Interactions with Hosts and Pathogens-a history of close calls-

Clint MagillProfessor of Genetics

Department of Plant Pathology & MicrobiologyTexas A&M University

4N maize X 4N sorghum

• ‘Rescued’ embryos

Pathogen Variability

Louis Prom & Ramasamy Perumal

18 isolates 17 pathotypes

Anthracnose of Sorghum

Rice Blast

Complementing di-auxotrophsPyricularia oryzae

Dennis Genovesi

nic-, ura-

buf, lys-

leu-, ade-

lys-, met-

1N and 2N conidia

Parasexual origin of new pathotypes?

Anther Culture and Rice Chloroplast DNA

Chantel Scheuring

Aberrant Ct DNA in Albinos

Green

Albino

Albino

Green

Alberto Livore

Texmont Rice

Pathogenic Race Changes

Bai Chai Wu

Stable M. grisea Strain

Unstable M. grisea Strain

Phymatotrichum omnivorum

Cotton root rot

grapes

fruit trees (pear)

DNA methylation in P. omnivorum

Mol% C Mol% 5mC % C’s methylated

Mycelium 21.65 +/- 0.08 0.78 +/- 0.07 3.5

Sclerotia 20.39+/- 0.19 2.27+/- 0.08 10.1

P. omnivorum grew in 5AZA C; the sclerotia that formed had no 5mC and did not germinate

Jane Magill, Eldon Jupe

Pathogen-induced host defense -mRNA

Oscar Joost, Al Bell, Bob Stipanovic

CVVK CVVK

HMGR CoA-reductase(first step in terpenoid phytoalexin synthesis)

Chan Benedict, Jingao Liu

- gossypol

Gail Martin

Sorghum Defense Responses

Cory Cui

(PAL is the first step in flavonoid phytoalexin biosynthesis)

Head Smut; Sphacelotheca reiliana

Stealth pathogen- no response

Grain mold/Curvularia & Fusarium

Chris Little, Seriba Katilé

AFP mRNA levels in sorghum glumes 48 h post inoculation with Curvularia lunata (CL), Fusarium thapsinum (FT), water (control) or

both CL+FT.

0

5 0

1 0 0

1 5 0

2 0 0

2 5 0

RTx430+CL

RTx430+CL+FTRTx430+control

RTx430+FTSC170+CL

SC170+CL+FT SC170+Control

SC170+FTSureno+CL

Sureno+CL+FT Sureno+control

Sureno+FT TX2911+CL

TX2911+CL+FTTX2911+control

TX2911+FT

RTx430 SC170 Sureno TX2911

PR10 mRNA levels in glumes 48h p.i.

RTx430 SC170 Sureno TX2911

P. sorghi• conidia-asexual spores

• antheridum and oogonium forming in leaf tissue

Downy mildews of Andropogonea

• Peronosclerospora sorghi• P. maydis• P. sacchari• P. philippinensis (select agent)• P. zeae• Sclerophthora rayssiae (select agent)• Sclerospora graminicola

P. sorghi

Infected seed, with glume

Healthy seed, with glume

Infected seed, no glume

Healthy seed, no glume

Dot-Blot Hybridizations; probe pMLY12

Colletotrichm graminicola

Acremonium strictum

Fusarium moniliforme

Infected seed, glumes 40d

Infected seed, no glumes 40d

Chenglin Yao

ITS 1 ITS 2 & 5.8sP. sorghi pt1

P. sorghi Thai1P. sorghi Thai2

P. maydis

P. sacchari

P. sorghi pt1P. sorghi Thai1P. sorghi Thai2

P. maydis

P. sacchariM M

PCR using conserved ITS primers

Nebulize genomic DNA withHaeIII, RsaI, and DraI+ 50 ng of RNaseA

2. Ligate adaptersAP11 (5´CTCTTGCTTAGATCTGGACTA3´) &AP12 (5´pTAGTCCAGATCTAAGCAAGAGCACA3´, where p = 5´ phosphate)

3. Amplifyby PCR using AP11 primer

4. Hybridize with di & tribiotinylated oligos(TG/AC, CA/GT, GA/CT,CAA, AGG and GTT)

5. Select with streptavidin-coatedparamagnetic beads

6. Elution Of captured DNA

7. Remove residual oligos

8. Amplifyby PCR using AP11 primer

9. Cloning, Squencing,Identifying SSRs,

Primer Designing &Pathotypes genotyping

Microsatellite Capture

SSR’s for DM

Ramasamy Perumal

Cluster analysis of DM species based on 54 Simple Sequence Repeats

R gene taggingSorghum anthracnose example

Midrib infection Stem infection Seed infection

Co-segregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands.

Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1 allele was 152 bp (BTx623) or 155 bp (SC748-5)

Ramasamy Perumal

Jae Min Cho and Andy Paterson

Sorghum RGA Map

Claviceps africana: Ergot

RNAi against cotton nematodes

Root-Knot

reniform

• Two species causing large losses in Texas – Root knot = Meloidogyne incognita– Reniform = Rotylenchulus reniformis

• Plan– ID ‘matching’ sequences in genes of both species that are lethal if

knocked out in C. elegans– Prepare hairpin construct to express in cotton

• a) roots• b) constitutively (CaMV 35S promoter)

• So far– No common sequences, but individual constructs made– Transient expression in root cultures worked well– Transgenic plants look very promising

Keerti Rathore and Jim Starr

THANKS

To you for listening and to

TRRFSeveral USDA Collaborative AgreementsINTSORMILTARPThe Sorghum Checkoff ProgramGlobal Crop Diversity TrustTexas A&M Agrilife Research (formerly TAES)

For Research $$