i - nc science essential standards -...

COURSE: Biology

I. Grade Level/Unit Number: 9 - 12 Unit 1

II: Unit Title: Life on a Cellular Level

III. Unit Length: 3 weeks (on a 90 min per day block schedule)

IV. Major Learning Outcomes:

The student will gain an understanding of role of inquiry in investigating cells basic macromolecules found in living things, the structures of those molecules and

their function in living systems. the function of those macromolecules within the context of cell structure the functions of various cell organelles the maintenance of homeostasis within a cell the replication of DNA in order to prepare for cell division sexual and asexual reproduction at the cellular level how DNA directs the production of proteins within a cell the effects of mutations on protein production the relationship of gene regulation, cell specialization, and cell communication

V. Content Objectives Included (with RBT Tags):

Objective Number

Objective RBT Tag

Goal 1 Learner will develop abilities necessary to do and understand scientific inquiry. Goal 1 addresses scientific investigation. These objectives are an integral part of each of the other goals. Students must be given the opportunity to design and conduct their own investigations in a safe laboratory. The students should use questions and models to formulate the relationship identified in their investigations and then report and share those findings with others.

1.01 Identify biological problems and questions that can be answered through scientific investigations.

B1

1.02 Design and conduct scientific investigations to answer biological questions. Create testable hypotheses. Identify variables. Use a control or comparison group when appropriate. Select and use appropriate measurement tools. Collect and record data. Organize data into charts and graphs. Analyze and interpret data. Communicate findings

B6

1.03 Formulate and revise scientific explanations and models of biological phenomena using logic and evidence to: Explain observations. Make inferences and predictions. Explain the relationship between evidence and explanation.

B6

Biology- Unit 1 DRAFT 1

1.04 Apply safety procedures in the laboratory and in field studies: Recognize and avoid potential hazards. Safely manipulate materials and equipment needed for scientific

investigations.

C3

1.05 Analyze reports of scientific investigations from an informed scientifically literate viewpoint including considerations of:

Appropriate sample. Adequacy of experimental controls. Replication of findings. Alternative interpretations of the data.

B4

2.01 Compare and contrast the structure and functions of the following organic molecules:

Carbohydrates. Proteins. Lipids. Nucleic Acids.

B2

2.02 Investigate and describe the structure and function of cells including: Cell organelles. Cell specialization Communication among cells within an organism.

B4C3

3.01 Analyze the molecular basis of heredity including: DNA Replication Protein Synthesis(transcription and translation) Gene Regulation

B4

3.02 Compare and contrast the characteristics of asexual and sexual reproduction B2

VI. English Language Development Objectives (ELD) Included: NC English Language Proficiency (ELP) Standard 4 (2008) for Limited English Proficiency Students (LEP)- English Language learners communicate information, ideas, and concepts necessary for academic success in the content area of science.

Suggestions for modified instruction and scaffolding for LEP students and/or students who need additional support are embedded in the unit plan and/or are added at the end of the corresponding section of the lessons. The amount of scaffolding needed will depend on the level of English proficiency of each LEP student. Therefore, novice level students will need more support with the language needed to understand and demonstrate the acquisition of concepts than intermediate or advanced students.


VII. Materials/Equipment Needed:

Activity MaterialsYum! Liquid Lunch: A Study of Nutrients

AlbuminStarch solutionVegetable oilFood Solution AFood SolutionGlucose Solution Test tubes Test tube rackTesting solutions – Benedicts, Biurets, Iodine, Sudan III

Yum! Liquid Lunch: A Study of nutrients

Test tubes Test tube rackBenedict’s (for simple sugars)Biuret’s (for proteins)Lugol’s Iodine (for starch)

Sudan III (for lipids)Glucose solutionAlbuminHClPepsinStarch solutionVegetable oil

Sort the Groceries (LEP Alternative)

Intact packages of grocery items and household products

Molecule Madness Webquest Computer with Internet access (Suggestion: 1 computer per 2 students)

Organic Molecules Concept Map

Blank paper- variety of sizesPost-it Notes Markers

Organic Molecules Concept Map (CONCEPT MAP for Biomolecules)

Index CardsMarkers

Energy in a Nut Celsius thermometerMetal can with holesPaper clipBalanceRing stand and ringStirring rodWalnut chunkAlmond chunkMini marshmallowMatches


Introduction to Microscope MicroscopeLetter “e”Microscope slidesCover slipsWaterThread (different colors)

Introduction to Microscope MicroscopeLetter “e”Microscope slidesCover slipsWater

Investigating Cells Various types of cells: cork onion Elodea potato cheek yeast stomata

Dropper bottles of: water salt water iodine solution methylene blue solution

Toothpicks Lens paper SlidesCover slips Microscope

Investigating Cells Drawing paperPencilsMarkers

Cell Foldable 1 piece of construction paper (preferably a light color)ScissorsPictures/diagrams

Cell Simile Project- (Cells R Us! Cell Simile () Project)

Cell Storybook

Poster board (Bulletin board paper is an alternative.)MarkersPensPencilsPaper (notebook or typing)PensMarkersMaterials for cover (variety of sturdy paper products)

Cell Storybook Paper (notebook or typing)PensMarkersMaterials for cover (variety of sturdy paper


products)

Cell Size and Diffusion- (Cell Size: Surface to Volume Ratios)

Knox Gelatin blocks containing phenolphthalein Plastic spoonMetric rulerPaper towelsPlastic knifesmall bowl0.1% sodium hydroxide (NaOH)Latex gloves

Cell Cycle Inquiry Lab microscopeonion root tip slidesfive note cardspencil

Mitosis in Motion Flipbook 3 x 5 cards – 16 per studentTemplates: available at this website: http://sciencespot.net/Media/mitosisbook.pdfColored pens or pencilsStapler

Comparison of Mitosis & Meiosis

ScissorsPiece of string (6 feet in length)

Online Review of Mitosis & Meiosis

Computer with Internet access (Suggestion: 1 computer per 2 students)


http://sciencespot.net/Media/mitosisbook.pdf

Strawberry DNA Extraction 1 heavy duty zip-lock baggie1 strawberry (fresh or frozen and thawed) cheesecloth funnel 100 ml beaker test tube stirrershampoo without conditioner or liquid dishwashing detergentNaClDistilled water95% ethanol or 95% isopropyl alcohol

Collect Your Own DNA! (Alternate to Strawberry DNA Extraction)

Small cup6% salt solution Test tube10% soap solution Alcohol

DNA in My Food- Banana (Alternate to Strawberry DNA Extraction)

Two 5 oz. Plastic cupsBlenderPlastic spoon#2 Cone coffee filtersDistilled waterClear-colored shampoo3 bananasTable salt (either iodized or non-iodized)One plastic transfer pipette or medicine dropperOne test tube with stopper95% ethanol

DNA Model BuildingModeling materials- teacher/student choice (clay, play dough, jelly beans, toothpicks, pipe cleaners, cotton balls, etc.)

Cracking the DNA CodeComputer with Internet access (Suggestion: 1 computer per 2 students)

DNA Web QuestComputer with Internet access (Suggestion: 1 computer per 2 students)

Alien EncountersPaper for drawing PencilsColored pencilsMarkers

Alien Encounters PaperPencils

Cell Specialization and Gene Regulation Web Quest- (Cell

Computer with Internet access (Suggestion: 1 computer per 2 students)


Specialization and Control of Gene Expression Webquest)Summary Foldable 1 piece of construction paper (preferably a light

color)Scissors

VIII. Detailed Content Description:

Please see the detailed content description for each objective in the biology support document. The link to this downloadable document is in the Biology Standard Course of Study at:

http://www.ncpublicschools.org/curriculum/science/scos/2004/23biology

IX. Unit Notes

This unit is focused on the cell as the basic component of structure and function in living things. In particular, this unit is focused on basic biochemistry and cell processes. Students will learn about cells and many of the molecules that are involved in cell function. Specifically, students will gain an understanding of:

basic macromolecules found in living things, the structures of those molecules and their function in living systems.

the function of those macromolecules within the context of cell structure the functions of various cell organelles the maintenance of homeostasis within a cell the replication of DNA in order to prepare for cell division sexual and asexual reproduction at the cellular level how DNA directs the production of proteins within a cell the effects of mutations on protein production the relationship of gene regulation, cell specialization, and cell communication

In each unit, Goal 1 objectives which relate to the process of scientific investigation are included. In each of the units, students will be practicing the processes of science: observing, hypothesizing, collecting data, analyzing, and concluding.

The unit guide gives an overview of the activities that are suggested to meet the Standard Course of Study Goals for Unit One. The guide includes activities, teacher notes on how to weave the activities into the content, and supplementary notes related to other issues such as preparation time and time to complete the activity. If a teacher follows this unit (s)he will have addressed the goals and objectives of the SCOS. However, teachers may want to substitute other activities that teach the same concept.

Teachers should also refer to the support document for Biology at http://www.ncpublicschools.org/curriculum/science/scos/2004/23biology for the detailed content description for each objective to be sure they are emphasizing the specified concepts for each objective.

Essential Questions for Unit One:Following are the essential questions for this unit. Essential questions are those questions that lead to enduring understanding. These are the questions that students should be able to




answer at some level years after the course. These questions are designed to incorporate multiple concepts. Students will work on answering these questions throughout the unit. Teachers are advised to put these questions up in a prominent place in the classroom and refer to them during the teaching of the unit.

1) What is the role and importance of organic molecules to cells?2) How do cells function as the smallest unit of life?3) How do cells specialize and communicate in order to promote the functioning of an

organism?

Modified Activities for LEP Students:Those activities marked with a have a modified version or notes designed to assist teachers in supporting students who are English language learners. Teachers should also consult the Department of Public Instruction website for English as a Second Language at: http://www.ncpublicschools.org/curriculum/esl/ to find additional resources.

Computer Based ActivitiesSeveral of the recommended activities are computer based and require students to visit various internet sites and view animations of various biological processes. These animations require various players and plug-ins which may or may not already be installed on your computers. Additionally some districts have firewalls that block downloading these types of files. Before assigning these activities to students it is essential for the teacher to try them on the computers that the students will use and to consult with the technology or media specialist if there are issues. These animations also have sound. Teachers may wish to provide headphones if possible.

X. Global Content: Aligned with 21 st Skills

One of the goals of the unit plans is to provide strategies that will enable educators to develop the 21st Century skills for their students. As much as students need to master the NCSOS goals and objectives, they need to master the skills that develop problem solving strategies, as well as the creativity and innovative thinking skills that have become critical in today’s increasingly interconnected workforce and society. The Partnership for 21st Century Skills website is provided below for more information about the skills and resources related to the 21st Century classroom.

http://www.21stcenturyskills.org/index.php?option=com_content&task=view&id=27&Itemid=120

NC SCS Biology 21st Century Skills ActivityCommunication Skills

1.01, 1.02, 2.01, 2.02, 2.04

Conveying thought or opinions effectively

Cell SimileOrganic Molecules Concept MapReproduction at a GlanceStrawberry DNA

When presenting information, distinguishing between relevant and irrelevant information

Reproduction at a Glance

Explaining a concept to others Cell SimileCell Storybook


http://www.21stcenturyskills.org/index.php?option=com_content&task=view&id=27&Itemid=120

http://www.ncpublicschools.org/curriculum/esl/

Interviewing others or being interviewed

Computer KnowledgeUsing word-processing and database programsDeveloping visual aides for presentationsUsing a computer for communicationLearning new software programs

Employability SkillsAssuming responsibility for own learning

Cell Storybook

Persisting until job is completedWorking independently Cell StorybookDeveloping career interest/goalsResponding to criticism or questions

Information-retrieval SkillsSearching for information via the computer

Cell specialization and control of gene expressionMitosis and Meiosis Online Review ActivityMolecule Madness

Searching for print informationSearching for information using community members

Language Skills - ReadingFollowing written directions Most of the activities can be

presented as opportunities for students to follow written directions. The teacher will have to work with most students to develop this skill over time. The following activities are well suited to developing skills in following directions:

Alien Encounters Collect Your Own DNA DNA In My Food – Banana Introduction to the

Microscope Onion Root Tip Mitosis

Identifying cause and effect relationships

DNA Web Quest

Summarizing main points after reading

Cell Specialization and Control of Gene ExpressionCracking the DNA CodeMolecule Madness

Locating and choosing appropriate reference materialsReading for personal learning

Language Skill - Writing


Using language accurately Cell Cycle Inquiry LabCell StorybookInvestigating CellsReproduction at a Glance

Organizing and relating ideas when writing

Alien EncountersCell StorybookComparison of Mitosis and MeiosisStrawberry DNA

Proofing and Editing Cell StorybookSynthesizing information from several sources

Cell StorybookMitosis and Meiosis Online Review Activity

Documenting sourcesDeveloping an outlineWriting to persuade or justify a position

Strawberry DNA

Creating memos, letters, other forms of correspondence

TeamworkTaking initiativeWorking on a team Most of the activities are designed

to be done and discussed in teams. The following activities are well suited to developing team interdependence skills:Organic Molecules Concept MapSell That Organelle

Thinking/Problem-Solving SkillsIdentifying key problems or questionsEvaluating results Cell Growth Activity

Energy in a NutMutation Lab

Developing strategies to address problems

DNA Model Building

Developing an action plan or timeline


XI. Hyperlinks to Activities1. Yum! Liquid Lunch 2. Sort the Groceries 3. Molecule Madness Online Learning Activity 4. Organic Molecule Concept Map5. Energy in a Nut6. Introduction to Cells7. Introduction to Microscopes8. Cells Lab9. Cell Foldable10. Cell Simile/Cell Storybook11. Whale and Shrew Assessment Probe12. Reproduction at a Glance13. Cell Growth Activity14. Cell Size: Surface to Volume Ratios Activity15. Cell Cycle Inquiry Lab16. Onion Root Tip Mitosis17. Mitosis in Motion Flipbook18. Comparison of Mitosis and Meiosis19. Mitosis and Meiosis Online Review Activity20. Strawberry DNA Extraction21. Alternate DNA Extraction Activities22. DNA Model Building23. Cracking the DNA Code Web Quest24. DNA Web Quest25. Alien Encounters26. What are the Effects of Various Mutations on Protein Synthesis?27. Cell Specialization and Control of Gene Expression Web Quest28. Summative Evaluations


Yum! Liquid LunchENGAGE : (20 min.)

What nutrients are found in foods? How do you know? How do we test for them? Think, Pair, Share activity – ask students to think about everything they ate the previous day, what nutrients were present in those foods, how do they know? Introduce liquid lunch lab as simple nutrient testing. Have them think and share their ideas with a partner. Have brief class discussion on how we know what is in foods. In addition to serving as an engage activity this allows the teacher to assess previous knowledge.

EXPLORE : This activity (Yum! Liquid Lunch: A Study of Nutrients) is intended to allow students to explore organic molecules with a concrete experience. Students will test different mixtures for the presence of glucose, starch, lipid, and protein.

Guiding Question: What are the nutrients that are found in various foods and how do we test for them?

Before the activity: The teacher should prepare students for the basic procedures of the activity such as how to do the nutrient tests and safety rules, but should avoid giving too much content information during the explore phase. Students will research content later.

Activity Time: One 60 minute period. This will include class discussion.

Preparation Time: The time will vary; the teacher needs to prepare a class set of testing solutions and unknowns. This could take about 2 hours; however, once the testing solutions have been made they will be ready for the next year and the preparation time will be much less. Note: the amounts of materials in each test tube can be varied.

Safety: Be aware of students who may have allergies to the foods used (although they should not be drinking the liquid lunches).

Consult MSDS for safety issues surrounding testing solutions.

Make sure students use goggles.

Focus Objectives 2.01, 1.02

Biology- Unit 1 DRAFT

LEP Modification: Write students’ input/comments on chart paper so that you may refer to it and add to it as you teach the unit.

Language Objectives: Students will: read laboratory procedures fill in a chart to show whether or not reactions indicate a positive result.

12

Yum! Liquid Lunch: A Study of NutrientsMaterials: Test tubes Test tube rackTesting solutions – Benedicts, Biurets, Iodine, Sudan IIIGlucose solutionAlbuminStarch solutionVegetable oilFood Solution AFood Solution B


WEAR GOGGLESSimple sugars test: Set up 4 test tubes as shown in the chart. Add 10 drops Benedict’s Solution to each tube. Place tubes in boiling water bath. Leave for a few minutes and note color change.If solution turns olive green to yellow to orange to brick red, there are simple sugars present.

Test Tube Benedicts solution Results1 – 2 ml water 10 drops

2 – 2 ml glucose solution

10 drops

3 – 2 ml food solution A

10 drops

4 – 2 ml food solution B

10 drops

Protein Test: Set up 4 test tubes with the solutions as shown in the chart. Add 5 drops of Biuret’s Solution to each one. Observe color change and record. A violet color indicates the presence of proteins.

Test Tube Biurets solution Results1 – 2 ml water 5 drops

2 – 2 ml albumin solution

5 drops

3 – 2 ml Food solution A

5 drops

4 – 2 ml Food solution B

5 drops

Starch test: Set up 4 test tubes with the solutions as shown in the chart. Add 2 drops of Iodine solution to each tube. Observe color change and record.

Test Tube Iodine solution Results1 – 2 ml water 2 drops

2 – 2 ml starch solution

2 drops


2 drops


2 drops

Fats Test: Set up 4 test tubes as shown in the chart. Add 5 drops of Sudan III solution. Observe color change and record.Test Tube Sudan III solution Results1 – 5 ml water 5 drops

2 – 5 ml oil 5 drops


5 drops


5 drops

NOTE:Benedict's solution is used to test for simple sugars. It is a clear turquoise blue solution that changes color in the presence of simple sugars and after heating. The blue solution changes to olive green, then to yellow, and then to brick-red, depending on the amount of sugar.

Iodine solution is used to identify the presence of starch. The solution is brownish-yellow, but produces a blue-black precipitate when it reacts with starch.

Biuret solution is used to identify the presence of protein. Biuret solution is deep blue initially and when it reacts with protein, it changes color to violet (pinkish-purple).

Sudan III is used to identify the presence of lipids in liquids. It stains fats red.

Teacher:Starch test:Starch solution: Mix 1 gram soluble starch with 200 ml waterUndiluted Lugol’s iodine

Protein test:Powdered albumin or egg whites 1 part albumin to 5 parts waterBiuret’s solution

Sugar Test:

Glucose solution: mix 3 grams glucose or dextrose in 200 ml waterBenedict’s solution

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Sudan%20III%23Sudan%20III

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Biuret%20Reagent%23Biuret%20Reagent

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Lugol's%20Iodine%23Lugol's%20Iodine

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Benedict's%20Solution%23Benedict's%20Solution

Fats Test:Oil: Any oil will do; you could use lard and have students put the drops of Sudan III directly on the lard Sudan III solution

Mixing the meal

Break the meal into small pieces and then put into a blender. Mix very well with blender.Filter the mixture through a few layers of cheesecloth or a coffee filter into a beaker.

You can use any “meal” you wish. Try to choose a meal that will have all the nutrients.

Fast food meals (hamburger, fries)Cafeteria meals (pizza)Deli sandwich meal

You can do two meals (data chart is set up for this) or just one if time is a problem.

Yum! Liquid Lunch: A Study of Nutrients- LEP

Key Vocaculary:Starch lipids carbohydratesBenedict’s solution Biuret’s solution Lugol’s solutionIodine albumin pepsinOil Sudan III

Pre-Lab Questions:Circle the correct answer in each set of parentheses)

1. (Starch / Oil) is a carbohydrate.2. (Albumin / Glucose) is a protein.3. (Oil / Pepsin) is a lipid.4. (Biuret’s / Lugol’s) is deep blue to start.5. (Iodine / Lugol’s) is yellow-orange.6. Sudan III tests for (fats / proteins)7. (Lugol’s / Benedict’s) is clear, light blue to start.

Materials:Test tubes Test tube rackBenedict’s (for simple sugars)Biuret’s (for proteins)Lugol’s Iodine (for starch)Sudan III (for lipids)Glucose solutionAlbuminHClPepsinStarch solutionVegetable oil

WEAR GOGGLES!!!!!

Simple sugars test: Set up 4 test tubes as shown in the chart. Add 10 drops Benedict’s Solution to each tube. Place tubes in boiling water bath. Leave for 5 minutes and record color change.If solution turns olive green to yellow to orange to brick red, there are simple sugars present.

Test Tube Benedicts solution Color Change1 – 2 ml water 10 drops

2 – 2 ml glucose solution

10 drops


10 drops


10 drops

Protein Test: Set up 4 test tubes with the solutions as shown in the chart. Add 5 drops of Biuret’s Solution to each one. Observe color change and record. A purple color indicates the presence of proteins.

Test Tube Biurets solution Color Change1 – 2 ml water 5 drops

2 – 2 ml albumin solution

5 drops

3 – 2 ml Food solution A

5 drops

4 – 2 ml Food solution B

5 drops

Starch test: Set up 4 test tubes with the solutions as shown in the chart. Add 1-5 drops of Iodine solution to each tube. Observe color change and record.

Test Tube Iodine solution Color Change1 – 2 ml water 5 drops

2 – 2 ml starch solution

5 drops

3 – 2 ml food solution 5 drops


A


5 drops

Fats Test: Set up 4 test tubes as shown in the chart. Add 5 drops of Sudan III solution. Observe color change and record.Test Tube Sudan III solution Results1 – 5 ml water 5 drops

2 – 5 ml oil 5 drops


5 drops


5 drops

NOTE:Benedict's solution is used to test for simple sugars. It is a clear turquoise blue solution that changes color in the presence of simple sugars and after heating. The blue solution changes to olive green, then to yellow, and then to brick-red, depending on the amount of sugar.

Lugol's iodine solution is used to identify the presence of starch. The solution is brownish-yellow, but produces a blue-black precipitate when it reacts with starch.

Biuret solution is used to identify the presence of protein. Biuret solution is deep blue initially and when it reacts with protein, it changes color to violet (pinkish-purple).

Sudan III is used to identify the presence of lipids in liquids. It stains fats red.

Teacher Prep:Starch test:Starch solution: Mix 1 gram soluble starch with 200 ml waterUndiluted Lugol’s iodine

Protein test:Powdered albumin or egg whites 1 part albumin to 5 parts waterBiuret’s solution

Sugar Test:Glucose solution: mix 3 grams glucose or dextrose in 200 ml waterBenedict’s solution

Fats Test:Oil: Any oil will do; you could use lard and have students put the drops of Sudan III directly on the lard Sudan III solution


http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Sudan%20III%23Sudan%20III

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Biuret%20Reagent%23Biuret%20Reagent

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Lugol's%20Iodine%23Lugol's%20Iodine

http://www.sciencecompany.com/sci-exper/food_chemistry.htm#Benedict's%20Solution%23Benedict's%20Solution

Mixing the mealBreak the meal into small pieces and then put into a blender. Mix very well with blender.Filter the mixture through a few layers of cheesecloth or a coffee filter into a beaker.

You can use any “meal” you wish. Try to choose a meal that will have all the nutrients.

Fast food meals (hamburger, fries)Cafeteria meals (pizza)Deli sandwich meal

You can do two meals (data chart is set up for this) or just one if time is a problem.

Alternative: Sort the Groceries-LEP

Alternative: If teachers do not have enough preparation time, Sort the Groceries could be done instead. Students are given packages of various grocery items. They will sort them into categories based on their contents. The categories are Lipids, Carbohydrates, Proteins, and Nucleic Acids. For this activity teachers will need: empty packages of various grocery items and signs to indicate the 4 categories.

Sort The Groceries- LEP

Teacher Notes: You will need to collect empty, intact packages of grocery items and household products. You may also use real objects. Refer to the list below for ideas. You may have students bring them in and/or you may collect them on your own. A children’s play food set (available at large discount stores) works well. You will need a great variety and enough for every student to have at least one item.

Place signs at 4 locations around the classroom to indicate a place for lipids, nucleic acids, proteins, and carbohydrates.

Have each student choose an item and put it into the appropriate category location. Encourage students to read nutrition labels and make their decision based upon which organic molecule makes up the majority of the product.


Language Objectives: Students will: read food labels and sort the items into proper categories orally explain why each item is placed into its corresponding category write examples of products that represent proteins, carbohydrates, lipids, and nucleic acids.

After all items are sorted, lead a discussion about whether or not each item is correctly placed. Move any items that are misplaced.

Once all items are appropriately placed, have students divide a sheet of paper into 4 quadrants. Label each square with a category name. Students should go to each of the categories and write down examples of actual items in each.

On the 4-square sheet have students take notes on each category.

Product Examples:

CARBOHYDRATES NUCLEIC ACIDSchip bags DNA modelscandy wrappers magazine pictures:cereal boxes red flowers vs. white flowerspaperback book (cellulose) people of different raceswooden ruler DNA items from science catalogs

LIPIDS PROTEINScooking oil dairy product packagingmotor oil play food meatscandles nut canschap-stik RID-X for septic tanks (enzymes)lotioncar waxbutter packagemargarine packaging

EXPLAIN:

After the activity: The teacher should lead students in discussing which of their “lunches” had more lipid, protein, starch, or sugar. Then the teacher could ask “Which lunch would be better in terms of nutrition and why?” All answers should be considered. Again this is an explore activity so the teacher is not explaining the answers at this point. Students will research these questions in the next activity.

Molecule Madness Online Learning Activity

ELABORATE: The purpose of this web quest is to build on the nutrient testing experience of “Yum: Liquid Lunch” by having students research the structures and functions of the molecules. Students will go to websites to research the characteristics of the


macromolecules identified in Liquid Lunch as well as others such as nucleic acids. Emphasis will be on structure (monomers and polymers) and on function.

Guiding Question: What is the structure and function of each of the essential nutrients?

Before the activity: The teacher should explain to students that they will be researching the structure and function of the macromolecules that they tested for in the previous activity. The teacher should also show how to access and navigate the website. The teacher should be sure to go the website ahead of time to learn how it works.

Focus Objective 2:01

Activity Time: one 90 minute period (LEP students will likely require more time and substantial teacher support).

Preparation: Check the recommended websites to be sure they are all still active before copying the handouts. Teachers may want to substitute other websites and or allow students to use textbooks and additional reference materials.

Note: For this activity, students will need to have access to computers. This activity would be excellent for pairs of students to work at one computer. Alternatively, the teacher could use one computer and a projection device and have the whole class work together. The teacher centered method works better with students that have a harder time academically.

Molecule Madness Online Learning ActivityNAME_____________________

Go to the following websites to fill in the chart below and to answer the questions below.http://www.cst.cmich.edu/users/baile1re/bio101fall/atmolorga/molecu/moleprez/sld001.htmhttp://www2.visalia.k12.ca.us/eldiamante/science/biology/powerpoints/biochem.pdfhttp://faculty.dccc.edu/~rmarcus/Unit01/04BiologicalMolecules.pdfhttp://www.bmhs-la.org/academics/faculty/teachers/lwalle/files/Honors%20Biology/HonorsBioCh3.pdf (When you open the website above, change the view to 150%).Biology- Unit 1 DRAFT 21

Language Objectives: Students will: listen to teacher discussion about information on websites read information and study diagrams/animations on websites summarize in writing and complete a chart answer questions in complete sentences.

http://www.bmhs-la.org/academics/faculty/teachers/lwalle/files/Honors%20Biology/HonorsBioCh3.pdf

http://www.bmhs-la.org/academics/faculty/teachers/lwalle/files/Honors%20Biology/HonorsBioCh3.pdf

http://faculty.dccc.edu/~rmarcus/Unit01/04BiologicalMolecules.pdf

http://www2.visalia.k12.ca.us/eldiamante/science/biology/powerpoints/biochem.pdf

http://www.cst.cmich.edu/users/baile1re/bio101fall/atmolorga/molecu/moleprez/sld001.htm

http://www.cst.cmich.edu/users/baile1re/bio101fall/atmolorga/molecu/moleprez/sld001.htm

Type of Molecule

Elements

Monomers

General structure

Function Examples Test for

Questions:1. Describe the relationship between a monomer and a polymer and give

an example from one of the macromolecules in the chart.

2. Which macromolecule is not a polymer?

3. What is the chemical process that links the monomers together?

4. What is the chemical process that breaks monomers apart?

5. What essential protein is involved in the breaking and linking of monomers?

6. Describe the differences between a monosaccharide, a disaccharide, and a polysaccharide?

7. Name three important polysaccharides. Describe their functions.

8. What type of molecule is glucose?

9. How many different amino acids are there?

10. One of the most important roles of proteins is to function as enzymes. Generally, describe the function of enzymes.


11. What does it mean to say that a protein functions by a “lock and key” model?

12. What is the active site of a protein?

13. What determines the shape of a protein?

14. What type of molecule is insulin? What is the function of insulin?

15. What type of molecule if hemoglobin? What is the function of hemoglobin?

After the activity: The teacher should help the students summarize some basic ideas giving students plenty of opportunities to use the vocabulary of organic molecules as they discuss the questions. What monomers are the polymers composed of? What are the primary functions of each type of macromolecule? How do mutations affect the functioning of a protein? What is the importance of enzymes? Be sure to relate the discussion back to Liquid Lunch and nutrients in food.

Organic Molecules Concept MapEVALUATE: In this activity (Organic Molecules concept map), students will work together in groups; they can generate the words or be given a list of words to include in their concept maps. This activity is intended to help them synthesize the information gathered in the web search. It will build upon the discussion that they had at the end of their web quest.

Guiding Question: How do the macromolecules relate to each other?

Before the activity: Teachers should explain to students how to create concept maps. These instructions are given in the activity. Teachers should also explain that concepts maps are a good way for students to synthesize and build connections among ideas which will help them remember better. Preparation Time: 15 minutes to gather materials and set them out.

Notes: Concept maps can be done using software that is listed in the activity. But a low tech alternative is to use post-it notes. Each post-it note will have one word. Students can rearrange their post-it notes on a large piece of paper until they are satisfied with the organization and then they can add the connecting words.

Sharing concept maps can be done by having students walk around the room to observe each map and see if they understand it. Alternatively, students could formally present their maps in front of the class. The advantage of sharing is that the concepts are reinforced in different ways leading to better understanding and memory.


Organic Molecules concept map Organic Molecules concept map-LEP

OR

Organic Molecules Quadrant Notes-LEP

Focus Objective: 2.01

Activity Time: 45 minutes

Organic Molecules Concept MapDefinition A concept map is a written representation of the relationships among major concepts, ideas, objects or activities. Concept maps consist of nodes and labeled lines. All words/phrases that represent a concept are called nodes and are usually written within a circle or some other shape. The labeled lines represent connections between the nodes. The labels describe the relationship between the nodes and an arrow represents the direction of that relationship. See example below.

Teacher DemonstrationIf your students are familiar with concept mapping then this initial demonstration can be skipped. If your students are not familiar with concept mapping they will need an example to go by.


Language Objectives: Students will: create and be able to orally explain their concept maps concept maps may be used as a framework for writing paragraphs about each of the

molecule types.

Language Objectives: Students will: participate in class discussion create notes for future reference Notes may be used as a framework for writing paragraphs about each of the molecules.

types.

Model the creation of a concept map by choosing a topic that is a familiar concept to your students (for example a sport (football), your class environment, a food (pizza) or anything else your students can relate to). Make sure to choose a quick and simple concept to demonstrate.

1. First make a list of major concepts to include on the map that describe your topic. 2. Next to each major concept, list more specific concepts to form a cluster of

related ideas.3. Write the topic in the center of your working area, blackboard, overhead etc.,

surrounded by a circle. 4. Surround the topic with the words/phrases from your major concept list.5. Draw links connecting the major ideas to the topic.6. Write labels on the lines that describe how one concept links/relates to the topic.7. Add in the words/phrases from your specific concept list around the appropriate

major concepts identified in your map.8. Draw links connecting the specific ideas to the major concepts.9. Write labels on the lines that describe how the specific concept links/ relates to

the major concepts.10.Draw cross-links that relate concepts in one part of the map to concepts in

another part of the map. Cross-links should have an arrowhead that indicates the intended direction of the relationship.

11.Label these lines to describe the connections.

Explain that there are many correct ways to map the same set of concepts.

ActivitySplit the students into small groups.

Supply students with a large surface to prepare their map, such as poster board, bulletin board paper, legal paper, etc. They will also need post-it notes and markers.

Each group generates a list of the most important concepts related to organic compounds. Students can brainstorm this list or a list can be generated by the teacher and given to the students. Next to each major concept, students should list more specific concepts to form a cluster of related ideas.

Have students write Organic Compounds in the center of their working area surrounded by a circle. Write all the major and specific concepts on separate post-it notes. This allows the students to arrange and rearrange these concepts around the topic as they work through their thinking as a team.

Students arrange the major concepts around the center item and the specific concepts around the major concepts. Arrange the post-it notes so that related terms are close to each other. As the map expands, the concepts tend to become more detailed and specific.

Students should edit this first phase and think about the relation of the outside items to the center item. Remove, rearrange, edit, and/or shorten words to key ideas.


Once they have decided on the arrangement of the concepts, they can draw the connecting lines and label these lines to describe the connections.

Students can then share their maps with the rest of the class and explain their reasoning behind the arrangement of the map. This map is a personal learning document. It combines what the students know with what they are learningand determines what they may need to know to complete their understanding of organic compounds.These maps can be kept, added to, and edited as student’s knowledge is strengthened through instruction.

Evaluation1. Map should be neat and easy to read.2. Look for original work. Each team should have their own way of organizing the

information. 3. Concept lists should be appropriate to the topic. They should represent a good

overview of the topic without showing extreme detail. 4. Connections should show correct linkage and descriptions of the relationships.5. Map should possess cross-links that are rich in meaning using precise linking

terms.

Sample Concept Maps

This diagram created using Inspiration® by Inspiration Software®, Inc


http://www.graphic.org/similie.html

Resources Computer tools for concept- or mind mappingInspiration Software, Inc. maker of Inspiration Axon Idea Processor 5.0 by Chan BokCMap 2.0 for Macintosh fetch by gopherDecision Explorer (formerly called Graphics COPE) by Banxia SoftwareSemNet Research Group maker of SemNetMindMan by Micheal JetterCoCo Systems maker of VisiMap and InfoMap (Lite)Activity Map by Time/system Int.TextVision / TekstNet by Piet Kommers.SMART Ideas by SMART TechnologiesEGLE Magic (info by e-mail) maker of Mind Mapper [Mind Mapper fetch by ftp (approx. 300kb)]

CONCEPT MAP WRAP-UPMake index cards for each of the following. Students should arrange them to form a concept map showing the biomolecules, their functions, and examples.

Alternate: provide the following on different colored paper. Have students cut out each item, arrange them into a concept map, and glue them down.


ftp://ftp.std.com/ftp/vendors/emagic/mindmap/mindmap.zip

mailto:[email protected]

http://www.smarttech.com/smartideas.htm

http://130.89.41.31/textvisi.htm

http://www.timesystem.com/timesystem/software/AMW/

http://www.coco.co.uk/

http://mindman.com/

http://apple.sdsu.edu/logan/SemNet.html

http://www.scotnet.co.uk:80/banxia/demain.html

gopher://oldal.mannlib.cornell.edu:9570/40/misc/CMap_2.0.hqx

http://web.singnet.com.sg/~axon2000/article.htm

http://www.inspiration.com/

http://www.graphic.org/similie.html

Colors listed in ( ) allow students to differentiate between categories, functions, and examples.

ORGANIC MOLECULES (white)

NUCLEIC ACIDS (yellow)DNA (pink)RNA (pink)genetic information (blue)determine traits (blue)directions for making proteins (blue)made of nucleotides (blue)

CARBOHYDRATES (yellow)energy source for cells (blue)names end in –ose (blue)cellulose=cell walls of plants (pink)lactose=milk sugar (pink)cereal (pink)candy (pink)sucrose=table sugar (pink)glucose=simple sugar from photosynthesis (pink)

PROTEINS (yellow)structure (blue)skin, hair, nails (pink)made of amino acids (blue)meat, fish, eggs (pink)nuts (pink)muscles (pink)names end in –in (blue)enzymes are 1 group (blue)speed up chemical reactions (blue)names end in –ase (blue)

LIPIDS yellowstore energy (blue)insulation (blue)waterproof coverings (blue)oil (pink)fat (pink)wax (pink)

Organic MoleculesLEP Alternative to Concept Map


Have students divide a sheet of paper into 4 quadrants.Label each quadrant as follows: Lipids, Carbohydrates, Proteins, Nucleic Acids

Give students the following list. They should place each item in the correct quadrant.(Depending upon your students, you may need to edit the list)

sugarsimportant for structureglucosedetermine traitsDNAmade of amino acidsHair, skin, nailsglucosecelluloseenzymesRNAused to make proteinsmaltosericelardcandlesimportant for insulationwaterproof coatingsstarch-food storage for plantsglycogen-food storage for animalsimportant for long-term energy storagemain source of energy for cells

When complete, students should work with a partner to discuss/check their work. Check to make sure all students have all items placed correctly.

EXPLAIN:After the activity: The teachers should have students share their concept maps. The teacher can ask questions to prompt filling in missing concepts and clarify additional points.

Energy in a NutELABORATE: At this point, students have been studying the structure and function of macro-molecules. This activity (Energy in a Nut) will help them see the connection between macromolecules and energy contained in the bonds of those molecules. Students will use tin can calorimeters and paper clips to hold a walnut and/or a pecan. They will ignite each nut and calculate the energy in terms of calories.


In addition, the teacher can use this opportunity to explain the difference between the release of energy by burning (combustion) and the slow enzymatic release of energy in cells. Both release carbon dioxide, a point that can be returned to later when discussing the carbon cycle.

Guiding Question: What is the connection between nutrient molecules and energy?

Before the activity: The teacher should explain to students that they are going to learn about macromolecules and energy. But the teacher should not give too much information. More content can be developed after the activity.

Focus Objective 2.01

Activity Time: One 60 minute period

Preparation: It will take about 1 hour to gather the materials and set up the lab stations. The materials needed are listed in the activity. The teacher will have to get a supply of walnuts, almonds, and mini-marshmallows. Often students are willing to bring these materials, but you will have to ask for them a few days ahead of the lab. Also, the teacher will have to collect the cans ahead of time and prepare them. Soup cans, cans from vegetables or regular sized dog food cans are great. An awl can be used to push holes in the two opposite sides close to the top. These will be used to hang the can on the ring stand using large paperclip that go through the holes in the can and then over the ring on the ring stand. The cans may be reused.

Safety: Be alert to any student allergies to the food products used. Make sure that students follow good safety procedures in using matches. Teachers should monitor this part of the lab very closely. Students should use goggles.

Notes: Here are the actual calories taken from: http://www.calorie-charts.net/

Almond: 5780 calories/gramWalnut: 6540 calories/gramMarshmallows: 3180 calories/gram

It is important to remember that a 1000 calories = 1 Calorie. The Calorie is what is used in food charts

Energy in a NutNAME________________________________

DATE_____________________PER________PURPOSE:

In this lab, you will use a simple calorimeter to calculate the energy content of a walnut, an almond and a mini-marshmallow. By measuring the increase in temperature of a can of


http://www.calorie-charts.net/

water, you will be able to determine the amount of heat given off by the tasty morsel. The unit of heat energy you will use is the CALORIE. The CALORIE is: the amount of heat energy required to raise the temperature of one gram of water one Celsius degree (Co).

MATERIALS:Celsius thermometer metal can with holes paper clipBalance ring stand and ring stirring rodWalnut chunk Almond chunk mini-marshmallowMatches

HYPOTHESIS:Which do you think will have more calories per gram – the walnut, the almond or the mini-marshmallow? Give a reason for your hypothesis.PROCEDURE1. Shape a paper clip so that it can hold a peanut about 2-3 cm above the base of your ring stand.

2. Adjust the ring on the ring stand so that you can hold the can about 3-4 cm above the top of the paper clip. You will hang your can from the ring stand with paper clips that are looped into the holes on each side of the top of the can.

3. Weigh the paper clip and the empty can and record these masses to the nearest 0.1 g.

4. Fill the can about 1/3 full of water. Weigh the can again WITH the water. Record the mass. Calculate the mass of the water alone.

5. Push the end of the paper clip into the food that you are going to burn. Use sort of a drilling motion. Weigh the paper clip WITH the food bit and record the mass. Calculate the mass of the food bit.

6. Measure the temperature of the water and record your result.

7. Place the mounted food bit under the water can. Ignite the food bit by holding a match under it until it is able to burn on its own.

8. Stuff the water with a stirring rod until the flame goes out.

9. Record the final water temperature. Calculate the change in water temperature.

Table 1 – DATA for Determine the Energy Value of Two Nuts and a Mini-Marshmallow

Walnut Almond Mini-Mallow

Walnut Almond Mini-Mallow

Mass of can + water

Mass of Nut + clip

Mass of can

Mass of clip

Mass of Mass of


water nut

Final Water Temp.Initial Water Temp.Change in water Temp.

CALCULATIONS:1. Calculate the number of calories in each of the food bits above.

Mass of water (g) x temp. change of water (oC) = energy to heat water (g)

Walnut: ____________g x ________________ oC = _______________ calories

Almond: ____________g x ________________ oC = _______________ calories

Marshmallow: ____________g x ________________ oC = _______________ calories

2. Next, calculate the amount of energy per gram of each food bit:

Walnut: energy/gram = energy to heat water = calories = _____ calories/gram

Mass of nut grams

Almond: energy/gram = energy to heat water = calories = _____ calories/gram

Mass of nut grams

Marshmallow: energy/gram = energy to heat water = calories = _____ calories/gram

Mass of nut grams

3. When the word “calories” is used in reference to food, it actually means kilocalories or Calorie with a capital “C”. A kilocalorie is equal to 1,000 calories. Now, calculate the number of kilocalories per gram of each of your food bits.

Walnut: energy/gram ___________ cal/g ÷ 1000 cal = _______ kcal/gramAlmond: energy/gram ___________ cal/g ÷ 1000 cal = _______ kcal/gramMarshmallow: energy/gram ___________ cal/g ÷ 1000 cal = _______ kcal/gram

4. Do a little research and find the actual calories in a gram of each of your food bits.

Walnut: _______ cal/g Almond: _______ cal/g Marshmallow_______ cal/g

5. Calculate your “percent error” for each nut. The formula for percent error is:

Observed value – expected value x 100 = % errorExpected value

Note: your observed value is the one you determined in the lab and your expected value is the one we got from research.


SHOW YOUR WORK:

Walnut % error: _______ Almond % error: ________ Marshmallow% error: ________

DISCUSSION QUESTIONS:1. Your calculations assumed that all of the heat produced by the burning of the nut was absorbed by the water in the can. What is your evidence that this is not really true?

2. What else absorbed heat energy (besides the water)?

3. What evidence is there that the burning might have been incomplete?

4. If you had used a more efficient device, how would this have changed your calculated value for energy per gram of food?

5. How do you account for any differences between your experimentally determined value and the accepted value of calories in each of your food bits.

6. What was the ultimate SOURCE of energy for the nuts?

7. What form is the energy in each of the food items?

After the activity: The teacher will need to help students calculate percent error. The percent errors will be huge because of the primitive nature of these calorimeters and the large loss of energy to the atmosphere. Teachers should reinforce the idea that the covalent bonds that hold macromolecules together release energy when they are broken in digestion. In living organisms that energy is captured in ATP bonds (and released as heat). In combustion the energy is light and heat and is released very quickly. .EVALUATE: At this point, students will go back to their concept maps and add the information about energy. The will also make modifications if needed and present their modifications to the class. (Learning by repetition)

Guiding Question: Where does energy fit into the concept map?


Before activity: The teacher should explain that students will be adding words such as energy, covalent bonds, ATP, and heat to their concept maps.



Preparation Time: The teacher may want to generate a list of new words for the concept map.

Modify Concept Maps Organic Molecules Concept Map-LEP

After activity: The teacher will help students summarize what they have learned. The teacher will refer to essential question #1. (What is the role and importance of organic molecules to cells?) The teacher can help students understand that each of the macromolecules has a function within organisms and that in the next part of the unit they will learn how these molecules function within cells. The teacher may also want to provide a brief written assessment at this point.

Introduction to Cells ActivityENGAGE:Peak students’ curiousity and interest by showing a video and/or a collection of pictures showing a variety of cells. The teacher could produce a PowerPoint with pictures of a variety of cells. For example, single-celled Protists come in many forms. In addition, pictures of nerve cells, leaf cells, stomata, cheek cells, blood cells, etc. can be used. Showing a variety of cells is intended to engage student interest in the wide variety of cells and their various functions. There are also a wide variety of cell videos available. One that would fit this activity is The Magic of Cells. This is available for purchase for approximately $29.95. Look on-line for vendors. Questions are provided for this video (The Magic of Cells Video Questions). The teacher could also modify the questions to fit a different video or teacher-produced cell resource. Guiding Question: Why do cells come in such a great variety?

Before activity: The teacher should explain to students that they will be looking at a variety of cells and that cells are the basic unit of living things. The teacher should also explain that the molecules that the students have been studying are found within cells and promote cell function. The teacher can also explain that although the students are


Language Objectives: Students will: Construct a concept map representing the organic molecules and important related information Write a minimum of 1 paragraph summarizing what they have represented in their concept maps

LEP Modification: Have students use their concept maps as a framework for writing a narrative summary of what they have learned. You will need to model how to do this and it may be helpful to allow students to work in pairs.

going to be studying “generic cells” as pictured in their texts, cells really come in a great variety.


Activity Time: about 20 minutes

Preparation Time: If showing the video, the questions (below) will need to be copied. If the teacher needs to create a PowerPoint or print pictures of cells, (s)he will need to allot time for that.

The Magic of Cells- Video Questions

Lesson One:1. ___________________ are the building blocks of life.

2. The three basic characteristics of life are:

a. _________________________________

b. __________________________________

c. _________________________________

3. The two types of cells are:

a. _________________________________

b. _________________________________

Lesson Two:4. Two purposes of a membrane are ___________________ and

____________________.

5. Cytoplasm is made mostly of ________________________.

6. “Organelle” means __________________ organ.

7. The cytoskeleton is used to ____________________ the cell.

8. Ribosomes manufacture ________________________.

9. Vessicles store and ________________________ materials.

10. Lysosomes have digestive ______________________.

11. The nucleus has ____________ (use the abbreviation) inside it.


Lesson Three:12. Many plant cells have a ________________ wall.

13. Vacuoles ______________________ materials.

14. Chloroplasts help plants carry out ___________________________.

15. Cilia and flagella help cells ____________________.

16. Cells with similar function ____________________ alike.

After activity: The teacher should let students ask questions but there is no need to answer all of them. But the teacher can help students begin to answer the guiding question – focusing them on the fact that different cells have different functions and that structure is related to function. Then the teacher can explain that students will be looking at living cells after they learn how to use the microscope.

Introduction to MicroscopeEXPLORE: This activity (Introduction to Microscope) is intended to help students learn the features of the microscope, including, total magnification, size of field of view of each objective, reversal of images, and how to estimate size of objects viewed through the microscope.

Guiding Question: What happens to the image of an object when viewed through a microscope?

Before activity: The teacher will explain that this activity is designed to help students learn how to use one of tools that helps scientists study cells.


Activity Time: 90 minutes – although some students may need more time. Teachers can invite students in during lunch or after school, etc. to finish if need be.


Language Objectives: Students will: Locate and discuss the functions of the parts of the microscope with their partners. Students

may do this orally, or you can have them write a list of the parts and their functions. Read laboratory procedures. Answer questions in complete, written sentences.

LEP Modification: Write students’ questions on chart paper so that they may be answered as you teach the unit. Keep the list in a prominent place in the classroom.

Preparation Time: The materials are listed with the activity. Teachers will need time to copy the lab hand-out and to prepare the lab stations. It is useful to have a little basket at each table with a dropper bottle of water, a small piece of newsprint with at least one word that has a small “e”, a pair of scissors, a few slides and cover slips, and some lens paper.

Safety: Make sure students learn the proper methods for carrying and using the microscopes.

Students should use caution with the scissors.

Note: It is useful for the teacher to take the class through the first part of this activity. Have every student list the rules of handling the microscopeAlways hold the microscope with both hands.Only use lens paper to clean the eyepiece and objectives.Always start to focus with low power.Never use coarse adjustment with high power.Make sure you have a coverslip on the slide.Don’t place microscope at the edge of table.

The teacher can help the whole class by describing each part of the microscope and also its function. (It is a nice time to point out that the structure determines the function!) The teacher should also help students determine total magnification and explain to them how to measure and calculate field of view diameters. Finally, the teacher should explain how to estimate size of a cell using the microscope and how to make a wet mount slide.

Introduction to the MicroscopeNAME___________________________

1. Microscope VocabularyKnow where each of the following is found and what the function is.eyepiece (ocular) arm diaphragmrevolving nosepiece stage clip lamp (light)low power objective base fine adjustmentmedium power objective stage coarse adjustment

high power objective

2. Rules for using microscope (care of the microscope):


LEP Modifications: Have students make posters to illustrate the rules. Post their work around the room and leave them up for future reference.

3. When you are viewing material under high power, which is the ONLY adjustment knob that you should use?

4. Magnification and Field of View Diameters: Fill in the chart below.To determine the diameter of the field of views:

a. measure the diameter of the low power field of view using a ruler (mm units).b. Divide the low power magnification by the medium power magnificationc. Multiply the answer to “b” by the low power diameter; the answer will be the

medium power diameter.d. Repeat steps “b” and “c” using high power magnification to get the high power

diameter.

SHOW YOUR WORK to the above steps:

Eyepiece Magnification x Objective Magnification = Total Magnification Diameter of Field of View

10 x Low power: Measured: _______mm _______μm

10 x Medium power: Calculated: ______mm _______μm

10 x High power: Calculated: ______mm _______μm

5. Estimating the size of objects: Follow the steps listed.a. Note the magnification and diameter of the field you are using.b. Decide how many of your objects could fit across the diameter.c. Divide that number into the diameter of the power being used.

d. That gives you the estimate of the dimension of your "cell".e. Give your estimate in mm and um. (Remember 1 mm = 1000 um.)

f. PRACTICE: (SHOW YOUR WORK!!!!)

MICROSCOPE 1: 100x MICROSCOPE 2: 400x


(MP) algae strand (HP) human cheek cellsEstimated width in mm:________ Estimated diameter in mm:________

Estimated width in um:________ Estimated width in um:________

6. Making Slides: Follow the procedure listed.a. Cut a lower case “e” from a piece of newpaper – you can use a whole word such

as “decide.”b. Place the word on a slide and add a drop of water to it.c. After the newsprint is soaked, add a coverslip by holding the coverslip at a 45o

angle and slowly lowering it onto the word.d. Place the slide on the stage of the microscope and clamp it down. Put the word

on your stage so that it is right side up BEFORE YOU VIEW IT WITH THE MICROSCOPE.

e. Move the slide so that the letter “e” is in the center of the opening in the stage.f. Using low power, lower the objective to its lowest position; then slowly raise the

objective (using coarse adjustment) until the newsprint comes into view. Use fine adjustment to sharpen the focus.

g. Now change to the medium power objective. Use fine adjustment to sharpen the focus.

h. Make a sketch of the letter “e” and describe how it looks under the microscope.

DATA/QUESTIONS Object Being Drawing and ObservationsViewed

Letter "e"(Describe)

Magnification_______

i. Now make a slide of two crossed hairs, one light and one dark. Follow the procedures above, but this time get your hairs visible under high power.

crossed hairs Drawing and Observations:(Describe)

Magnification:


j. Try moving the slide from right to left. Observe what happens.k. Try moving the slide away from you. Observe what happens.

Questions:1. What does the microscope do to the position of the viewed image (refer to your

observations with the letter “e”).

2. What happens when you move the slide from right to left?

3. What happens when you move the slide away from you?

4. When you observed the crossed hairs under high power, could you see both in sharp focus at the same time?Why not?

5. How could you use the fine adjustment knob to determine which hair is on top?

6. When you switch from low to medium or high power:a. Is the field of view larger or smaller under the higher power?

b. Does the position of the image change?

c. Is there more or less light with the higher power than with low power?

Microscope Investigation- LEPNAME___________________________

1. Microscope VocabularyKnow where each of the following is found and what the function is.eyepiece (ocular) arm diaphragmrevolving nosepiece stage clip lamp (light)low power objective base fine adjustmentmedium power objective stage coarse adjustment

high power objective

2. Rules for using microscope (care of the microscope):


3. When you are viewing material under high power, which is the ONLY adjustment knob that you should use?

Eyepiece Magnification x Objective Magnification = Total Magnification 10 x Low power:

10 x Medium power:

10 x High power:

4. Making Slides: Follow the procedure listed.i. Cut a small “e” from a piece of newspaper.j. Place the “e” on a slide and add a drop of water to it.k. Holding a coverslip at a 45o angle and slowly lower it onto the “e”.l. Put the slide on your stage so that the “e” is right side up BEFORE YOU VIEW IT

WITH THE MICROSCOPE.m. Move the slide so that the letter “e” is in the center of the opening in the stage.n. Use the low power objective and the coarse focus knob until the newsprint comes

into view. Use the fine focus knob to sharpen the focus.o. Now change to the medium power objective. Use the fine focus knob to sharpen

the focus.p. Make a sketch of the letter “e” and describe how it looks under the microscope.

DATA/QUESTIONS Object Being Drawing and ObservationsViewed

Letter "e"(Describe)

Magnification_______

Questions:5. What does the microscope do to the position of the viewed image (refer to your observations with the letter “e”).

6. What happens when you move the slide from right to left?

7. What happens when you move the slide away from you?

8. When you switch from low to medium or high power:c. Is the field of view larger or smaller under the higher power?


d. Does the position of the image change?

c. Is there more or less light with the higher power than with low power?

EXPLAIN:During the lab, the teacher should circulate the room and check to make sure that each student understands each part of the activity by asking each student to explain how to properly use a microscope.

Cells LabEXPLORE: Students will use microscopes to view various cells (cork, onion, Elodea, potato, cheek, yeast, stomata). Students will investigate the specific functions of each of the types of cells as they relate to the structures. The lab (Investigating Cells) also includes investigating osmosis. This part of the lab could be done later in Unit 4.

Guiding Question: What are some of the important structures that determine the functions of various cells?



Preparation: The teacher needs to provide at each station: dropper bottles of: water, salt water, iodine solution, and methylene blue solution. Each station should also have toothpicks, lens paper, slides and cover slips. The teacher needs to prepare a general station with: shavings of cork, a sprig of Elodea, some potato slices (in water), small pieces of onion (in water), a yeast solution (with a little sugar so they will grow and bud), and a geranium leaf (or other leaf) with stomata (on the thin tissue that covers the leaf).

Note: To save time, teachers can set-up seven stations and rotate students through them. Each group of students will prepare the slides for just the first station they go to. Teachers may want to select a few of the tissues listed in this activity rather than all of them.


Language Objectives: Students will: read laboratory procedures. discuss with a partner how to draw, color, and label diagrams. write answers to various questions.

LEP Modification: Have students draw, label, and color diagrams provided by teacher to learn organelles.

Safety:Consult MSDS for safety issues surrounding testing solutions.

Make sure students know the proper methods for carrying and using the microscopes. (Refer to posters made during microscope lab.)

Before Activity: The teacher will explain to students how to make the various slides. The teacher will also explain how to make labeled drawings. (Be sure to model proper procedures and show examples of how you expect diagrams to look when complete.)

Special Notes to Teacher Regarding Investigating Cells Lab:Cork: Robert Hooke first coined the term “cell” while observing cork. These cells come from the covering of the cork tree. They are dead and filled with air.

Onion: Use the very thin membrane that covers the onion sections. Students will have to make two onion slides – on the first one, they will stain with iodine and on the second they will apply salt to see what happens. They should be able to see a clear nucleus and even nucleoli. When they add salt, the membrane will pull away from the cell wall as the central vacuole loses water.

Elodea: The chloroplasts are very clear and the students may see “cytoplasmic streaming” as the chloroplasts circulate – apparently this allows more efficient photosynthesis. If a light is placed over the dish of Elodea overnight this increases the chances of observing the streaming.

Potato: The leucoplasts are very visible, especially after staining with iodine. It is important to note that onion stained with iodine looks golden and potato stained with iodine looks “blue-black.” This reinforces the starch test done at the beginning of this unit.

Cheek Cells: Students should be very careful to gently scrape the inside of their cheeks – firmly but not enough to draw blood! They will stain the cheek cells with methylene blue. The cheek cells are a clear example of form and function. They are flat like pancakes and their function is to cover other tissues. Students should make sure to throw away their used toothpicks.

Yeast Cells: These cells are very small. They may be budding and this can be used later in the unit when the students study asexual reproduction. A typical yeast cell is only 4 µm in diameter! They will be golden when stained with iodine

Stomata: These are fairly easy to find on either the epidermis that covers either the top or the bottom of the leaf. Instead of removing the epidermal


layer of the leaf, you can paint it with clear fingernail polish, then peel off the polish and observe that lacquer layer through the microscope.

Investigating Cells

Name ___________________________________ Date _______________ Per _____

Item Draw & LabelInclude the

magnification

Estimated Size

LP diam – 4 mmMP dia – 1.6 mmLP dia - 0.4 mm

Observations

1. Cork These are the

same cells that Robert Hooke observed.

Look for and label the cell wall.

What is the general shape of these cells?

What do you think is inside these cells?

2. Onion Epidermal Cells Examine on low

and high power.

Draw 3 cells and label the cell wall, nucleus, nucleolus

Stain with iodine and note changes.

Add salt water and observe. Draw cells to show what happens.

How are onion cells similar to cork cells?

How can you tell that the cell has depth?

Where is the water in the onion cell?

What happened when you put salt water on the cells?

3. Elodea Cells Label the cell

Are all the chloroplasts


wall, chloroplasts, and nucleus.

Look for and describe movement of chloroplasts.

Add salt water and observe.

moving in the same direction?

Are they all moving at the same speed?

What makes the chloroplasts move?

What is the function of the chloroplasts?

4. Potato Cells Observe a thin

slice, then stain with iodine.

Label the cell walls and leucoplasts.

Sketch and estimate size of starch grains.

Where in the potato cell is the starch located?

What is the function of potato cells?

Do you see any chloroplasts? Why or why not?

5. Human Cheek Cells Find cells that

do not overlap. Adjust diaphragm for best image.

Stain with methylene blue.

Label the cell membrane, nucleus, and cytoplasm.

How are cheek cells and Elodea cells different?

How is the flatness of the cheek cells related to their function?

6. Yeast Cells Put a drop of

yeast on a slide

How does iodine stain yeast and potato differently?


and add a cover slip.

Observe under low, medium and high powers.

Add a drop of iodine stain.

Sketch five cells and their internal structures.

Label and estimate size

Explain this difference.

How do you think yeast cells reproduce?

7. Stomata Put a small

piece of epidermis from a leaf on a slide.

Add water and a cover slip.

Make a drawing of a stomata and label the guard cells and the opening.

Estimate the size of a whole stomata and count the number of stomata you see in your field of view.

Do guard cells have chloroplasts?

What is the function of guard cells?

What is the function of the stomata opening?

Measure the area of one leaf (in mm2). Calculate the area of your field of view (r2) . Estimate how many stomata could be found on the underside of a typical leaf for the plant that you are using.


After Activity: The teacher should go over many of the questions, helping students interpret what they have seen.

Cell FoldableEXPLAIN:Students will prepare a foldable which is a 3-D graphic organizer that is created by folding and cutting paper to display information. They often have flaps that can be lifted to reveal information. This activity can replace note-taking.

Guiding Question: What are some of the differences and similarities between plant and animal cells?

Cell FoldableLEP Note: Model each step of foldable construction. Monitor students’ progress closely. Have students keep their foldable in their notebooks and encourage them to refer to it when working on later assignments.


Activity Time: 25 minutes to start activity which students will finish as homework

Preparation: The teacher needs to gather the materials – construction paper, pictures, tape and scissors. Students can also be assigned to do their own drawings or collect their own pictures.

Before Activity: The teacher will explain to the students how to make their foldable and give them examples of what to place in each section. The teacher should go over the instructions that are on the attached hand-out.

Cell Foldable

Definition Foldables are 3-D graphic organizers that are created by folding and cutting paper graphic to display information. They often have flaps that can be lifted to reveal information. See Figure 1.


Language Objectives: Students will: read and summarize their notes to create a graphic organizer. may work with a partner to discuss foldable construction and what information to

include. write key information to differentiate between plant and animal cells.

Figure 1

Materials1 piece of construction paper (preferable a light color)ScissorsPictures/diagrams Markers

Activity1. Hold the construction paper in landscape format. 2. Fold the paper in half.3. Open flat and then fold each side toward the center fold.4. Title the left column “Animal Cell” and the right column “Plant Cell”.5. Write the names of the cell parts found in an animal cell on the front side of the

“Animal Cell” column.6. Write the names of the cell parts found in a plant cell on the front side of the

“Plant Cell” column.7. Using a pair of scissors, cut under each term until you get to the fold. This

creates tabs. Do this for both columns. See Figure 1, however your columns will have more tabs than the one shown.

8. Flip the tabs open and write a description of the term in your own words. Diagrams/pictures should be included.

Evaluation6. Foldable should be neat and easy to read.7. Cell terms should be comprehensive.8. Descriptions should be accurate and detailed.9. Diagrams should help enhance the understanding of the cell part.

Teacher NotesStudents will need you to demonstrate the folding and cutting of the paper. This foldable creates a great study tool that can be added to as the students work through


the unit. They can use it as a resource for homework, labs, activities and even quizzes and tests.

After Activity: Make sure to ask students if they have any questions or confusions and have them summarize the differences between plant and animal cells – focusing on form and function.

Cell Simile/Cell StorybookELABORATE:Students work in groups (or individually) to create a cell simile or cell storybook. In either project, the focus is on showing how the organelles interact with each other to support cell function. These activities may be adapted by using a reduced list of organelles. This activity is a good extension activity and also allows the teacher to evaluate student understanding of cell structure and function before going on to cell reproduction

An extension activity is also included here. Sell that Organelle (LEP Note: Great for LEP kids, but some may need extra help with slogan development.) In this activity, students work in groups to develop an advertisement for a specific cell organelle; they create a poster or commercial and then present to the class.

Guiding Question: How do the organelles in a cell interact to produce optimal functioning of that cell?


Activity Time: 90 minutes - 30 minutes to get a good start on the activity. Students will finish the activity as homework. Give students 2-3 days to finish. 60 minutes to present projects.

Preparation: The teacher needs to gather the materials – construction or poster paper, scissors, tape or glue and markers.

Note: These activities may be adapted by using a reduced list of organelles.

Before Activity: Teachers should explain to students that they have now finished identifying molecules and organelles each of which has a specific function within cells. Now the students will be exploring how cell organelles interact to help cells function as a whole unit.


Language Objectives: Students will: write and illustrate a children’s story about organelles students will read about various organelles.

Cells R Us!Cell Simile () Project

Cell Biology Assignment: You have embarked on a

study of the cell: plant and animal cells. This project will allow you to communicate your understanding of the inner structures of the animal cell and how those structures function interdependently.

PROCEDURE : PART ONE:1. You will work individually to create a poster simile of a cell.2. Choose a human built structure to serve as the basis for your cell similes.

The title of your poster will be “An Cell is like a…………..”. In the blank space you will put the name of your human built structure such as a/an airport, football game, circus, shopping mall, etc. The poster will actually show your human built structure – NOT the cell.

3. Choose details from your human built structure to compare to the structures and functions of the organelles of a cell. Often a cell is compared to a factory. A sample is attached – you will NOT use a factory for your simile. The logic and richness of your similes will help you to learn better how a cell and its structures function together to enable the cell to grow, acquire and use energy, produce wastes, divide, communicate, etc.

4. Next to each part of your human built structure, you will put a sentence that compares that part to a part of the cell. EXAMPLE: “Just as a shipping/receiving department determines what enters or leaves a factory, so the cell membrane selectively determines what can enter or leave a cell.”

5. Use the following organelles/structures:Plasma membrane Mitochondria LysosomesCytoplasm Nucleus PeroxisomesRough endoplasmic reticulumCytoskeleton Golgi Apparatus

BONUS: centriole Nucleolus smooth ER

6. Strive for EXCELLENCEBiology- Unit 1 DRAFT 50

Use sturdy posterboard and PLAN BEFORE your start the poster. Use neat printing or computer generated text. Plan graphics that illustrate the simile without overwhelming it.

7. Assessment: Your posters will be evaluated on the following criteria: Simile: Does your simile project a dominant, unified central image

of the cell? Details: Have you included all of the animal cell organelles WITH

details? Clarity: Have you produced clear, correct labels for each detail? Unity: Does your simile show that the parts of the cell function

together coherently – that the cell is using energy, growing, responding, etc.)?

Technical Details: Have you used posterboard? Does your poster have a title? Is your poster neat, attractive, and easy to read?

Excellence: Is your poster creative, original, and interesting?

Here is an example of comparisons of cell parts to parts of a factory.

Factory Job Cell Organelle SimileShipping andReceiving Dept.

Plasma Membrane

Just as the shipping and receiving department controls what enters and leaves a factor, so the plasma membrane regulates what enters and leaves a cell.

CEO – Chief Executive Officer

Nucleus Just as the CEO directs all operations of the factory, so the nucleus and DNA controls all cell activities and what proteins will be made.

Factory Floor

Cytoplasm Just as the factory floor holds all of the machinery and parts in the factory, so the cytoplasm is the where all the organelles and activity are found in the cell.

Assembly Line

Rough ER (Endoplasmic Reticulum)

Just as the assembly line is the place where the workers to their job in the factory, so the ER is the place where the ribosomes do their job of assembling proteins.

Finishing and Packaging Dept.

Golgi Apparatus

Just as the finishing and packaging department prepares factory products for shipment, so the Golgi apparatus prepares the proteins for use or export out of the cell.

Maintenance Crew

Lysosomes Just as the maintenance crew cleans up all of the trash and recycles what can still be used, so the lysosomes break down the cell waste so the parts can be reused.

Support Beams, Walls, Ceilings,

Cytoskeleton Just as the support beams, walls, ceilings and floor of the factory support the whole building, so the cytoskeleton supports and maintains the shape of the cell.


FloorPower plant Mitochondria Just as the power plant provides energy for all

the activities in the factory, so the mitochondria are the source of the ATP that is used for energy in cell processes.

Hazardous Waste Removal Bags

Peroxisomes Just as special hazardous waste removal bags are used to get rid of dangerous waste in the factor, so the peroxisomes break down hazardous material such as hydrogen peroxide.

Cell Storybook

Name ___________________________________Due Date ____________

Congratulations! You have just been hired by Cytophile Press- “Where Every Day is a Cell-ebration”- to work in the children’s book department. Your first assignment is to write and illustrate a storybook that explains the organelles present in an animal or plant cell. Your book should be written so that an elementary student could understand the structure and function of each organelle. Remember to be creative! You could use a mystery format, a biography, or use the format of other children’s books. In addition to writing and illustrating of the book, you should design the book cover, which should include the title and author/illustrator name. This assignment will be evaluated on the following scale:

Use of seven organelles: 7 pointsUse of a story line (do not just state the functions)/ Creativity: 15 pointsIdentification features of plant and animal cells: 5 pointsFunction/structure of each organelle: 4 points each (total of 56 points)Appropriate illustration to go along with the story line: 10 pointsSpelling/Grammar: -2 for each mistakeBook Cover (with author/illustrator name): 7 points

CELL STORYBOOK- LEP

Your class has been chosen to write a children’s book about cells. Your book should be written so that an elementary student could understand the structure and function of each organelle.

You and your partner are responsible for writing about and illustrating one organelle. We will put all of your work together to make the book.

I am working with ___________________________________________________.


Our organelle is _____________________________________________________.

We have included the following:_____organelle’s name_____organelle’s function_____organelle’s diagram_____at least 3 complete sentences about the organelle_____our page is colorful and creative

EVALUATE:The teacher can have the students present their similes or story books to the class. During the presentations, the teacher can reinforce the relationships among and between the organelles. The teacher should refer to the essential question “How do cells function as the smallest unit of life?” and help students build a more in-depth answer to this question.

Whale and Shrew Assessment ProbeENGAGE:Use the following assessment probe (Whale and Shrew) regarding a whale and a shrew to assess students’ understanding of cells and cell size. The probe is designed to find out if students think that animal cell size is related to the overall size of an animal.

Administering the Probe: Show a picture of a whale and a shrew to contrast size. Make sure students focus on the concept of “average-sized” cells. You might explain that some cells, such as neurons, vary considerably in size. If necessary, choose a particular cell, such as a red blood cell or a cell from the liver.

Note: The best answer is C: The average cell of a blue whale is about the same size as the average cell of a pygmy shrew. The size of average mammals cells (this excludes cells that are unusually large, such as neurons) is similar in all mammal species. Even though some body cells (such as neurons) can be very large and cells vary, the average body cells of most mammals are about 10 micrometers in diameter. Interestingly, the earliest-stage embryos of the whale and shrew are also in a similar size, even though a whale eventually reaches a mass of 150,000 kg whereas a mouse only reaches 15g--- a 10-million-fold difference!

Cells are limited in how large they can be because the surface area-to-volume ratio does not stay the same as the size of a cell increases. Cells need to be able to move materials into and out of a cell, and it is harder for a large cell to pass materials in and out of the membrane and to move materials through the cell. The reason blue whales are larger than pygmy shrew is because they have more cells, not because their cells are larger.

Whale and Shrew


The blue whale is the largest mammal in the world. The pygmy shrew is one of the smallest mammals in the world. How does the size of average cells compare between a blue whale and a pygmy shrew? Circle the answer that best matches your thinking.

A) The average cell of a blue whale is smaller than the average cell of a pygmy shrew.

B) The average cell of a blue whale is larger than the average cell of pygmy shrew.

C) The average cell of a blue whale is about the same size as the average cell of a pygmy shrew.

Explain your thinking. Describe the “rule” or reasoning you used to choose your answer.

Reference: Keeley, P., Eberle, F. & Tugel, J. (2007). Uncovering Student Ideas in Science: 25 More Formative Assessment Probes Vol. 2. Arlington, Virginia: NSTA Press


EXPLORE:The purpose of this activity is to extend student knowledge about cells by stimulating discussion of sexual and asexual reproduction. Teacher will set up centers around the room with a variety of slides, plants, pictures of animals or preserved animals, pictures of organisms, budding yeast to observe through the microscope, etc. Students will ask the question of each organism “How do they reproduce?” Questions at each station will ask students to evaluate the advantages and disadvantages of sexual and asexual reproduction.

Guiding Question: How do different organisms reproduce?

Before Activity: The teacher will briefly explain sexual and asexual reproduction. Then the students will go around to the stations and answer the questions.



Station 1: Budding Yeast


Language Objectives: Students will: listen to teacher explanation of sexual and asexual reproduction.l discuss the items at each station with their partners. write answers to questions in complete sentences. orally share their answers with one another, the teacher, and the class.

The picture to the left shows yeast cells. Some of them are budding. The arrow is pointing to a cell that is budding.

How do you think this type of reproduction works?

Do you think this is asexual or sexual reproduction? Why or why not?

http://bugs.bio.usyd.edu.au/Mycology/images/Topics/StructureFunction/buddingYeastCells.jpg

Station 2: Budding Hydra

The hydra to the left is also budding. You can see the new hydra on the right budding off the older one.

How do you think this type of reproduction works?

How many organisms are required for budding to happen?

http://www.microscope-microscope.org/gallery/Mark-Simmons/images/hydra2.jpg

Station 3: Bacteria Reproducing

On the left are bacteria that are reproducing. You can see that some of them look like two bacteria connected together.

What type of reproduction is this?

Describe how this type of reproduction would happen.


http://www.emc.maricopa.edu/faculty/farabee/BIOBK/96444c.jpg

Station 4: Pine Tree Reproduction

On the left are two types of cones found on a pine tree. The small yellow cones produce pollen and the large cone contains ovules that become seeds.


How many cells are needed for this type of reproduction?

http://biology.clc.uc.edu/graphics/taxonomy/plants/

spermatophyta/gymnosperms/other%20pines/JSC%209805&06%20male%20&%20female%20pine%20cones%202.JPG

Station 5: Flowering Plant Reproduction

The flower on the left is from a tulip plant. You can see the dark colored anthers that produce pollen and the white pistil that contains the ovules.


What would be involved in producing new tulip plants?

Would these plants look exactly like their parents?


http://www.bridgewater.edu/~lhill/images/tulipflowerpts.jpgStation 6:

On the left is a picture of a peacock wooing a peahen. Eventually, they will produce fertilized eggs and the peachicks will hatch.


This type of reproduction can be difficult because the male has to find a mate. So what is the advantage of this type of reproduction?

http://subjunctive.net/photoblog/2003/peacock-wooing-peahen.jpgActivity Time: 45 minutes

Preparation: The teacher will need to set up the stations.

Note: The accompanying activity is a sample of the pictures and questions that a teacher could use for this activity.

EXPLAIN: The teacher will have the students discuss some of the examples and share their answers. There is no need to be rigid about right and wrong answers at this point. The teacher should explain that all cells need to divide whether for sexual or asexual reproduction. (S)he will tell students that the next activity will help them understand why some cells are stimulated to divide.

Cell Growth ActivityELABORATE: This activity (Cell Growth Activity or Cell Size and Diffusion- alternate) helps students understand how changes in surface area:volume ratio affect diffusion in cells. This leads to an understanding that small cells are more efficient and that mitosis may be initiated when cell efficiency is compromised as the cell grows too large.

Guiding Question: What is the relationship between cell size and cell division?



Preparation: The teacher will need to copy the forms for the cutouts.


Safety: Consult MSDS for safety issues surrounding testing solutions.

Students should wear goggles.

Although the percentages of chemicals in this lab are very small, teachers could have students wear plastic gloves.

If students cut their own agar, have them use care with the plastic knives.

Alternative: Teachers could provide a variety of plastic bags - craft bags, snack, sandwich, quart and gallon). Then students could measure and compare the surface area of each bag with the volume of water that each bag can hold.

Before Activity: The teacher will explain the procedure to the students and help them with the math calculations. The teacher could do one of the calculations as a whole class example. The teacher should reinforce the idea that there is a stimulus that initiates cell division.

Cell Growth ActivityWHY DON’T CELLS GROW INDEFINITELY?

Cell size is influenced by many different factors. The cell’s specific function is one of the main factors that determine cell’s size and shape. For example, the shape of a red blood cell is directly related to its ability to carry large amounts of oxygen. Other factors to consider are surface area, volume and mass of the cell, which all change as a cell grows. For example, think of filling a balloon with water. As water enters the balloon, the balloon gets stretched which changes the surface area, the balloon gets bigger, which changes the volume and the balloon gets heavier, which changes the mass. Of these factors, which one limits the overall size of a cell? In addition, how do these factors change in relationship to each other?

This activity is designed to consider the relationship between surface area, volume and mass as a cell grows. Before producing cell models to help consider these relationship, make a prediction about what happens to the surface area to volume ratio and the surface area to mass ratio as a cell grows.

Hypothesis:


LEP Modification: After making the calculations, make an index card showing surface area and volume of each type of bag used. Get a clean, dry example of each bag you used in class and place its corresponding index card inside. Keep these examples to use as visuals as you discuss and review the unit.

Now, collect data to support or reject the above stated hypothesis. After the data has been collected, complete the analysis section.

Analysis:

1. Anything a cell takes in or lets out must pass through the plasma membrane. Which measurement best represents the plasma membrane?

2. The cell contents, including the cytoplasm and the organelles, use food and oxygen and produce waste. Which two measurements best represent the contents of your model?

3. As the cell grows larger and accumulates more contents, will it need more or less cell membrane to survive? Explain your answer.

4. As the cell grows larger, what happens to the surface area to volume ratio? Explain the relationship between these factors as the cell grows.

5. As the cell grows larger, what happens to the surface area to mass ratio? Explain the relationship between these factors as the cells grows.

6. How are the total surface area/volume ratio and the total surface area/mass ratio related to the cell survival?

7. Which size cell (small, medium or large) would have the greatest chance for survival and why?

8. Did the data support or reject the hypothesis?

Procedure:1. Produce three cubes from the provided template. There should be a small,

medium and large cube. These cubes will represent the different sizes that occur as a cell is growing.

2. Calculate the surface area of one face of each cube, using the following equation: s X s. Place this information in the data table.

3. Calculate the total surface area of each cube, using the following equation: 6 X (s X s). Place this information in the data table.

4. Calculate the volume of each cube, using the following equation:s X s X s. Place this information in the data table.

5. Determine the mass of each cube by filling the cube with bird seed and weighing it on a balance.6. Calculate the total surface area to volume ratio and the total surface area to mass ratio. Place this information in the data table.

Small CubeS= 12.5 mm

Medium CubeS=25 mm

Large CubeS=50 mm

Area of One Face


Total Surface Area

Volume

Mass (Weight)

Total Surface Area/Volume Ratio

Total Surface Area/Mass Ratio


WHY DON’T CELLS GROW INDEFINITELY?—LEP

Key Vocabulary:Surface areaVolumeMass

Language Objectives:Students will work with a partner to complete this activity.Students will orally discuss all parts of the activity with their partners.Students will write in complete sentences.

Cell size is influenced by many different factors: function surface area volume mass

Think of filling a balloon with water. Does the balloon get bigger?__________Is this a change in volume?__________Does the surface area change?__________

The amount of water is the balloon’s (surface area / volume).The rubber is the balloon’s (surface area / volume).

This activity is designed to consider the relationship between surface area, volume and mass as a cell grows.

Discuss the following question with your partner. Work together to write a hypothesis for the problem. Write your hypothesis in a complete sentence.

Question:Does volume of a cell have an effect on its survival?Hypothesis:

Procedure:


Working with a partner. . . 5. Produce three cubes from the provided template. There should be a small,

medium and large cube. These cubes will represent the different sizes that occur as a cell is growing.

6. Calculate the surface area of one face of each cube, using the following equation: side (cm) X side (cm). Place this information in the data table.

7. Calculate the total surface area of each cube, using the following equation: 6 X (side X side). Place this information in the data table.

8. Calculate the volume of each cube, using the following equation:side X side X side. Place this information in the data table.

5. Determine the mass of each cube by filling the cube with bird seed and weighing it on a balance.7. Calculate the total surface area to volume ratio and the total surface area to mass ratio. Place this information in the data table.

Small CubeS= 12.5 cm

Medium CubeS=25 cm

Large CubeS=50 cm

Area of One Face(side X side)

cm2

Total Surface Area6(side X side)

cm2

Volume(side X side X side)

cm3

Massg

Total Surface Area/Volume Ratio

cm2 / cm3

Total Surface Area/Mass Ratio

cm2 / g

Analysis:Answer all questions in complete sentences!!!

9. Anything a cell takes in or lets out must pass through the _________________________.

10.Which part of you cubes best represents the plasma membrane?


11.The cell contents, including the cytoplasm and the organelles, use food and oxygen and produce waste. What part of you model best represents the contents of a cell?

12.Which cube has the most surface area?

13.Which cube has the least surface area?

14.Which cube has the largest volume?

15.Which cube has the smallest volume?

16.Which cell has the most cytoplasm and organelles?

17.Which cell will require more nutrients?

18.Which cell will need to get rid of more wastes?

19. Is there enough surface area to supply what the cell needs and get rid of the wastes?

20. If there is not enough surface area, what will happen to the cell?


Cell Size: Surface to Volume Ratios (Alternate Lab)

Purpose and Background (Adapted from BSCS Green Version biology)

Why are cells so small? Why do they stop growing after reaching a certain size? How does the size of a cell affect the diffusion of molecules across the membrane? What causes the cell to stop growing and then to divide into two smaller cells? In this lab you will use some cell “models” to learn about the relationship between the surface area of a cell, the volume of a cell, and the effect of cell size on the efficiency of diffusion.Materials

Knox Gelatin blocks containing phenolphthalein Plastic spoonMetric rulerPaper towelsPlastic knifesmall bowl0.1% sodium hydroxide (NaOH)Latex gloves Procedure

1. Using the plastic knife cut the gelatin block into 3 cubesCube A – 3 cm on each sideCube B – 2 cm on each sideCube C – 1 cm on each side

2. Place the cubes in the small dish and cover them with the NaOH. Use the spoon to turn the cubes and make sure that the NaOH is circulating around the cubes. Continue for 10 minutes.

3. While the cubes are soaking in the NaOH, you can fill out your data table. Calculate the surface area (SA) and volume (V) for each of cubes (your cell models). Also do the calculations for the 4th very small cell – too small to create an agar model.

4. After 10 minutes, remove the gelatin cubes from the NaOH and blot them dry on some paper towels.

5. With the plastic knife, slice each cube in half. Measure how deep the pink zone has penetrated into the each cube. Record your measurements in mm.

Cell Size and Diffusion NAME___________________________________

DATE______________________PER___________

DATA TABLECube Surface area Volume (V) SA:V ratio Depth of pink


Dimensions (SA) (cm2) (cm3) (mm)3 cm

2 cm

1 cm

0.01 cm

Discussion Questions:

1. a. Materials that a cell needs and materials that a cell needs to get rid of must go through the membrane surrounding the cell. Which cell do you think will do the BEST job of moving materials into and out of the cell?

b. Why did you pick that cell?

2. How do the depths of the pink areas of each cube compare?

3. a. Which cell has the largest percentage of its volume pink?

b. What does this mean about how efficient this cell is in receiving materials from the outside?

4. Looking at the surface area to volume ratio (SA:V) for each of your cells, explain efficiency of a cell in terms of the SA:V ratio.

Teacher notes:

Gelatin should be made according to instructions on the box. 10 drops of phenolphthalein should be added to the gelatin before it gels. Put the liquid mixture into a pan (pyrex for example) that is about 13’ by 9”. The depth of the agar should be 3 cm. Then after the agar gels, give each group of students a 3 cm by 5 cm block. This will be enough for them to cut their three cubes.

Alternative: If you have many classes you can make a pan of agar that is 3 cm deep, another that is 2 cm deep and a final one that is 1 cm deep. You can cut the cubes and this will eliminate the need for students to cut and measure their own cubes.

Sodium hydroxide 0.1% can be made by putting 1 gram of sodium hydroxide in 1000 ml of distilled water.


Putting the cubes on white paper will make the effect more visible.

Because sodium hydroxide solution diffuses at an equal rate into each cube students will find that the smallest cube will appear all pink or almost all pink inside. The 2 cm cube will have about 3-5 mm depth of pink around all edges and the largest cube will also have a 3-5 mm depth of pink. It can be inferred that the largest “cell” is not able to eliminate waste effectively from the non-pink area nor bring in needed molecules to that non-pink area.

Teachers can reinforce the idea that one stimulus for cell division might be a cell becoming too large to efficiently take care of its needs.

After Activity: The teacher will explain that now that students understand what might stimulate a cell to divide, they will be studying next what happens to the nucleus during cell division.

Cell Cycle Inquiry LabELABORATE: This activity (Cell Cycle Inquiry Lab) will help students understand the cycle that cells go through – from interphase to mitosis to cytokinesis and over again.

Guiding Question: What are the primary stages in the cell cycle?

Before Activity: Teacher should explain that students are now going to study how cells go through cell division a process that is used for repair, growth, and asexual reproduction.



Preparation : This will vary; teacher needs to make the onion root tip mitosis slides available and provide 3 x 5 cards as well as copy the hand-out.

Safety:Remind students about proper microscope use. (Refer to posters made during microscope lab.)


Language Objectives: Students will: read procedures. write descriptions of diagrams they draw during the lab. discuss the descriptions and sequence of diagrams with their partners. orally explain their diagrams and descriptions.

Cell Cycle Inquiry Lab: Background Information

Targeted Standard Course of Study: Goals and Objectives

Goal 1: The learner will develop abilities necessary to do and understand scientific inquiry.

1.02: Design and conduct scientific investigations to answer biological questions. 1.03: Formulate and revise scientific explanations and models of biological phenomena using logic and evidence to: a) Explain observations. b) Make inferences and predictions. c) Explain the relationship between evidence and explanation.

Goal 3: The learner will develop an understanding of the continuity of life and the changes of organisms over time.

3.02: Compare and contrast the characteristics of asexual and sexual reproduction.

Introduction to the Teacher Through inquiry techniques, students will recognize the process by which nuclear division occurs. It is recommended that this laboratory activity be completed prior to cell cycle instruction. Onion root tip slides will be observed and the five different stages of the cell cycle will randomly be drawn. Students will then use their drawings to place the cells in the different stages of the cell cycle in a logical sequence to determine the correct order of cellular division. Upon the completion of the activity, the teacher can collect the cards for the lab grade and use the best drawings for classroom discussion.

Students may have trouble visualizing individual cells when viewed under the microscope in small groups. A solution to this would be to use a videoscope, flex cam or overhead transparency to present the students with an enlarged picture of an onion root tip. The teacher could then point out individual cells to stress the importance of what these cells look like and what they represent to prepare students for the inquiry lab. Another alternative would be to modify the laboratory into a whole class activity. Students will need a good understanding of the parts of the cell and the nuclear material before beginning this laboratory.

Some possible extensions of this lab may include the use of whitefish slides in addition to the onion root tip slides. Whitefish slides could be used for the comparison of the stages of the cell cycle. The class could be divided into an even number of groups with half using the onion root tip and half using the whitefish slides. The groups could then compare their diagrams and discuss the similarities and differences between the cell cycle in plant and animal


cells. Another suggested extension would involve the use of a computer and data projector or computer lab. Once students have completed the inquiry lab and the stages of the cell cycle have been identified, students can practice recognizing the different cells by using the Online Onion Root Tip Tutorial at http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.html.As students view the different cells, the number of cells present in each stage can be recorded and a pie graph can be produced to show the percentage of time in each stage.

Safety ConsiderationsStudents should be reminded of proper microscope technique. References This lab was written based on a suggestion from Gena Barnhardt.

http://www.bioweb.uncc.edu/biol1110/Stages.htmlThis website provides microscope pictures of whitefish and onion root tip slides.

http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.htmlThis website allows the student to determine how many cells are found in each stage of the cell cycle.

http://biologyinmotion.com/cell_division/This website provides an animated tutorial of the process of mitosis.


http://biologyinmotion.com/cell_division/

http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.html

http://www.bioweb.uncc.edu/biol1110/Stages.html

http://www.biology.arizona.edu/cell_bio/activities/cell_cycle/cell_cycle.html

Cell Cycle Inquiry Lab: ActivityPurpose To study the different stages of the cell cycle

Materials (per person or lab group) microscope onion root tip slides five note cards pencil

Procedure 1. Obtain all needed materials: microscope, onion root tip slide, 5 note

cards, and pencil.2. Start your observation of the onion root tip slide on low power using the

coarse adjustment. The slide should be scanned until the region directly behind the root cap can be viewed.

3. Increase the magnification of the microscope by switching to the medium power objective and use the fine adjustment to focus the microscope so that several different cells can be viewed clearly at once.

4. Observe the cells in the field of view very carefully. You should notice differences between the cells, especially with the nuclear material. Each of the different looking cells should be drawn on a separate note card. As you draw your cells, you may need to increase the magnification of your microscope to more clearly view the individual cells and their nuclear material. When you have completed your diagrams, you should have five different cells on five separate note cards.

5. Have your teacher approve all of your diagrams.6. After your diagrams have been approved, write a description at the

bottom of each note card of how each cell looks different. Be sure to emphasize the differences between the nuclear materials.

7. After carefully studying your note cards and descriptions, place your diagrams in a logical order to determine the steps involved in the cell cycle.

8. Once you have placed your cards in order, number them 1-5 in the upper right hand corner.

Lab DataStudents will turn in their note cards with the diagrams of the cells and their written description of the differences between the cells.

After Activity: The teacher will allow time for questions and then will explain to students that the process of mitosis is actually continuous rather than single steps – a movie not a slide show.

Onion Root Tip MitosisOptional further extension: Onion Root Tip Mitosis


This extension activity has students count the number of cells in each stage of mitosis and then infer the time that cells spend in each stage.

Onion Root Tip Mitosis

NAME______________________________ DATE_____________________PER______ I. TITLE: Mitosis and Cell Division in Plants

II. PURPOSE: - to study the process of Mitosis and determine what occurs in each phase- to estimate how long a cell spends in each stage.

III. PROCEDURE:1. Obtain a prepared slide of onion root tip. Under low power locate a group of cells near the tapering end of the root tip. Make note that there are three root tips on your slide; you will be using each one of them. Move to high power and find a good section with many cell divisions. Make sure the field of view is completely filled with the cells.

2. We will use 300 as an estimate of the total number of cells in the high power field of view. Find this number in the three columns beside "CELL TOTAL" at the bottom of the data table.

3. Count the number of cells in each phase of mitosis and record the numbers in the column labeled "1". A good way to do this is for each lab partner to count independently and compare estimates, then take the average of the two. Interphase numbers can be calculated by subtracting the other four counts from the 300.

4. Follow the same procedure for the other two root tips on your slide.

5. Add columns 1, 2, and 3 for each phase; record in the column "TOTAL." Divide each of these totals by 300 and multiply by 100 to find the percentage of cells in each phase.

6. Record your percentages in the chart on the front board. From this we will calculate the class percentages.

7. From your data and the class data you are to construct a bar graph, showing both individual and class percentages for each phase of mitosis.

DATA TABLE:

Phases Root Tip #1 Root Tip #2 Root Tip #3 Average Class Average

Prophase

Metaphase

Anaphase

Telophase

Interphase

Total Cells 300 300 300 300 300


Mitosis InvestigationDISCUSSION:

1. Why are root tips a good place to observe mitosis?

2. How does your data compare with the class data: Explain why the results are different.

3. Create a Pie Chart showing the proportions of each of the 5 phases. Remember that a circle has 360o so if interphase is 30% of the cells it will fill 30% of 360o.

4. Using the class data calculate the following. Suppose an onion cell takes six hours from the beginning of one mitosis to the beginning of the next. How many minutes does the cell spend in each of five phases? interphase______prophase_______metaphase________ anaphase_______telophase_______

5. What are the principal sources of error in this laboratory investigation?

Mitosis in Motion FlipbookEVALUATE: In this activity (Mitosis in Motion Flipbook), students will prepare a flip book of the stages of the cell cycle in order to show the continuous nature of the process.

Guiding Question: How is mitosis more like a video rather than a slide show?

Before Activity: The teacher will explain the procedure and make sure students understand what the product will look like.


Activity Time : 45 minutes and then homework to finish it up.

Preparation Time : Teacher needs time to set out the 3 x 5 cards, pens and stapler as well as copy the handout.


Mitosis in Motion

Overview: Although when we study mitosis, it appears as a series of snap shots, in fact, it is a continuous process involving a disappearing nuclear membrane and moving chromosomes. In this activity, you will be creating a flip book on mitosis. When you finish you will have a little book that you can scroll through and it will show a rough continuous animation of the process of mitosis.

Materials: 3 x 5 cards – 16 per studentTemplates: available at this website: http://sciencespot.net/Media/mitosisbook.pdfColored pens or pencilsStapler

Procedure: On each card you will draw a cell going through some stage of mitosis. You will label the appropriate structures and you will put a brief narrative of the steps. Your cell should have 4 chromosomes (2 pairs). Use the given number of 3 x 5 cards for each of the stages listed below.

Title Page - 1 card Interphase - 2 cards Prophase - 3 cards Metaphase - 3 cards Anaphase - 3 cards Telophase - 3 cards Cytokinesis - 1 card

1. Get 16 3/5 cards.2. On the first card put your name and a title for the book (Mitosis in Motion, for

example)3. Make sure that the location where you draw your nucleus will be on the same place

on each card.4. Use colored pens or pencils and be consistent with your colors on each card.5. On each card label structures such as chromosomes, centromere, spindle fiber,

nuclear membrane, 6. On the back of each card, describe what is happening on the front.7. When finished, staple them together in the correct order along the left edge. When

you flip through the book you will have Mitosis in Motion!

Notes: The first "cell" to begin each phase should be the beginning stages of that phase

(e.g., the first cell for metaphase should include the chromosomes lined up along the center of the cell and the spindle fibers attached to the centromere).

The other cards for each phase should change very gradually to give the appearance of the cell actually dividing. You should also make sure that the last "cell" for a particular phase gradually changes into the beginnings of the next stage (e.g., the final "cell" for interphase should blend into the first "cell" for prophase).

Make sure that you make your drawings in a place that they will be seen when you flip the pages. Also watch the size of your drawings. Do not make the


http://sciencespot.net/Media/mitosisbook.pdf

drawings so large that you will be able to see only parts of the "cell," but do not make them so small that you will compromise details.

After Activity: The teacher will have students share what they have learned from the activity. (S)he, then, should explain that that students will be studying two different types of nuclear division, mitosis and meiosis. (S)he will connect mitosis with asexual cell division that is used during cell repair, growth. Then, (s)he will connect meiosis to the production of cells needed for sexual reproduction.

Comparison of Mitosis and Meiosis

ELABORATE: This activity (Comparison of Mitosis and Meiosis) is conducted as a whole class experience. The teacher talks students through a simulation of mitosis and then through a simulation of meiosis, helping students to compare both processes as they simulate them. The focus is on the similarities and differences of each process in terms of number and type of cell produced and function of each process. Teacher should also stress the possibility of variations within each process.

Guiding Question: What are the similarities and differences between mitosis and meiosis?

Before Activity: The teacher should explain that students will be comparing two processes – one of which is used for organism growth and repair and the other that is used to produce gametes for sexual reproduction.



Preparation: You need to copy the chromosome strips and the other handout. Each student will need 2 pages of chromosome strips and one handout, as well as a piece of string about 6 feet long to serve as a nuclear membrane.

Safety: Students should be careful using scissors.

Comparison of Mitosis and MeiosisNAME______________________________


Language Objectives: Students will: listen to teacher discussion. participate in class discussion. complete a chart comparing mitosis and meiosis. read questions and answer in complete sentences.

DATE_____________________PER______

1. Complete the following chart comparing mitosis and meiosis (relative to the cell models that you worked with in the lab.

Characteristic MITOSIS MEIOSISLocation(s) where process occurs

number of cells produced

chromosome number ofparent nucleus (haploid/diploid)chromosome number of new nucleus

type of cell produced(body cell/gamete) function in the organism

2. How are the nuclei of the cells resulting from mitosis different from the nuclei of egg and sperm cells formed in meiosis? (Describe in terms of chromosome number.)

3. How are the nuclei of the cells resulting from mitosis different from the nuclei of the

fertilized egg cells? (Describe in terms of chromosome number.)

4. What are the functions of mitosis to organisms?


5. What are the functions of meiosis to organisms?

MITOSIS


MEIOSISDiagram 3

Biology- Unit 1 DRAFT

Diagram 1

Diagram 2

78

OOCYTE SPERM

Diagram 6


Diagram 4

Diagram 5

ZYGOTEDiagram 7

Teacher Notes:

The teacher should give each student two sheets of chromosomes and a pair of scissors. Have students cut out the chromosome strips and keep them in two sets. Each set will have 2 long chromosomes with 5 genes, 2 medium chromosome with 3 genes, and 2 short chromosomes with 2 genes. The teacher can stress that for example, gene 1 on the long chromsome carries information for the same trait although the specific information can vary.


FERTILIZATION

Chromosome Strips for Comparison of Mitosis and Meiosis

Gene 1

Gene 1

Gene 6

Gene 6

Gene 9

Gene 9

Gene 2

Gene 2

Gene 7

Gene 7

Gene 10

Gene 10


Gene 3

Gene 3

Gene 8

Gene 8

Gene 4

Gene 4

Gene 5

Gene 5

After Activity: The teacher should help the students summarize the comparison between mitosis and meiosis. The teacher can then lead students to the online review which follows.

Mitosis and Meiosis Online Review Activity

Additional or Alternate Activity for Comparison of Meiosis and Mitosis: This activity (Mitosis and Meiosis Online Review Activity) directs students to different websites to review mitosis and meiosis. One of these websites allows students to review mitosis and meiosis and the other allows them to actually move the chromosomes.


Activity Time: 30 minutes (LEP students will likely require more time and substantial teacher support)

Preparation: Teacher will need either a computer lab or a computer and a projection device. Check the computers you will be using in advance to be sure the necessary


LEP Modification: Have students write a paragraph comparing mitosis and meiosis.

plug-ins are installed to run the animations. Consult with your technology specialist if you need assistance.

Before Activity: Explain to students that they will be reviewing the steps in mitosis and meiosis.

(LEP students will likely require more time and substantial teacher support)

Mitosis and Meiosis Online Review Activity

Step One: Go to the following websites to review the steps in mitosis and meiosishttp://www.johnkyrk.com/mitosis.htmlhttp://www.johnkyrk.com/meiosis.html

Step two: Go to http://biologyinmotion.com/cell_division/ to complete the following activities.

Click on “practice mitosis”.

In the space provided, draw a sketch of the mother cell being sure to include the chromosomes with the different color bands, which represent different genes. You may use any four colors of your choosing. Next, following the instruction to the left and show how the genetic material is distributed during mitosis. Next, draw a sketch of the two daughter cells produced once the mother cell goes through mitosis.

Quit that activity and proceed to “Practice meiosis”In the space provided, draw a sketch of the mother cell being sure to include the chromosomes with the different color bands, which represent different genes. You may use any four colors of your choosing. Next, following the instruction to the left and show how the genetic material is distributed during meiosis. Next, draw a sketch of the two daughter cells after the first division.


http://biologyinmotion.com/cell_division/

http://www.johnkyrk.com/meiosis.html

http://www.johnkyrk.com/mitosis.html

Then draw a sketch of the four daughter cells produced after the second cell division.

Provide a written description of the difference between cells produced in mitosis and meiosis.

After Activity: Summarize with students to ensure that they all understand the similarities and differences between mitosis and meiosis.

ENGAGE:The teacher should pose the following questions: Is DNA found in all species? What does it mean? Record student responses on the board.

Strawberry DNA ExtractionEXPLORE: The teacher should remind students that DNA is found in the nucleus. Teachers should also explain how the DNA will be extracted. Students will extract DNA from a strawberry and answer questions about the presence of DNA in all species. Crushing the strawberry helps break open the cells. The soap which is nonpolar helps break open the plasma membrane. The salt which is ionic helps to unwind the DNA and break it loose from the attached proteins. DNA is insoluble in alcohol and will precipitate into the alcohol layer.



Preparation: Teachers will need to buy strawberries and set up the stations. All the materials and more teacher notes are listed in the activity handout.


Safety: Be alert to any student allergies to the food products used and consult MSDS for safety issues surrounding testing solutions. Students should wear goggles If teachers do human DNA collection, care should be taken to Clorox any glassware or other materials that may have come in contact with human fluids.

Strawberry DNA Extraction Purpose:

Students will extract DNA from strawberries.

Materials / Equipment (per student group):

1. 1 heavy duty zip-lock baggie

2. 1 strawberry (fresh or frozen and thawed)

3. cheesecloth

4. funnel

5. 100 ml beaker

6. test tube

7. stirrerReagents:

1. DNA extraction buffer (One liter: mix 100 ml of shampoo (without conditioner), 15 g NaCl, 900 ml water or 50 ml liquid dishwashing detergent, 15 g NaCl and 950 ml water)

2. Ice-cold 95% ethanol or 95% isopropyl alcohol

Procedure:

1. Place one strawberry in a zip lock baggie.

2. Smash strawberry with fist for 2 minutes.

3. Add 10 ml DNA extraction buffer to the bag.

4. Mush again for one minute.

5. Filter through cheesecloth in a funnel into beaker.

6. Pour filtrate into test tube so that it is 1/8 full.

7. Slowly pour the ice-cold alcohol into the tube until the tube is half full.

8. At the interface, you will see the DNA precipitate out of solution and float to the top. You may spool the DNA on your glass rod or pipette tip.

Questions:

1. Where is DNA found in the cell?

2. What does the soap (detergent) do to the cells. What is the purpose of the soap in this activity?


3. What was the purpose of the sodium chloride? Don’t forget about polarity and charged particles.

4. Why was the cold ethanol added to the soap and salt mixture?

5. Describe the appearance of your final product?

6. How might the DNA of a strawberry and the DNA of a human be the same?

7. How might the DNA of a strawberry and the DNA of a human be different?

Teacher Notes:

1. Thaw strawberries before class.

2. Set up the extraction buffer in small bottles at each lab station with a 10.0 ml pipette or a 10.0 ml graduated cylinder.

3. Set the alcohol in an ice bucket with ice to be ice cold. (70% isopropyl from the drug store will work)

4. If there are enough funds and space, each student can do this experiment.

5. You could also set up half of the stations for students to extract their own DNA – that way you can make the connection with the students that all organisms have DNA.

Alternative: Teachers could have a different extraction activity at each lab station. For example, teachers can have half the class extract their own DNA from cheek cells and the other half extract DNA from a plant.

Alternate DNA Extraction ActivitiesCollect Your Own DNA or DNA in My Food - Banana

Collect Your Own DNA! (Alternate Lab)Materials:

Small cup 6% salt solution (1 T salt to 8 oz.)Test tube 10% soap solution (1 part soap to 9 parts water)

Alcohol

Procedure:1. Pour 15 mL of salt water solution into the cup. 2. Put the solution into your mouth and swirl it around your mouth for 30 seconds. REMEMBER: MORE VIGOROUS SWIRLING COLLECTS MORE CHEEK CELLS!

3. Spit the water back into the cup.

4. Pour enough of the swirled salt water into the test tube to fill it up half way.

5. Add 2 mL of soap solution and mix by swirling gently 3-4 times.

6. Add about 2 mL of ethanol. Pour it gently in along the side of the test tube so it forms a layer on top of the salt water/soap solution.


7. Wait one minute.

8. Hold the test tube up to the light and look for the cloudy, stringy substance forming at the bottom of the alcohol layer. You may see a cloud of bubbles. As the bubbles rise to the surface, you will begin to see white “strings” being drawn up along with the bubbles. These “strings” are clumps containing thousands of DNA molecules.

9. Take a glass rod and put it all the way into the test tube and turn it in one direction. DO NOT STIR! The DNA will wrap around the rod.

How it works:Cells contain water, proteins and nucleic acids (DNA and RNA) within a membrane made of lipids (fat). When you add soap, it breaks the membranes open and the contents of the cell spill out. The salt changes the ionic concentration of the water and makes it easier for the DNA and RNA to separate. DNA will not dissolve in alcohol, so when you add it to the solution, the DNA collects where the two layers meet.

DNA IN MY FOOD!!!!! (Alternate Lab)Introduction: DNA is present in the cells of all living organisms. The process of extracting DNA from a cell is the first step for many laboratory procedures in biotechnology. Objective: To isolate DNA from bananasMaterials:• Two 5 oz. Plastic cups• blender• plastic spoon• #2 Cone coffee filters• distilled water• clear-colored shampoo• 3 bananas• table salt, either iodized or non-iodized• One plastic transfer pipette or medicine dropper• one sealed tube containing 95% ethanol (fill about 1/2 of the tube with alcohol), kept on ice (the colder the better the results)Methods:1. To a blender add two bananas with one cup (250 ml) of distilled water. Blend for 15 to 20 seconds, until the solution is a slurry. (the teacher will prepare the solution for you)2. In one of the 5 oz. plastic cups make a solution of 1 teaspoon of shampoo and two pinches of table salt. Add 20 ml (4 teaspoons) of distilled water. Dissolve the salt and shampoo by stirring slowly with the plastic spoon to avoid foaming.3. To the solution from step two add two heaping teaspoons of the banana slurry from step 1. Mix the solution for 5-10 minutes.4. Place #2 coffee filter inside the second 5 oz. plastic cup. Fold the coffee filter’s edge around the cup so that the filter does not touch the bottom of the cup.


5. Now filter the mixture from step three by pouring it into the filter and let the solution drain for several minutes until there is approximately 5 ml (covers the bottom of the cup) of the filtrate to test.6. Obtain a test tube filled 1/2 full of the cold alcohol.7. Fill the plastic pipette or medicine dropper with solution from step five and add it to the alcohol.8. Let the solution sit for 2 to 3 minutes without disturbing it. It is important not to shake the tube, you can watch the white DNA precipitate out into the alcohol layer. There will be enough DNA to spool on to a glass rod after good results are obtained. DNA has the appearance of white, stringy mucus.

How does this experiment work?The solution of banana treated with salt, distilled water, and shampoo is specifically prepared. The shampoo, a detergent, breaks down the cell membrane by dissolving lipids and proteins of the cell. This disrupts the bonds that hold the cell membrane together. The detergent then causes these lipids and proteins to precipitate out of solution. Therefore, the DNA is able to pass through the filter. The salt brings the DNA strands together and since DNA does not dissolve in ice-cold ethanol it separates out of solution.

Name_____________________________ Date _____________ Per _______Questions:

1. What does DNA stand for?

2. Describe the shape of DNA on a molecular level.

3. Name the three parts of a nucleotide.

4. Who discovered the structure of DNA?

5. What type of bond holds the nitrogen bases together in the DNA molecule?

6. Why are the number of adenine and thymine always the same in a DNA molecule?

7. Provide the complementary strand for the DNA below:A-T-A-C-G-T-C-G-A-C

How did each of the following materials contribute to the extraction of the banana DNA?

8. Shampoo


9. Coffee Filter

10. Salt

11. Distilled Water

12. Blender

13. Alcohol

14. Why is it important to use cold alcohol and not warm?

After Activity: Teacher should reinforce the concept that all living things have DNA and the basic steps for extraction can be used with a great variety of materials.

DNA Model Building

EXPLORE:In this activity (DNA Model Building), students will build a model of DNA.

Guiding Question: What is the basic structure of DNA? What parts are the same and what parts are variable?

Before Activity: Teacher explains to students the basic structure of DNA so that they can build their models.

Activity Time: 60 minutes for the paper activity or students could build the model as an “out of class activity”. The paper model could be done in class and it would take about 60 minutes.

Preparation Time: If teachers do the paper model, it would take a little time for them to copy the templates.

Safety:Teachers should review student plans and be alert to any safety issues.

Notes: Templates for paper model available at:http://www.csiro.au/files/files/pa5y.pdf

There are several versions of DNA building activities. Some teachers may have students each build their own models; others may prefer an in class activity. This site includes a DNA project assignment and a link to templates for building a paper model.


http://www.csiro.au/files/files/pa5y.pdf

DNA Model Building

Objective: to create a DNA model that is composed of at least 12 base pairs, the appropriate sugars and phosphates and illustrates the double helix by showing the hydrogen bonds and the helical spiral.

In your plan you need to consider the following:A. You need to clearly show the different subunits: deoxyribose, phosphate, and the four nitrogen bases (adenine, thymine, cytosine, and guanine)B. You need to show the double helix twist.C. You need to show the hydrogen bonds between the nitrogenous

bases.D. Your model needs to be supported in some way.E. You need to correctly connect the various subunits and identify the

hydrogen bonding between the bases.F. Make sure that your model is sturdy. DO NOT build it out of food or

other degradable materials.

After Activity: Teacher should use the models to reinforce the structure of DNA and then point out that the code is carried in the nucleotides (nitrogen bases). Teacher should also explain to students that DNA needs to replicate during cell reproduction and that the code is also used for producing proteins in the cell. This is a good time for the teacher to remind students that proteins are extremely important molecules that form structures within the cells and also serve as enzymes for all the chemical reactions in a living cell.

Alternative: There is a DNA origami activity on the DNAi website. http://www.dnai.org

Cracking the DNA Code

EXPLAIN:This web quest (Cracking the DNA Code) will help students understand the historical development of the knowledge of DNA structure. It will also allow them to review the structure of DNA on an interactive site. Before Activity: The teacher will explain that this activity is helping students understand the scientific research and problem solving that went into the discovery of the structure of DNA.


http://www.dnai.org/

Guiding Question: What were the major discoveries that led to understanding the structure of DNA?


Preparation: Teacher will have to arrange for a computer lab or a classroom computer with a projection device. The teacher will also have to copy the handout.

Cracking the DNA CodeUse the following website, http://www.dnai.org , to complete this activity about the research that lead to

the discovery of DNA’s structure.

Click on “Code” from the menu on the website first page, then click on “Finding the Structure”.

Part 1: Using the “Problem” Section, answer the following questions.1. How did Miescher’s contribute to our knowledge of DNA?2. Which tool of science assisted Miescher in his discovery? How was the tool

useful?3. After Miescher, other scientists determined the “nuclein” contained lots of …4. Eventually DNA was determined to be a long chain that contained …5. Which molecule, DNA or protein, carries the information of hereditary? Who and

how was this determined?

Part 2: Using the “Players” and “Pieces of the Puzzle” Sections, provide a short summary of the contribution of each of the following scientists to the structure of DNA.

1. Erwin Chargaff2. Rosalind Franklin3. Linus Pauling4. James Watson and Francis Crick5. Maurice Wilkins

Part 3: Using the putting it together section, click on the base pairing interactive section and follow the instruction on the screen to determine the structure of DNA. Provide a diagram of DNA, which shows the general shape of the DNA molecule with the nitrogen bases (A, T, C and G), sugar and phosphate in the correct location. How can the 3D structure of DNA be described?

** Please note that fifteen activities have been created by the sponsors of DNA interactive to be used with the website. The following link connects to the teacher guide, http://www.dnai.org/teacherguide/guide.html . **


http://www.dnai.org/teacherguide/guide.html

http://www.dnai.org/

After Activity: The teacher should allow students to ask questions and discuss the structure of DNA and the various participants who lead to that discovery. The teacher might also want to point out that the work of many people went into the discovery.

DNA Web QuestELABORATE: This investigation (DNA Web Quest) is designed to help students learn how DNA replicates and how DNA serves as the template for protein synthesis.

Guiding Question: What are the major functions of DNA and how do they work?

Before Activity: Explain to students that they will be learning about the functioning of the DNA molecule.


Preparation: Teacher will have to arrange for a computer lab or a classroom computer with a projection device. You must have Shockwave for Director installed. Try the activity on the computers you will be using in advance and consult with a Technology specialist if you have difficulty getting it to run. The teacher will also have to copy the handout.

DNA WebQuestNAME___________________________ Date ___________ Per ____Topic: Replication and Protein SynthesisA. Go to: http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html

Click: “DNA replication” (upper left) and then click “unzip” Read the script, answer the questions below, and then, click “OK”.

1. In a real cell, what does the DNA molecule do before it unzips?

2. What molecules break the rungs (bases) apart?

Drag the correct bases over to “synthesize” the new DNA halves.Read script, answer questions, and then click “OK”.

3. How many base pairs are in the real human genome?

Click “protein synthesis” (upper right). Click “upzip”.

4. How much of the DNA molecule actually unzips in a real cell?

Base pair the nucleotides for just one half of the DNA. Read the script, answer the questions, and click “OK”.

5. About how many bases would a real mRNA molecule have?

6. Where does the mRNA go now?


http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html

Match the tRNA molecules to their base pair nucleotides on the mRNA. Answer the questions.

7. Which molecule has the codons?

8. Which molecule has the anticodons? 9. What molecules are attached to the tRNAs?

Click “OK” and continue matching the tRNAs. Read the script, answer questions, and click “OK”.

10. Where does the first tRNA go?

Continue matching and answer questions.

11. How long will a real polypeptide chain get to be?

12. When does translation of the mRNA end?

Topic: Protein SynthesisB. Go to: http://learn.genetics.utah.edu/units/basics/transcribe/Click the button that says “click here to begin”Use the keyboard to type the bases that would form the mRNA.Follow the instructions to determine the order of the amino acids.

13. List the order of your amino acids.

14. How did the process know to end?

Read the script on the right side of the webpage.

15. Describe the process of transcription.

16. Describe the process of translation.

C. Go to: http://www.wisc-online.com/objects/index_tj.asp?objid=AP1302Read the animation page by page – just click the “next” button when you are ready to move on.

17. How does the mRNA leave the nucleus?

18. Is just one mRNA molecule made? Explain.

19. How many amino acids does each codon code for?

20. Describe the structure of a tRNA molecule.

21. Where does the energy to form the peptide bond between two amino acids come from?


http://www.wisc-online.com/objects/index_tj.asp?objid=AP1302

http://learn.genetics.utah.edu/units/basics/transcribe/

22. Can a single mRNA be read more than once? Explain.

Topic: MutationsD. Go to: http://www.understandingevolution.com/evolibrary/article/0_0_0/mutations_03Read the information and fill out the table below:

Type of mutation Description Effect on resulting proteinSubstitution

Insertion

Deletion

Frameshift

Topic: ReplicationE. Go to: http://nobelprize.org/educational_games/medicine/dna_double_helix/Click on “Play DNA Game”; Click “next” and reading each page, continue to click next until you come to the game.; Click on organism #1 and match the base pairs as fast as you can! It is hard. Click Next and then click on each organism until you identify the one that belongs to chromosome #1; continue playing the game with the other two chromosomes, filling in the chart below.Be careful, other teams may get different results.

Chromosome # How many chromosomes?

How many base pairs?

How many genes?

What is the organism?

123

After Activity: The teacher should reinforce the functions of DNA with the students.

EVALUATE: Students should answer the following questions. This can be done as an in-class assignment or for homework.

1) How does the process of DNA replication allow for daughter cells to have an exact copy of parental DNA?

2) Explain how the process of DNA replication is semi-conservative.3) Where, specifically in the cell, does DNA replication occur? Why is this

location important?4) Explain the importance of relatively weak hydrogen bonds between

nucleotides.5) The sequence of bases on one strand of DNA is:

GGCACTTCATGC. What would be the sequence of bases on the complementary strand?

6) Draw and label 3 DNA complementary pairs. Circle and label a nucleotide.


http://nobelprize.org/educational_games/medicine/dna_double_helix/

http://www.understandingevolution.com/evolibrary/article/0_0_0/mutations_03

7) Explain how mitosis is part of asexual reproduction and meiosis is part of sexual reproduction.

8) Complete the following chart regarding the similarities and differences in mitosis and meiosis:

Mitosis MeiosisReplication & separation of DNA

Cellular material

Changes in chromosome number

Number of cell divisions

Number of cells produced in complete cycle

Alien Encounters!

ENGAGE:This activity (Alien Encounters!) connects the knowledge of how proteins are made with actual traits in an organism. Each student will transcribe and translate bits of DNA to determine the traits of their alien. They will then draw their alien.

Guiding Question: What is the relationship between DNA, mRNA, proteins, and actual traits?

Before Activity: The teacher will go over the instructions to make sure students understand the process.


Language Objectives: Students will: follow along as their teacher reads a passage, or students may read the passage aloud. select key terms and concepts from a passage. orally summarize the passage, including key information. answer conclusion questions in complete sentences.

Activity Time: 45 minutes but students may want to finish their alien drawings at home.

Preparation Time: The preparation mainly involves copying the materials. Each student will receive a different alien to work with. There are 30 different aliens. The teacher also should provide markers, crayons, or colored pencils and blank paper for drawing the aliens.LEP Caution-work through 1 or 2 examples, step-by-step with students.

Background: In the year 2050, an incredible archeological discovery was made in the middle of a remote area of South America. It was an area where a large meteor had struck the Earth. A pile of alien bones was found completely mixed up together. The explorers who made the discovery immediately informed the organization known as Scientific Phenomena Over Our Fabulous Sphere (S. P. O. O. F. S). S. P. O. O. F. S. sent out its best scientists to collect DNA samples. (Yes, these aliens really did have DNA!) The scientists were able to recover small fragments of DNA which they brought back to their labs. After much work, they determined that the DNA fragments represented 9 genes.

EXPLORE:Purpose: In this activity, you will determine the traits of these unfortunate recovered aliens by analyzing their DNA and determining the amino acid sequences of the resulting small protein fragments. Each fragment is associated with a particular gene and a specific alien characteristic (trait).Procedure:1. Put the DNA sequence for each gene in the proper location on your data sheet.2. Transcribe the DNA for each gene into mRNA. Record these sequences.3. Translate the mRNA into amino acids using the provided mRNA Codon Chart. Record the amino acid sequence for each gene.4. Use the “Alien Genes” chart to determine the traits that are associated with each of your amino acids sequences and write those traits on the charts.

EXPLAIN:

Using a blank piece of paper, sketch and color your alien, making sure to include all relevant (known) traits. Be sure to include your alien’s genus and species at the top of your drawing and data sheet. Place your name on your drawing. (NOTE: The genus name must be capitalized and the species name always starts with a lower case letter.)

ELABORATE:If you wish, add other unknown traits and explain why you chose to include them.


EVALUATE:Answer the following questions on the back of your alien picture:

Questions:A. Did you find any “identical” aliens in your group?B. Give the tRNA sequences for Gene D.C. How does a single change in a nitrogen base alter the formation of a resulting protein? D. If you knew a particular amino acid sequence, could you figure out the DNA for that sequence? Why or why not?E. What is the difference between transcription and translation?F. What are the roles of the DNA, the mRNA, the rRNA, and tRNA in protein synthesis?


mRNA CODON CHART

DATA Tables for Alien Gene Analysis: NAME__________________________

Alien Number _______ Alien Genus and species_________________________Biology- Unit 1 DRAFT 98

Is your alien hairless or hairy? Is your alien fat or skinny? GENE

A GENE

B

DNA DNAmRNA mRNAAmino Acids

Amino Acids

Trait Trait

Does your alien have 4 legs or 8 legs? What size nose does your alien have? GENE

C GENE

D


Amino Acids

Trait Trait

Does your alien have antennae or not? What color skin does your alien have? GENE

E GENE

F


Amino Acids

Trait Trait

How many fingers does your alien have? Does your alien have a tail? GENE

G GENE

H


Amino Acids

Trait Trait

Does your alien have 4 eyes or 8 eyes? GENE

I

DNAmRNAAmino AcidsTraitBiology- Unit 1 DRAFT 99

ALIEN GENES

This table shows the amino acid sequences for the various alien genes and traits.

Gene Letter

Amino Acid Sequence Resulting Characteristic

A Val-pro-ileu HairlessTryp-pro-ileu Hairy

B Tryp-val-val fat Ileu-ileu-ser skinny

C Ser-ala 4 legsSer-ser 8 legs

D Pro-ser-phe-gly Long noseGln-ser-phe-gly Short nose

E Lys-phe No antennaeLys-leu 4 antennae

F Pro-ala-ala Blue skinPro-ala-asp Red skinPro-ala-val Yellow skinPro-ala-pro Green skin

G Gln-gln-asp 10 fingersGln-gln-lys 12 fingers

H Gly-gly-ileu tailala-gly-ileu No tail

I Ileu-asp-ala 4 eyesSer-asp-ala 8 eyes

Note to Teacher: This table shows the traits for each of the 30 alien species.

Trait 1 2 3 4 5 6 7 8 9 10

11

12

13

14

15


Hairless

x x x x x x x x

Hairy x x x x x x xFat x x x x x x x xSkinny x x x x x x x4 legs x x x x x x8 legs x x x x x x x x xLg nose

x x x x x x x x

St nose x x x x x x xNo ant x x x x x x xAnt x x x x x x x xBlue x x x xGreen x x x xRed x x x xYellow x x x10 fing x x x x x x x x12 fing x x x x x x xTail x x x x x x x xNo tail x x x x x x x4 eyes x x x x x x x8 eyes x x x x x x x x


To the teacher: This table shows the traits of each of the 30 alien species.

Trait 16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Hairless

x x x x x x x

Hairy x x x x x x x xFat x x x x x x x xSkinny x x x x x x x4 legs x x x x x x x x x8 legs x x x x x xLg nose

x x x x x x x

St nose x x x x x x x xNo ant x x x x x x x x x xAnt x x x x xBlue x x xGreen x x x xRed x x x xYellow x x x x10 fing x x x x x x x x12 fing x x x x x x xTail x x x x x x xNo tail x x x x x x x x4 eyes x x x x x x x x8 eyes x x x x x x x


Recovered Sequences = Alien Species #1

GENE A: C A A G G A T A T

GENE B: A C C C A A C A A

GENE C: A G C A G G

GENE D: G T C A G G A A A C C C

GENE E: T T T A A A

GENE F: G G A C G C C G A

GENE G: G T C G T C C T A

GENE H: C G C C C C T A T

GENE I: T A T C T A C G C


GENE A: A C C G G T T A T



GENE C: A G C A G G

GENE D: G G T A G G A A A C C C

GENE E: T T T A A A

GENE F: G G A C G C G G G

GENE G: G T C G T C T T T


GENE I: A G C C T A C G C



GENE B: T A T T A T A G C

GENE C: A G C A G G


GENE E: T T T A A C


GENE F: G G A C G C C T A


GENE H: C C C C C C T A T





GENE C: A G C C G A


GENE E: T T T A A C

GENE F: G G A C G C C A A








GENE C: A G C C G A


GENE E: T T T A A C









GENE C: A G C A G G


GENE E: T T T A A A









GENE C: A G C A G G


GENE E: T T T A A A








GENE C: A G C A G G



GENE E: T T T A A A








GENE C: A G C C G A


GENE E: T T T A A A









GENE C: A G C C G A


GENE E: T T T A A C









GENE C: A G C A G G


GENE E: T T T A A C









GENE C: A G C A G G


GENE E: T T T A A C








GENE C: A G C A G G



GENE E: T T T A A A








GENE C: A G C C G A


GENE E: T T T A A A


GENE G: G T C G T C T T TBiology- Unit 1 DRAFT 208






GENE C: A G C C G A


GENE E: T T T A A A









GENE C: A G C A G G


GENE E: T T T A A C









GENE C: A G C A G G


GENE E: T T T A A A








GENE C: A G C A G G



GENE E: T T T A A A








GENE C: A G C C G A


GENE E: T T T A A A









GENE C: A G C C G A


GENE E: T T T A A C









GENE C: A G C C G A


GENE E: T T T A A A









GENE C: A G C A G G


GENE E: T T T A A A









GENE C: A G C A G G


GENE E: T T T A A C









GENE C: A G C A G G


GENE E: T T T A A C








GENE C: A G C C G A



GENE E: T T T A A A








GENE C: A G C C G A


GENE E: T T T A A A









GENE C: A G C C G A


GENE E: T T T A A C






Key Vocabulary:genes transcribe ribosomesDNA translate sequenceamino acids mRNAproteins codons

Language Objectives:Students will follow along as their teacher reads a passage.Students will select key terms and concepts from a passage.Students will orally summarize the passage, including key information.Students will answer conclusion questions in complete sentences.

Alien Encounters!- LEPRead the following story aloud with your teacher. Listen carefully. After you have read it together, underline the most important information. Work with your partner to summarize or explain in your own words what the story is about.

Background: In the year 2050, an incredible archeological discovery was made in the middle of a

remote area of South America. It was an area where a large meteor had struck the Earth. A pile of alien bones were found completely mixed up together. The explorers who made the discovery immediately informed the organization known as Scientific Phenomena Over Our Fabulous Sphere (S. P. O. O. F. S). S. P. O. O. F. S. sent out their best scientists to collect DNA samples. (Yes, these aliens really did have DNA!) The scientists were able to recover small fragments of DNA which they brought back to their labs. After much work, they determined that the DNA fragments represented 9 genes.

Purpose: In this activity, you will determine the traits of the aliens by analyzing their DNA and determining the amino acid sequences of the resulting protein fragments. Each fragment is associated with a gene and a specific alien characteristic (trait).

Procedure:1. Put the DNA sequence for each gene in the proper location on your data sheet.


2. Transcribe the DNA for each gene into mRNA. Record those sequences.3. Translate the mRNA into amino acids using the provided mRNA Codon Chart. Record the amino acid sequence for each gene.4. Use the “Alien Genes” chart to determine the traits that are associated with each of your amino acids sequences and write those traits on the charts.5. Using a blank piece of paper, sketch and color your alien, making sure to include all relevant (known) traits. (You can add other unknown traits, if you wish.) Place your names on your drawing.

Questions:Write your answers in COMPLETE SENTENCES on the back of your alien picture.

1. Did you find any “identical” aliens in your group?2. What is the difference between transcription and translation?3. What are the roles of the DNA, the mRNA, and tRNA in protein synthesis? 4. Which organelle is responsible for protein synthesis?

Note: The rest of this is identical to the non – LEP version of the Alien Encounters activity.


After Activity: The teacher should reinforce the concept that DNA is transcribed into mRNA and then translated into proteins. These proteins then determine traits.

What are the Effects of Various Mutations on Protein Synthesis?

ELABORATE:The Mutation Activity reinforces students’ understanding of protein synthesis while allowing them to see how a change in a DNA nucleotide might mean a change in the amino acid sequence of a protein.

Before Activity: Hypothesize with students what might happen if one of the nucleotides in a strand of DNA was changed. Help students understand that this would mean a change in mRNA and might mean that a different amino acid would be inserted into the chain and that could affect the folding of the protein and ultimately the function of the protein. Remind students that proteins often function as enzymes catalyzing important reactions. Enzymes function according to their shape. If the shape changes, then the enzyme cannot function appropriately that produces a genetic disorder.


Preparation: Teachers need to copy the mRNA strips and the student hand-out. Each student should receive four copies of the same mRNA strip. The teacher can make four copies of a complete page. Then staple the pages together – one staple per strip number. Then cut the strips out, cutting through all four pages. The result is four identical strips stapled together- several units per page.

What are the Effects of Various Mutations on Protein Synthesis?

Competency Goal 3: The learner will develop an understanding of the continuity of life and the changes of organisms over time.

3.01 Analyze the molecular basis of heredity including: DNA replication. Protein synthesis (transcription, translation). Gene regulation.

INTRODUCTION TO THE TEACHER:

This exercise provides a simple way of teaching about the molecular basis of heredity and genetic coding. It also challenges the students to analyze the effects of various types of mutations on the resulting protein (polypeptide).


The central question of the exercise is how the genetic code is translated into proteins as part of the Central Dogma of Biology (DNAmRNAProteinsTraits) and what effect changes in the code (mutations) have on the protein sequence (leading to possible changes in the trait).

This activity provides the teacher with much latitude in teaching transcription, translation, and mutation. Some teachers may only want to use the randomly generated mRNA strands to teach the concept of transcription, translation and the use of an mRNA “dictionary.” However, the activity is designed as an exploration of the effects of mutations on amino acid sequences.

Teachers may also choose to have students determine the DNA sequence (both strands of the double helix) and teach DNA replication. Teachers may design a “template” upon which students tape their individual strands to form an even larger protein.

The mutation terms and definitions are purposely not given initially to the students while they explore the actual effects of manipulating their strands of mRNA. Teachers may give students the terms after the activity. However, there is no need for the students to actually learn the names for the different types of mutations. The main issue is that they understand how various types of mutations affect the resulting polypeptide and possibly the related trait.

In step 1, each student is given a randomly generated mRNA sequence. The student translates the sequence into the correct sequence of amino acids to form a polypeptide. Each sequence begins with and initiation codon (AUG) and ends with one of the three termination codons (UAA, UAG, or UGA).

In steps 2-4, each student changes the mRNA sequence in ways that simulate some of the types of mutations. The student is challenged to determine the mutations that have the most devastating effect on the resulting polypeptide and then to think about the implications for the expression of the trait.


Point mutations:

Step 2 has the students do a transition mutation by changing every cytosine that is the last/third base in a codon to a uracil. A transition mutation is a purine to purine or pyrimidine to pyrimidine shift.

Step 3 has the students do a transversion mutation by changing every cytosine that is the last/third base in a codon to an adenine. A transversion mutation is a purine to pyrimidine or pyrimidine to purine shift.

Frameshift mutation (insertions and/or deletions):

Step 4 has the students add one extra base (adenine) after the initiation codon.

Teachers may introduce the difference between missense mutations and nonsense mutations. Missense mutations occur when the amino acid sequence may still make sense after a mutation but not necessarily the right sense. Nonsense mutations occur when a transversion results in a premature termination codon that truncates the protein and renders it nonfunctional.

Students should discover the degeneracy (redundancy) of the genetic code. (Some mutations do NOT result in a change in the amino acid sequence since there are multiple codes for some amino acids.

Activity designed by Gordon Plumblee, Western Alamance High School, Elon College, NC Adapted by Judy Jones, East Chapel Hill High School, Chapel Hill, NC


Student Activity: What are the Effects of Various Mutations on Protein Synthesis?

INTRODUCTION: In this activity you will be translating strands of mRNA into small sequences of amino acids. You will also be experimenting with various types of mutations and trying to determine which mutations cause the greatest change in the polypeptide sequence.

STEP 1: Take your strand of mRNA and using a standard “dictionary” of mRNA codons, translate your mRNA into the correct sequence of amino acids.

Questions: 1. What did you discover about first codon in your sequence?

2. Check with some of the students near you. What is the first codon in their sequence?

3. What would you hypothesize about all strands of mRNA that code for proteins?

4. What did you discover about the last codon in your sequence?

5. Check with some of the students near you. What is their last codon and what does it do?

6. What would you hypothesize about the last codon for all strands of mRNA that code for proteins?

STEP 2: Take another copy of your strand of mRNA and change every C that is the third base in a codon to a U. Now translate the new mRNA into a polypeptide sequence.

Example: AUG/ACU/GUC/CAG/UCA/UCC/ACU (The underlined C’s would be changed to U’s.)

7. What did you discover about your new polypeptide strand (compared to the original)?

Collect some class data:

Number of strands with premature STOP codon ________

Number of strands with no new amino acids ________


Number of strands with 1 new amino acid ________

Number of strands with 2 new amino acids ________


Number of strands with 4 or more new amino acids ________

8. How do you explain that some students had strands with no new amino acids?

STEP 3: Take another copy of your strand of mRNA and change every C that is the third base in a codon to an A. Now translate the new mRNA into a polypeptide sequence.

Example: AUG/UCC/CUU/AUC/ACU/GUC (The underlined C’s would be changed to A’s.)

9. What did you discover about your new polypeptide (compared to the original AND to the polypeptide from step 2)?








10. How is the class data from Step 3 different from the class data from Step 2?

11. Which step seemed to result in the greatest number of changes in the polypeptide?

12. How do you explain the reason for your answer to question 11?


STEP 4: Take another copy of your mRNA strand. This time add one extra base (A) immediately after the START codon in your mRNA sequence. Translate this into a new amino acid sequence (polypeptide).

13. How does this polypeptide differ from the original and the ones you created in steps 2 and 3?








13. What did you discover about the type of mutation where a single base is inserted into the mRNA sequence.

14. What would have happened to the polypeptide if you had deleted a single base instead of inserting a base at the same location in the mRNA sequence?

15. What would have been the results if the insertion or deletion of a base had happened near the end of the mRNA sequence?

GENERAL QUESTIONS:16. What effect would these various mutations have on the trait that is

controlled by the protein that is produced from the mRNA?

17. Summarize what you have learned about mutations and their effect on the resulting polypeptide.


1. AUGCUCUCUGGAUACCGCAAGCGAAACGGCAAUGGGGUAUUGGCACAGGACAAAGCUUUGUAUGGUUAA

2. AUGUUUGCUCCGUUUUACCCUUAUUCGAACACAGACUCCGAGUUGACAGGGGGCUACAAAGAAUAUUAG

3. AUGCCUCCGUUUAAGUAUCUAAUCCGGUUGAUACCAGACUACGAGAAGUUAGCUAUAUCUACAGCGUAG

4. AUGUCGACCCAAUGUCUGUGUAUUACGCAGUCUAUCCAAAACAUUACUCAUGUAGAUUCUCUGCGGUGA

5. AUGCUGUGGGGGCCGAUGCGGCAGUGGGAAGACUACGUGGGGCCACUGGGGUACGAAUUGAUAACUUAA

6. AUGAGCACUCCAUCACACUACGUUAGGGGGAGCAGGAGCCUUCGGUAUGUGAUGGCCGCGAAGGGAUAA

7. AUGGCACAGGAGAGCCAGCAGACGUUCCCCGUGACUGCCCUCCUAAGUACCCUCGCCGAGACGGAUUAG

8. AUGCUGUACCCAGACAAAGAAUUCUUUUACGACAGAGCAGGACAGGGCAGACAGGCAUGGUUAGAUUAG

9. AUGGAUGUUAUUCGUUACCCGAGUGAGACCAAUAGCCAGCAAAACUCUACUUUUAUGGAUUGGAACUGA


10. AUGACGUGUACGUACUCGUACAUCCGCCCACGUCGAAACAGAAGUAGCAGUCUGACGGGCGUACAAUAA

11. AUGGUGUCCGCGUCACCUGUGGAUCGGACUCAUGAGUGGAUGGGUACCCAACAACACUGGCUCACGUAG

12. AUGGCUAGGCGGACGGCGCUUACAGUGCCUGUCCAUUACAAUGUGACGUAUGUAGAACCCGUCAUUUAA

13. AUGGGGGUGGACCUCAAGAAUUCUCGCAUCACUCAUGAUGGGGCGGCCCUAAAAACGGGAGACAUUUGA

14. AUGCCAUGUCCCCAGACGCUCGCCUUUUCGUUACUUAUGGUGUACUUACAUCAUUCCAUCUCACUCUAG

15. AUGCACCGCAAAUACUACGCACGAGAUGCAAUGCGCAAAUCUUUGAUCUCUACCGCUAUCUCUGGGUAG

16. AUGUCCCGGUUACGUGGCAACGCGAACCCUCCGAACUCUUAUGCAGUGGAGCCUAGUUCAGCUGUCUAA

17. AUGGUAGGUCGCAUAGGGGACUUCAAAUAUGCCGGAGAUUCGUUACUGCUGCACCGCGCCAUUGCUUGA


18. AUGUCACGCAUUACCAAAGCCGUCCAGUCCAAGCGAGACAUCAUACGGAUGCUUGCGCCAUAUCUUUAA

19. AUGGAUAGCAUGCUGACCUUACAGCUGGAUACAUCGAACGCACGGAUUUCUGCGACUCACUUAUUCUAG

20. AUGCGACUUUACACCAAUGGCUUAAUGCCUGCGUAUAGUUGUAUUGCUGUUGAGUAUCGCAAAACAUAA

21. AUGUUCGCAUUCUGUGCCAACGAUGCAAUACCCUUAAGAGGCCACGGCUACUCGCCUCUGGUCGGAUGA

22. AUGUCGAGGACCUUCCCUGUCACCUCAAAGAGUUACCCCCUCGAAGUCGUGUCGAUCGUGAAUCGCUAG

23. AUGGGUGGAUCGUCCAACAAUAGGACGAAAAACUUGCUCUUUCCCAAUGCUUACACUCGGGGUGCGUAA

24. AUGGAGGCGUUCCGGAAACACGCAACUAUGCCAUUAGUCUGCGAUCCGGGUCCCAACAAUAGGAGUUGA

25. AUGGGUAAUAACUUAUUGCAACAUCCCGUGUUGACUCUAAGGAGUCGUUUGGCUUAUUCACUGCUCUAA

26. AUGGGCUUAACAGGAGACUUUCAGCGCAGCUCAGGCGUCCCGUACAGGCGUCCCCCUAAUAAAGCAUGA


27. AUGGCGGGACGCAGUUUCAAAUUUAGGGCGAACCAGACGAGAAUUCGCACAGGCCGUUCACUGAUGUGA

28. AUGGAACUGCGUGGGAUAGUCGCGGGGCACUUAGCCCACGUUCAGUGUACAUCGCACAAAUAUUUAUAA

29. AUGUCCCGGCGGGCCCGAUGCAGGGCAUCGAAAGACACUAGACCGAAUUUCGAGUCAAGUGCUGCCUGA

30. AUGGAUUACAACUUUGAUACCCUGGUAUGGAUCGUACGGAGAUAUUUAGCUCUCUUAGAUCCGUUAUGA

31. AUGCUAGUGCCCAUCCCGUUUAUCAACGCCGACAUUCUCUGUGUAGCCCCUCUUCGUGGCAUGCCAUGA

32. AUGAACUUUAUCGACCAGGAUCAUUACACAGGCUCUGACAUAUUGCCAAGAGGCGUUAGAAUAUUAUGA

33. AUGUCUACCCACUUUUGGGAGAGAACUGGACCUGAGUUACAUCUUGAGGCGCACGACCUUGGUCGGUAA

34. AUGGGACAUUGUAAGGUAUUCUGUGACGGAAUCUGUGUCCUAGUCCAGGCUAUCUUACAGUCCCACUAG


35. AUGUGUCUCAAAAUCAAUACCAAGAGUAGAUGUAAGGCCGAGGCGAUGAAUAUCACGUCUAGGACCUUAUAA

36. AUGCCCACAGAGAUUUCGCACCGUAAGCGGGUGGUGAUCACUGAAGCUAUAAGGAGAUGGAGUUAUUAG

37. AUGGAGAUGGCAAAGGCUUACAGGAUACUUGAUACAUCCUUGGGAGCUACGCCGUCUGGUCACCCAUAA

38. AUGCAAUACCUUCAGCGCUCCAUUGAUAUUCAAACGCGCACCGCAGUACGGCAGAUAUCUCCCGUCUAG

39. AUGCAAUACCUUCAGCGCUCCAUUGAUAUUCAAACGCGCACCGCAGUACGGCAGAUAUCUCCCGUCUGA

40. AUGUCGAGUCCCAAUUGCGGUAGUCGCGGUACACUUCAAUCUGAUAGCUCGAUAAUCAUGCAUAGCUAA

After Activity: Once students have translated the sequences, collect class data. Discuss with students the types of mutations that cause an amino acid sequence to change. Reinforce the concepts that were discussed before the activity.

Cell Specialization and Control of Gene Expression Web Quest

ELABORATE:Before Activity: The websites on this handout help teach about cell specialization and gene regulation. Have students think about why one fertilized egg cell can become the great variety of cells found in human tissues. Also have them think about why only certain cells produce certain products – for example, why are the cells in the digestive system the only ones that produce digestive enzymes even though all cells have the same DNA which carries the information for making all cell products. Explain that students will be using two websites to explore these questions.



Preparation: Access to computer and projection device is needed. Again check the computers in advance to be sure they can run the animations the students will be directed to.

Cell Specialization and Control of Gene Expression Web Quest

Topic: Cell SpecializationA. Go to: http://learn.genetics.utah.edu/units/stemcells/Click on “What is a stem cell?” Follow the animation through to the end.

1. What is a stem cell?

2. What causes a stem cell to become different kinds of cells?

3. What is the relationship between signals, genes, cell types, and proteins?

4. List all of the different cells that are described and also give their functions.

Topic: Control of Gene ExpressionB. Go to: http://www-class.unl.edu/biochem/gp2/m_biology/animation/m_animations/gene2.swfClick the right hand arrow to move through the animation. Answer the following questions.

1. Where does protein synthesis begin?

2. What information do chromosomes contain?

3. How is this information encoded?

4. What is the function of mRNA?

5. What does the promoter do?

6. What are the three regions of a gene?

7. What does RNA polymerase do?

8. Describe the transcription process in terms of the three regions of the gene.

9. What would happen if there was a molecule that blocked the promoter?

10. What would happen if there was a molecule that unblocked the promoter?

11. Would there ever be an advantage to blocking a promoter?

12. Describe how cell that is not in the digestive system (for example, a brain cell) might avoid producing unnecessary digestive enzymes.


http://www-class.unl.edu/biochem/gp2/m_biology/animation/m_animations/gene2.swf

http://learn.genetics.utah.edu/units/stemcells/

After Activity: Summarize with students that signals cause genes to produce proteins that lead to differentiation and specialization. Summarize with students the idea that promoters can turn on genes but that genes can also be blocked by the very products that they are coding for.

SUMMATIVE EVALUATIONS

Summary Foldable


Preparation: Teachers will need to accumulate construction paper, markers and similar supplies.

Before Activity: Students will do a final foldable that includes all of the concepts from this unit. Teachers should focus on concepts and objectives from the state biology curriculum. Of particular importance would be the essential questions at the beginning of the unit and the guiding questions for each activity.

After Activity: Teachers might want to give a culminating test. Sample assessment items are provided below.

Unit 1 Wrap-Up---Guiding Questions Presentations

UNIT 1 WRAP-UP PRESENTATIONS---GUIDING QUESTIONS FROM UNIT 1

Assign a group of questions to each team of 2-3 students. Students should create a presentation that addresses the concepts in the questions. Presentation ideas include posters, diagrams, power points, paragraphs, skits, poems, raps, songs, etc.

Students must be prepared to share their work with the class.

QUESTION SET 1What are the nutrients that are found in various foods and how do we test for them? What is the structure and function of each of the essential nutrients?How do the macromolecules relate to each other?

QUESTION SET 2


Language Objectives: Students will: discuss topics with team members. create a presentation. orally present their work to the class.

What is the connection between nutrient molecules and energy?Where does energy fit into the concept map?

QUESTION SET 3Why do cells come in such a great variety?What happens to the image of an object when viewed through a microscope?What are some of the differences and similarities between plant and animal cells?

QUESTION SET 4What are some of the important structures that determine the functions of various cells?How do the organelles in a cell interact to produce optimal functioning of that cell?

QUESTION SET 5How do different organisms reproduce?What is the relationship between cell size and cell division?

QUESTION SET 6What are the primary stages in the cell cycle?How is mitosis more like a video rather than a slide show?What are the similarities and differences between mitosis and meiosis?

QUESTION SET 7Is DNA found in all species? What does it mean?What is the basic structure of DNA? What parts are the same and what parts are variable?What were the major discoveries that led to understanding the structure of DNA?

QUESTION SET 8What are the major functions of DNA and how do they work? What is the relationship between DNA, mRNA, proteins, and actual traits?

UNIT 1 WRAP-UP PRESENTATIONS---GUIDING QUESTIONS FROM UNIT 1- LEP

Assign a group of questions to each team of 2-3 students. Students should create a presentation that addresses the concepts in the questions. Presentation ideas include posters, diagrams, power points, paragraphs, skits, poems, raps, songs, etc.

Students must be prepared to share their work with the class.

QUESTION SET 1What are the nutrients that are found in various foods and how do we test for them?


What is the structure and function of each of the essential nutrients?How do the macromolecules relate to each other?

QUESTION SET 2What is the connection between nutrient molecules and energy?Where does energy fit into the concept map?

QUESTION SET 3Why do cells come in such a great variety?What happens to the image of an object when viewed through a microscope?What are some of the differences and similarities between plant and animal cells?

QUESTION SET 4What are some of the important structures that determine the functions of various cells?How do the organelles in a cell interact to produce optimal functioning of that cell?

QUESTION SET 5How do different organisms reproduce?What is the relationship between cell size and cell division?

QUESTION SET 6What are the primary stages in the cell cycle?How is mitosis more like a video rather than a slide show?What are the similarities and differences between mitosis and meiosis?

QUESTION SET 7Is DNA found in all species? What does it mean?What is the basic structure of DNA? What parts are the same and what parts are variable?What were the major discoveries that led to understanding the structure of DNA?

QUESTION SET 8What are the major functions of DNA and how do they work? What is the relationship between DNA, mRNA, proteins, and actual traits?


XII. Sample Assessment Questions

Goal 2.011. An unknown solution was tested for four nutrients. See Table 1 for the results. Which nutrient was not present?

a. glucoseb. proteinc. starchd. lipid

Nutrient Test ResultsIodine Blue/black colorBenedicts Orange colorBiuret’s No color changeBrown Paper Bag Spot mark left

2. Which nutrient would be most helpful for an athlete immediately before an event? a. carbohydrateb. lipidc. proteind. nucleic acids

Goal 2.021. Using a microscope, what happens to the viewed image of a specimen when you change from low to high power?

a….less of the specimen is seen but in greater detailb. more of the specimen is seen and in greater detailc. less of the specimen is seen and in less detaild. more of the specimen is seen but in less detail

2. If a disease results in the thickening of the plasma membrane, what function would be most directly affected?

a. intake of waterb. production of proteinsc. production of ATPd. storage of lipids


Questions for 3.02

1. List the correct order for the stages of mitosis shown in the diagram.

a. B, E, C, D, Ab. C, B, E, A, D c. A, B, C, D, E,d. D, C, B, A, E


2. Which of the processes below would produce cells with the greatest variety?

a. process on the left b. process on the right c. Neither would produce cells with variety d. Both would produce cells with variety

Questions for 3.01

1. Given the following DNA strand, what would the mRNA strand be? T A C G T T G C A

a. T A C G T T G C Ab. A U G C A A C G Uc. A T G C A A C G Td. U T G C U U C G T

2. Using the provided mRNA codon chart, give the correct amino acid sequence for the following mRNA strand:

A U G U A C G A G U A G


a. Methionine Tyrosine Glutamic acid Stop

b. Isoleucine Tyrosine Glutamic acid Cysteine

c. Tyrosine Methionine Leucine Phenylalanine

d. Glutamic acid Tyrosine Methionine Stop


i - nc science essential standards -...

Documents