il21 therapy combined with pd-1 and tim-3 blockade ... · hyungseok seo1,2, byung-seok kim3, eun-ah...

Research Article

IL21 Therapy Combined with PD-1 and Tim-3Blockade Provides Enhanced NK Cell AntitumorActivity against MHC Class I–Deficient TumorsHyungseok Seo1,2, Byung-Seok Kim3, Eun-Ah Bae2, Byung Soh Min4, Yoon Dae Han4,Sang Joon Shin5, and Chang-Yuil Kang1,2

Abstract

Increased expression of coinhibitory molecules such asPD-1 and Tim-3 on NK cells has been demonstrated inadvanced cancer patients who harbor MHC class I–deficienttumors. However, even in preclinical models, the antitumoreffects of checkpoint blockade on NK cells have not beenclearly elucidated. Here, we show that anti–PD-1/anti–Tim-3treatment suppressed tumor progression in mice bearingMHC class I–deficient tumors, and the suppression was fur-ther enhanced by recombinant IL21 (rIL21) treatmentsthrough an NK-cell–dependent mechanism. We also show

that the intratumoral delivery of rIL21 attracted NK cellsto the tumor site in a CXCR3-dependent fashion. A combi-nation of IL21 and checkpoint blockade facilitated theeffector function of exhausted NK cells in cancer patients.Given the effects of the checkpoint blockade and rIL21 com-bination on NK cells infiltrating into MHC class I–deficienttumors, we suggest that the efficacy of checkpoint blockadecan be enhanced through the administration of IL21 foradvanced cancer patients with MHC class I–low/deficienttumors. Cancer Immunol Res; 6(6); 685–95. �2018 AACR.

IntroductionDownregulation or loss of MHC class I expression in tumor

cells is often associated with tumor progression (1–3). Despitethe high susceptibility to immunosurveillance by activated NKcells, MHC class I–low/deficient tumor cells are still detectablein many advanced cancer patients (4). Studies have uncoveredthat MHC class I–deficient tumors induce a functional exhaus-tion of tumor-infiltrating NK cells through the high expressionof inhibitory molecules, such as programmed cell death-1(PD-1) and T-cell immunoglobulin and mucin domain 3(Tim-3; refs. 5–9). However, whether the anti–PD-1/anti–Tim-3 checkpoint blockade is effective for eradicating MHCclass I–deficient tumors through the recovery of NK cell func-tion remains to be elucidated (5).

During the last decade, therapies targeting PD-1 and Tim-3inhibitory receptors have shown clinical efficacy in a subset ofpatients with advanced cancers (10–12). However, many cancerpatients do not respond to anti–PD-1 and anti–Tim-3 therapy(13, 14). Although the combination of anti–PD-1 and anti–Tim-3therapies has shown additive effects in preclinical animalmodels,unmet needs in combination therapy targeting in cancer patientsremain (14). It has long been thought that the antitumor effect ofcheckpoint inhibitors is attributed to the reinvigoration of cyto-toxic T cells (CTL), although most MHC class I–deficient tumorcells readily escape immunosurveillance by the CTLs (3). Con-sidering thatNK cells also coexpress PD-1 and Tim-3 inMHCclassI–deficient tumor-bearing mice with tumor progression, NKcells have emerged as another target for checkpoint blockadeimmunotherapy (6).

Cytokine therapies have been tested in preclinical studiesand clinical trials to treat cancer by directly activating immunecells, including T cells (4, 15). Because NK cells express recep-tors for various cytokines, including IL2, IL7, IL12, IL15, IL18,and IL21, the addition of these cytokines also promotes theactivation and maturation of NK cells (4, 16, 17). For example,we previously demonstrated that the administration of IL21 inMHC class I–deficient tumor-bearing mice induced robustantitumor immunity through the reactivation of exhausted NKcells (5). Although many cytokine therapies have shown prom-ising clinical outcomes in cancer patients, potential toxicityat higher doses has been a hurdle to their clinical application(18–20). Therefore, the development of strategies for minimiz-ing the adverse effect of cytokine therapy while maintaining itsefficacy is required.

In the present study, we found that PD-1 and Tim-3 blockaderestrained MHC class I–deficient tumor progression by reinvigor-ating the function ofNK cells. PD-1 and Tim-3 blockadewith IL21

1Laboratory of Immunology, Research Institute of Pharmaceutical Sciences,College of Pharmacy Seoul National University, Seoul, Republic of Korea.2Department of Molecular Medicine and Biopharmaceutical Sciences, GraduateSchool of Convergence Science and Technology, Seoul National University,Seoul, Republic of Korea. 3Laboratory of Immune Regulation, Research Instituteof Pharmaceutical Sciences, College of Pharmacy, Seoul National University,Seoul, Republic of Korea. 4Department of Surgery, Yonsei University College ofMedicine, Seoul, Republic of Korea. 5Department of Internal Medicine, YonseiUniversity College of Medicine, Seoul, Republic of Korea.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

Corresponding Author: Chang-Yuil Kang, Bldg 29, Rm 117, Seoul NationalUniversity, Gwan-ak ro 1, Seoul 08826, Republic of Korea (South). Phone: 82-2-880-7860; Fax: 82-2-885-1373; E-mail: [email protected]

doi: 10.1158/2326-6066.CIR-17-0708

�2018 American Association for Cancer Research.

CancerImmunologyResearch

www.aacrjournals.org 685

on July 28, 2020. © 2018 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst April 3, 2018; DOI: 10.1158/2326-6066.CIR-17-0708

http://crossmark.crossref.org/dialog/?doi=10.1158/2326-6066.CIR-17-0708&domain=pdf&date_stamp=2018-5-8

http://cancerimmunolres.aacrjournals.org/

also eradicatedMHC class I–deficient tumors. Finally, we showedthat IL21 enhanced the antitumor effect of PD-1 and Tim-3blockade by inducing CXCR3-dependent infiltration of NK cellsinto tumor sites.

Materials and MethodsMice and human samples

Female C57BL/6 mice were purchased from Charles RiverLaboratories. All mice were used at 6 to 10 weeks of age andwere bred and maintained in the specific pathogen-free vivar-ium of the Seoul National University. All animal experimentswere approved by the Institutional Animal Care and UseCommittee (IACUC) at Seoul National University. The humantumor tissue and normal tissue specimens from patients withcolorectal (n ¼ 3), melanoma (n ¼ 1), and bladder cancer(n ¼ 1) were obtained from surgical specimens of patients. Thematched normal tissues were at least 2 cm away from the edgeof corresponding tumors. The tumor tissues were placed in inRPMI 1640 medium (GIBCO) that was supplemented with10% FBS (GIBCO), 1% penicillin/streptomycin (Lonza),1 mmol/L sodium pyruvate (Lonza), 0.1 mmol/L NEAA (Lonza),55mmol/L 2-mercaptoethanol (GIBCO), and 25mmol/LHEPES(Lonza) on ice before the tumor dissociation. Tumor tissuesless than 1 cm were excluded from this study. The collectionof human samples was approved by the ethical committee ofSeverance Hospital.

Reagents and antibodiesThe antibodies for flow cytometry were purchased from

BioLegend, eBioscience, and BD Biosciences. The antibodiesagainst PD-1 (RMP1-14, cat: 1141), Tim-3 (RMT3-23, cat:1197), CD3e (145-2C11, cat: 1003), CD19 (6D5, cat: 1155),NK1.1 (PK136, cat: 1087), CXCR3 (CXCR3-173, cat: 1265),CD16(3G8, cat: 3020), CD56(HCD56, cat: 3183), and CD45.2(104, cat: 1098) were purchased from BioLegend. The antibodiesagainst IFNg (XMG1.2, cat: 7311), granzyme B (NGZB, cat: 8898),PD-1 (MIH4, cat: 9969), Tim-3 (F38-2E2, cat: 3109), IFNg (4S.B3,cat: 7319), and granzyme B (GB11, cat: 8899) were purchasedfrom eBioscience. The antibodies for in vivo depletion of NK1.1(PK136, cat: BE0036), CXCR3 (CXCR3-173, cat: BE0249), andCD8 (2.43, cat: BE0061) were purchased from Bio X Cell. Therecombinantmouse IL2 (cat: 402-ML),mouse IL21 (cat: 594-ML),human IL2 (cat: 202-IL), human IL21 (cat: 8879-IL), and humananti-NKp46 (cat: MAB1850) were purchased from R&D Systems.

Cell line generation and cultureThe MC38, TC-1, and CT26 cell lines were purchased from

ATCC (MC38 and TC-1 were purchased in 2006, and CT26 waspurchased in 2002), and we checked morphology, growth kinet-ics, and antigen expression of tumor cells to validate them. Thecells were distributed in several vials (1 � 106/vial) with culturemedia [DMEM (GIBCO), 10% FBS (GIBCO)] that was supple-mented with 10% DMSO (Sigma-Aldrich) and stored in a liquidnitrogen tank. The cells were cultured in DMEM (GIBCO) thatwas supplemented with 10% FBS (GIBCO) and 1% penicillin–streptomycin. MHC class I, PD-1, and galectin-9 molecule geneswere knocked out by CRISPR/Cas9 technology. The optimizedsingle-guide RNA (sgRNA) constructs, targeting PD-L1 andgalectin-9, and theCas9 expression construct, pRGEN-Cas9-CMV,were obtained from ToolGen. The MC38, TC-1, CT26 MHC

class I–deficient cell lines and MC38 MHC class I–deficientand PD-L1 or galectin-9 double knockout cell lines were generat-ed by transfection with the indicated sgRNA construct [H2-k1exon 3: AGCCGTCGTAGGCGTACTGCTGG, H2-d1 exon 2: AGT-CACAGCCAGACATCTGC TGG, B2m exon2: TCACGCCACCCA-CCGGAGAATGG, Pdcd1 exon 2: GACTTGTACGTGGTGGAG-TATGG; Lgal9 exon2: CCCTTTACTGGACCAATCCAAGG; andpRGEN-Cas9-CMV using Lipofectamine 2000 (Invitrogen)],according to the manufacturer's protocol. Each genome-editedcell line was sorted by a T7E1 assay (ToolGen) with single-cellselection or FACSAria III (BD Bioscience). For T7E1 assay withsingle-cell selection, we followed the manufacturer's protocol.For sorting with FACSAria III, we sorted the negative populationafter staining with knockout molecules in tumor cells. For veri-fying the purity of knockout tumor cell lines, we analyzedthe expression of knockout molecules using FACSAria III (BDBioscience) after stimulation for 24 hours with mouse IFNg(10 ng/mL; R&D Systems) to induce knockout of molecules.

For primary cell culture (primary cells were lymphocytestaken from mouse/human tumor tissue), the mouse primarycells were cultured in RPMI 1640 (GIBCO) medium that wassupplemented with 10% FBS (GIBCO) and 1% penicillin–streptomycin (Lonza). Human primary cells were cultured inX-VIVO15 medium (Lonza) that was supplemented with 1%penicillin–streptomycin (Lonza). For NK cell culture, a lowdose (1–2 ng/mL) of rIL2 was added to the culture medium forcell survival. All cell lines were found to be negative formycoplasma contamination, and these cell lines were used atpassages 3 to 7 for all experiments after MHC class I–deficientcell lines generation.

In vitro cytotoxicity assayThe NK cells were prepared from tumor-infiltrating lympho-

cytes from MHC class I–deficient, MHC class I–deficient plusPD-L1 knockout, MHC class I–deficient plus galectin-9 knock-out tumor-bearing mice via FACSArea III sorting as effectorcells. Next, NK cells were cocultured with 51Cr-labeled respec-tive tumor cells as target cells. The effector-to-target cell ratio(E:T) was 1:1, 3:1, and 10:1, and NK cell cytotoxicity wascalculated by 51Cr release in the culture supernatants throughthe specific lysis of the target cells, as measured by a Wallac1480 Wizard automatic g-counter (PerkinElmer). When NKcells were cocultured with tumor cells, the tumor cells wereirradiated (5,000 rad) using a g irradiator (GC 3000 Elan) atthe National Center for Inter-University Research Facilities(NCIRF) at Seoul National University.

Transplantable tumor and therapeutic tumor modelsConventional subcutaneous indicated tumors were generated

by subcutaneous (s.c.) injection in the right flank. The tumorgrowth was measured by a metric caliper 2 to 3 times a week.For the therapeutic tumor model, 5 � 105 tumor cells weresubcutaneously injected into the left flank of mice on day 0.Recombinant IL21 (rIL21; 10 mg in 100 mL PBS) or PBS (100 mL)alone were injected intratumorally (i.t.) using a 31-gauge insulinsyringe at the indicated time points. All depleting antibodieswere administered every 3 days. The indicated checkpointblockade antibodies (anti–PD-1: 300 mg/mouse; anti–Tim-3:300 mg/mouse) or depleting antibodies (anti-CD8: 200 mg/mouse;anti-NK1.1: 200mg/mouse; and anti-CXCR3: 100 mg/mouse)were administered via intraperitoneal (i.p.) route, according to

Seo et al.

Cancer Immunol Res; 6(6) June 2018 Cancer Immunology Research686




themanufacturer's instructions. Themouse survival ratewas exam-ined by actual survival, and statistical analysis was performed bylog-rank Mantel–Cox test (conservative). Mouse whole tumorweight was measured by microbalance upon sacrifice at day 13after tumor inoculation.

Antibody staining and flow cytometry analysisThe cells (mouse and human primary cells: 1 � 105 to 5 � 105,

respectively, and mouse tumor cells: 5 � 104 to 1 � 105) werestained with anti-mouse CD16/32 (BioLegend) for FcR blocking,and the specified surface antibodies in 50 mL of FACS buffer (PBSNplus 1% FBS). The cells were incubated on 4�C in the dark for15 minutes, and then the cells were washed with FACS buffer.Dead cells were excluded by staining with Fixable Viability Dye(eBioscience), following the manufacturer's instruction. Intracel-lular staining for the indicated cytokines was performed aftersurface staining with the Cytofix/Cytoperm kit (BD Bioscience),according to the manufacturer's instruction.

To assay the cytokine release from human NK cells, 3 � 104 –1 � 106 cells were stimulated in flat-bottomed, high-protein–

binding plates (Corning) that were coated with hNKp46antibodies for 5 hours in the presence of GolgiPlug (1 mg/mL;BD) before staining the cells for intracellular IFNg , perforin, orgranzyme B. The samples were acquired with a FACSCalibur or aFACSAria III instrument (BD Biosciences), and the data wereanalyzed with FlowJo software (TreeStar).

Tumor-infiltrating lymphocyte preparationMouse and human tumors were cut 2 to 5 mm sizes and

placed C tube (Miltenyi Biotec) containing RPMI 1640 mediumwith 10% FBS containing Collagenase D (300 mg/mL; Roche),hyaluronidase (20 mg/mL; Sigma-Aldrich), and DNase I(20 mg/mL; Sigma-Aldrich) or reagents from a human tumordissociation kit (Miltenyi Biotec, cat: 130-095-929). After, thetumors were dissociated using the gentleMACS Dissociator(Miltenyi Biotec, cat: 130-093-235). The dissociated tumorswere incubated in 37�C for 30 minutes and washed in PBS.Next, lymphocytes were separated using lymphocyte separa-tion medium (MP Biomedicals, cat: 0850494) and filtered ina 70-mm nylon mesh. Lymphocytes were counted and used for

Figure 1.

Genetic deletion of PD-L1 or galectin-9 results in tumor regression and NK cell function. A, Flow cytometry analysis of PD-1 and Tim-3 expression on intratumoralNK cells in mice bearing MHC class I knockout (M1 KO), MHC class I and PD-L1 knockout (M1 and PD-L1 KO), and MHC class I and galectin-9 knockout (M1 andGal9 KO) MC38 tumors. B, C57BL/6 mice were inoculated with MC38 M1, M1andPD-L1, and M1 and Gal9 KO tumor cells (5 � 105). Mice (n ¼ 6/group) weretreated with anti-CD8 to deplete CD8þ T cells the day after tumor inoculation, and anti-CD8 was administered every 3 days by i.p. injection. Tumor growth wasmeasured three times weekly by caliper. C, Intratumoral NK cells isolated from mice bearing different types of tumors were cocultured with the respectivetarget tumor cells that were labeled with 51Cr prior to culturing to assess specific lysis. D, IFNg and granzyme B (GrazB) expression on intratumoral NK cellswas analyzed by flow cytometry at day 12. The data in B was analyzed by a two-way ANOVA with a Bonferroni multiple comparison test, and C and D wereanalyzed by Student t test. � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001. The data are representative of at least two independent experiments thatincluded six mice per group. All values represent the mean � SEM.

IL21 and Checkpoint Blockade Enhance Antitumor Immunity

www.aacrjournals.org Cancer Immunol Res; 6(6) June 2018 687




FACS staining tumor-infiltrating NK cell was calculated as

¼ % of CD45:2þ NK1:1þ cells � No: of tumor�infiltrating lymphocytetumor weight ðgÞ

� �:

Quantification of chemokine production by tumor cellsTo measure the production of the CCL5, CXCL9, and CXCL10

chemokines by tumor cells, MC38 and TC-1 MHC class I–defi-cient tumor cells were harvested from tumor-bearing mice, thedissociated tumor cells were maintained in RPMI 1640 mediumsupplemented with 10% FBS for 2 days prior to supernatantcollection. The following chemokines were measured in thesupernatant an ELISA kit according to the manufacturer's instruc-tions: CCL5, CXCL9, and CXCL10 (R&D Systems).

Statistical analysisStatistical comparisons were performed using the Prism (ver-

sion 6.0) software (GraphPad Software). P values were deter-mined as follows: (i) two-way ANOVAwith a Bonferronimultiplecomparisons test: Figs. 1B, 2B, 4B, 4E, Fig. 5J; Supplementary Fig.S4B; Supplementary Fig. S6B and S6C; (ii) unpaired two-tailedStudent t test: Figs. 1C, 1D, 3A, 3B, 4D, 5B, 5D, 5E, 5F, 5I, 6E;Supplementary Figs. S3; S5; S7A; S7B, and S8; and (iii) a log-rank(Mantel–Cox) test (conservative): Figs. 2C and4C.

ResultsAntitumor effects of targeting Tim-3 and PD-1 in MHC class I–deficient tumors

We previously reported that tumor-infiltrating NK cells arefunctionally exhausted and coexpress PD-1 and Tim-3 mole-cules on their surface in MHC class I–deficient tumor-bearingmice (5). To determine whether the PD-1/PD-L1 and Tim-3/galectin-9 axis transmit negative signals in tumor-infiltratingNK cells, we used the CRISPR/Cas9 system to genetically delete

the Pdcd1 or Lgal9 gene in an MHC class I–deficient MC38tumor cell line (Supplementary Fig. S1A). The prolifera-tive capacities of the resultant PD-L1-deficient, MHC classI–deficient (MC38 M1&PD-L1 KO), and galectin-9-deficient,MHC class I–deficient (MC38 M1&Gal9 KO) cell lines werecomparable with the MHC class I–deficient (M1 KO) controltumor cells in vitro (Supplementary Fig. S1B). When subcuta-neously implanted in syngeneic C57BL/6 mice, each MHC classI–deficient tumor cell line comparably induced PD-1þTim-3þ

NK cells at the tumor site, regardless of PD-L1 or galectin-9expression (Fig. 1A). To exclude the possible involvement ofCD8þ T cells, CD8þ T cells were depleted by treating with anti-CD8 after MHC class I–deficient tumor inoculation (Supple-mentary Fig. S2). PD-L1 deficiency almost completely abro-gated the progression of MHC class I–deficient tumor cells,whereas the tumor progression was partially inhibited bygalectin-9 deficiency (Fig. 1B), and PD-L1 or galectin-9 defi-ciency increased intratumoral NK cell cytotoxicity against micebearing each type of tumor (Fig. 1C). The frequencies of IFNgþ

and granzyme B (GrazB)þ NK cells were inversely correlatedwith tumor burdens, suggesting that both PD-1/PD-L1 andTim-3/gal-9 axes contribute to the functional exhaustion oftumor-infiltrating NK cells in MHC class I–deficient tumor-bearing mice (Fig. 1D).

We next sought to examine whether the abrogation of eitherPD-1/PD-L1 or Tim-3/galectin-9 signaling by anti–PD-1 or anti–Tim-3 treatment, respectively, could inhibit the progression ofMHC class I–deficient tumor cells. Our previous study revealedthat Tim-3 expression on NK cells was induced a few days earlierthan PD-1 expression. Based on this finding, anti–Tim-3 treat-ment started earlier than anti–PD-1 treatment, and to exclude thepossible involvement of CD8þ T cells in response to checkpointblockade, CD8þ T cells were depleted using anti-CD8 (Fig. 2A).

Figure 2.

Effect of anti–PD-1 and anti–Tim-3 checkpoint blockade in mice bearing MHC class I–deficient tumors. A, Mice (n ¼ 6/group) were treated with anti–PD-1 and/oranti–Tim-3, as indicated on the schedule, after MC38 MHC class I–deficient tumor (M1 KO) subcutaneous injection (5 � 105) at day 0. Mice were depleted ofCD8þ T cells using anti-CD8 every 3 days by i.p. injection. B, Tumor growth and (C) survival over time of M1 KO tumor-bearing mice (n ¼ 6/group)treated with control IgG, anti–PD-1, and anti–Tim-3 antibodies. The data in B were analyzed by a two-way ANOVA with a Bonferroni multiple comparisontest, and C was analyzed using a log-rank Mantel–Cox test (conservative). � , P < 0.05; ��P < 0.01; �� , P < 0.001; �� , P < 0.0001. The data are representativeof at least two independent experiments that included six mice per group. All values represent the mean � SEM.

Seo et al.





We found that anti–PD-1 or anti–Tim-3 treatment inhibitedtumor growth and improved survival compared with control IgGtreatment (median survival: 32 days), and anti–PD-1 treatmentinhibited tumor growth and improved the survival of the tumor-bearing mice (median survival: 46.50 days) to a greater extentthan treatmentwith anti–Tim-3 (median survival: 36 days; Fig. 2Band C). We then tested whether a combination of anti–PD-1 andanti–Tim-3 could induce an additive increase in the antitumoreffects against MHC class I–deficient tumors. Although tumorgrowth was not significantly inhibited by the combination ther-apy, the addition of an anti–Tim-3 antibody marginally extendedthe survival of the mice compared with the anti–PD-1 antibodyalone (Fig. 2B and C).

IL21 and checkpoint blockade enhance the effector functionof exhausted NK cells

Studies have shown that cytokine therapy restores the functionof exhausted NK cells in MHC class I–deficient tumor microen-vironments (5, 21, 22). We tested whether rIL2, rIL12, or rIL21could increase the effector function of NK cells in MHC class I–deficient tumors. IFNgþ NK cells were increased by rIL21 treat-ment in a dose-dependent manner, whereas either rIL2 or rIL12treatmentwas less effective than rIL21 treatment at all tested doses(Supplementary Fig. S3). Our previous study demonstrated thatrIL21 treatment restored the effector function of exhausted NKcells in MHC class I–deficient tumor-bearing mice through thePI3K–AKT–Foxo1 andSTAT1 signalingpathways,while the rIL21-treatedNK cells still expressed PD-1 and Tim-3molecules on theirsurface (5). Based on this finding, we hypothesized that the

blockade of PD-1 and Tim-3 has an additive effect on therIL21-mediated reversal of NK cell function. Consistent with thedecreased tumor progression with anti–PD-1/anti–Tim-3 treat-ment, IFNgþ or granzyme Bþ NK cells were increased in anti–PD-1/anti–Tim-3-treated MHC class-deficient tumor-bearingmice compared with those in the control-treated mice (Fig. 3Aand B). The addition of exogenous rIL21 further increasedIFNg and granzyme B expression in tumor-infiltrating NK cellsisolated from mice treated with anti–PD-1/anti–Tim-3 (Fig. 3Aand B). Collectively, these results suggest that the combinationof rIL-21 and anti–PD-1/anti–Tim-3 may foster antitumorimmune responses against MHC class I–deficient tumors byenhancing the effector function of exhausted NK cells.

Combination IL21 and checkpoint blockade enhancesantitumor effects

To evaluate whether checkpoint blockade could furtherenhance IL21-mediated antitumor immunity against MHC classI–deficient tumors, intratumoral rIL21 in combination with anti–PD-1/anti–Tim-3 was administered to M1 KO MC38, TC-1, andCT26 tumor-bearingmice. To exclude thepossible involvement ofCD8þ T cells in response to either IL21 or checkpoint blockade,CD8þ T cells were depleted using anti-CD8 (Fig. 4A; Supplemen-tary Figs. S2A and S4A). Although both intratumoral rIL21 aloneand anti–PD-1/anti–Tim-3 alone were comparably effective forrestrainingM1 KOMC38 and TC-1 tumor growth compared withcontrol IgG, a combination of rIL21 and anti–PD-1/anti–Tim-3therapies was more effective than each monotherapy in terms oftumor progression, as well as survival of the mice (Fig. 4B and C;

Figure 3.

Induction of effector cytokines in the intratumoral NK cells after treatment with rIL21 in vitro. A and B, Mice (n ¼ 6/group) were treated with the anti–PD-1and anti–Tim-3 antibodies, as indicated on the schedule, after MC38 MHC class I–deficient tumor subcutaneous injection (5 � 105) at day 0. Mice were depletedof CD8þ T cells by anti-CD8 every 3 days by i.p. injection. rIL21 or vehicle was added to intratumoral NK cells isolated from the indicated treated mice.A, IFNg and (B) granzymeB (GrazB)were analyzed by flow cytometry. The datawere analyzed by Student t test. � ,P<0.05; �� ,P <0.01; ��P<0.001; �� ,P <0.0001.The data are representative of at least two independent experiments that included six mice per group. All values represent the mean � SEM.






Supplementary Fig. S4B and C). However, although intratumoralrIL21 and anti–PD-1/anti–Tim-3 alonewere comparably effectivefor restrainingM1KOCT26 tumor growth comparedwith controlIgG, the combination therapy was not more effective than eachmonotherapy in termsof tumor progression inmice bearingCT26tumors (Supplementary Fig. S4D).

The frequency of IFNgþ intratumoral NK cells was signifi-cantly increased after the combination of rIL21 and anti–PD-1/anti–Tim-3 therapies, suggesting that combination therapyadditively restored the function of exhausted NK cells (Fig.4D; Supplementary Fig. S4C). In contrast, the frequency andabsolute number of intratumoral NK cells were significantlyincreased by the combination therapy but were indistinguish-able from those with the rIL21 treatment alone, indicating thatIL21 was responsible for the recruitment of NK cells into thetumor site (Supplementary Fig. S5). The antitumor effect ofcombination therapy was dependent on NK cells, as NK celldepletion by anti-NK1.1 treatment abrogated the tumor growthinhibition by combination therapy (Fig. 4E).

To verify whether the combination of rIL21 with checkpointblockade enhances antitumor effects in MHC class I–deficienttumors, we administered checkpoint blockade alone, rIL21 alone,or rIL21with checkpoint blockade inM1&Gal9 KOorM1&PD-L1KO MC38 tumor models (Supplementary Fig. S6A). Althoughboth intratumoral rIL21 alone and anti–PD-1 alone were com-parably effective for restraining M1&Gal9 KO MC38 tumor

growth compared with control IgG, the combination of rIL21with anti–PD-1 was more effective than each monotherapy interms of tumor progression (Supplementary Fig. S6B), andalthough anti–Tim-3 alone or intratumoral rIL21 alone did notsignificantly inhibit M1&PD-L1 KO MC38 tumor growth com-paredwith control IgG, the combination of rIL21with anti–Tim-3significantly suppressed M1&PD-L1 KO MC38 tumor growth(Supplementary Fig. S6C). Collectively, these results suggest thatIL21 and anti–PD-1/anti–Tim-3 combination therapy improvesantitumor immunity by enhancing tumor infiltration and theeffector function of NK cells.

Increased local accumulation of NK cells by intratumoraladministration of rIL21

Aswe described earlier, we found that the combination of rIL21and checkpoint blockade therapies or rIL21 alone increased thetumor infiltration of NK cells (Supplementary Fig. S5). It ispossible that intratumoral administration of rIL21 increases therecruitment of NK cells to the tumor site. To address this possi-bility, rIL21 was administered intratumorally in MHC class I–deficient tumor-bearing mice. After 3 administrations of rIL21,the frequency and absolute number of tumor-infiltrating NKcells were significantly increased compared with the vehicletreatment (Fig. 5 A and B). CXCR3 expression on tumor-infiltrat-ing NK cells and CXCL9 and CXCL10 production by MC38 andTC-1 tumor cells were significantly enhanced by rIL21 treatment,

Figure 4.

Enhanced antitumor effects with combination IL21 and anti–PD-1/anti–Tim-3 therapy. A–E, MC38 MHC class I–deficient (M1 KO) tumor-bearing mice (n¼ 6/group)were treated with rIL21 (10 mg/mouse) by intratumoral injection and/or anti–PD-1/anti–Tim-3 by i.p. injection. A–D, Mice were treated with anti-CD8 todeplete CD8þ T cells every 3 days.B, IFNg expression onNK cells was analyzed by flow cytometry.C, Tumor growthwasmeasured using ametric caliper 2 to 3 timesper week. D, Survival rate in each group is represented. E, Mice (n ¼ 6/group) were treated with anti-NK1.1 every 3 days for depleting NK cells by i.p. injection, andtumor growth was measured using a metric caliper 2 to 3 times per week. The data in B were analyzed by Student t test. The data in C and E were analyzedby a two-way ANOVA with a Bonferroni multiple comparison test. The data in D were analyzed using a log-rank Mantel–Cox test (conservative). � , P < 0.05;�� , P < 0.01; �� ; P < 0.001; �� , P < 0.0001. The data are representative of at least two independent experiments that included six mice per group. All valuesrepresent the mean � SEM.

Seo et al.





suggesting that CXCR3-dependent chemotaxis is associated withthe increased recruitment of NK cells at the tumor site by rIL21(Fig. 5C–E; Supplementary Fig S7A and B). However, CCL5production by each tumor cell was not significantly enhancedby rIL21 treatment (Fig. 5F; Supplementary Fig. S7C). Consistentwith this notion, CXCR3 blockade abrogated the IL21-mediatedincrease in NK cell infiltration at the tumor site (Fig. 5G–I) andcompletely abolished the tumor growth inhibition by rIL21treatment (Fig. 5J). Altogether, these results clearly indicated thatCXCR3-dependent recruitment of NK cells to the tumor site wasessential for the IL21-mediated antitumor immune responses.

Improving the effector function of exhausted NK cells in cancerpatients by a combination of rIL21 and checkpoint blockade

Studies have demonstrated that the coexpression of PD-1 andTim-3 molecules marks functionally exhausted intratumoral NKcells in patients with different cancers and that the antibody-mediated blockade of these coinhibitory molecules restores thefunction of NK cells (6–8, 23, 24). We also previously foundthat rIL21 treatment was effective in restoring the function ofexhausted PD-1þTim-3þ NK cells isolated from tumor tissues ofcancer patients (5). To evaluate whether the combination of rIL21treatment and checkpoint blockade could enhance the functional

Figure 5.

CXCR3-depedent recruitment of NK cells in tumor tissue by intratumoral administration of rIL21.A–D,MC38MHC class I–deficient tumor-bearingmice (n¼ 6/group)were treated with rIL21 (10 mg/mouse) by intratumoral injection.A, The percentage of intratumoral NK cells was analyzed by flow cytometry, and (B) the number ofintratumoral NK cells was calculated. C, CXCR3 expression on intratumoral NK cells was analyzed by flow cytometry. D–F, MC38 MHC class I–deficient tumorcells (M1 KO) were harvested from indicated treated mice on Day 13. Tumor cells were cultured for 2 days prior to supernatant collection. The concentrationsof the chemokines (D) CXCL9, (E) CXCL10, and (F) CCL5were analyzed by ELISA from the culture supernatant.G–J,M1 KOMC38 tumor-bearingmice (n¼ 6/group)were treated with rIL21 (10 mg/mouse) by intratumoral injection and/or anti-CXCR3 (100 mg/mouse) by i.p. injection. H and I, The percentage of intratumoralNK cells was analyzed by flow cytometry, and the number of intratumoral NK cells was calculated (J) tumor growth was measured using a metric caliper2 to 3 times per week. The data in B, D, E, F and I were analyzed by Student t test. The data in J were analyzed by a two-way ANOVA with a Bonferroni multiplecomparison test. � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001. The data are representative of at least two independent experiments that includedsix mice per group. All values represent the mean � SEM.






reversal of exhausted NK cells in cancer patients, we treatednormal tissues or tumor tissues isolated from cancer patientswith rIL21 alone, anti–PD-1/anti–Tim-3 alone, or both.rIL21 treatment significantly increased IFNg production ofPD-1�Tim-3� NK cells, whereas checkpoint blockade did notaffect IFNg production of PD-1�Tim-3� NK cells from normaltissues (Supplementary Fig. S8). When we analyzed the IFNgexpression of intratumoral PD-1þTim-3þ NK cells as a readoutfor NK cell function, it was significantly augmented by treat-ment with rIL21 alone, whereas checkpoint blockade wasless effective. The combination of rIL21 and the check-point blockade increased IFNg production by intratumoralPD-1þTim-3þ NK cells (Fig. 6A and B). Taken together, theseresults suggest that a combination of rIL21 and checkpointinhibitors can enhance antitumor immunity in cancer patientsby additively increasing the effector function of NK cells.

DiscussionAdvances in cancer immunotherapy are not only changing

standard therapies for cancer but are also expected to yieldcomplete responses in patients with advanced cancer (25–27).Although various cancer immunotherapies, such as checkpointinhibitors, immunostimulatory cytokines, tumor vaccines, andCAR-T cells, have shown clinical efficacy, a significant proportionof cancer patients still do not respond to any of these immu-notherapies (28–30). Most immunotherapies have mainlyfocused on their effect on T cells, whereas NK cells are one ofthemost important effector arms, especially against MHC class I–

deficient tumors, whose frequency is closely associated with themalignancy of the cancer (4, 5, 31, 32).

PD-1 and Tim-3 expressed on exhausted T cells are well knowntargets for cancer immunotherapy, and various ongoing clinicaltrials are targeting these molecules (11, 33, 34). Several studieshave shown that PD-1 and Tim-3 expression onNK cells results indeceased cytokine production, degranulation, and cytotoxicity,indicating that these coinhibitorymolecules not only act onT cellsbut alsoonNKcells (6–9, 24). In our previous study,we also showthat PD-1þTim-3þ NK cells with defective effector function arefound in MHC class I–deficient tumor-bearing mice and cancerpatients (5), and rIL21 treatment restores the effector function ofexhausted NK cells. Interestingly, the PD-1 and Tim-3 expressionlevels on NK cells were still maintained even after rIL21 treatment(5). Thisfinding ledus to evaluatewhether anti–PD-1/anti–Tim-3checkpoint blockade enhances rIL21-mediated antitumor immu-nity against MHC class I–deficient tumors. Checkpoint blockadein combination with intratumoral rIL21 treatment furtherincreased the effector function of NK cells, leading to the signif-icant regression of established tumors. Whereas both rIL21 andcheckpoint blockade contributed to the enhancement of NK celleffector function, the combination of the two was more effectivethan each single therapy. These results suggest that the twodifferent therapies may enhance NK cell effector function viadistinct mechanisms of action.

It has been demonstrated that IFNg upregulates CXCL9 andCXCL10 chemokine expression in tumors (35–37). We alsofound that rIL21 administration augmented CXCL9 and CXCL10production by tumors. However, whether IL21 directly induces

Figure 6.

rIL21 and checkpoint blockade restoreIFNg production in Tim-3þPD-1þ

intratumoral NK cells from cancerpatients. A and B, Isolatedintratumoral immune cells from cancerpatients were incubated overnight inthe presence or absence of rIL21(10 ng/mL) and/or anti–PD-1/anti–Tim-3 antibodies (1 mg/mL). IFNgexpression on Tim-3þPD-1þ NK cellswas analyzed by flow cytometry. Thedata were analyzed by Student t test.� , P < 0.05; �� , P < 0.01; �� , P < 0.001;�� , P < 0.0001. The data arecumulative from five tumor tissuesfrom colon (3 patients), bladder(1 patient), and melanoma (1 patient)cancer patients. All values representthe mean � SEM.

Seo et al.





CXCL9 and CXCL10 expression by tumor cells or whetherincreased IFNg production by IL21-activated NK cells indirectlycontributes to the chemokine production remains to be elucidat-ed. Whereas the anti–PD-1/anti–Tim-3 checkpoint blockade wasfound to be less effective in NK cell recruitment to the tumor site,intratumoral rIL21 administration significantly increased the NKcell infiltration into the tumor. These results provide evidence thatthe two therapies act at different stages during development of theantitumor immune response.

Our present study has focused on the antitumor effects ofNK cells induced by IL21 and checkpoint blockade combina-tion therapy against MHC class I–deficient tumors. However, itis possible that the combination therapy may be beneficialfor the eradication of MHC class I–sufficient tumors throughenhancing the effector functions of exhausted T cells. Previouspreclinical and clinical studies have suggested that IL21enhances and sustains antitumor immune responses of cyto-toxic CD8þ T cells (38–40), and targeting the PD-1 and Tim-3pathways is effective in restoring antitumor immunity byreversing exhausted T cells (34, 41). Therefore, the combina-tion of rIL21 and checkpoint blockade could foster the anti-tumor immune responses of exhausted T cells, as well as thoseof exhausted NK cells.

Another study has demonstrated that PD-1 expression oftumor-associated macrophages (TAM) gradually increaseover time in tumor-bearing mice and in cancer patients withincreasing disease stages (42, 43). These authors also show thatPD-1/PD-L1 blockade inhibits tumor growth in variousmouse tumor models by enhancing the phagocytosis of TAMs(42, 43). Another study shows that the intratumoral delivery ofIL21 can skew TAM polarization from the M2 phenotype to theM1 phenotype, which is known to inhibit tumor progression(44). Based on these findings, a combination of IL21 and check-point blockade might have affected the function of the macro-phages. In this study, NK cell depletion did not completelyabrogate the tumor growth inhibition by IL21 and checkpointblockade combination therapy, suggesting that other immunecells, such as macrophages, could be involved in enhancingthe antitumor effect of combination therapy. Given that macro-phages also contribute to the rejection of MHC class I–deficienttumors, further studies are needed to identify whether theenhancement of TAM phagocytosis is involved in the additiveincrease of antitumor immunity by the combination of IL21and checkpoint blockade.

Although our study has examined the role of PD-L1, galec-tin-9, CXCL9, and CXCL10 expression by tumor cells, thesemolecules are also expressed or secreted by various immunecells. Myeloid-derived suppressor cells populating the tu-mor microenvironments express both PD-L1 and galectin-9(45–47). CXCL9 and CXCL10 can be secreted by M1 macro-phages (48). Their expression or secretion by various immunecells might be crucial for regulating antitumor immuneresponses. Therefore, further studies are needed to identifythe roles of PD-L1, galectin-9, CXCL9, and CXCL10 expressionby other immune cells.

Previous attempts to treat cancer with cytokines have pro-vided dramatic clinical efficacy in some preclinical mousemodels but have yielded disappointing results in humanclinical trials with high systemic toxicity (18, 19). However,our combination regimen of rIL21 and checkpoint blockadedid not induce any evident side effects, such as weight

loss. Considering that rIL21 has been proven safe in clinicaltrials for treating metastatic melanoma patients or renalcell carcinoma patients, rIL21 might be one of the mostpromising candidates as a combination partner for checkpointblockade immunotherapy (49, 50). Although rIL21 was intra-tumorally injected in the present study to avoid possiblesystemic detrimental effects of the cytokine, systemic deliveryof IL21 could potentially induce antitumor effects in clinicaltrials (20).

In this study, although we showed that combinationtherapy enhanced antitumor immune responses in MHCclass I–deficient mouse tumor models by an NK cell-depen-dent mechanism, not all of the tumor cells in cancer patientsare MHC class I–deficient. Given that human cancer micro-environments are more complex than mouse tumor models,particularly in end-stage cancer patients with heterogeneoustumors, the direct application of these findings to the humanclinical setting may be limited. However, combining IL21 andcheckpoint blockade could enhance antitumor responses ofNK cells, as well as CD8þ T cells, for eradicating heterogeneoustumors. In summary, our study showed that the PD-1/PD-L1and Tim-3/galectin-9 axes transmitted negative signals onNK cells, and checkpoint blockade, such as anti–PD-1 oranti–Tim-3, significantly inhibited tumor growth, and intra-tumoral administration of rIL21 recruited NK cells to thetumor site through a CXCR3-dependent mechanism. Thecombination of IL21 with anti–PD-1/anti–Tim-3 was moreeffective than the monotherapy in eradicating MHC class I–deficient tumors. The improved therapeutic efficacy of com-bination of IL21 with checkpoint blockade warrants theinitiation of a clinical trial with this regimen.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: H. Seo, C.-Y. KangDevelopment of methodology: H. Seo, E.-A. Bae, C.-Y. KangAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): H. Seo, E.-A. Bae, B.S. Min, Y.D. Han, S.J. ShinAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): H. Seo, B.-S. Kim, C.-Y. KangWriting, review, and/or revisionof themanuscript:H. Seo, B.-S. Kim, E.-A. Bae,S.J. Shin, C.-Y. KangAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): H. Seo, S.J. Shin, C.-Y. KangStudy supervision: C.-Y. Kang

AcknowledgmentsThis work was supported by grants from the Basic Science Research Program

(NRF-2015R1A2A1A10055844) and the Bio and Medical TechnologyDevelopment Program (NRF-2016M3A9B5941426).

The authors thank the staff of the National Center for Inter-UniversityResearch Facilities (NCIRF) at Seoul National University for assistance withthe cell irradiation by the gamma irradiator (GC 3000 Elan).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 5, 2017; revised January 18, 2018; accepted March 15,2018; published first April 3, 2018.






References1. Zeestraten E, Reimers M, Saadatmand S, Dekker JT, Liefers G, Van Den

Elsen P, et al. Combined analysis of HLA class I, HLA-E and HLA-Gpredicts prognosis in colon cancer patients. Br J Cancer 2014;110:459–68.

2. Turcotte S, Gros A, Hogan K, Tran E, Hinrichs CS, Wunderlich JR, et al.Phenotype and function of T cells infiltrating visceral metastases fromgastrointestinal cancers and melanoma: implications for adoptive celltransfer therapy. J Immunol 2013;191:2217–25.

3. Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integratingimmunity's roles in cancer suppression and promotion. Science 2011;331:1565–70.

4. Shifrin N, Raulet DH, Ardolino M. NK cell self tolerance, responsivenessand missing self recognition. Sem Immunol 2014;26:138–44.

5. SeoH, Jeon I, KimBS, ParkM, Bae EA, Song B, et al. IL-21-mediated reversalof NK cell exhaustion facilitates anti-tumour immunity in MHC class I-deficient tumours. Nat Commun 2017;8:15776.

6. Pesce S, Greppi M, Tabellini G, Rampinelli F, Parolini S, Olive D, et al.Identification of a subset of human NK cells expressing high levels of PD-1receptor: a phenotypic and functional characterization. J Allergy ClinImmunol 2017;139:335–46. e3.

7. Beldi-Ferchiou A, Lambert M, Dogniaux S, V�ely F, Vivier E, Olive D, et al.PD-1mediates functional exhaustion of activated NK cells in patients withKaposi sarcoma. Oncotarget 2016.

8. da Silva IP, Gallois A, Jimenez-Baranda S, Khan S, Anderson AC, KuchrooVK, et al. Reversal of NK-cell exhaustion in advanced melanoma by Tim-3blockade. Cancer Immunol Res 2014;2:410–22.

9. Benson DM, Bakan CE, Mishra A, Hofmeister CC, Efebera Y, Becknell B,et al. The PD-1/PD-L1 axis modulates the natural killer cell versus multiplemyeloma effect: a therapeutic target for CT-011, a novel monoclonal anti–PD-1 antibody. Blood 2010;116:2286–94.

10. Rizvi NA, Mazi�eres J, Planchard D, Stinchcombe TE, Dy GK, Antonia SJ,et al. Activity and safety of nivolumab, an anti-PD-1 immune checkpointinhibitor, for patients with advanced, refractory squamous non-small-celllung cancer (CheckMate 063): a phase 2, single-arm trial. Lancet Oncol2015;16:257–65.

11. Powles T, Eder JP, Fine GD, Braiteh FS, Loriot Y, Cruz C, et al. MPDL3280A(anti-PD-L1) treatment leads to clinical activity in metastatic bladdercancer. Nature 2014;515:558–62.

12. Afanasiev OK, Yelistratova L, Miller N, Nagase K, Paulson K, Iyer JG, et al.Merkel polyomavirus-specific T cells fluctuate with Merkel cell carcinomaburden and express therapeutically targetable PD-1 and Tim-3 exhaustionmarkers. Clin Cancer Res 2013;19:5351–60.

13. Ferris RL, Blumenschein G Jr, Fayette J, Guigay J, Colevas AD, Licitra L,et al. Nivolumab for recurrent squamous-cell carcinoma of the head andneck. N Engl J Med 2016;375:1856–67.

14. Zou W, Wolchok JD, Chen L. PD-L1 (B7-H1) and PD-1 pathway blockadefor cancer therapy: mechanisms, response biomarkers, and combinations.Sci Transl Med 2016;8:328rv4.

15. Davis ID, Brady B, Kefford RF, Millward M, Cebon J, Skrumsager BK, et al.Clinical and biological efficacy of recombinant human interleukin-21 inpatients with stage IV malignant melanoma without prior treatment: aphase IIa trial. Clin Cancer Res 2009;15:2123–9.

16. KasaianMT,Whitters MJ, Carter LL, Lowe LD, Jussif JM, Deng B, et al. IL-21limits NK cell responses and promotes antigen-specific T cell activation: amediator of the transition from innate to adaptive immunity. Immunity2002;16:559–69.

17. McMichael EL, Jaime-Ramirez AC, Guenterberg KD, Luedke E, Atwal LS,Campbell AR, et al. IL-21 enhances natural killer cell response to cetux-imab-coated pancreatic tumor cells. Clin Cancer Res 2017;23:489–502.

18. Rosenberg SA, Lotze MT, Yang JC, Aebersold PM, Linehan WM, Seipp CA,et al. Experience with the use of high-dose interleukin-2 in the treatment of652 cancer patients. Ann Surg 1989;210:474.

19. AtkinsMB, ReganM,McDermottD.Update on the role of interleukin 2 andother cytokines in the treatment of patients with stage IV renal carcinoma.Clin Cancer Res 2004;10:6342S–6S.

20. Spolski R, Leonard WJ. Interleukin-21: a double-edged sword with ther-apeutic potential. Nat Rev Drug Discov 2014;13:379–95.

21. Ardolino M, Azimi CS, Iannello A, Trevino TN, Horan L, Zhang L, et al.Cytokine therapy reverses NK cell anergy in MHC-deficient tumors. J ClinInvest 2014;124:4781–94.

22. Beldi-Ferchiou A, Lambert M, Dogniaux S, Vely F, Vivier E, Olive D, et al.PD-1mediates functional exhaustion of activated NK cells in patients withKaposi sarcoma. Oncotarget 2016;7:72961–77.

23. Geller M, Bendzick L, Ryan C, Chu S, Lenvik A, Skubitz A, et al. Combi-nation therapy with IL-15 superagonist (ALT-803) and PD-1 blockadeenhances human NK cell immunotherapy against ovarian cancer. GynecolOncol 2017;145:19.

24. Liu Y, Cheng Y, Xu Y, Wang Z, Du X, Li C, et al. Increased expression ofprogrammed cell death protein 1 on NK cells inhibits NK-cell-mediatedanti-tumor function and indicates poor prognosis in digestive cancers.Oncogene 2017;36:6143–53.

25. Couzin-Frankel J. Breakthrough of the year 2013. Cancer immunotherapy.Science 2013;342:1432–3.

26. Gubin MM, Zhang X, Schuster H, Caron E, Ward JP, Noguchi T, et al.Checkpoint blockade cancer immunotherapy targets tumour-specificmutant antigens. Nature 2014;515:577–81.

27. Baumeister SH, Freeman GJ, Dranoff G, Sharpe AH. Coinhibitorypathways in immunotherapy for cancer. Annu Rev Immunol 2016;34:539–73.

28. Sharma P, Hu-Lieskovan S, Wargo JA, Ribas A. Primary, adaptive,and acquired resistance to cancer immunotherapy. Cell 2017;168:707–23.

29. Kim EK, Jeon I, Seo H, Park YJ, Song B, Lee KA, et al. Tumor-derivedosteopontin suppresses antitumor immunity by promoting extramedul-lary myelopoiesis. Cancer Res 2014;74:6705–16.

30. Kim EK, Seo HS, Chae MJ, Jeon IS, Song BY, Park YJ, et al. Enhancedantitumor immunotherapeutic effect of B-cell-based vaccine transducedwith modified adenoviral vector containing type 35 fiber structures.Gene Ther 2014;21:106–14.

31. Doorduijn EM, Sluijter M, Salvatori DC, Silvestri S, Maas S, Arens R,et al. CD4þ T cell and NK cell interplay key to regression of MHC classIlow tumors upon TLR7/8 agonist therapy. Cancer Immunol Res2017;5:642–53.

32. Wiedemann GM, Jacobi SJ, Chaloupka M, Kr€achan A, Hamm S,Strobl S, et al. A novel TLR7 agonist reverses NK cell anergy andcures RMA-S lymphoma-bearing mice. Oncoimmunology 2016;5:e1189051.

33. Fourcade J, Sun Z, BenallaouaM, Guillaume P, Luescher IF, Sander C, et al.Upregulation of Tim-3 and PD-1 expression is associated with tumorantigen–specific CD8þ T cell dysfunction in melanoma patients. J ExpMed 2010;207:2175–86.

34. Sakuishi K, Apetoh L, Sullivan JM, Blazar BR, Kuchroo VK, Anderson AC.Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restoreanti-tumor immunity. J Exp Med 2010;207:2187–94.

35. Nagarsheth N, Wicha MS, Zou W. Chemokines in the cancer microenvi-ronment and their relevance in cancer immunotherapy. Nat Rev Immunol2017;17:559–72.

36. Wendel M, Galani IE, Suri-Payer E, Cerwenka A. Natural killer cell accu-mulation in tumors is dependent on IFN-g and CXCR3 ligands. Cancer Res2008;68:8437–45.

37. PengW, LiuC, XuC, LouY,Chen J, YangY, et al. PD-1blockade enhances T-cell migration to tumors by elevating IFN-g inducible chemokines. CancerRes 2012;72:5209–18.

38. SutherlandAP, JollerN,MichaudM, Liu SM, KuchrooVK,GrusbyMJ. IL-21promotes CD8þ CTL activity via the transcription factor T-bet. J Immunol2013;190:3977–84.

39. Moroz A, Eppolito C, Li Q, Tao J, Clegg CH, Shrikant PA. IL-21 enhancesand sustains CD8þ T cell responses to achieve durable tumor immunity:comparative evaluation of IL-2, IL-15, and IL-21. J Immunol 2004;173:900–9.

40. Chapuis AG, Lee SM, Thompson JA, Roberts IM, Margolin KA, Bhatia S,et al. Combined IL-21–primed polyclonal CTL plus CTLA4 blockadecontrols refractory metastatic melanoma in a patient. J Exp Med 2016;213:1133–9.

41. JinHT, AndersonAC, TanWG,West EE,Ha SJ, Araki K, et al. Cooperation ofTim-3 and PD-1 in CD8 T-cell exhaustion during chronic viral infection.Proc Natl Acad Sci USA 2010;107:14733–8.

42. Gordon SR, Maute RL, Dulken BW, Hutter G, George BM, McCracken MN,et al. PD-1 expression by tumour-associated macrophages inhibits phago-cytosis and tumour immunity. Nature 2017;545:495–9.


Seo et al.




43. Arlauckas SP, Garris CS, Kohler RH, Kitaoka M, Cuccarese MF, Yang KS,et al. In vivo imaging reveals a tumor-associated macrophage–mediatedresistance pathway in anti–PD-1 therapy. Sci Transl Med 2017;9:pii: eaal3604.

44. Xu M, Liu M, Du X, Li S, Li H, Li X, et al. Intratumoral delivery of IL-21overcomes anti-Her2/Neu resistance through shifting tumor-associatedmacrophages from M2 to M1 phenotype. J Immunol 2015;194:4997–5006.

45. Dardalhon V, Anderson AC, Karman J, Apetoh L, Chandwaskar R, Lee DH,et al. Tim-3/galectin-9 pathway: regulation of Th1 immunity throughpromotion of CD11bþ Ly-6Gþ myeloid cells. J Immunol 2010;185:1383–92.

46. Juneja VR,McGuire KA,Manguso RT, LaFleurMW,CollinsN,HainingWN,et al. PD-L1 on tumor cells is sufficient for immune evasion in immuno-

genic tumors and inhibits CD8 T cell cytotoxicity. J Exp Med 2017;214:895–904.

47. Lau J, Cheung J, Navarro A, Lianoglou S, Haley B, Totpal K, et al. Tumourand host cell PD-L1 is required to mediate suppression of anti-tumourimmunity in mice. Nat Commun 2017;8:14572.

48. Biswas SK, Mantovani A. Macrophage plasticity and interaction withlymphocyte subsets: cancer as a paradigm. Nat Immunol 2010;11:889–96.

49. Thompson JA, Curti BD, Redman BG, Bhatia S,Weber JS, Agarwala SS, et al.Phase I study of recombinant interleukin-21 in patients with metastaticmelanoma and renal cell carcinoma. J Clin Oncol 2008;26:2034–9.

50. Davis ID, Skrumsager BK, Cebon J, Nicholaou T, Barlow JW, Moller NP,et al. An open-label, two-arm, phase I trial of recombinant human inter-leukin-21 in patients with metastatic melanoma. Clin Cancer Res 2007;13:3630–6.






2018;6:685-695. Published OnlineFirst April 3, 2018.Cancer Immunol Res Hyungseok Seo, Byung-Seok Kim, Eun-Ah Bae, et al. Deficient Tumors

−Enhanced NK Cell Antitumor Activity against MHC Class I IL21 Therapy Combined with PD-1 and Tim-3 Blockade Provides

Updated version

10.1158/2326-6066.CIR-17-0708doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2018/04/03/2326-6066.CIR-17-0708.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/6/6/685.full#ref-list-1

This article cites 46 articles, 25 of which you can access for free at:

Citing articles

http://cancerimmunolres.aacrjournals.org/content/6/6/685.full#related-urls

This article has been cited by 4 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/6/6/685To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-17-0708

http://cancerimmunolres.aacrjournals.org/content/suppl/2018/04/03/2326-6066.CIR-17-0708.DC1

http://cancerimmunolres.aacrjournals.org/content/6/6/685.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/content/6/6/685.full#related-urls

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/6/6/685


il21 therapy combined with pd-1 and tim-3 blockade ... · hyungseok seo1,2, byung-seok kim3, eun-ah...

Documents