of keratan sulfate by fluorophore assisted carbohydrate

electrophoresis (FACE). A. Unlabeled keratan sulfate from keratocyte cultures was

digested with a mixture of keratanase II and endo-ß-galactosidase. Fragments were

derivitized with 2-aminoacridone, separated by gel electrophoresis and detected by

fluorescence as described in Experimental Procedures. Marked bands representing

>90% of the labeled products were used for quantitation. Bands were identified by co-

electrophoresis with commercial standards (Gal, GnSO4) or with fragments of purified

corneal keratan sulfate characterized as described in Experimental Procedures. MSE


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


and MSK, monosulfated fragments produced by endo-ß-galactosidase (GnSO4-Gal) and

keratanase II (Gal-GnSO4); USE, unsulfated endo-ß-galactosidase disaccharide (Gn-

Gal); DSK, disulfated keratanase II disaccharide (GalSO4-GnSO4). R, non-specific

reagent band; bands marked with (*) are keratan sulfate-derived components of non-

determined structure. B. Quantification of keratan sulfate bands in keratocyte,

fibroblasts, and myofibroblasts. Triplicate samples similar to that in Figure 6A were

analyzed for abundance of the 11 bands marked in 6A. White bars show the sum of all

components (excluding R). Black bars show sums of identified components of keratan

sulfate chain elongation and Gray bars show unidentified fragments, marked * in Fig

6A. The total for keratocytes (K) was set to 100.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


Table I

Primers and Probes for Real-time RT-PCR

Gene Name DNA SequenceALDH GGAAGCCATCCAGTTCATCA Forward

GTCTCCGCGATCATCTTCTT ReverseTGGCGCTCTACGTCTTCTCACCG Probe

Keratocan TGCTGGCCTTCCTTCTAGTG ForwardGATGAAGGTGCTGCAGATGA ReverseCAAAGGTCCCCAAAATCAGTGC Probe

Biglycan TCTCAGAGGCCAAGCTCACT ForwardTAGCTCGATTGCCTGGATTT ReverseCAATGAACTCCACCTGGACCACAACA Probe

Cellular Fibronectin TTGATCGCCCTAAAGGACTG ForwardCATCCTCAGGGCTCGAGTAG ReverseCCTGTGGGCTTTCCCAAGCAATTT Probe

a-Smooth Muscle Actin CACTCCCTGCTCTCTTGTCTG ForwardCAGAGCTTGGGCTAGGAATG ReverseTGAAGGCATTATTCCACAGAACATTCACA Probe

18S Ribosomal CCCTGTAATTGGAATGAGTCCAC ForwardGCTGGAATTACCGCGGCT ReverseTGCTGGCACCAGACTTGCCCTC Probe

Collagen Ia2 CAACCATGCCTCTCAGAACA ForwardGCCAGTTTCCTCATCCATGT ReverseCCTACCATTGCAAGAACAGCATTGCA Probe

Collagen III GTCCTGATGGTTCCCGTAAA ForwardTTCAGGATGGCAGAATTTCA ReverseCCCTGCACGGAACTGCAGGG Probe

Table II

Relative Abundance of mRNA

Keratocytes Fibroblasts Myofibroblasts

Smooth Muscle Actin 100 ± 7 51 ± 6 1271 ± 79Fibronectin-EDA 100 ± 37 229 ± 10 3948 ± 137Biglycan 100 ± 37 166 ± 101 1250 ± 535ALDH 100 ± 14 0.14 ± 0.1 0.05 ± 0.01Keratocan 100 ± 7.9 6.4 ± 0.6 1.8 ± 0.7Collagen I 100 ± 4.2 360 ± 18 572 ± 24Collagen III 100 ± 21 5583 ± 883 6437 ± 680


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

James L. Funderburgh, Mary M. Mann, Nirmala Sundarraj and Martha L. Funderburghcorneal fibrosis

Keratocyte phenotype mediates proteoglycan structure: A role for fibroblasts in

published online August 20, 2003J. Biol. Chem.

10.1074/jbc.M303292200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M303292200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M303292200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/08/20/jbc.M303292200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/08/20/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/08/20/jbc.M303292200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

keratocyte phenotype mediates proteoglycan structure: a ...collagen fibrils required for corneal...

Documents