Hoover High School
Mr.Plazak’s Biology
:Write an answer here
What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT
CGGUGCA
A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?
180
What type of molecule is codon is found in?
mRNA
A: B:Write an answer here Write an answer here
C: D:
Define Translation
The process by wich an mRNA molecule is
translated into a protien
A:
The genes in the chromosomes of living cells are made of what?
DNA
A: B:Write an answer here Write an answer here
The process of reading mRNA and turning it into a polypeptide chain is known as what?
Translation
Give the complimentary DNA sequence of the following DNA:
ATCGGTGAACGTAACCATTTAAA
TAGCCACTTGCATTGGTAAATTT
The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?
GUA
A: B:Write an answer here Write an answer here
Define Mutation?
Changes in the DNA sequence that affect genetic information
Inheritance of acquired
characteristics
Great Job!!!!Great Job!!!!
Thank you for playing!Thank you for playing!