hiseq 2000 user guide - rikenfantom.gsc.riken.jp/.../11/hiseq2000_userguide...d.pdf · hiseq 2000...

HiSeq 2000User Guide

GT

GAAAAAAACAAAAAAACCCAAAAAAA

GCCGGGGGT

ATGCATGCATGCATGCATCAT

GCATGCATGCA

G

TAG

CC

FOR RESEARCH USE ONLY

™

ILLUMINA PROPRIETARYCatalog # SY-940-1001Part # 15011190 Rev D

HiSeq 2000 User Guide iii

Notice

This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and

are intended solely for the contractual use of its customer in connection with the use of the

product(s) described herein and for no other purpose. This document and its contents shall not

be used or distributed for any other purpose and/or otherwise communicated, disclosed, or

reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does

not convey any license under its patent, trademark, copyright, or common-law rights nor similar

rights of any third parties by this document.

The instructions in this document must be strictly and explicitly followed by qualified and

properly trained personnel in order to ensure the proper and safe use of the product(s)

described herein. All of the contents of this document must be fully read and understood prior

to using such product(s).

FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS

CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS,

INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY.

ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE

PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) OR ANY USE

OF SUCH PRODUCT(S) OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR

PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER'S ACQUISITION

OF SUCH PRODUCT(S).

FOR RESEARCH USE ONLY

© 2010 Illumina, Inc. All rights reserved.

Illumina, illuminaDx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iSelect, CSPro, GenomeStudio, Genetic Energy, HiSeq, and HiScan are registered

trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the

property of their respective owners.

HiSeq 2000 User Guide v

Revision History

Part # Revision Date Description of Change

15011190 D May 2010 Corrected Sequencing Kit box 1 and box 2 contents.

Updated volumes in the preparation of Multiplexing Rd2 Seq Primer for use on HiSeq.

15011190 C April 2010 Corrected reagent thawing instructions for LFN and volumes listed in the multiplexing reagent preparation instructions.

15011190 B March 2010 Updated software descriptions and workflow to HCS v1.0.

Added instructions for changing reagents during a run, and stopping, pausing, and resuming a run.

Updated reagent preparation instructions and added instructions for allocating reagents for 101 cycles.

15011190 A February 2010 Initial release.

HiSeq 2000 User Guide vii

Table of Contents

Notice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iii

Revision History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v

Table of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii

List of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

Chapter 1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

Audience and Purpose. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

Technical Assistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

HiSeq Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

Sequencing Consumables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

HiSeq Sequencing Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

HiSeq Paired-End Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

Multiplexing Sequencing Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

Chapter 2 HiSeq Control Software . . . . . . . . . . . . . . . . . . . . . . 13

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

HiSeq Software Interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Pausing, Stopping, and Resuming a Run . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

Run Folders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Available Disk Space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

Chapter 3 Performing a Sequencing Run . . . . . . . . . . . . . . . . . 35

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

Sequencing Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

Starting the HiSeq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

Preparing Sequencing Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Allocating Reagents For Shorter Runs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Preparing Multiplexing Reagents. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

Setting Up the Sequencing Run. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

Loading Sequencing Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

Loading Multiplexing Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50

Loading a Used Flow Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

Priming Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

Loading a Clustered Flow Cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

viii Table of Contents

Catalog # SY-940-1001

Part # 15011190 Rev. D

Monitoring the Run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

Preparing ICR for Read 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

Preparing Paired-End Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71

Changing Reagents During a Run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73

Loading ICR for Read 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75

Loading Paired-End Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77

Chapter 4 Post-Run Procedures . . . . . . . . . . . . . . . . . . . . . . . . 81

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82

Unloading Reagents. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

Performing a Maintenance Wash . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84

Performing a Post-Run Instrument Wash . . . . . . . . . . . . . . . . . . . . . . . . . . . 89

Chapter 5 Real Time Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 93

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94

Monitoring Runtime Statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

Real Time Analysis Output Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101

Appendix A Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . 105

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106

Troubleshooting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106

Performing a Fluidics Check. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109

HiSeq 2000 User Guide ix

List of Tables

Table 1 Illumina General Contact Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

Table 2 Illumina Customer Support Telephone Numbers . . . . . . . . . . . . . . . . . . . . . 4

Table 3 Illumina Kits and Kit Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

Table 4 User-Supplied Consumables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Table 5 Run Folder Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Table 6 Allocating Reagents for Standard 101-Cycle Runs . . . . . . . . . . . . . . . . . . . 41

Table 7 Sequencing Reagent Positions (Rack A or B) . . . . . . . . . . . . . . . . . . . . . . . . 48

Table 8 Multiplexing Reagent Positions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50

Table 9 Paired-End Reagent Positions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78

Table 10 Wash Run Times. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84

Table 11 Expected Wash Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87

Table 12 Wash Run Times. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

Table 13 Expected Wash Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

Table 14 Troubleshooting Run Problems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106

x List of Tables


Part # 15011190 Rev. D

HiSeq 2000 User Guide 1

Chapter 1

Overview

Topics2 Introduction

3 Audience and Purpose

4 Technical Assistance

5 HiSeq Components

8 Sequencing Consumables

10 HiSeq Sequencing Reagents

11 HiSeq Paired-End Reagents

12 Multiplexing Sequencing Reagents

2 CHAPTER 1

Overview


Part # 15011190 Rev. D

Introduction

The Illumina HiSeq™ 2000 sequencing system combines innovative engineering with proven SBS technology to set new standards in output, simplicity, and cost-effectiveness.

The HiSeq 2000 includes the following features:

Dual Flow Cells—The HiSeq 2000 is a dual flow cell system. You can

sequence a single flow cell or two flow cells with different read lengths

simultaneously, and start and stop experiments independently.

Dual Surface Imaging—The HiSeq 2000 uses a four camera epi-

fluorescence system with cutting-edge scanning technology to enable

dual surface imaging.

High-Capacity Reagent Chiller—The HiSeq reagent compartment is a

high-capacity chiller that holds enough sequencing reagents for up to

209 cycles of sequencing on each flow cell.

Integrated Fluidics for Paired-End Runs—In addition to the sequencing

reagents, the HiSeq reagent compartment holds paired-end reagents for

each flow cell.

Dual Interface Control Options—The HiSeq software interface provides

dual controls, one for each flow cell, on a touch screen enabled monitor.

In addition, an integrated keyboard can be used for recording run

components and operating the instrument.

Real Time Analysis—The HiSeq software performs real time data

analysis on the instrument computer, which allows you to monitor

important quality metrics during the sequencing run and save valuable

downstream analysis time.

Figure 1 HiSeq 2000 Sequencing System

Audience and Purpose 3

HiSeq 2000 User Guide

Audience and Purpose

This guide describes the instrument components, software interface, safety considerations, consumables, and operational procedures for performing a sequencing run on the HiSeq. This guide also includes a detailed description of Real Time Analysis (RTA), which is part of the HiSeq Control Software (HCS).

This guide is for laboratory personnel and other individuals responsible for:

Operating the Illumina HiSeq 2000

Performing instrument and component maintenance

Training personnel

4 CHAPTER 1

Overview


Part # 15011190 Rev. D

Technical Assistance

For technical assistance, contact Illumina Customer Support.

MSDSs

Material safety data sheets (MSDSs) are available on the Illumina website at http://www.illumina.com/msds.

Product Documentation

If you require additional product documentation, you can obtain PDFs from the Illumina website. Go to http://www.illumina.com/documentation. When you click on a link, you will be asked to log in to iCom. After you log in, you can view or save the PDF.

If you do not already have an iCom account, then click New User on the iCom login screen and fill in your contact information. Indicate whether you wish to receive the iCommunity newsletter (a quarterly newsletter with articles about, by, and for the Illumina Community), illumiNOTES (a monthly newsletter that provides important product updates), and announcements about upcoming user meetings. After you submit your registration information, an Illumina representative will create your account and email login instructions to you.

Table 1 Illumina General Contact Information

Illumina Website http://www.illumina.com

Email [email protected]

Table 2 Illumina Customer Support Telephone Numbers

Region Contact Number

North America toll-free 1.800.809.ILMN (1.800.809.4566)

United Kingdom toll-free 0800.917.0041

Germany toll-free 0800.180.8994

Netherlands toll-free 0800.0223859

France toll-free 0800.911850

Other European time zones +44.1799.534000

Other regions and locations 1.858.202.ILMN (1.858.202.4566)

http://www.illumina.com

http://www.illumina.com/msds

http://www.illumina.com/documentation

HiSeq Components 5


HiSeq Components

HiSeq 2000 components include:

Reagent Compartment—Contains three racks of reagents required for

sequencing runs or wash solution for instrument washes.

Flow Cell Compartment—Contains the vacuum-controlled dual flow cell

stage, which holds flow cell A and flow cell B.

Fluidics Compartment—Contains integrated paired-end fluidics and

two fluidics pumps that operate independently, one for flow cell A and

one for flow cell B.

Enclosed Optics Module—Contains optical components that enable

dual surface imaging of the flow cell. The HiSeq images A, C, G, and T at

the same time using Epi fluorescence. The excitation laser beam passes

through the objective and the fluorescence is collected through the same

objective.

Status Bar—Uses three colors to indicate instrument status. Blue

indicates the instrument is running, orange indicates the instrument

needs attention, and green indicates that the instrument is ready to

begin the next run.

Figure 2 HiSeq Main Compartments

To set up a sequencing run on the HiSeq, you will access the reagent compartment and the flow cell compartment.

Flow Cell Compartment

Optics Module

Fluidics Compartment

Reagent Compartment

Status Bar

6 CHAPTER 1

Overview


Part # 15011190 Rev. D

Reagent Compartment

The reagent compartment is a high-capacity reagent chiller that holds three reagent racks. Two of the racks hold 250 ml bottles and provide SBS sequencing reagents to flow cell A and flow cell B. The third rack holds tubes of paired-end reagents for both flow cells. This rack also holds the Index Read Sequencing Primer (optional).

The HiSeq reagent chiller is designed to maintain reagent temperature at 4°C. The reagent chiller is not intended to cool down reagents; therefore, reagents must be cooled before they are loaded onto the instrument.

Figure 3 Reagent Compartment

The reagent rack for flow cell A is located in the center position, and the rack for flow cell B is located in the far right position. Each reagent rack has numbered positions that correspond to the connection on the fluidics pump. You only need to load the reagent rack that corresponds to the flow cell you plan to sequence.

The paired-end reagent rack, to the left of racks A and B, has two rows of numbered positions, one row for flow cell A and the other for flow cell B. This rack holds multiplexing reagents and paired-end reagents.

After filled reagent racks are positioned inside the reagent compartment, you lower the sippers into the reagent bottles using the sipper handles.

Two fluidics pumps in the fluidics compartment, one for each flow cell, direct reagents through the fluidics lines to the flow cell, and then deliver waste to the waste bottle.

Reagent Rack for Paired-End

and Multiplexing Reagents

Reagent Rack for Flow Cell BReagent Rack for Flow Cell A

Sipper Handles

HiSeq Components 7


Flow Cell Compartment

The flow cell compartment houses the flow cell stage, dual thermal stations, the vacuum system, and the fluidics connections to each flow cell.

The flow cells are seated on the flow cell stage, which moves in and out of the optics module. Flow cell A is on the left, and flow cell B is on the right. Each flow cell is positioned on the flow cell holder with the inlet and outlet holes facing down, and held in place by a vacuum. The vacuum is controlled by a flow cell lever in front of each flow cell. The flow cell lever flashes green or yellow, indicating the status of the vacuum seal.

Figure 4 Flow Cell Stage

Flow Cell A Flow Cell B

Flow Cell Lever A Flow Cell Lever B

8 CHAPTER 1

Overview


Part # 15011190 Rev. D

Sequencing Consumables

This section lists the Illumina-supplied kits and user-supplied consumables required to perform a sequencing run on the HiSeq.

Illumina-Supplied

The following Illumina-supplied kits and consumables contain components used on the HiSeq.

Table 3 Illumina Kits and Kit Contents

Illumina-Supplied Consumable Kit Contents and Description

HiSeq Sequencing Kit (200 Cycles)

Catalog # FC-401-1001

Sequencing reagents sufficient for 209 cycles of sequencing:

• Seven 250 ml bottles of sequencing reagents.

• Five tubes of reagents used to prepare ICR (Incorporation Reagent Mix).

• One 250 ml bottle of PW1 used for washing the instrument.

For more information, see HiSeq Sequencing Reagents on page 10

HiSeq Single-Read Cluster Generation Kit

Catalog # GD-401-1001

Single-read cluster generation reagents, one HiSeq single-read flow cell, and run components used on the cBot.

For more information, see the cBot User Guide.

HiSeq Accessories Kit:

• Seven single-use funnel caps for use on 250 ml reagent bottles provided in the HiSeq Sequencing Kit. For more information, see Loading Sequencing Reagents on page 47.

• Manifold gaskets for use between the manifolds and the flow cell. For more information, see Loading a Clustered Flow Cell on page 58.

HiSeq Paired-End Cluster Generation Kit

Catalog # PE-401-1001

Paired-end cluster generation reagents, one HiSeq paired-end flow cell, and run components used on the cBot.

For more information, see the cBot User Guide.

Read 2 Cluster Resynthesis Kit:

• Paired-end reagents used for Read 2 resynthesis step in paired-end runs.

For more information, see HiSeq Paired-End Reagents on page 11.

HiSeq Accessories Kit:

• Seven single-use reagent funnel caps for use on 250 ml reagent bottles provided in the HiSeq Sequencing Kit. For more information, see Loading Sequencing Reagents on page 47.

• Manifold gaskets for use between the manifolds and the flow cell. For more information, see Loading a Clustered Flow Cell on page 58.

Multiplexing Sequencing Primers and PhiX Control Kit

Catalog # PE-400-2002

Multiplexing reagents used for preparation of the Index Read in multiplexed runs.

Sequencing Consumables 9


User-Supplied Ensure that you have all of the following user-supplied consumables before you begin your run.

Table 4 User-Supplied Consumables

Consumable Supplier Purpose

1 M NaOH General lab supplier Instrument wash.

Alcohol wipes, 70% Isopropyl

or

Ethanol, 70%

VWR, catalog # 15648-981

General lab supplier

Cleaning the flow cell and flow cell stage.

Centrifuge tube, 250 ml Corning, catalog # 430776 Instrument and monthly maintenance wash.

Conical tubes, 15 ml Corning, catalog # 430052 Collecting and measuring waste volumes.

Conical tubes, self-standing, 50 ml Corning, catalog # 430291 Storing flow cells.

Disposable gloves, powder-free General lab supplier General use.

Lab tissue, low-lint VWR, catalog # 21905-026 Cleaning the flow cell holder.

Lens paper, 4 x 6 in. VWR, catalog # 52846-001 Cleaning the flow cell.

Pipette tips, 200 μl General lab supplier Preparing and aliquoting reagents.

Pipette tips, 1000 μl General lab supplier Preparing and aliquoting reagents.

Water, laboratory-grade Millipore SBS reagent rack, position 2.

Instrument wash.

10 CHAPTER 1

Overview


Part # 15011190 Rev. D

HiSeq Sequencing Reagents

To perform a sequencing run on the HiSeq, you need one HiSeq Sequencing Kit (200 Cycles), catalog # FC-401-1001.

HiSeq reagents have the following features:

The 250 ml conical bottles load directly onto reagent racks.

One 200-cycle sequencing kit provides sufficient reagents for 209 cycles

of sequencing.

Reagent labels are color-coded to reduce possible errors while loading

reagents.

Each reagent contains a barcode for tracking and a human-readable

label for ease of use.

When thawed, reagents are ready for use with the exception of ICR

(Incorporation Mix Reagent), which requires mixing prior to the run.

HiSeq reagents are shipped in two boxes on dry ice. As soon as you receive your kit, promptly store the reagents at the indicated temperature to ensure proper performance.

200 Cycle Kit Box 1: Store at 2° to 8°C

Box 2: Store at -15° to -25°C

NOTEThe reagent kit ID is located on the box. During run setup, you need to enter the reagent kit ID prior to loading reagents.

200-Cycle Kit Quantity Container Size Reagent Reagent

1 250 ml bottle PW1 Wash Buffer

1 250 ml bottle ICR-200 cycles Incorporation Mix Reagent

1 250 ml bottle SB1-200 cycles High Salt Buffer

2 250 ml bottle SB2-200 cycles Incorporation Buffer

1 250 ml bottle SB3-200 cycles Cleavage Buffer

200-Cycle Kit Quantity Container Size Reagent Reagent

1 250 ml bottle CMR-200 cycles Cleavage Mix Reagent

1 250 ml bottle SMR-200 cycles Scanning Mix Reagent

1 5 ml tube LRP-200 cycles Long Read DNA Polymerase

4 5 ml tube LFN36 Long Read Nucleotide Mix

HiSeq Paired-End Reagents 11


HiSeq Paired-End Reagents

To perform a paired-end sequencing run on the HiSeq, you need the Read 2 Cluster Resynthesis Kit, part of the HiSeq Paired-End Cluster Generation Kit, catalog # PE-401-1001.

Paired-end cluster resynthesis reagents have the following features:

The 15 ml tubes load directly onto the paired-end reagent racks.

One kit provides sufficient reagents for one flow cell.

Reagent labels are color-coded to help reduce possible errors while

loading reagents.

Each reagent includes a barcode for tracking and a human-readable label

for ease of use.

When thawed, reagents are ready for use with the exception of HP3 (2 N

NaOH), which is diluted to 0.1 N NaOH before use.

Box 2 is shipped on dry ice. As soon as you receive your kit, promptly store the reagents at the indicated temperature to ensure proper performance.

Kit Contents Store at -15° to -25°C


Quantity Container Size Reagent

1 15 ml tube HT2 (Wash Buffer)

1 15 ml tube RMX (Resynthesis Mix)

1 15 ml tube AT2 (100% Formamide)

1 15 ml tube APM2 (AMX2 Premix)

1 15 ml tube AMX2 (Amplification Mix 2)

1 15 ml tube LMX2 (Linearization Mix 2)

1 15 ml tube BMX (Blocking Mix)

1 15 ml tube HP2 (Sequencing Primer Mix 2)

1 15 ml tube HP3 (2 N NaOH)

12 CHAPTER 1

Overview


Part # 15011190 Rev. D

Multiplexing Sequencing Reagents

To perform a multiplexed sequencing run on the HiSeq, you need the Multiplexing Sequencing Primers and PhiX Control Kit, catalog # PE-400-2002.

Multiplexing reagents have the following features:

When used on the HiSeq, one kit provides sufficient reagents for eight flow cells.

When thawed, reagents require about ten minutes of preparation time

and transfer to 15 ml tubes before loading them onto the reagent rack.

For more information, see Preparing Multiplexing Reagents on page 43.

The kit is shipped on dry ice. As soon as you receive your kit, promptly store the reagents at the indicated temperature to ensure proper performance.

Kit Contents, Box 1

Store at -15° to -25°C

Kit Contents, Box 2

Store at -15° to -25°C



1 0.5 ml tube ISP (Indexing Seq Primer)

1 0.5 ml tube Multiplexing Rd2 seq Primer


1 1 ml tube 2 N NaOH

4 35 ml bottle Hybridization Buffer

1 40 ml bottle Wash Buffer


Chapter 2

HiSeq Control Software


15 HiSeq Software Interface

28 Pausing, Stopping, and Resuming a Run

32 Run Folders

34 Available Disk Space

14 CHAPTER 2



Part # 15011190 Rev. D

Introduction

HiSeq Control Software (HCS) guides you through the run setup steps, and allows you to monitor your sequencing run as it progresses and assess quality statistics in real time.

HCS has the following features:

Convenient location on the instrument computer, simplifying data

management.

Easy to use graphical user interface with wizards for instrument washes,

recipe creation, reagent priming, fluidics checks, as well as a run

overview screen to monitor the run in progress.

Integrated focus feature to ensure reliable image capture.

Real time analysis (RTA), which performs base calling and provides fast

access to quality metrics. For more information, see Chapter 5, Real Time Analysis.

HiSeq Software Interface 15


HiSeq Software Interface

The HiSeq Control Software (HCS) interface opens to the start screen. The start screen is split into two panels, one for flow cell A and the other for flow cell B. You can set up a run for flow cell A and flow cell B in parallel using the software interface.

Figure 5 HCS Software Interface, Start Screen

Start Screen Menu

The menu button, located in the upper-left corner of the start screen, provides the following options:

View—Provides options to view the interface in full screen or in a

window, and to minimize the interface.

Tools—Accesses the Options window and the Show Log file. From the

Options window you can define default output and temp folders. Other

features listed are not yet supported in HCS v1.0. The Show Log file is a

text file used for troubleshooting.

About—Provide information about the HiSeq hardware, HCS version,

and technical support contacts.

Exit—Closes the HCS interface.

Figure 6 Menu Button

Menu Flow Cell A Interface Panel Flow Cell B Interface Panel

Activity Indicators

16 CHAPTER 2



Part # 15011190 Rev. D

Activity Indicators

The start screen contains a series of activity indicators in the lower-right corner of the screen. They tell you which activity the instrument is performing and are used throughout the interface. From left to right, they represent the X, Y, and Z motors, electronics functionality, the camera, the fluidics system, and processing functions.

Figure 7 Activity Icons

Start Screen Options

Each run begins at the start screen and returns to the start screen after the run is complete. From the start screen, you have three options: Sequence, Wash, and Check.

Figure 8 Start Screen Options

Sequence—Select Sequence to begin setting up your sequencing run.

The software guides you through the run setup steps. For more

information, see Run Configuration Screens on page 17.

Wash—Select Wash to initiate a post-run instrument wash. Perform a

wash at the beginning of a run if the instrument has been idle for one day

or more. Two wash options are available:

• Post-Run Wash—The post-run wash flushes water through the

system for either flow cell A or flow cell B. Use either the post-run

wash or the maintenance wash after single-read runs.

• Maintenance Wash—The maintenance wash flushes water, then

NaOH, and then water through the system for either flow cell A or

flow cell B. Use the maintenance wash after paired-end runs.

Check—Select Check to open the fluidics check screen and confirm

proper flow during instrument installation and fluidics troubleshooting.

For more information, see Performing a Fluidics Check on page 107.

Wash

Sequence

Fluidics Check



Run Configuration

Screens

The software guides you through each run setup step. Each run configuration screen contains dropdown lists, checkboxes, or text fields to enter information for your run.

You can enter information using the keyboard located at the base of the flow cell compartment, or you can select the keyboard icon next to a text field to open the touch screen keyboard. To enter a flow cell or reagent kit ID, you can also scan the barcode ID using the hand-held scanner.

When you have finished entering required information on each screen, the Next button becomes active. Select Next to move to the next screen or select Back to return to the previous screen. At any time during the run setup steps, you can select Cancel to abort the run setup and return to the start screen.

Status Icons

Status icons notify you of any errors or warnings during the run setup steps or during the run. Status icons are located in the top-right corner of each screen.

Figure 9 Status Alert Icon

When a condition occurs, the icon changes and blinks to alert you. Select the icon on the screen to open the status window. Select any item displayed for a detailed description of the error or warning. Select Acknowledge to accept the message and Close to close the dialog box.

You can filter the types of messages that appear in the status window by selecting the icons along the top margin of the window. Selecting an icon toggles the condition to show or to hide.

Scan Parameters

The scan parameters screen is the first run setup screen where you record information specific to your run.

Figure 10 Scan Parameters

Status OK ErrorInformation Attention Warning

18 CHAPTER 2



Part # 15011190 Rev. D

Flow Cell ID—You can enter the flow cell ID using the keyboard, the

touch screen keyboard, or the barcode scanner.

If you enter a flow cell ID from a previous run, a dialog box appears asking if you want to resume that run. Selecting Yes opens the run setup steps for resuming a run. For more information, see Resuming a Stopped Run on page 30.

Figure 11 Resume Run

Experiment—Enter an experiment name. The name appears at the top

of each interface screen to help identify the sequencing run.

User Name—Enter the name of the person setting up the run.

Flow Cell Type—Select the flow cell type from the dropdown list. This

entry is used to confirm that the flow cell is compatible with the HiSeq.

The default is HiSeq Flow cell and currently there is no other flow cell

compatible with the HiSeq.

Control Lane—Select the lane on your flow cell containing the control

from the dropdown list, or select None if you used an integrated control.

Output Folder—Enter the path to the run folder. The run folder is the

destination for all output files. For more information, see Run Folders on

page 32.

If you designate a path on the instrument computer, make sure that you have archived the data from previous runs. Always specify a network location if you plan to save images.

Scan Parameters: Advanced Settings

Select Advanced to indicate your preference for the following:

.

Figure 12 Scan Parameters, Advanced Settings



Confirm First Base—Select the checkbox to receive a first base

confirmation dialog box that provides the option to abort the run at this

point or to continue.

If you do not select the checkbox, the first base report is generated as usual and the run continues without showing the first base report confirmation dialog box. The first base report may be accessed at any time during the run from the run folder. For more information, see First Base Report Confirmation on page 27.

Keep Intensity Files—Select the checkbox to save cluster intensity files

(*.cif) for later reanalysis, troubleshooting, or custom processing. Saving

intensity files is not required for on-instrument analysis.

Existing Recipe—If you wish to use an existing or custom recipe, enter

the path and recipe name. Illumina recommends using the recipe wizard

on the recipe parameters screen. For more information, see Recipe Parameters on page 19.

Save Images—By default, the software does not save images, and saved

images are not required for on-instrument analysis. If you choose to save

image samples, select one of the following options from the dropdown

list:

• Save Thumbnail Only—Thumbnail images are a combination of nine

images from each swath, combined in one thumbnail image. The

nine images are from the left, center, and right sections of the top,

center, and bottom regions of the swath. Thumbnail images are not

used for image analysis, but can be used to troubleshoot a run.

• Save Full Size Images—Saved image full size images may be used

for later reanalysis. However, saving images can increase processing

time. Always specify a network location for your run folder if you save

full size images.

Align Lanes—By default, all lanes are selected for alignment by RTA.

Deselect the checkbox for any lanes that do not have PhiX added to the

sample, so that RTA does not align and calculate error rates for that lane,

resulting in arbitrarily high error rates.

When you have entered the information for your run, select Next to move to the recipe parameters screen.

Recipe Parameters

The recipe parameters screen creates the recipe used for your run based on the information you entered. A copy of the recipe is automatically copied to the Recipe subfolder in the run folder for your run.

NOTEIllumina strongly recommends that you do not save full size images due to a significant negative effect on run performance, network performance, and archiving costs.

NOTEImage size per channel is about 650 MB. For example, full size images for 202 cycles, all four channels for every lane, and both surfaces of the flow cell require >16.4 TB of space.

20 CHAPTER 2



Part # 15011190 Rev. D

Figure 13 Recipe Parameters

Indicate the number of cycles you plan to sequence on the recipe parameters screen:

Cycles—Enter the number of cycles you plan to sequence for Read 1,

and if applicable, the Index Read and Read 2. Entering a cycle count in

the Indexing or Read 2 field, adds additional fields to specify the

chemistry for each portion of the recipe.

SBS—Select the chemistry to use for your run from the dropdown list.

Index—Select the chemistry to use for the Index Read, if applicable.

PE Turnaround—Select the chemistry to use for the paired-end

turnaround (cluster resynthesis) step, if applicable.

When you have entered the information for your run, select Next to proceed to the reagent parameters screen.

Reagent Parameters

The reagent parameters screen records the following information about the reagents used for your run:

Figure 14 Reagent Parameters



SBS Reagent Kit ID—Enter the SBS reagent kit ID using the keyboard,

the touch screen keyboard, or the barcode scanner. The reagent kit ID is

located on the reagent kit box.

Indexing Reagent Kit ID—For multiplexed sequencing runs, enter the

indexing reagent kit ID using the keyboard, the touch screen keyboard,

or the barcode scanner.

PE Reagent Kit ID—For paired-end sequencing runs, enter the paired-

end reagent kit ID using the keyboard, the touch screen keyboard, or the

barcode scanner.

New SBS Kit—This feature is not supported at this time. Instead, use

SBS Cycles Remaining.

SBS Cycles Remaining—Enter 101 cycles or less. The software counts

down the number of cycles entered prompts you to load fresh reagents

as needed. For more information, see Changing Reagents During a Run

on page 73.

Prime SBS Reagents—Select this checkbox to prime reagents before

you start a run, and select the appropriate priming recipe from the

dropdown list. Always prime reagents before loading a new flow cell.

Select Next to proceed. If you specified a number of cycles in the Indexing field on the recipe parameters screen, the indexing parameter screen opens. Otherwise, the review run setup screen opens.

Indexing Parameters

The indexing parameters screen provides a place to record the sample sheet associated with your multiplexed sequencing run. Enter or browse to the path and file name of the sample sheet for your run.

Figure 15 Indexing Parameters

Select Next to proceed to the review run setup screen.

22 CHAPTER 2



Part # 15011190 Rev. D

Review Run Setup

The review run setup screen lists the information you entered for your run. If it is correct, select Next to proceed to the pre-run setup screens. Select Back if you need to change any entries.

Figure 16 Review Run Setup

Pre-Run Setup Screens

The pre-run setup screens guide you through loading reagents, loading a used flow cell for priming, performing a fluidics check, and priming reagents.

Load Reagents

The load reagents screen prompts you to load sequencing reagents provided in the HiSeq Sequencing Kit. If you plan to perform a multiplexed run, load multiplexing reagents on the paired-end rack. For more information, see Loading Sequencing Reagents on page 47.

The software pauses the run after Read 1 of a paired-end run, so that you can load the appropriate Read 2 reagents.

Figure 17 Load Reagents

After the appropriate reagents are loaded, select Next.



Load Prime Flow Cell

The load prime flow cell screen prompts you to load a used flow cell for the priming step. Confirm that the vacuum is engaged and select Next to proceed the fluidics check.

Figure 18 Load Prime Flow Cell

Fluidics Check

The fluidics check screen prompts you to confirm proper flow before the priming of reagents. Select Pump to start the fluidics check. For more information, see Confirm Proper Flow on page 55. Select Next after you have confirmed proper flow.

Figure 19 Fluidics Check

You can pause or cancel the fluidics check from this screen:

Select Pause to temporarily pause the fluidics check. The pause button

changes to the resume button.

Select Resume to continue.

Select Cancel to abort the run setup and return to the start screen.

Pause/ResumePump

24 CHAPTER 2



Part # 15011190 Rev. D

Prime Reagents

From the prime screen, you can monitor the priming step in progress. If you need to pause or cancel the priming step, select Pause or Cancel.

Figure 20 Prime Reagents

You can pause or cancel the priming step from this screen:

Select Pause to temporarily pause the priming step. The pause button

changes to the resume button.

Select Resume to continue.

Select Cancel to abort the run setup and return to the start screen.

When priming of reagents is complete, the initiate run screens open.

Initiate Run Screens

The initiate run screens guide you through loading the new clustered flow cell, performing a fluidics check, and starting the run.

Load Sequencing Flow Cell

The load sequencing flow cell screen illustrates the steps to load the flow cell and engage the vacuum. For more information, see Loading a Clustered Flow Cell on page 58. Select Next to proceed.

Figure 21 Load Sequencing Flow Cell

Pause/Resume



Fluidics Check

Always confirm proper flow prior to a sequencing run. Select the reagent you want to prime, volume, aspiration rate, and dispense rate. Select Pump to start the fluidics check. For more information, see Confirm Proper Flow on page 63. Select Next after you have confirmed proper flow.


Close Flow Cell Compartment Door

At this point, the software prompts you to close the flow cell compartment door. The software selects the Vacuum Engaged and Door Closed checkboxes when the system is ready. Select Next to proceed.

Figure 23 Close Flow Cell Compartment

Start Sequencing

The start sequencing screen is the last screen that appears before starting the run. Once the run begins you cannot change any of the run parameters without stopping the run. Select Start to begin the sequencing run.

26 CHAPTER 2



Part # 15011190 Rev. D

Sequencing Screens

The run overview screen opens when the sequencing run begins cycle 1. After the completion of cycle 1, the first base report confirmation dialog box appears.

Run Overview

Figure 24 Run Overview

The run overview screen contains the following sections to monitor your run:

Run Progress—Provides a visual display of run progress and lists the

number of cycles completed. Run progress is indicated by a visual

progress bar and an image of a flow cell.

The progress bar shows the number of cycles completed. The flow cell image shows which lanes have been imaged for that cycle. Light gray indicates that the lane has been imaged and dark gray indicates that the lane has not been imaged.

Figure 25 Flow Cell Image on Run Overview Screen

Wavy lines across the flow cell indicate that reagents are pumping through the flow cell. The background of the flow cell image changes colors during the run to indicate temperature changes. Blue indicates cooler temperatures, while orange and red colors indicate warmer temperatures.

Configuration—Lists the read type, output folder, and run parameters.

Analysis—Lists cycles called, cycles scored, clusters/cycles passing filter,

and total data in gigabases, and a graph of intensities by cycle.

Run Configuration

Analysis

Run Progress

Images

Fluidics

Flow Cell Image: Imaging In Progress

Flow Cell Image: Fluidics In Progress



HCS performs image analysis during the run. The software uses the first four cycles to initialize image analysis. By cycle five, image analysis results appear on the run overview screen.

Fluidics—Shows the current temperature, protocol step, and reagent.

The green line shows the temperature for the flow cell, the blue line shows the chiller temperature.

Images—Shows a sampling of three images from each swath. A swath is

the area imaged during one scanning pass of the flow cell. There are two

swaths per surface, resulting in four swaths for each lane. The three

images are samples from the current scan position.

Select the arrow button to expand any section on the run overview screen. For more information, see Monitoring the Run on page 65.

First Base Report Confirmation

The first base report confirmation dialog box appears automatically after the completion of cycle 1, if you selected the First Base Confirmation checkbox on the scan parameters screen. For more information, see Scan Parameters: Advanced Settings on page 18.

Figure 26 First Base Report

If the first base report is satisfactory, select Continue to begin your run. From this point the run is underway. You can walk away or monitor the run using the run overview screen.

28 CHAPTER 2



Part # 15011190 Rev. D

Pausing, Stopping, and Resuming a Run

At any time during the run you can pause or stop the run. You might pause a run to check run components, such as reagent volumes, before proceeding with the run. You should only stop a run if the data is bad, if the run was set up incorrectly, or if there is a hardware error.

You can resume a paused run or a run that was stopped safely using the normal stop option.

Pausing a Run 1. From the run overview screen, select Pause. The pause menu appears.

Figure 27 Pause Menu

2. Select Normal Pause.

3. Select Yes to confirm the pause command. The software completes the

current chemistry or imaging command and places the flow cell in a safe

state.

Figure 28 Confirm Pause Command

4. The pause button changes to the resume button. Select Resume when

you are ready to resume the run.

Normal Pause

Pausing, Stopping, and Resuming a Run 29


Stopping a Run 1. From the run overview screen, select Stop. The stop menu appears.

Figure 29 Stop the Run

2. Select one of the following stop options:

• Normal Stop—Stops the run only after the current chemistry or

imaging command is complete, and then places the flow cell in a

safe state. Using the normal stop option allosw you to resume the

run at a later time.

Figure 30 Confirm Normal Stop

• Immediate Stop—Stops the run without completing the current

operation and does not place the flow cell in safe state. You cannot

resume a run that was stopped using the immediate stop option.

Figure 31 Immediate Stop Warning

3. After the run is stopped, select Return to Start on the run overview

screen. The start screen opens.

Normal Stop

Immediate Stop

30 CHAPTER 2



Part # 15011190 Rev. D

Resuming a Stopped Run

Use the following instructions to resume a run that was stopped using the normal stop option:

1. From the start screen, select Sequence.

2. On the scan parameters screen, enter the flow cell ID from the run you

want to resume.

Figure 32 Resume Run

3. Select Yes to confirm that this is the correct flow cell ID and associated

run to resume. The resume parameters screen opens.

Figure 33 Resume Parameters

4. Select the run folder from the dropdown list and enter where in the run

you want to resume.

5. Select Next. The parameters from the previous run appear on the screen.

Pausing, Stopping, and Resuming a Run 31


Figure 34 Parameters from Previous Run

6. Select Next. The software prompts you to close the flow cell

compartment door.

7. Ensure the flow cell lever is green and close the flow cell compartment

door.

8. Ensure that the Vacuum Engaged and Door Closed checkboxes are

selected and select Next.

Figure 35 Close Flow Cell Compartment Door

9. Select Start to start the sequencing run.

32 CHAPTER 2



Part # 15011190 Rev. D

Run Folders

Each run on the HiSeq generates a run folder that contains data files and log files for that run.

During run setup, the software prompts you to enter the path and folder name for the run folder. By default, the folder is named in the following format:

YYMMDD_<Workstation Name>_<Run Number>

Example: 090120_WORKSTATION-487_0002

The run number increments by one each time you perform a run on a given workstation. Typically, users add the flow cell ID to the run folder name. Do not include any spaces in the run folder name.

Run Folder Path All run folders are stored in a single folder. The location of the run folder is Illumina\HiSeqTemp. The flow cell ID entered during the run setup steps appends to the the end of the run folder name.

Contents of Run Folders

The following tables list the contents of the run folder and subfolders.

Table 5 Run Folder Contents

Subfolder Key Files/Folders Description

[Root level] First_Base_Report.txt File with basic metrics for the first cycle.

IALog.txt Log file for image analysis events.

Sample Sheet (optional) If you create a sample sheet, it is copied to this location, and the name is added to the params file in this folder. A sample sheet is required only if you do a multiplexing run.

RunInfo.xml Identifies high-level run information.

runParameters.xml Provides the setup parameters for the run.

Bottom Contains an Images folder with a folder for the bottom surface of each lane; each lane folder contains one subfolder for each cycle (optional)

Each cycle folder contains TIF image files for each lane if you selected save images on the Run Parameters window

Contains an Images folder with focus files Contains the TIF focus images.

Config Contains a copy of the software configuration parameters used for the run.

Run Folders 33


Data Status.xml Contains run and analysis-specific metrics generated during the run.

Intensities folder Contains image analysis results.

This folder is saved on the network folder under <Run Folder>\Data, and is given the same name as the run folder on the instrument computer.

CopyLog.txt Log file for copy events.

Log.txt Log file for image analysis and base calling.

Data\ Intensities

BaseCalls folder Contains RTA base calling results.

config.xml file Contains run and image analysis-specific information.

RTAConfiguration.xml Configuration file for RTA in *.xml format.

Data\ Intensities\ BaseCalls

BustardSummary.xml file Contains run- and analysis-specific metrics generated after base calling.

config.xml file Contains run and base calling-specific information.

Logs Log file

Recipe_<date>_<time>.log

Contains the run log information. Whenever the log file gets too big (approximately 5 MB), HCS starts a new log file.

Recipe *.xml When you start a run, a copy of the recipe is moved to the Recipe folder. If you stop the run and resume it later, this recipe restarts where the run was stopped.

Top Contains an Images folder with a folder for the top surface of each lane; each lane folder contains one subfolder for each cycle

Each cycle folder contains TIF image files for each lane if you selected save images on the Run Parameters window

Contains an Images folder with focus files (optional)

Contains the TIF focus images. This folder is created if you opted to save focus images in the Run Parameters screen.

Table 5 Run Folder Contents (Continued)

Subfolder Key Files/Folders Description

34 CHAPTER 2



Part # 15011190 Rev. D

Available Disk Space

During the run at the end of each lane, the software checks available disk space. If disk space drops below the safe threshold, the software pauses the run and a message alerts you.

If you get this message, you need to make disk space available to continue the run. When sufficient disk space becomes available, the run automatically resumes.

The HiSeq instrument computer has a storage capacity of 1.8 TB per flow cell, enough space to hold a 209 cycle run if images are not saved to disk. Data from flow cell A is stored on the D: drive, while data from flow cell B is stored on the E: drive.


Chapter 3

Performing a Sequencing Run


37 Sequencing Workflow

38 Starting the HiSeq

39 Preparing Sequencing Reagents

41 Allocating Reagents For Shorter Runs

43 Preparing Multiplexing Reagents

44 Setting Up the Sequencing Run

47 Loading Sequencing Reagents

50 Loading Multiplexing Reagents

52 Loading a Used Flow Cell

57 Priming Reagents

58 Loading a Clustered Flow Cell

65 Monitoring the Run

73 Changing Reagents During a Run

70 Preparing ICR for Read 2

71 Preparing Paired-End Reagents

75 Loading ICR for Read 2

77 Loading Paired-End Reagents

36 CHAPTER 3



Part # 15011190 Rev. D

Introduction

The section explains how to perform a sequencing run on the HiSeq.

The run is set up using the HCS software interface. The hands on time includes entering run information, loading and priming reagents, loading the new clustered flow cell, and performing a fluidics check. The sequencing run can be monitored from the run overview screen.

Multiplexed runs require additional reagents used for the Index Read, which are loaded onto the instrument at the beginning of the run. See Preparing Multiplexing Reagents on page 43.

Paired-end runs require additional reagents for Read 2 resynthesis, which are loaded onto the instrument after Read 1 is complete. See Preparing Sequencing Reagents on page 39.

Sequencing Workflow 37


Sequencing Workflow

The following diagram illustrates the HiSeq sequencing workflow for a multiplexed paired-end run. Steps specific to a multiplexed run and a paired-end run are labeled. All other steps are standard for any type of run.

Figure 36 Sequencing Workflow

Paired-End Runs

Prepare Reagents for Read 2 Resynthesis

Load Reagents for Read 2 Resynthesis

Prepare and Load ICR for Read 2

Read 2 Resynthesis

Monitor Read 2

Perform an Instrument Wash

Load Sequencing Reagents

Load Multiplexing Reagents

Load a Used Flow Cell

Confirm Proper Flow

Prime Sequencing Reagents

Measure Priming Waste

Prepare Sequencing Reagents

Prepare Multiplexing Reagents

Enter Run Parameters Using HCS Interface

Load a Clustered Flow Cell

Confirm Proper Flow

Inspect First Base Report After Cycle 1

Monitor Read 1

Prime Multiplexing Reagents

Index Read Preparation

Monitor the Index Read

Multiplexed Runs

38 CHAPTER 3



Part # 15011190 Rev. D

Starting the HiSeq

It is best to leave the HiSeq on at all times. Turn the instrument off only if it will remain idle for more than three days.

Use the following instructions to start the HiSeq and instrument computer.

1. Start the HiSeq instrument control computer (Dell T7500).

2. Log on to the operating system using the default user name and

password. Wait until it has completely loaded.

• User name: sbsuser

• Password: sbs123

If the default values do not work, consult your IT personnel for the user name and password for your site.

3. Turn the HiSeq main power switch, located on the left side of the

instrument, to the ON position.

4. Wait for instrument drive called “DoNotEject” to initialize. A window

appears when the drive is initialized. Close the window.

5. To ensure adequate disk space, archive the data on the instrument

computer from all previous runs to a network location.

6. Open the HiSeq Control Software (HCS) using the icon on the computer

desktop. The HiSeq Control Software takes a few minutes to initialize.

When the software is initialized, the start screen appears.

7. Check for the initialization icon on the bottom left of the HCS

start screen to confirm complete instrument initialization.

NOTE

If you need to turn the instrument off, wait a minimum of 60 seconds before turning the main switch back to the ON position. This allows the electronics to discharge and ensures that the instrument initializes properly upon restart.

NOTE

Never eject the HiSeq “DoNotEject” flash drive located inside the HiSeq chassis, or modify the files on it. This drive contains hardware configuration files and initializes whenever the HiSeq is turned on.

NOTEThe HiSeq instrument computer has a storage capacity of 1.8 TB for each flow cell, enough space to hold a 209 cycle run if images are not saved to disk.

Preparing Sequencing Reagents 39


Preparing Sequencing Reagents

The HiSeq Sequencing Kit (200 Cycles) contains reagents sufficient for 209 cycles of sequencing. If you are performing a shorter run, see Allocating Reagents For Shorter Runs on page 41 for more information.

Reagent preparation requires the following three steps:

Thawing—CMR, SMR, and LFN require thawing prior to use. LRP does

not freeze and can remain in -15° to -25°C storage. ICR, SB1, SB2, and

SB3 are used directly from 2° to 8°C storage.

Allocating ICR for Read 1 and Read 2—You must split the volume of

ICR into two equal portions, one bottle for Read 1 and the other bottle

for Read 2. You can prepare and use both bottles immediately for

concurrent runs, or you can use one bottle now and store the other

bottle for Read 2 of the same run.

Preparing ICR—ICR is the only reagent that requires mixing prior to use.

Thaw Reagents Sequencing reagents CMR-200 cycles, SMR-200 cycles, and LFN36 require thawing prior to your sequencing run. Start the thawing process about 17 hours prior to your run.

1. Leave LRP-200 cycles in -15° to -25°C storage until you are ready to use

it to prepare ICR.

2. Remove SMR-200 cycles and CMR-200 cycles from -15° to -25°C storage

and thaw at 2° to 8°C overnight (at least 16 hours).

3. After overnight thawing, place the reagent bottles in a rack, and then

place the rack in a water bath filled with room temperature deionized

water for about one hour to finish thawing.

4. Invert each bottle several times and inspect the reagents for ice crystals.

Ensure the reagents are completely thawed.

5. Remove LFN36 from -15° to -25°C storage and thaw in a beaker

containing room temperature deionized water for 20 minutes.

Only thaw two tubes of LFN36 if you plan to use half of the ICR at this time, such as for Read 1. Thaw all four tubes of LFN36 if you plan to use both halves of ICR now, such as for two concurrent runs.

6. When thawed, set SMR-200 cycles, CMR-200 cycles, and LFN36 aside on

ice until you are ready to load them onto the instrument.

7. Use ICR-200 cycles, SB1-200 cycles, SB2-200 cycles, and SB3-200 cycles

directly from 2° to 8°C storage.

8. Record the lot numbers of each reagent on the lab tracking form.

Allocate ICR 1. Aliquot 47 ml of ICR-200 cycles into a spare 250 ml bottle to result in two

equal volumes of ICR.

2. Do one of following:

40 CHAPTER 3



Part # 15011190 Rev. D

• Two Flow Cells—If you are preparing reagents to run two flow cells

concurrently, prepare both bottles of ICR as described in Prepare ICR for 108 Cycles. Use a new Sequencing Kit for Read 2 of a paired-end

run, and repeat the thawing and allocating procedure.

• One Flow Cell—If you are preparing reagents to run one flow cell at

this time, prepare only one bottle of ICR as described in Prepare ICR for 108 Cycles. Return the second bottle of ICR to 2° to 8°C storage

until you are ready to load reagents for Read 2.

Prepare ICR for 108 Cycles

1. Add the contents of two tubes of LFN36 to the bottle containing 47 ml of

ICR-200 cycles.

2. Rinse each tube of LFN36 with ICR-200 cycles to ensure that all LFN36 is

transferred.

3. Aliquot 1.1 ml of LRP-200 cycles into the ICR/LFN36 mix.

4. Return the unused portion of LRP-200 cycles to -15° to -25°C storage.

5. Cap the bottle and invert several times to mix.

6. Set aside on ice until you are ready to load reagents onto the HiSeq.

NOTEIllumina recommends preparing and using the “spare” bottle of ICR first and storing the labeled bottle of ICR as the original label contains important expiry information.

Allocating Reagents For Shorter Runs 41


Allocating Reagents For Shorter Runs

The HiSeq Sequencing Kit (200 Cycles) contains sufficient reagents for 209 cycles of sequencing. You can allocate reagents provided in the kit into volumes suitable for 101 cycles using the following instructions.

Consumables User-SuppliedSeven 250 ml bottles (Corning, catalog # 430776)

Procedure Use the following instructions to allocate reagents into two equal sets.

1. Thaw reagents as described in Thaw Reagents on page 39.

2. Label seven 250 ml bottles as follows:

• Reagent #1 ICR

• Reagent #3 SMR

• Reagent #4 SB1

• Reagent #5 SB2

• Reagent #6 SB2

• Reagent #7 CMR

• Reagent #8 SB3

3. Aliquot the volumes of each reagent listed below into the appropriate

250 ml bottle to result in two equal sets of reagents. Prepare CMR last

and then replace your gloves.

4. Do one of following:

• Two Flow Cells—If you are preparing reagents to run two flow cells

concurrently, prepare both bottles of ICR as described in Prepare ICR for 108 Cycles on page 40. Use a new Sequencing Kit for Read 2 of a

paired-end run, and repeat the thawing and allocating procedure.

Table 6 Allocating Reagents for Standard 101-Cycle Runs

Reagent # Reagent Name Container 1 Container 2

1 ICR 47 ml 47 ml

3 SMR 107 ml 107 ml

4 SB1 100 ml 100 ml

5 SB2 (for position #5) 62 ml 62 ml

6 SB2 (for position #6) 62 ml 62 ml

7 CMR 107 ml 107 ml

8 SB3 110 ml 110 ml

42 CHAPTER 3



Part # 15011190 Rev. D

• One Flow Cell—If you are preparing reagents to run one flow cell at

this time, prepare only one bottle of ICR as described in Prepare ICR for 108 Cycles on page 40. Return the second set of reagents to

proper storage. Store CMR, SMR, and LRP at -15° to -25°C. Store

ICR, SB1, SB2, and SB3 at 2° to 8°C.

Preparing Multiplexing Reagents 43


Preparing Multiplexing Reagents

The following reagents are used for Index Read preparation prior to the start of the Index Read. They are provided in the Multiplexing Sequencing Primers and PhiX Control Kit. For more information, see Multiplexing Sequencing Reagents on page 12.

Thaw Reagents 1. Remove the following multiplexing reagents from -15° to -25°C storage:

• 2.0 N NaOH

• Wash Buffer

• Hybridization Buffer

• Index Seq Primer

Do not thaw the Multiplexing Rd2 Seq Primer at this time.

2. Thaw at room temperature or in a beaker containing room temperature

deionized water.

Prepare Reagents

Prepare 0.1 N NaOH

Dilute 2 N NaOH to 0.1 N NaOH prior to loading it onto the HiSeq.

1. Invert the container of 2 N NaOH five times to mix the reagent, and then

pulse centrifuge the reagent.

2. Transfer 3,325 μl of PW1 (provided in the Sequencing Kit) into a 15 ml

conical tube, and add 175 μl of 2 N NaOH.

3. Invert the tube five times to mix the reagent.

4. Label the conical tube of 0.1 N NaOH “Reagent #18.”

5. Centrifuge at 1,000 rpm for one minute.

6. Set aside at room temperature until you are ready to load reagents onto

the HiSeq.

Prepare Wash Buffer

1. Invert the container of Wash Buffer five times to mix the reagent, and

then transfer 4 ml of Wash Buffer into a 15 ml conical tube.

2. Label the tube “Reagent #19.”


the HiSeq.

Prepare Index Seq Primer

1. Transfer 2,985 μl of Hybridization Buffer into a 15 ml conical tube, and

add 15 μl of Index Seq Primer.

2. Vortex the tube to mix the reagent.



the HiSeq.

44 CHAPTER 3



Part # 15011190 Rev. D

Setting Up the Sequencing Run

The HiSeq software interface guides you through the run setup steps. For more information, see HiSeq Software Interface on page 15.

Prerequisites You have recently performed an instrument wash. For more information,

see Performing a Maintenance Wash on page 84.

You have thawed and prepared sequencing reagents. For more

information, see Preparing Sequencing Reagents on page 39.

Procedure 1. From the start screen, select Sequence. The scan parameters screen

opens.

Figure 37 Enter Scan Parameters

2. Enter the following parameters for your run:

a. Scan or enter the flow cell ID of the flow cell to be sequenced.

b. Enter your experiment name and user name.

c. Select the flow cell type from the dropdown list.

d. Select the lane containing the control, if applicable. If you used an

integrated control, select None.

e. Enter or browse to the path of your run folder and enter the run

folder name.

f. If applicable, select the notifications checkbox to receive email

messages about the status of your run.

3. Select Advanced to expand the following additional settings:

a. Select the Confirm First Base checkbox to generate a first base

report confirmation.

b. Select the Save Images checkbox to save thumbnail images. For

more information, see Scan Parameters: Advanced Settings on

page 18.

c. Select the Use Existing Recipe checkbox only if you want to use a

custom recipe. Otherwise, allow the software to create your recipe

based on information you provide on the run setup screens.

4. Select Next. The recipe parameters screen opens.

Setting Up the Sequencing Run 45


Figure 38 Enter Recipe Parameters

5. Enter the following recipe parameters:

a. Enter the number of cycles you plan to sequence for Read 1, and if

applicable, the Index Read and Read 2.

b. Select the appropriate SBS chemistry from the dropdown list.

c. If you are performing a multiplexed run, select the appropriate Index

chemistry from the dropdown list.

d. If you are performing a paired-end run, select the appropriate PE

turnaround chemistry from the dropdown list.

6. Select Next. The reagent parameters screen opens.

Figure 39 Enter Reagent Parameters

7. Enter the following reagent parameters:

a. Scan or enter the reagent kit IDs for the kits you are using to perform

your run. Reagent kit IDs are located on the reagent kit box.

b. Select the reagent kit type from the dropdown list.

c. Specify 101 cycles or less. The software prompts you to load fresh

ICR and paired-end reagents after the last cycle of Read 1

completes.

46 CHAPTER 3



Part # 15011190 Rev. D

8. Select Next. The indexing parameters screen opens if you entered a

number greater than zero for the index read. Otherwise, the review run

setup screen opens.

Figure 40 Enter Indexing Parameters

9. Browse to the path and file name of the sample sheet for your

multiplexed sequencing run.

10. Select Next. The review run setup screen opens.

11. Review your run information. If it is correct, select Next and proceed to

Loading Sequencing Reagents on page 47. Select Back if you need to

change any entries.

Loading Sequencing Reagents 47


Loading Sequencing Reagents

The next step in the run setup is to load sequencing reagents followed by the priming step. The software interface guides you through the process.

Consumables Illumina-SuppliedThoroughly thawed and prepared sequencing reagents

(Provided in the HiSeq Sequencing Kit)

Seven funnel caps

(Provided in the HiSeq Cluster Generation Kit)

User-SuppliedOne 250 ml bottle (Corning, catalog # 430776) containing 5 ml of

laboratory grade water

Procedure 1. Record the weight of each reagent on the lab tracking form.

2. Open the reagent compartment door.

Figure 41 Reagent Racks

3. Raise the sippers for the reagent rack you are loading using the following

motion:

a. Pull the sipper handle towards you.

b. Push the sipper handle up while pulling it towards you.

NOTEWeighing reagents before and after a sequencing run confirms proper reagent delivery.

Reagent Rack for

Paired-End Reagents


Sipper Handles

48 CHAPTER 3



Part # 15011190 Rev. D

c. Release the sipper handle into the slot on top end of the groove. You

should feel the sipper handle rest securely into the slot.

4. Slide the reagent rack out of the reagent compartment using the rack

handle.

5. Place each reagent bottle onto the rack in the associated numbered

position, making sure that the conical end of the bottle rests in the

indentation on the base of the rack.

Figure 42 Sequencing Reagent Rack (A or B)

NOTE

The paired-end rack is located to the left of Rack A and holds two sets of paired-end reagents used during the resynthesis step of a paired-end run. For more information, see Loading Paired-End Reagents on page 77.

Table 7 Sequencing Reagent Positions (Rack A or B)

Position Reagent Description

1 ICR Incorporation Mix Reagent

2 Water 250 ml bottle with laboratory-grade water

3 SMR Scanning Mix Reagent

4 SBS Buffer 1 (SB1) High Salt Buffer

5 SBS Buffer 2 (SB2) Incorporation Buffer

6 SBS Buffer 2 (SB2) Incorporation Buffer

7 CMR Cleavage Mix Reagent

8 SBS Buffer 3 (SB3) Cleavage Buffer

7CMR

5SB2

3SMR

1ICR

8SB3

6SB2

4SB1

2Water

Loading Sequencing Reagents 49


6. Remove the cap from each bottle of ICR, SMR, SB1, SB2, and SB3, and

replace it with a funnel cap. Funnel caps are provided in the HiSeq

Accessories Kit, part of the HiSeq Cluster Generation Kit.

7. Remove the cap from the CMR bottle and replace it with a funnel cap.

Replace your gloves.

8. Slide the reagent rack into the reagent compartment, aligning the rack

with the raised guide on the floor of the compartment.

9. Lower the sippers into the reagent bottles of the appropriate rack using

the following motion:


b. Lower the sipper handle while pulling it towards you.

c. Release the sipper handle into the slot on the bottom end of the

groove. You should feel the sipper handle rest securely into the slot.

10. Visually inspect the sippers to ensure they are centered inside the

bottles, and did not bend as they were lowered into the funnel caps.

11. For multiplexed runs, proceed to Loading Multiplexing Reagents on

page 50. Otherwise, go to the next step.

12. Close the reagent compartment door.


13. Select Next and proceed to Loading a Used Flow Cell on page 52.

NOTEAlways use the funnel caps on reagent bottles. The small hole in the cap minimizes the risk of contamination.

CAUTIONAfter handling the bottle of CMR, be sure to discard your gloves and replace them with a new pair.

50 CHAPTER 3



Part # 15011190 Rev. D

Loading Multiplexing Reagents

If you are performing a multiplexed run, you need to load multiplexing reagents onto the instrument before you start the run. The paired-end rack is located to the left of Rack A and holds two sets of multiplexing reagents, one set for each flow cell.

Figure 44 Paired-End/Multiplexing Reagent Rack

1. Record the weight of each reagent on the lab tracking form.

2. Raise the sippers for the paired-end reagent rack using the following

motion:

a. Pull the handle towards you.

b. Push the handle up while pulling it towards you.

c. Release the handle into the slot on top end of the groove. You

should feel the handle rest securely into the slot.


handle.

4. Place each of the reagent tubes onto the rack in the associated

numbered positions.

NOTEIt is very important to ensure that reagents are thoroughly mixed before loading them onto the instrument.

Table 8 Multiplexing Reagent Positions


17 ISP Indexing Seq Primer

18 HP3 0.1 N NaOH

19 HT2 Wash Buffer

Reagent Rack for Multiplexing Reagents

Sipper Handle

Loading Multiplexing Reagents 51


Figure 45 Paired-End Reagent Rack

5. Remove the caps from each reagent tube.



7. Lower the sippers into the paired-end reagent tubes using the following

motion:


b. Lower the handle while pulling it towards you.

c. Release the handle into the slot on the bottom end of the groove.

You should feel the handle rest securely into the slot.

8. Visually inspect the sippers to ensure they are centered inside the tubes,

and did not bend as they were lowered into the tubes.


10. Select Next to proceed to loading a used flow cell.

10

AAA B

11

12

13

14

15

16

17

18

19

10

11

12

13

14

15

16

17

18

19 HT2 (Wash Buffer)

HP3 (Diluted to 0.1 N NaOH)

ISP (Indexing Seq Primer)

52 CHAPTER 3



Part # 15011190 Rev. D

Loading a Used Flow Cell

The HiSeq must be loaded with a used flow cell before performing an instrument wash or priming reagents. If you do not have a used flow cell, contact your Illumina Field Application Scientist (FAS) or Field Service Engineer (FSE).

If you are ready to perform a post-run wash at the completion of your sequencing run, leave the flow cell on the instrument and proceed to Performing a Post-Run Instrument Wash on page 89.

Consumables User-SuppliedLens cleaning tissue

70% ethanol or alcohol wipes

Low-lint lab tissue

Used HiSeq flow cell

Clean the Flow Cell Holder

1. Open the flow cell compartment door.

2. Make sure that the flow cell lever for the flow cell you are loading, either

A or B, is in the OFF position (far-left).

Figure 46 Flow Cell Lever in OFF Position (Far-Left)

3. Put on a new pair of powder-free latex gloves.

4. Using an alcohol wipe or a lint-free tissue moistened with ethanol or

isopropanol, carefully wipe the surface of the flow cell holder until it is

completely clean.

WARNINGWARNINGDo not set fluids on the flow cell compartment door or on the flow cell stage when the door is open. Spills in this area can damage the instrument.

NOTEDo not allow alcohol to drip into the vacuum holes or around the manifolds. Use a low-lint lab tissue to dry the stage, if necessary.

Flow Cell Lever A Flow Cell Lever B

Loading a Used Flow Cell 53


5. Visually inspect the flow cell holder to make sure it is free of lint, and the

vacuum holes are free of obstructions.

Figure 47 Vacuum Hole Locations

Load Used Flow Cell

You are ready to load the used flow cell. You may reuse existing gaskets when loading a used flow cell for instrument washes or reagent priming.

1. Remove the used flow cell from storage buffer and clean it using alcohol

wipes and lens cleaning tissue.

2. Place the used flow cell on the flow cell holder with the inlet and outlet

ports facing down and the barcode on the right. The arrow on the left

edge of the flow cell, which indicates flow direction, should point

towards the instrument.

3. Gently slide the flow cell towards the top and right guide pins until it

stops.

Figure 48 Position Flow Cell Against Top and Right Guide Pins

Vacuum Holes

(Flow Cell A)

Vacuum Holes

(Flow Cell B)

NOTERemove your hand from the flow cell before engaging the vacuum switch. This prevents any pressure on the guide pins that may cause alignment drift over time.

Top Guide Pin Right Guide Pins

54 CHAPTER 3



Part # 15011190 Rev. D

4. Move the flow cell lever slowly to position 1 (middle), until it is pointing

upward. This engages the vacuum and secures the flow cell into position.

The flow cell lever turns yellow, and then quickly blinks green. When the

flow cell lever is green, the vacuum is engaged. If the flow cell lever

remains yellow, the vacuum seal is not secure. Repeat the cleaning steps

and reload the flow cell.

Figure 49 Flow Cell Lever in Position 1 (Middle)

5. Wait for about five seconds, and then move the flow cell lever slowly to

position 2 (far-right). This raises the manifolds, allowing the gaskets to

make contact with the flow cell. When the flow cell lever is solid green,

the flow cell is ready for use.

If the flow cell lever remains yellow, the manifolds did not engage or the vacuum seal has been lost. Remove the flow cell, repeat the cleaning steps, and reload the flow cell.

Figure 50 Flow Cell Lever in Position 2 (Far-Right)

6. Ensure the Vacuum Engaged checkbox is selected on the load prime

flow cell screen.

Flow Cell A Vacuum Engaged

Loading a Used Flow Cell 55


Figure 51 Load Prime Flow Cell

7. Select Next to proceed to the fluidics check.

Confirm Proper Flow

After the used flow cell is loaded, you are ready to check for proper flow using the fluidics check screen. Checking for proper flow confirms that the flow cell and gaskets are properly installed and the manifold is engaged.


1. Select solution 5 (SB2) from the dropdown list.

2. Enter the following default values:

• Volume: 250

• Aspiration Rate: 250

• Dispense Rate: 2,000

3. Select Pump.

4. Visually inspect the flow cell for bubbles passing through the lanes and

leaks near the manifolds.

If you see excessive bubbles, check the gaskets for obstructions, reduce the aspiration rate to 100, and pump another 250 μl of water to the flow

56 CHAPTER 3



Part # 15011190 Rev. D

cell. For more information, see Troubleshooting on page 106. If problems persist, contact Illumina Technical Support.

Prepare for Priming

1. Prepare the waste tubes for collection of priming waste as follows:

a. Loosen and remove the eight lines of waste tubing for the

appropriate flow cell from the waste container.

b. Place each waste tubing into an empty 15 ml tube, one line per tube.

Priming waste is collected and measured after the priming step.

2. Select Next. The priming screen opens and the priming step starts

automatically.

NOTEBe sure you do not include the eight lines for the opposite flow cell, the condensation pump, or the two paired-end priming pumps.

Priming Reagents 57


Priming Reagents

You are ready to prime reagents through the fluidics lines.

You can monitor the progress of the priming step from the priming screen.

Figure 53 Prime Reagents

1. When the priming step is complete, measure the collected priming waste

and confirm that the volume is 1.75 ml from each lane. Record the results

on the lab tracking form.

If the measured volume differs from the expected volume by more than 10%, repeat the priming step.

2. Return the waste tubing to the waste container before proceeding.

3. Select Next. You are ready to load the clustered flow cell. Proceed to

Loading a Clustered Flow Cell on page 58.

58 CHAPTER 3



Part # 15011190 Rev. D

Loading a Clustered Flow Cell

After priming is complete, you are ready to load the clustered flow cell onto the HiSeq for sequencing.

Consumables User-SuppliedLens cleaning tissue

70% ethanol or alcohol wipes

Low-lint lab tissue

Remove the Used Flow Cell

1. Open the flow cell compartment door.


2. Slowly move the flow cell lever to position 1 (middle) to disengage the

manifolds.

3. Slowly move the flow cell lever to the OFF position (far-left) to disengage

the vacuum seal and release the flow cell.

WARNINGWARNINGDo not set fluids on the flow cell compartment door or on the flow cell stage when the door is open. Spills in this area can damage the instrument.

Flow Cell A

Vacuum Engaged

Loading a Clustered Flow Cell 59


Figure 55 Flow Cell Lever in OFF Position (Far-Left)

4. Lift the used flow cell from the flow cell holder.

5. Remove the used gaskets and discard them.

Figure 56 Remove Used Manifold Gaskets

Clean the Flow Cell Holder

1. Put on a new pair of powder-free latex gloves.

2. Using an alcohol wipe or a lint-free tissue moistened with ethanol or

isopropanol, carefully wipe the surface of the flow cell holder until it is

completely clean.

Flow Cell Lever A in OFF Position

Manifold Gaskets

(Flow Cell A)

NOTEDo not allow alcohol to drip into the vacuum holes or around the manifolds. use a low-lint lab tissue to dry the stage, if necessary.

60 CHAPTER 3



Part # 15011190 Rev. D

Figure 57 Inspect Vacuum Holes

3. Visually inspect the flow cell holder to make sure it is free of lint, and the

vacuum holes are free of obstructions.

4. Let the surface air dry before installing new gaskets.

5. Position two new gaskets in the slots on the front end and back end of

the flow cell holder.

Figure 58 Position New Manifold Gaskets

Clean the Flow Cell

1. Fold an alcohol wipe to approximately the size of the flow cell.

2. Hold the edges of the clustered flow cell with two fingers. Ensure the

inlet and outlet ports are facing up.

3. Wipe off each side of the flow cell with a single sweeping motion.

Repeat, refolding the alcohol wipe with each pass, until the flow cell is

completely clean.

4. Dry the flow cell using a dry lens cleaning tissue.

Vacuum Holes

(Flow Cell A)

Vacuum Holes

(Flow Cell B)

Manifold Gaskets

(Flow Cell A)



5. Protect the flow cell from dust until you are ready to load it onto the

HiSeq.

Load the Clustered Flow

Cell

You are ready to load the clustered flow cell.

1. Place the flow cell on the flow cell holder with the inlet and outlet ports

facing down and the barcode on the right. The arrow on the left edge of

the flow cell, which indicates flow direction, should point towards the

instrument.

2. Gently slide the flow cell towards the top and right guide pins until it

stops.

Figure 59 Position Flow Cell Against Top and Right Guide Pins

3. Move the flow cell lever slowly to position 1 (middle), until it is pointing

upward. This engages the vacuum and secures the flow cell into position.

The flow cell lever turns yellow, and then quickly blinks green. When the

flow cell lever is green, the vacuum is engaged.

If the flow cell lever remains yellow, the vacuum seal is not secure. Remove the flow cell, and inspect the gaskets and vacuum holes. Repeat the cleaning steps, if necessary, and reload the flow cell.

CAUTION

If you clean the flow cell while it is lying on the bench top, you could easily apply too much pressure and break the flow cell. Illumina recommends cleaning the flow cell while holding the edges between your fingers.

NOTEAlways replace the manifold gaskets when loading a new clustered flow cell.

NOTERemove your hand from the flow cell before engaging the vacuum switch. This prevents any pressure on the guide pins that may cause alignment drift over time.

Top Guide Pin Right Guide Pins

62 CHAPTER 3



Part # 15011190 Rev. D


4. Wait for about five seconds, and then move the flow cell lever slowly to

position 2 (far right). This raises the manifolds, allowing the gaskets to

make contact with the flow cell. When the flow cell lever is solid green,

the flow cell is ready for use.

If the flow cell lever remains yellow, the manifolds did not engage or the vacuum seal has been lost. Remove the flow cell, repeat the cleaning steps, and reload the flow cell.

Figure 61 Flow Cell Lever in Position 2 (Far-Right)

5. Ensure the Vacuum Engaged checkbox is selected on the load

sequencing flow cell screen.

Flow Cell A Vacuum Engaged



Figure 62 Load Sequencing Flow Cell

6. From the load sequencing flow cell screen, select Next to proceed to the

fluidics check.

Confirm Proper Flow

After the clustered flow cell is loaded, you are ready to check for proper flow using the fluidics check screen. Checking for proper flow confirms that the flow cell and gaskets are properly installed and the manifold is engaged.


1. Select solution 5 (SB2) from the dropdown list.


• Volume: 250



3. Select Pump.



64 CHAPTER 3



Part # 15011190 Rev. D

If you see excessive bubbles, check the gaskets for obstructions, reduce the aspiration rate to 100, and pump another 250 μl of SB2 to the flow cell. For more information, see Troubleshooting on page 106. If problems persist, contact Illumina Technical Support.

5. After you have confirmed proper flow, select Next to proceed. The

software prompts you to close the flow cell compartment door.

6. Ensure the flow cell lever is green and close the flow cell compartment

door.Ensure that the Vacuum Engaged and Door Closed checkboxes

are selected and select Next.

Figure 64 Close Flow Cell Compartment Door

7. Select Start to start the sequencing run.

Figure 65 Start Sequencing Run

Monitoring the Run 65


Monitoring the Run

The run overview screen shows the progress of your run. Use this screen to monitor on-instrument analysis, fluidics, and imaging. For more information, see Run Overview on page 26.

If you are performing a paired-end sequencing run, be prepared to load paired-end reagents and fresh sequencing reagents prior to the start of Read 2 resynthesis. For more information, see Preparing ICR for Read 2 on page 70 and Preparing Paired-End Reagents on page 71.

Figure 66 Run Overview

1. Use the progress bar to monitor how many cycles are complete.

2. View the flow cell image to monitor which lanes have been imaged for

that cycle and to visualize fluidics flow and temperature changes.

3. Select the arrow button to expand the analysis section to monitor cluster

intensities, cluster density, and Qscores.

• Flow Cell Chart—Metrics displayed per tile on the flow cell image,

filtered by cycle and base (when appropriate). The color bar to the

right indicates the values that the colors represent.

— Intensity—Displays cluster intensity by base.

— FWHM—Displays the focus quality, as indicated by the full width

at half maximum of clusters (in pixels).

— % Base—Displays the bases read on the flow cell.

— % >Q20—Displays the percentage of bases with a quality score

of 20 or higher by cycle for each tile, generated after cycle 25.



— Error rate—Displays the calculated error rate, as determined by a

spiked in PhiX control sample.

Run Configuration

Analysis

Run Progress

Images

Fluidics and Temperature

66 CHAPTER 3



Part # 15011190 Rev. D

• Data By Cycle—Metrics displayed per cycle, filtered by lane, surface,

and base (when appropriate).

— Intensity—Displays cluster intensity by base.

— FWHM—Displays the focus score, as indicated by the full width

at half maximum of clusters (in pixels).

— % Base—Displays the bases read.





— Error rate—Displays the calculated error rate, as determined by a

spiked in PhiX control sample.

— % Perfect Reads—displays the percentage of perfect reads,

determined by a spiked in PhiX control sample.

• Data By Lane—Metrics displayed per cycle, filtered by surface and

read (when appropriate).

— Clusters—The density of clusters detected by image analysis,

and density of clusters passing filtering.

— % Phasing—The percentage of molecules in a cluster for which

sequencing falls behind (phasing) or jumps ahead (prephasing)

the current cycle within a read.

— % Prephasing—The percentage of molecules in a cluster for

which sequencing jumps ahead the current cycle within a read.

— % Aligned—The percentage of the sample that aligned to the

PhiX genome. Only informative if the lane contains a PhiX

control sample.

• Qscore Distribution—Histogram of quality scores across all cycles

and lanes. Filter data by cycle, lane, and surface.

• Qscore Heatmap—Heatmap of quality scores. Filter data by lane

and surface.

• Plot Features—The plots share the following features:

— The red line indicates the median tile value.

— The box outlines the interquartile range (the middle 50% of the

data) for the tiles analyzed for the data point.

— The error bars delineate the minimum and maximum without

outliers.

— The outliers are the values that are more than 1.5 times the

interquartile range below the 25th percentile, or more than 1.5

times the interquartile range above the 75th percentile. Outliers

are indicated as dots.

— The numbers above the X-axis indicate the number of analyzed

tiles used for the data point.



Figure 67 Analysis Expanded

4. Select the arrow button to expand the fluidics section and monitor

individual steps in the protocol, temperature changes, and reagent

locations.

Figure 68 Fluidics Expanded

5. Select the arrow button to expand the images section and monitor

image samples and associated data.

NOTECycle 4 takes longer to process due to analysis template generation. This delay is normal.

68 CHAPTER 3



Part # 15011190 Rev. D

Figure 69 Images Expanded

6. Access the status page generated by Real Time Analysis (RTA). The

status page provides access to analysis metrics in plots, graphs, and

tables. For more information, see Real Time Analysis on page 93.

Figure 70 Access the Status Page

Open Status Page



First-Base Incorporation

The first base report confirmation dialog box appears automatically after cycle one is complete, if you selected the Confirm First Base checkbox on the scan parameters screen.

If you did not select the checkbox, the run continues after first base incorporation without prompting you to review the first base report. For more information, see Scan Parameters: Advanced Settings on page 18.

Figure 71 First Base Report

1. Review the first base report from the first base report confirmation dialog

box or by opening First_Base_Report.txt from the root level of the run

folder.

2. If the results are satisfactory, select Continue to continue your run.

70 CHAPTER 3



Part # 15011190 Rev. D

Preparing ICR for Read 2

Use the following instructions to prepare ICR for Read 2. If you are preparing reagents for Read 2 from a new Sequencing Kit, thaw and prepare sequencing reagents as described in Preparing Sequencing Reagents on page 39.

Thaw Reagents 1. Leave LRP (Long Read DNA Polymerase) in -15° to -25°C storage until

you are ready to prepare ICR.

2. Remove two tubes of LFN from -15° to -25°C storage and thaw at 2° to

8°C overnight.

3. Invert each tube several times and ensure it is completely thawed.

4. Use ICR directly from 2° to 8°C storage.

Prepare ICR for 101 Cycles

1. Add the contents of two tubes of LFN to the bottle containing 47 ml of

ICR.

2. Rinse each tube of LFN with ICR to ensure that all LFN is transferred.

3. Aliquot 1.1 ml of LRP into the ICR/LFN mix.

4. Cap the bottle and invert several times to mix.


Preparing Paired-End Reagents 71


Preparing Paired-End Reagents

The following reagents are used for Read 2 resynthesis prior to the start of Read 2. They are provided in HiSeq Read 2 Cluster Resynthesis Kit, which is box 2 of the HiSeq Paired-End Cluster Generation Kit. For more information, see HiSeq Paired-End Reagents on page 11.

If you are performing a multiplexed sequencing run, use the multiplexing-specific primer provided in the Multiplexing Sequencing Primers and PhiX Control Kit during the resynthesis step. Prepare Multiplexing Rd2 Seq Primer instead of HP2 for multiplexed runs.

Thaw Reagents 1. Remove the following Read 2 resynthesis reagents from -15° to -25°C

storage:

• HT2 (Wash Buffer)

• HP3 (2 N NaOH)

• AT2 (100% Formamide)

• APM2 (AMX2 Premix)

• AMX2 (Amplification Mix 2)

• BMX (Blocking Mix)

• LMX2 (Linearization Mix 2)

• RMX (Resynthesis Mix)

• HP2 (Sequencing Primer Mix 2) (For standard paired-end runs)

• Multiplexing Rd2 Seq Primer (For multiplexed paired-end runs)

2. Thaw at room temperature or in a beaker containing room temperature

deionized water.

Prepare Reagents

Prepare RMX, LMX2, BMX, and AMX2

1. Invert each thawed tube five times to mix the reagent.

2. Briefly pulse centrifuge to collect reagent droplets.


Prepare APM2, AT2, and HT2




the HiSeq.

Prepare HP3

Dilute HP3 (2 N NaOH) to 0.1 N NaOH prior to loading it onto the HiSeq.

72 CHAPTER 3



Part # 15011190 Rev. D

1. Invert the thawed tube of HP3 five times to mix, and then pulse

centrifuge the reagent.

2. Transfer 2.85 ml of PW1 (provided in the HiSeq Sequencing Kit) into a

15 ml conical tube and add 150 μl of HP3.

3. Invert the tube five times to mix the reagent.


the HiSeq.

Prepare HP2 (Standard Paired-End Runs)




the HiSeq.

Prepare Multiplexing Rd2 Seq Primer (Multiplexed Paired-End Runs)

Multiplexing Rd2 Seq Primer is a component of the Multiplexing Sequencing Primers and PhiX Control Kit.

1. Transfer 2,985 μl of Hybridization Buffer into a 15 ml conical tube, and

add 15 μl of Multiplexing Rd2 Seq Primer.

2. Vortex the tube to mix the reagent.


4. Set aside at room temperature.

Changing Reagents During a Run 73


Changing Reagents During a Run

Use the following instructions to load fresh reagents during a run.

1. From the run overview screen, select Pause. The pause menu appears.

2. Select Change Reagents.

Figure 72 Pause Menu

3. Select Yes to confirm the pause command. The run pauses only after the

current operation is complete and the flow cell is placed in a safe state.

Figure 73 Confirm Pause Command

4. Enter the following reagent parameters:

• Reagent kit ID for any reagents you are loading.

• Indicate if you are using a new kit or how many cycles the reagents

are expected to last.

Figure 74 Reagent Parameters

Change Reagents

74 CHAPTER 3



Part # 15011190 Rev. D

5. Select Next to proceed to loading reagents.


NOTEThe priming checkbox is disabled on the change reagents screen. Priming is not required.

Loading ICR for Read 2 75


Loading ICR for Read 2

Load fresh ICR for Read 2 after the completion of Read 1, and the Index Read if applicable.

1. Record the weight of ICR on the lab tracking form.


Figure 76 Reagent Racks


motion:






handle.

5. Remove the existing bottle of ICR from position 1 of the reagent rack and

remove the funnel cap from the bottle.

6. Place the funnel cap on the new bottle of ICR and load the bottle in

position 1 on the reagent rack, making sure that the conical end of the

bottle rests in the indentation on the base of the rack.



NOTEWeighing reagents before and after a sequencing run confirms proper reagent delivery.

Reagent Rack for

Paired-End Reagents


Sipper Handles

76 CHAPTER 3



Part # 15011190 Rev. D

8. Lower the sippers into the reagent bottles of the appropriate rack using

the following motion:


b. Lower the sipper handle while pulling it towards you.

c. Release the sipper handle into the slot on the bottom end of the

groove. You should feel the sipper handle rest securely into the slot.

9. Visually inspect the sippers to ensure they are centered inside the

bottles, and did not bend as they were lowered into the funnel caps.


11. Select Next to resume the run.

Loading Paired-End Reagents 77


Loading Paired-End Reagents

If you are performing a paired-end run, you need to load reagents onto the paired-end reagent rack prior to the start of Read 2 resynthesis.

The paired-end rack is located to the left of Rack A and holds two sets of paired-end reagents, one for each flow cell.

Figure 77 Rack for Paired-End Reagents

1. Record the weight of each reagent on the lab tracking form.

2. Make sure the paired-end rack is not in use for Read 2 resynthesis or

Index Read preparation on the opposite flow cell.

3. Raise the sippers for the paired-end reagent rack using the following

motion:


b. Push the handle up while pulling it towards you.

c. Release the handle into the slot on top end of the groove. You

should feel the handle rest securely into the slot.


handle.

NOTE

If you are performing a multiplexed sequencing run, load the multiplexing-specific primer (Multiplexing Seq Rd2 Primer) in position 16 on the paired-end rack. Otherwise, load HP2 in position 16.

NOTEIt is very important to ensure that reagents are thoroughly mixed before loading them onto the instrument.

Reagent Rack for

Paired-End Reagents

Sipper Handle

78 CHAPTER 3



Part # 15011190 Rev. D

5. Place each of the reagent tubes onto the rack in the associated

numbered positions.

Figure 78 Paired-End Reagent Rack

6. Remove the caps from each reagent tube.



Table 9 Paired-End Reagent Positions


10 RMX Resynthesis Mix

11 LMX2 Linearization Mix 2

12 BMX Blocking Mix

13 AMX2 Amplification Mix 2

14 APM2 AMX2 Premix

15 AT2 100% Formamide

16 HP2 Sequencing Primer Mix 2

(For standard paired-end runs)

Multiplexing Primer Multiplexing Rd2 Seq Primer

(For multiplexed paired-end runs)

18 HP3 0.1 N NaOH

19 HT2 Wash Buffer

10

AAA B

11

12

13

14

15

16

17

18

19

10

11

12

13

14

15

16

17

18

19 HT2

AMX2

BMX

AT2

APM2

HP2 (Standard paired-end runs)

Multiplexing Rd2 Seq Primer (Multiplexed paired-end runs)

HP3

LMX2

RMX

Loading Paired-End Reagents 79


8. Lower the sippers into the paired-end reagent tubes using the following

motion:


b. Lower the handle while pulling it towards you.

c. Release the handle into the slot on the bottom end of the groove.

You should feel the handle rest securely into the slot.

9. Visually inspect the sippers to ensure they are centered inside the tubes,

and did not bend as they were lowered into the tubes.


11. Select Next to resume the run.

80 CHAPTER 3



Part # 15011190 Rev. D


Chapter 4

Post-Run Procedures


83 Unloading Reagents

84 Performing a Maintenance Wash

89 Performing a Post-Run Instrument Wash

82 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

Introduction

Post-run procedures include the removal and weighing of reagents, and an instrument wash. It is important to regularly wash the lines of the HiSeq to ensure optimum performance. Instrument washes are initiated from the HCS start screen.

There are two types of washes:

Maintenance Wash—(Recommended) The maintenance wash consists of

three wash steps, and flushes the entire system for both flow cell A and

flow cell B. Perform a maintenance wash after the completion of a single-

read run or a paired-end run.

If the instrument has been idle for one day or more, perform a wash before starting a new run.

Post-Run Wash—This wash flushes the lines with water for either flow

cell A or flow cell B. Perform a post-run wash after the completion of a

single-read run.

Unloading Reagents 83


Unloading Reagents

When the run is complete you are ready to unload reagent racks and weigh reagents.



motion:






handle.

4. Remove each bottle from the reagent rack and record the weight on the

lab tracking form.

84 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

Performing a Maintenance Wash

Perform an instrument maintenance wash after each run to ensure optimal instrument performance.

The maintenance wash consists of three wash steps. The first wash flushes the system with SuperQ water or other laboratory-grade water, followed by a wash with NaOH, and finishes with a second wash of SuperQ water or other laboratory-grade water.

Consumables User-Supplied48 bottles, 250 ml (Corning, catalog # 430776)

(Eight bottles per wash step, per flow cell rack)

60 tubes, 15 ml (Corning, catalog # 430052)

(20 tubes per wash step)

SuperQ water or other laboratory-grade water

1 N NaOH

Table 10 Wash Run Times

Positions Approximate Run Time Per Step

Eight SBS positions 20 minutes

Eight SBS positions

and ten paired-end positions

45 minutes

NOTE

Do not reuse the same water or wash bottles that you used for the first wash step. The water from the first wash step may be contaminated with reagents that were present on the sippers.

Performing a Maintenance Wash 85


Procedure 1. From the HCS start screen select Wash | Maintenance.

Figure 79 Select Maintenance Wash

2. Select Yes if you are washing paired-end positions. Otherwise, select No.

Select Next to proceed.

Figure 80 Wash Paired-End Reagent Lines

3. Load the instrument with SuperQ or laboratory-grade water as follows:

a. Load eight 250 ml bottles with 5 ml of laboratory-grade water and

load the bottles onto reagent rack A. Load the rack onto the

instrument.

NOTE

If the other flow cell is running at this time, the software pauses the run after the current imaging or chemistry operation is complete. The flow cell compartment door will not open until the other flow cell run is paused.

The run resumes when you close the flow cell compartment door after loading the used flow cell.

Maintenance Wash

86 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

b. Load eight 250 ml bottles with 5 ml of laboratory-grade water and

load the bottles onto reagent rack B. Load the rack onto the

instrument.

c. If you are washing paired-end positions, load twenty 15 ml tubes

with 5 ml laboratory-grade water and load the tubes onto the paired-

end reagent rack. Load the rack onto the instrument.

Figure 81 Load Wash Reagents

4. Ensure a used flow cell is loaded in the flow cell position you plan to

wash, A or B. Load a used flow cell, if necessary. For more information,

see Loading a Used Flow Cell on page 52.

Figure 82 Load Used Flow Cell

5. Select Next to proceed to the fluidics check.

6. If you loaded a used flow cell, perform a fluidics check:

a. Select solution 2 from the dropdown list.

NOTEIllumina recommends a fluidics chech before an instrument wash. However, you can bypass this step if you can confirm the flow cell has not been removed and the seal is secure.

Performing a Maintenance Wash 87


b. Enter the following default values:

— Volume: 250

— Aspiration Rate: 250

— Dispense Rate: 2,000

c. Select Pump.

d. Visually inspect the flow cell for bubbles passing through the lanes

and leaks near the manifolds.


7. Loosen and remove the eight lines of waste tubing for the appropriate

flow cell from the waste container.

8. Bundle the eight lines of waste tubing with parafilm, making sure to keep

all of the ends even. Place the bundled tube ends into a 250 ml bottle.

9. Select Next.

10. When the wash is complete, measure the delivered volume.

11. Return the waste tubing to the waste bottle.

12. Proceed to the NaOH wash.

NOTEBe sure you do not include the line from the condensation pump or the two lines from the paired-end priming pumps.

Table 11 Expected Wash Delivery

Positions Delivered Volume

Eight SBS positions 32 ml

Eight SBS positions


72 ml

88 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

NaOH Wash

1. Load the instrument with 1 N NaOH as follows:

a. Load eight 250 ml bottles with 5 ml of NaOH and load the bottles

onto reagent rack A. Load the rack onto the instrument.

b. Load eight 250 ml bottles with 5 ml of NaOH and load the bottles

onto reagent rack B. Load the rack onto the instrument.


with 5 ml NaOH and load the tubes onto the paired-end reagent

rack. Load the rack onto the instrument.

2. Select Next to start the NaOH wash.

3. When the NaOH wash is complete, measure the delivered volume.

4. Proceed to the final wash with laboratory-grade water.

Final Water Wash

1. Load the instrument with SuperQ or laboratory-grade water as follows:

a. Load eight 250 ml bottles with 5 ml of laboratory-grade water and

load the bottles onto reagent rack A. Load the rack onto the

instrument.

b. Load eight 250 ml bottles with 5 ml of laboratory-grade water and

load the bottles onto reagent rack B. Load the rack onto the

instrument.


with 5 ml laboratory-grade water and load the tubes onto the paired-

end reagent rack. Load the rack onto the instrument.

2. Select Next to start the final water wash.

3. When the NaOH wash is complete, measure the delivered volume.

Performing a Post-Run Instrument Wash 89


Performing a Post-Run Instrument Wash

The post-run instrument wash flushes PW1, provided in the HiSeq Sequencing Kit, through the system for flow cell A or flow cell B. You can perform an instrument wash on one flow cell while the other flow cell is processing.

Normally, the post-run instrument wash is performed when a sequencing run is complete. However, if the instrument has been idle for one day or more, perform the wash before you begin a new run.

After the wash, check the total volume in the waste container to confirm the stability of the reagent delivery system. Expected volumes from the wash cycle are a primary indicator of a stable fluid delivery system.

Consumables Illumina-SuppliedPW1 (provided in the Sequencing Kit)

User-SuppliedEight 250 ml bottles (Corning, catalog # 430776)

Ten 15 ml conical tubes (Corning, catalog # 430052)

Procedure 1. From the HCS start screen select Wash | Post-Run.

Figure 84 Select Post-Run Wash

2. Select Yes if you are washing paired-end positions after a paired-end or

multiplexed run. Otherwise, select No.

NOTE

If the other flow cell is running at this time, the software pauses the run after the current imaging or chemistry operation is complete. The flow cell compartment door will not open until the other flow cell run is paused.

The run resumes when you close the flow cell compartment door after loading the used flow cell.

Post-Run Wash

90 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

Figure 85 Wash Paired-End Reagent Lines

3. Select Next to proceed to loading of wash reagents.

4. Load eight 250 ml bottles with 20 ml of PW1 and load the bottles onto

the corresponding reagent rack (A or B). Load the rack onto the

instrument.

Figure 86 Load PW1 in Wash Positions

5. If you are washing paired-end positions after paired-end or multiplexed

runs, load ten 15 ml tubes with 4 ml of PW1 and load the tubes onto the

corresponding row of the paired-end reagent rack. (A is on the left side,

B is on the right side.) Load the rack onto the instrument.

6. Select Next to proceed.

7. Ensure a used flow cell is loaded in the flow cell position you plan to

wash, A or B. Load a used flow cell, if necessary. For more information,

see Loading a Used Flow Cell on page 52. Select Next to proceed.

Performing a Post-Run Instrument Wash 91


Figure 87 Load Used Flow Cell

8. If you loaded a used flow cell in the previous step, perform a fluidics

check:

a. Select solution 2 from the dropdown list.

b. Enter the following default values:

— Volume: 250,

— Aspiration Rate: 250,

— Dispense Rate: 2,000,

c. Select Pump.

d. Visually inspect the flow cell for bubbles passing through the lanes

and leaks near the manifolds.


9. Loosen and remove the eight lines of waste tubing for the appropriate

flow cell from the waste container.

NOTEBe sure you do not include the eight lines for the opposite flow cell, the condensation pump, or the two lines from the paired-end priming pumps.

92 CHAPTER 4

Post-Run Procedures


Part # 15011190 Rev. D

10. Bundle the eight lines of waste tubing with parafilm, making sure to keep

all of the ends even. Place the bundled tube ends into a 250 ml bottle.

11. Select Next to start the instrument wash.

Figure 89 Post-Run Wash In Progress

12. When the wash is complete, measure the delivered volume. Record the

delivery volume on the lab tracking form.

13. Return the waste tubing to the waste bottle.

Table 12 Wash Run Times

Positions Approximate Run Time

Eight SBS positions 20 minutes

Eight SBS positions


45 minutes

Table 13 Expected Wash Delivery

Positions Delivered Volume

Eight SBS positions 32 ml

Eight SBS positions


72 ml


Chapter 5

Real Time Analysis


95 Monitoring Runtime Statistics

101 Real Time Analysis Output Data

94 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D

Introduction

The HiSeq Control Software (HCS) performs real time image analysis and base calling, and provides fast access to quality metrics. The analysis is performed during the chemistry and imaging cycles of a sequencing run, which saves downstream analysis time and allows you to quickly decide whether or not your run is progressing as expected.

HCS real time analysis (RTA) runs automatically on the instrument computer, and is configured through the HCS interface at the beginning of a run.

Data Transfer The output from a sequencing run is a set of quality-scored base call files (*.bcl files), which are generated from the raw image files and contain the base calls per cycle. By default, images are deleted from the instrument computer after image analysis. The raw image data are not needed for downstream analysis, and in fact the two 1.5 TB hard drives can only store images from approximately 20 cycles.

If for any reason image analysis runs behind, HCS will stop sequencing and store the flow cell in a safe state. Sequencing can be resumed once the analysis issues have been resolved.

Analysis of RTA Data

Base calling data generated with RTA in the *.bcl file format needs to be converted into *_qseq.txt files using the BCL Converter. For instructions, see the BCL Converter User Guide. Data in the *_qseq.txt file format can be used for alignment in the GERALD module of the CASAVA software v1.7. For instructions about using GERALD, see the CASAVA Software Version 1.7 User Guide.

If you need to perform base calling or image analysis offline, use the OffLine Base Caller (OLB). For instructions about using OLB, see the OffLine Base Caller User Guide.

NOTE

If for any reason RTA stops functioning, the software automatically resumes analysis during the next cycle at the appropriate point on the flow cell. Do not restart the application manually.

NOTEYou can configure the instrument to save images but this will affect performance significantly.

Monitoring Runtime Statistics 95


Monitoring Runtime Statistics

Once RTA has started analyzing tiles, it automatically opens the Status page (Status.htm file). This page provides access to the most important runtime statistics, and summarizes the analysis configuration.

Not all metrics are available at the early cycles, since some processes need multiple cycles to provide meaningful data. These processes are listed below:

The software will not start with image analysis until after cycle fourfive,

since it first needs to generate a template with cluster locations. At cycle

fourfive the software will catch up with the image analysis.

The software will generate phasing/prephasing estimates and base calls

after cycle 12.

The software will generate error rates (if a PhiX control was included), and

quality scoring after cycle 25.

Status Page The Status page (Figure 90) reports the progress of the analysis, and provides access to the most important runtime statistics. The statistics are updated as soon as there is new analysis information available. The runtime statistics can be viewed from any computer with access to the experiment run folder. Navigate to the <RunFolder>\Data folder and open the Status file. The Status file is transferred to the Data subfolder in the analysis folder at the end of each cycle that is processed.

NOTE

Since HiSeq catches up with the image analysis during cycle four, this cycle takes significantly longer to finish. HiSeq will wait for the analysis to end before proceeding with the next cycle; this is normal behavior.

NOTEYour browser may warn you about active content. If so, click the warning in the information bar and allow blocked content.

96 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D

Figure 90 Status Page

General Run Information

The Run Info link of the Status page shows a page with general run information, such as run name, instrument name, input and output directories, and configuration settings.

Tile Status Summary

The Tile Status link leads to a page showing the progress of the analysis in the Tile Status Summary (Figure 91). The colors indicate the status of the image analysis for a tile for a particular cycle, as indicated in the legend to the right. The tiles are organized by lane, and each lane has four columns. The first two columns are for the top surface of that lane, swath 1 and swath 2 respectively. A swath is a column of tiles in one lane, and there are two swaths per tile surface. The last two columns are for swath 1 and swath 2 of the bottom surface. Clicking the Refresh button makes sure you see the most recent data.

Figure 91 Tile Status Summary

Links to Runtime Statistics

Progress status by cycleRefresh button



In every tile, two numbers indicate the progress of base calling and quality scoring. For every tile, the top number indicates the last cycle that has been base called, and the bottom number the last cycle for which quality has been scored.

Figure 92 Base Calling and Quality Scoring Progress

Charts The Charts link leads to a page with color coded quality metrics displayed per tile in three charts. The chart to the left displays cycle and base-independent metrics (cluster density, percentage clusters passing filter, and density of clusters passing filter), which can be selected through the dropdown lists. The two charts to the right display metrics that are cycle- and base-dependent (intensity, focus quality, error rate, and percentage base calls with Q >=30). The charts can be viewed using the default scale, or displayed with tailored scaling by checking the Autoscale checkbox.

You can select the displayed metric, cycle, and base through the dropdown lists. The color bars to the right of each chart indicate the values that the colors represent. Tiles that have not been measured or are not monitored are gray. The interactive tooltips provide the lane, tile and value of the data point.

Figure 93 Quality Metrics Charts Page

You can monitor the following quality metrics with these charts:

ClusterDensity—This chart displays the cluster density for each tile in

clusters per mm2. This chart will be generated after the second cycle.

%Cluster PF—This chart displays the percentage of clusters passing filter

for each tile. These charts will not be generated until after the 25th cycle.

Cluster PF Density—This chart displays the density of clusters passing

filter for each tile in clusters per mm2. These charts will not be generated

until after the 25th cycle.

Last base-called cycle for tile

Last quality-scored cycle for tile

Autoscale checkbox

98 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D

Intensity—This chart displays the intensity by color and cycle of the

middle 90% of the data for each tile.

Focus Quality—This chart displays the focus quality by color and cycle

for each tile, as indicated by the full width at half maximum of clusters (in

pixels).

%Q>=30—This chart displays the percentage of bases with a quality

score of 30 or higher by cycle for each tile. These charts will not be

generated until after the 25th cycle.

Error Rate—This chart displays the calculated error rate, as determined

by a spiked in PhiX control sample. If no PhiX control sample is run in the

lane, this chart is not available.

Quality Metrics Summary

The Summary link leads to two tables with basic data quality metrics summarized per lane and per read. All the statistics are given as means and standard deviations over the tiles used in the lane. The following items are displayed:

Lane—The number of the lane.

Tiles—The number of tiles per lane.

Clu.Dens.—The number of clusters per mm2 detected by image analysis.

% PF Clusters—The percentage of clusters passing filtering.

Clusters PF (#/mm2)—The number of detected clusters per mm2 that

meet the filtering criterion.

% Phas./Preph.—The value used by RTA for the percentage of

molecules in a cluster for which sequencing falls behind (phasing) or

jumps ahead (prephasing) the current cycle within a read.

% Aligned—The percentage of the sample that aligned to the PhiX

genome.

% Error Rate—The calculated error rate, as determined by the PhiX

alignment.

1st Cycle Int—The average of the four intensities (one per channel or

base type) measured at the first cycle averaged over filtered clusters.

% Intensity Cycle 20—The corresponding intensity statistic at cycle 20

as a percentage of that at the first cycle.

Plots The Status page displays important quality metric plots that are updated every minute. The plots share the following features:

The red line indicates the median tile value.

The box outlines the interquartile range (the middle 50% of the data) for

the tiles analyzed for the data point.

The error bars delineate the minimum and maximum without outliers.

The outliers are the values that are more than 1.5 times the interquartile

range below the 25th percentile, or more than 1.5 times the interquartile

range above the 75th percentile. Outliers are indicated as dots.

The numbers above the X-axis indicate the number of analyzed tiles used

for the data point.

Click the Refresh button at any time to see the latest data.



Cluster Density

The first plot link (Cluster Density) leads to a cluster density plot, which displays the number of clusters/mm2 for each lane (Figure 94).The data in this plot are populated as soon as the first cycle is processed with an estimate, and the final data appear after cycle 4. The raw cluster densities (blue boxes) and passing filtering cluster densities (green boxes) are displayed; select the Show PF only checkbox if you want to see the density of clusters that passed filtering.

Figure 94 Numbers of Clusters by Lane

The table below the plot contains the following raw cluster density metrics that are also graphed in the plot:

MIN—The minimum without outliers.

MAX—The maximum without outliers.

P50—The 50th percentile (median tile value).

Data By Cycle

The next plot link leads to two plots for which you can pick the metric and base using the dropdown lists:

The Intensity plot displays the intensity by base and cycle of the middle

90% of the data (Figure 95).

The Focus Quality plot displays focus quality by base and cycles.

The Quality Score plot displays quality score by base and cycles.

The %Q>=30 plot displays the percentage of bases with a quality score

of 30 or higher by cycle for each lane. These plots will not be generated

until after the 25th cycle.

100 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D

The Error Rate plot displays the calculated error rate for each lane, as

determined by alignment to PhiX of a PhiX control sample. The data in

this plot are populated after cycle 25. If no PhiX control sample is run in

the lane, this chart may show an artificially high error rate, accompanied

by a very low (close to zero) percentage of fragments aligned to the PhiX

control. This is normal behavior.

Scroll to the right to view later cycles.

Figure 95 Intensity by Color and Cycle

Real Time Analysis Output Data 101


Real Time Analysis Output Data

RTA output results are saved on the analysis server you specified during the run configuration. This section describes the purpose and location of the output data.

Real Time Analysis Folder

The figure below illustrates the organization of the network analysis folder, including the location of the most important output files. All analysis results are saved in an analysis folder that is given the same name as the Run folder on the instrument computer.

;

Figure 96 Real Time Analysis Folder

Analysis Results The analysis folder contains the following key files:

Key File Subfolder Description

Status.xml AnalysisFolder\Data Contains run and analysis-specific metrics generated during the run. See Status Page on page 95 for a description of the metrics.

BustardSummary.xml AnalysisFolder\Data\ Intensities\Basecalls\

Contains run- and analysis-specific metrics generated after base calling.

*.bcl files AnalysisFolder\Data\ Intensities\Basecalls\ L00X\CX.X

Each *.bcl file contains RTA base calling and base quality scoring results for one cycle, one tile. These files are used by the BCL Converter; for a description, see Main Sequence Output Files on page 102.

*.stats files AnalysisFolder\Data\ Intensities\Basecalls\ L00X\CX.X

*.stats files contain RTA base calling statistics per cycle, per tile. These files are used by the BCL Converter.

102 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D

Tile Numbering

Tile-specific files contain the tile number in the file name. The logic of tile numbering in a lane is as follows:

Tiles 1–8 are from swath 1 of the top surface

Tiles 21–28 are from swath 2 of the top surface

Tiles 41–48 are from swath 1 of the bottom surface

Tiles 61–68 are from swath 2 of the bottom surface

A swath is a column of tiles, and there are two swaths per lane per surface.

Main Sequence Output Files

The main sequence output files from RTA are the *.bcl and _qseq.txt files. Bcl files are generated every cycle, for each tile, and can be moved off the instrument and used for analysis once a cycle is fully analyzed. _qseq.txt files are generated once a read is complete, and contain the base calls and quality scores for all cycles of one read for each tile.

*.filter files AnalysisFolder\Data\ Intensities\Basecalls

*.filter files contain filter results per tile. These files are used by the BCL Converter.

SampleSheet.csv AnalysisFolder\Data\ Intensities\Basecalls\

Contains sample information, including multiplexing information.

config.xml AnalysisFolder\Data\ Intensities\

AnalysisFolder\Data\ Intensities\Basecalls\

Contains meta-information about the run, image analysis, and base calling.

RunInfo.xml AnalysisFolder\ Identifies the boundaries of the reads (including index reads), the Flowcell ID (if available), and the quality table selected for run.

ErrorLog.txt AnalysisFolder\Data Any error during an HCS real time analysis run is captured here. If there are no errors, no ErrorLog.txt file will be present.

CopyLog.txt AnalysisFolder\Data All copy events during an HCS real time analysis run are captured here.

*.cif files AnalysisFolder\Data\ Intensities\L00X\CX.X

Each binary *.cif file contains RTA image analysis results for one cycle, one tile. These files should be used in the OLB analysis software if you want to perform BUSTARD base calling; for a description, see the Off-line Base Caller User Guide.

*_pos.txt files AnalysisFolder\Data\ Intensities\

Reports the cluster coordinates. There is one *_pos.txt file for each tile. These files should be used in the OLB analysis software if you want to perform BUSTARD base calling.

*.jpg files AnalysisFolder\ Thumbnail_Images\ L00X\CX.X

HCS can generate thumbnail images (*.jpg files) of nine locations from each tile. The thumbnails are generated for each cycle and base, and can be used to troubleshoot a run. For more information, see Thumbnail Images on page 103.

Key File Subfolder Description

Real Time Analysis Output Data 103


*.bcl files

A *.bcl file contains base calls and quality scores for one cycle and one tile. The *.bcl files are in binary format and need to be converted to the _qseq.txt

format in OLB by the BCL Converter (see the BCL Converter User Guide).

Stats files

The Stats file is a binary file containing base calling statistics; the data is for clusters passing filter only. These files are used by the BCL Converter.

Filter files

The *.filter files are binary files containing filter results. These files are used by the BCL Converter.

Thumbnail Images

You can configure HCS to generate thumbnail images (.jpg files) from each swath. The thumbnails are generated for each cycle and base.

HCS combines images from nine sections of a swath. These nine images are combined in one thumbnail image (see Figure 97), and can be used to troubleshoot a run. The thumbnail images are not suitable for image analysis.

Figure 97 Thumbnail Image

Analysis Viewer The metrics generated by RTA can also be viewed from a remote location using the Analysis Viewer application, available through iCom.illumina.com. The files are located in the Interop directory. This viewer uses the same format to display the metrics as run overview screen in HCS (see Monitoring the Run on page 65).

Tile Thumbnail image

104 CHAPTER 5

Real Time Analysis


Part # 15011190 Rev. D


Appendix A

Troubleshooting


106 Troubleshooting

107 Performing a Fluidics Check

106 APPENDIX A

Troubleshooting


Part # 15011190 Rev. D

Introduction

This section describes how to troubleshoot possible problems encountered during a sequencing run and how to perfrom a fluidics check from the HiSeq start screen.

For issues not described in this section, contact Illumina Technical Support. For more information, see Technical Assistance on page 4.

Troubleshooting

Use the following table to troubleshoot possible problems encountered during a cluster generation run.

Table 14 Troubleshooting Run Problems

Problem Possible Cause Action

Flow cell lever is yellow. The flow cell did not seat properly.

The vacuum did not seal.

Manifolds did not raise.

Remove the flow cell and repeat the cleaning steps.

Ensure the gaskets are present and well-seated.

Reload the flow cell.

The software did not initialize. The software was unable to initialize internal hardware devices.

Close the error message and then relaunch the instrument software.

If the problem persists, restart the instrument computer.

If the problem persists, shut down the instrument, wait a minimum of 60 seconds, and restart the instrument.

Poor fluid delivery. Potential bubbles in the system. Reposition the flow cell and confirm that the holes are facing down.

Look for white precipitate around the gaskets. Always replace gasket before loading a new flow cell.

Confirm that the sipper assemblies are fully lowered and each sipper is in contact with the reagents.

Performing a Fluidics Check 107


Performing a Fluidics Check

The Check button on the start screen allows you to perform a fluidics check when you are not setting up a run. Use this option during instrument installation and fluidics troubleshooting.

1. Load a used flow cell onto the instrument. For more information, see

Loading a Used Flow Cell on page 52.

2. Load eight 250 ml bottles with wash solution or laboratory grade water,

and load the bottles onto the corresponding reagent rack (A or B). Load

the rack onto the instrument.

3. Select Check on the start screen.

Figure 98 Fluidics Check Button on Start Screen

4. Select solution 5 (SB2) from the dropdown list. If you are performing a

fluidics check with a used flow cell installed, you can select solution 2,

which is water.


Check

108 APPENDIX A

Troubleshooting


Part # 15011190 Rev. D


• Volume: 250



6. Select Pump. If you need to pause the fluidics check, select Pause.



If you see excessive bubbles, check the gaskets for obstructions, reduce the aspiration rate to 100, and pump another 250 μl of water to the flow cell. For more information, see Troubleshooting on page 106. If prob-lems persist, contact Illumina Technical Support.


Index

A

activity indicators 16

analysis folder 101

analysis results 101

B

base calling results 33

BustardSummary.xml 101

C

cif files 101, 102

clusters

measuring intensity 96

components

flow cell compartment 5, 7, 52

fluidics compartment 5optics module 5reagent compartment 5, 6, 47, 75,

83

config.xml 33, 102

consumables

HiSeq Sequencing Kit 10

Illumina sequencing kits 8Multiplexing Sequencing Primers

and PhiX Control Kit 12, 43

Read 2 Cluster Resynthesis Kit 11

user supplied 9customer support 4

D

data transfer 94

disk space, checking 34

documentation 4

F

first-base incorporation

confirmation 19, 27, 44, 69

report location 19, 32

flow 59

flow cell

cleaning 60

loading 23, 24, 52, 58

recording flow cell ID 18

troubleshooting 106

flow cell compartment 5, 7, 52

flow cell lever 54, 61

fluidics check 23, 25, 55, 63

fluidics compartment 5fluidics, troubleshooting 106

focus

quality 99

funnel caps 8

H

help, technical 4HiSeq Control Software 15–34

I

images

saving images samples 19

thumbnails 19

indexing parameters screen 21, 46

L

loading reagents 22, 47, 71, 75, 77, 83

M

maintenance wash 16, 82, 84

manifold gaskets 8metrics

cluster intensity 96

monitoring 65

cluster intensities 65

image samples 67

run fluidics 67

multiplexed sequencing

indexing parameters screen 21

reagents 12, 72

reagents, loading 50

110 Index


Part # 15011190 Rev. D

reagents, preparing 43

workflow 37

N

numclusters by lane 99

O

optics module 5

P

paired-end sequencing

reagents 11

reagents, loading 77

reagents, preparing 71

workflow 37

Pipeline analysis 94

pos.txt files 102

post-run wash 16, 82, 89

priming

preparation 56

waste volume 57

priming reagents 24

Q

qseq.txt files 103

R

reagent compartment 5, 6, 47, 75, 83

reagent parameters screen 20

reagent positions

flow cell A or B 48

multiplexing 50

paired end 78

reagents

allocating for shorter runs 41

ICR for 101 cycles, preparing 39

loading 22, 47, 50, 75, 77, 83

multiplexing 12, 43, 72

paired end 11, 71, 77

priming 24, 57

reagent parameters screen 20

recording kit ID 20

sequencing 10, 39, 47, 70, 75, 83

real time analysis. See SCS real time

analysis

recipe folder 33

recipe parameters screen 19, 44

reports

cluster intensity 96

first-base incorporation 19, 32, 69

run folder contents 32

review run setup screen 22, 46

RTA. See SCS real time analysis

run folders 32

run overview screen 26, 65

RunInfo.xml 32, 102

S

scan parameters screen 17, 44

SCS real time analysis 94

analysis folder 101

analysis results 101

data transfer 94

focus quality 99

numclusters by lane 99

Pipeline analysis 94

quality metrics 95

runtime statistics 95

status page 95

tile status summary 96

sequencing consumables 8, 39, 70

software

HiSeq Control 15–34

initialization 38

troubleshooting 106

status alert icon 17

status page 68, 95

Status.xml 101

status.xml 33

T

technical assistance 4tile status summary 96

troubleshooting 106

U

user-supplied consumables 9

W

washes

consumables, user-supplied 41, 47, 84, 89

delivered volumes 87, 92

maintenance wash 16, 82, 84

post-run wash 16, 82, 89

workflow, sequencing 37

Illumina, Inc.

9885 Towne Centre Drive

San Diego, CA 92121-1975

+1.800.809.ILMN (4566)

+1.858.202.4566 (outside North America)

[email protected]

www.illumina.com

hiseq 2000 user guide - rikenfantom.gsc.riken.jp/.../11/hiseq2000_userguide...d.pdf · hiseq 2000...

Documents