introduction to mendelian nonmendelian diseases and nonmendelian... · 2- recombination. variation...

Dr. Ashraf Yahia Osman MohamedMBBS, MSC

Whatsapp:00249922577404

Introduction to Mendelian &

NonMendelian Diseases

Why bacteria from

the same strain look alike

While we humans

look diferent???

Causes of genetic and phenotypic variations between eukaryotes include meiosis and mutations.

Genotype & Phenotype

● Gene is composed of introns and exons.


• Alleles are alternate forms of a gene that difer in their sequences and can encode diferent phenotypes.

• phenotype: observable properties of an organism.

• Locus: position of a gene on a chromosome.

Gene x

Allele 1

Allele 2

Eye colour gene


• Mendelian phenotype (monogenic) is a phenotype whose presence or absence depends on the genotype at a single locus.

• Mendelian phenotypes are classifed to dominant and recessive phenotypes.

• Non Mendelian phenotype (multifactorial) is a character whose presence or absence depends on the genotype at multiple loci.

Recessive character: Only manifests in homozygous individuals

Dominant character: can manifest in heterozygous individuals

Variation

Meiosis contribute to genetic and phenotypic variation by two mechanisms:1- Independent assortment of chromosomes

2- Recombination

Variation

• In humans for each of the 23 homologous pairs of chromosomes.

• Homologs distribute randomly in daughter cells.

Variation

Independent assortment allows for 223 (8.4 x 106) possible combinations in gametocytes.

Variation

Recombination: exchange (crossover) of analogous chromosomal segments between homologous chromosomes.

Variation

Mutation vs Variation!

Mutations

Frame-shift mutations

In-frame mutations

Trinucleotide repeat

mutations

Point Mutations

Silent mutations

Missense mutations

Nonsense mutations

Variation

5’CCCTACATGTTTATT3’If a gene sequence is as shown above, what will be the sequence of mRNA if all nucleotides in the gene are transcribed?Answer: GGGAUGUACAAAUAA

5’GGGAUGUACAAAUAA3’If the sequence above is of a mRNA, infer the sequence of the polypeptide chain encoded by this mRNA by using the following codons information:

GGG: Gly GGA: Gly GGU: Gly UGG: TrpAUG: Initiation codone/Met UAC: Thr ACA: Thr AAA: Lys AAG: lys AAC: Asn AAU: Asn UAA: stop codon Answer: Met-Thr-Lys

Variation

5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :

5’GGGAUGUACAAGUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?

Met-Thr-LysSilent mutation

Variation

Silent mutations: The codon containing the changed base code for the same amino acid.

E.g.: The rat get fat The rat get Fat

Variation


5’GGGAUGUACAACUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?

Met-Thr-AsnMissense mutation

Variation

Missense mutation: The codon containing the changed base code for diferent amino acid.

E.g.: The rat get fat The rat get cat

Variation


5’GGGAUGUAAAACUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?

MetNonsense mutation

Variation

Nonsense mutation: The codon containing the changed base codes for termination (stop codon).

E.g.: The rat get fat The rat

Variation


5’AUGGGAUGGGGUACAAAUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?

Met-Gly-Trp-Gly-Thr-AsnFrame shift mutation

Variation

Frame-shift mutations:If one or two nucleotides are added to or deleted from the coding region of a message sequence.

E.g.: The rat get fat Her atg etf at

Variation

5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :5’GGGAUGUACAAGAAGAAGAAGAAGUAA

3’1-What will be amino acid sequence?2- What is the type of this mutation?

Met-Thr-Lys-Lys-Lys-Lys-LysTrinucleotide repeat

Variation

Trinucleotide repeat mutations: a sequence of three bases that becomes repeated in tandem many times.

E.g.: The rat get fatThe rat rat rat rat rat get fat

introduction to mendelian nonmendelian diseases and nonmendelian... · 2- recombination. variation...

Documents