Hoover High School

Mr.Plazak’s Biology

:Write an answer here

What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT

CGGUGCA

A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?

180

What type of molecule is codon is found in?

mRNA

A: B:Write an answer here Write an answer here

C: D:

Define Translation

The process by wich an mRNA molecule is

translated into a protien

A:

The genes in the chromosomes of living cells are made of what?

DNA

A: B:Write an answer here Write an answer here

The process of reading mRNA and turning it into a polypeptide chain is known as what?

Translation

Give the complimentary DNA sequence of the following DNA:

ATCGGTGAACGTAACCATTTAAA

TAGCCACTTGCATTGGTAAATTT

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

GUA

A: B:Write an answer here Write an answer here

Define Mutation?

Changes in the DNA sequence that affect genetic information

Inheritance of acquired

characteristics

Great Job!!!!Great Job!!!!

Thank you for playing!Thank you for playing!