[CANCER RESEARCH 59, 4219–4221, September 1, 1999]

Advances in Brief

Heat Shock Cognate 70 Mutations in Sporadic Breast Carcinoma1

Christopher J. Bakkenist,2,3 John Koreth,2 Cory S. M. Williams, Nicholas C. A. Hunt, and James O. McGeeUniversity of Oxford, Nuffield Department of Pathology and Bacteriology, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom

Abstract

Heat Shock Cognate 70 (HSC70) is a constitutively expressed molecularchaperone, functions of which regulate the structure, subcellular localiza-tion, and turnover of cell proteins. It is also a component of the centro-some facilitating rearrangements during mitotic/meiotic spindle forma-tion and cytoplasmic microtubule organization. We localizedHSC70 to11q23.3, a region deleted in 40% of sporadic breast and other cancers.Sequencing demonstrated mutation in the NH2-terminal ATPase domainof HSC70 in 2 of 15 sporadic breast carcinomas examined. In both cases,mutation was coincident with allelic imbalance, suggesting thatHSC70 isa target of somatic mutation and deletion in a fraction of breast carcino-mas.

Introduction

HSC704 is a constitutive member of the highly conserved heatshock protein 70 family, which generally comprises;1% of totalcellular protein with possibly higher levels in transformed cells (1).HSC70 has several known functions: it is the uncoating ATPase forthe disassembly of clathrin-coated vesicles (involved in intracellularreceptor mediated transport; Ref. 2); it is a molecular chaperonefacilitating correct folding of nascent polypeptides (3); it enablesprotein translocation through the endoplasmic reticulum (Ref. 4; ste-roid hormone activation), nuclear membrane (5), and into the 26Sproteasome (Ref. 6; ubiquitin-mediated degradation); and it is anessential component of the centrosome, facilitating rearrangementsduring mitotic/meiotic spindle formation and cytoplasmic microtubuleorganization (7).HSC70has previously been located to chromosome11q23.3–q25 (8). AI has been demonstrated at 11q22–q23.1,11q23.3, and 11q25–qter in sporadic breast carcinomas at rates of60% (9, 10), 40% (11, 12), and 50% (10), respectively. Althoughsomatic mutations inATM (13) andPPP2R1B(14) at 11q22–q23.1have been identified in T-prolymphocytic leukemia (15) or malignantlung and colorectal carcinoma cell lines, respectively, genes mutatedat 11q23.3 and 11q25–qter in malignancy have remained anonymous.We fine mapped humanHSC70 and investigated its structure insporadic breast carcinomas.

Materials and Methods

Library Hybridization. A contiguous chromosome 11q22– qter YAClibrary mapped to 11q by STS content5 was plated in an ordered array.Filters were hybridized sequentially to [g-32P]ATP end-labeled oligonu-cleotides (intron 2, ctgaagagctatgaaattgaaa; and intron2/exon3, tttacagatgc-caaacgtctgatt) at 42°C overnight in 6X SSC, 5X Denhardt’s solution, 0.1%

SDS, and 100mg of denatured salmon sperm DNA, washed at 50°C in 23SSC, 1% SDS twice for 20 min, and visualized on XOMAT-AR film(Kodak) overnight at270°C.

PCR and Sequencing.Fifteen fresh cases of paired sporadic breastcarcinoma and adjacent normal breast tissues were available.HSC70exonswere amplified from 50 ng of genomic DNA using 10 pmol of each primerand 200mM deoxynucleotide triphosphates, 1.5 mM MgCl2, 50 mM KCl, 10mM Tris-HCl (pH 8.0), 0.1% Triton X-100, and 0.05 unit SuperTaq (HTBiotechnology, Cambridge, United Kingdom). Primers with intron se-quences were used because of the presence of at least two processedHSC70pseudogenes in the human genome: intron 1 to intron 3 (59-39) tggttaagt-gttctgttaag to gaatgcaccccatactggcc; intron 3 to intron 5, atagttaccaatctgt-ggtct to tgggcctgcctgcctttaggg; intron 5 to intron 8, aacaggagctatgtactgggtto catcattgtgaccctacactg; and intron 8 to 39 untranslated, aaagaacttgcagta-attcct to cattgcattttccacttaca. PCR products were resolved on 1.5% agarosegels, and DNA fragments were excised and purified (QIA Quick kit;Qiagen). The cycle was sequenced using Amplicycle (Perkin-Elmer). Se-quencing reactions were resolved on 6% denaturing urea-polyacrylamidegels and visualized on XOMAT-AR film. Mutations were confirmed bysequencing DNA fragments in both directions in duplicate from twoindependent PCR reactions.

Microsatellite Analysis. DNA samples were analyzed for polymorphicmicrosatellite repeats at two loci on chromosome 11q23.3 aroundHSC70(D11S1336andD11S1284). One of each set of primers was end-labeled with[g-32P]ATP. PCR products were resolved on 6% denaturing urea-polyacryl-amide gels and autoradiographed at275°C using intensifying screens andXOMAT-AR film preflashed to an absorbance of 0.15 (540 nm) for responselinearity. Informative autoradiographs were assessed for AI by software den-sitometric analysis (Quantiscan; Biosoft Ferguson, MO) using the allelic ratiomethod, with a cutoff ratio of 2.

Results

HSC70 was localized to three 11q23.3 YACs (y667F08, y881F03,and y874D02) betweenD11S1336andD11S1284(11.7 cR;;500 kb;Fig. 1A). Confirmation of this map position was obtained by PCR andSouthern blotting (data not shown). No genomic abnormalities inHSC70were detected in 15 samples of breast carcinoma and pairednormal DNA by Southern blotting (data not shown). We thereforeused PCR to amplify and sequenceHSC70 exons. In total, twosequence changes were detected in the 15 breast carcinomas. Bothwere single bp transitions (TA5CG at 1608 and TA5CG at 1680) inexon 3, and all resulted in missense mutations in the HSC70 proteinat codons 83 (GTC5Val to GCC5Ala) and 107 (TAC5Tyr toCAC5His; Figs. 1B and 2A).

Microsatellite PCR at the HSC70 locus demonstrated AI in 5 of the13 breast carcinomas with either one or both markers. Both of thecases in which mutation had been detected showed AI atD11S1336(Fig. 2B). Two patients were not polymorphic for either microsatellite.

A 2-bp polymorphism was identified in intron 2 adjacent to thesplice acceptor consensus sequence. Of the 15 paired normal andbreast carcinoma cases, 3 were heterozygous and 3 were homozygousfor a 2-bp deletion of GT at 1542, 1543. Of the two cases in whichHSC70point mutations were identified, both were homozygous forthe deletion.

Three homozygous deviations from the deposited sequence weredetected. These are CC rather than GG at 1447, 1448 in intron 2, C

Received 3/26/99; accepted 7/15/99.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby markedadvertisementin accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 C. J. B. was supported by a Cancer Research Campaign Grant (SP1888/1403). J. K.and C. S. C. W. were supported by the Rhodes Trust.

2 These authors contributed equally to this work.3 To whom requests for reprints should be addressed, at Hematology/Oncology, St.

Jude Children’s Research Hospital, 332 North Lauderdale Street, Memphis, TN 38105-2794. E-mail: Christopher.Bakkenist@stjude.org.

4 The abbreviations used are: HSC70, heat shock cognate 70; YAC, yeast artificialchromosome; AI, allelic imbalance.

5 M. R. James, unpublished data.

4219

on July 1, 2018. © 1999 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

rather than T at 3448 in intron 6, and CC rather than AA at 3795, 3796in intron 7. The deviation in intron 6 is within the sequence of a U14small nucleolar RNA required for the processing of eukaryotic ribo-somal RNA precursors. The change to C gives the human and mouseU14 small nucleolar RNAs identity at this nucleotide (16).

hsc70 sequences have been derived from malignant cell linesourced cDNA clones of mouse (F9 teratocarcinoma; Ref. 17) and rat(PC12 pheochromocytoma; Ref. 18). Thesehsc70 sequences arereported to deviate fromhsc70sequences subsequently derived fromnonmalignant tissue of the mouse (19) and rat (20) by a single aminoacid. We reasoned thathsc70could be mutated in the malignant in thecell lines. Analysis of publishedhsc70nucleic acid sequences failedto identify codon changes resulting in amino acid deviations betweenthe two genes in each species. Rather, a translation error at codon 97in exon 3 was suspected in the F9 sequence (GAT5Asn rather thanGAT5Asp). We have subsequently sequencedhsc70from the F9 cellline (genomic DNA and cDNA) and parental 129SvJ6 mouse (genom-ic DNA) and have confirmed the reportedhsc70sequence (19). Noamino acid deviations have been identified between the two ratsequences.

Discussion

We have localized HSC70 betweenD11S1336and D11S1284at11q23.3, a deleted region previously delineated from that at 11q22–23.1 in sporadic breast carcinoma (11, 12). HSC70 is,5 Mb distal toD11S528,with which AI has been reported in 40% of breast carci-nomas (12). Our demonstration of AI in 5 of 13 breast carcinomas atD11S1336and/or D11S1284corroborates this figure. Sequencingidentified mutation inHSC70in 2 of 15 breast carcinomas, and thesemutations were coincident with AI atD11S1336. We therefore pro-pose thatHSC70mutation and deletion are associated with a fractionof sporadic breast carcinomas. Allele loss at 11q23.3 has been iden-tified in a wide variety of solid tumors other than breast (cervical,ovarian, gastric, lung, bladder, prostate, nasopharyngeal, squamousand colorectal cancers, malignant melanoma, and intracerebral neo-plasms) at frequencies ranging from 40 to 75% (reviewed in Ref. 21).HSC70mutation may, therefore, be more generally associated withmalignancy.

Of the 15 patients, 3 were homozygous for a 2-bp germ-linedeletion adjacent to the splice acceptor sequence in intron 2. Thisincluded both the breast carcinomas with mutatedHSC70 which,although the number of patients is very small, suggests that there may

Fig. 1.A, ideogram of chromosome 11q. Microsatellites in the 11q22–qter region areshown (not to scale). Microsatellite loci along the YACs to whichHSC70was localizedare shown in greater detail. The position ofHSC70is indicated.B, HSC70gene structure.Solid horizontal boxes,coding exons. The sequence of the gene from nucleotide 1532 inintron 2 to nucleotide 1708 in the second coding exon is shown. The point mutations incases 1 and 4 are markedabovethe sequence, and the nucleotides in the polymorphismare indicated asXX.

Fig. 2.A, sequence analysis of six breast carcinoma samples. The reactions run throughthe second coding exon initiated from a sequence within intron 3 and are loaded ACGT.The point mutations are indicated.B, microsatellite analysis of four paired normal (N) andbreast carcinoma (T) DNA samples. The four cases shown are polymorphic forD11S1336.AIs in cases 1 and 4 are indicated.

4220

HSC70 MUTATIONS

on July 1, 2018. © 1999 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

be an association between the polymorphism and somatic mutation ofHSC70. The polymorphism is noteworthy because of the remarkablyrepetitive nature of the eight coding exons and seven interveningintrons in HSC70(Fig. 1B), the only heat shock protein 70 familymember containing introns. Five of the exons in the human geneencode peptides between 61 and 69 amino acids (including 2 and 3),whereas the remaining three encode peptides of 51, 78, and 185 aminoacids (22). Similarly, three of the intervening introns are 322–331 bp(including the first and second), whereas the others are 83, 211, 228,and 249 bp. The conservation of this repetitive gene structure suggeststhat it is functionally important and that the germ-line deletion,adjacent to the splice acceptor consensus sequence, may itself becorrupting. Alternatively, the polymorphism may be linked to someother sequence that confers some susceptibility to somatic mutation inHSC70. It is, therefore, interesting that the microsatellite distal to thegene was not polymorphic in the three patients homozygous for the2-bp deletion, whereas that proximal was polymorphic in both of thepatients with mutatedHSC70.

The two mutations detected inHSC70were missense mutations inthe Mr 44,000 NH2-terminal ATPase domain of HSC70 which, reg-ulated by two cofactors, controls substrate binding by the COOH-terminal of the protein (23). The mutations identified may affect thebinding and hydrolysis of ATP and/or the binding of the two cofac-tors, p48 (the human Hip homologue) and BAG-1. Hip interacts withthe ATPase domain of HSC70, following an initial activation byHSP40 stabilizing the ADP-bound form of HSC70, and may prolongits interaction with substrate proteins (24). Hip has also been found toassemble with the progesterone receptor and as part of an HSC70/HSP90 chaperone complex (Ref. 24 and references therein). Becausesteroid hormone receptors require sequential interaction with HSC70and HSP90 to attain their high affinity conformation for hormonebinding, Hip-mediated regulation of HSC70 may be required for theassembly of HSP90/steroid hormone receptor complexes. BAG-1, incontrast to Hip, promotes the dissociation of ADP from HSC70,thereby stimulating its ATPase activity (25). Overexpression ofBAG-1 prolongs the survival of fibroblast cells challenged by apop-totic stimuli (25). BAG-1 also binds Bcl-2, increasing the antiapop-totic activity of Bcl-2, interacts with hepatocyte and platelet-derivedgrowth factors, enhancing their antiapoptotic activity, and binds andactivates the Raf-1 protein kinase (Ref. 25 and references therein).Thus, mediated through its interactions with BAG-1 and Hip, HSC70is involved in multiple signaling pathways. Murinehsc70has alsobeen shown to be developmentally regulated in the mammary gland(19), and centrosome hypertrophy has been identified in a fraction ofhuman breast tumors (HSC70 is a known component of the centro-some; Ref. 26). Taken together, these findings and the homeostaticand chaperone functions of HSC70 regulating the structure, subcel-lular localization, and turnover of cell proteins makeHSC70 anattractive candidate for a gene associated with breast carcinoma. Herewe have identifiedHSC70point mutations with coincident AI in 2 of15 sporadic breast carcinomas. We therefore proposeHSC70to be atarget of somatic mutation and deletion in a fraction of human breastcarcinomas.

Acknowledgments

We thank Michael R. James for the 11q YAC contig.

References

1. Pinhasi, K. O., Michalovitz, D., Ben, Z. A., and Oren, M. Specific interaction betweenthe p53 cellular tumour antigen and major heat shock proteins. Nature (Lond.),320:182–184, 1986.

2. Chappell, T. G., Welch, W. J., Schlossman, D. M., Palter, K. B., Schlesinger, M. J.,and Rothman, J. E. Uncoating ATPase is a member of the 70 kilodalton family ofstress proteins. Cell,45: 3–13, 1986.

3. Anderson, R. L., Fong, K. J., Gabriele, T., Lavagnini, P., Hahn, G. M., Evans, J. W.,Waldren, C. A., Stamato, T. D., and Giaccia, A. J. Loss of the intrinsic heat resistanceof human cells and changes inMr 70,000 heat shock protein expression in hu-man3 hamster hybrids. Cancer Res.,51: 2636–2641, 1991.

4. Brodsky, J. L., and Schekman, R. The biology of heat shock proteins and molecularchaperones.In: R. I. Morimoto, A. Tissieres, and C. Georgopoulos (ed.), pp. 85–110.Plainview, NY: Cold Spring Harbor Laboratory, 1994.

5. Imamoto, N., Matsuoka, Y., Kurihara, T., Kohno, K., Miyagi, M., Sakiyama, F.,Okada, Y., Tsunasawa, S., and Yoneda,Y. Antibodies against 70-kD heat shockcognate protein inhibit mediated nuclear import of karyophilic proteins. J. Cell Biol.,119: 1047–1061, 1992.

6. Bercovich, B., Stancovski, I., Mayer, A., Blumenfeld, N., Laszlo, A., Schwartz, A. L.,and Ciechanover, A. Ubiquitin-dependent degradation of certain protein substratesinvitro requires the molecular chaperone Hsc70. J. Biol. Chem.,272:9002–9010, 1997.

7. Brown, C. R., Doxsey, S. J., Hong, B. L., Martin, R. L., and Welch, W. J. Molecularchaperones and the centrosome. A role for HSP 73 in centrosomal repair followingheat shock treatment. J. Biol. Chem.,271: 824–832, 1996.

8. Tavaria, M., Gabriele, T., Anderson, R. L., Mirault, M. E., Baker, E., Sutherland, G.,and Kola, I. Localization of the gene encoding the human heat shock cognate protein,HSP73, to chromosome 11. Genomics,29: 266–268, 1995.

9. Hampton, G. M., Mannermaa, A., Winquist, R., Alavaikko, M., Blanco, G., Taskinen,P. J., Kiviniemi, H., Newsham, I., Cavenee, W. K., and Evans, G. A. Loss ofheterozygosity in sporadic human breast carcinoma: a common region between 11q22and 11q23.3. Cancer Res.,54: 4586–4589, 1994.

10. Koreth, J., Bakkenist, C. J., and McGee, J. O. Allelic deletions at chromosome11q22–q23.1 and 11q25–qter are frequent in sporadic breast but not colorectalcancer. Oncogene,14: 431–437, 1997.

11. Carter, S. L., Negrini, M., Baffa, R., Gillum, D. R., Rosenberg, A. L., Schwartz, G. F.,and Croce, C. M. Loss of heterozygosity at 11q22–q23 in breast cancer. Cancer Res.,54: 6270–6274, 1994.

12. Negrini, M., Rasio, D., Hampton, G. M., Sabbioni, S., Rattan, S., Carter, S. L.,Rosenberg, A. L., Schwartz, G. F., Shiloh, Y., Cavenee, W. K., and Croce, C. M.Definition and refinement of chromosome 11 regions of loss of heterozygosity inbreast cancer: identification of a new region at 11q23.3. Cancer Res.,55: 3003–3007,1995.

13. Savitsky, K., Bar Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle,D. A., Smith, S., Uziel, T., Sfez, S., Ashkenazi, M., Pecker, I., Frydman, M., Harnik,R., Patanjali, S. R., Simmons, A., Clines, G. A., Sartiel, A., Gatti, R. A., Chessa, L.,Sanal, O., Lavin, M. F., Jaspers, N. G. I., Taylor, A. M. R., Arlett, C. F., Miki, T.,Weissman, S. M., Lovett, M., Collins, F. S., and Shiloh, Y. A single ataxia telangi-ectasia gene with a product similar to PI-3 kinase. Science (Washington DC),268:1749–1753, 1995.

14. Wang, S. S., Esplin, E. D., Li, J. L., Huang, L., Gazdar, A., Minna, J., and Evans,G. A. Alterations of thePPP2R1Bgene in human lung and colon cancer. Science(Washington DC),282: 284–286, 1998.

15. Stilgenbauer, S., Schaffner, C., Litters, A., Liebish, P., Gilad, S., Bar-Shira, A.,James, M. R., Lichter, P., and Dohner, H. Biallelic mutations in theATM gene inT-prolymphocytic leukemia. Nat. Med.,10: 1155–1159, 1997.

16. Barbhaiya, H., Leverette, R. D., Liu, J., and Maxwell, E. S. Processing of U14 smallnucleolar RNA from three different introns of the mouse 70-kDa cognate heat shockprotein premessenger RNA. Eur. J. Biochem.,226: 765–771, 1995.

17. Giebel, L. B., Dworniczak, B. P., and Bautz, E. K. Developmental regulation of aconstitutively expressed mouse mRNA encoding a 72-kDa heat shock- like protein.Dev. Biol., 125: 200–207, 1988.

18. O’Malley, K., Mauron, A., Barchas, J. D., and Kedes, L. Constitutively expressed ratmRNA encoding a 70-kilodalton heat-shock-like protein. Mol. Cell. Biol.,5: 3476–3483, 1985.

19. Soulier, S., Vilotte, J. L., L’Huillier, P. J., and Mercier, J. C. Developmentalregulation of murine integrinb1 subunit- and Hsc73-encoding genes in mammarygland: sequence of a new mouse Hsc73 cDNA. Gene (Amst.),172: 285–289, 1996.

20. Sorger, P. K., and Pelham, H. R. Cloning and expression of a gene encoding hsc73,the major hsp70-like protein in unstressed rat cells. EMBO J.,6: 993–998, 1987.

21. Koreth, J., Bakkenist, C. J., and McGee, J. O. D. Chromosomes 11q and cancer: areview. J. Pathol.,187: 28–38, 1999.

22. Dworniczak, B., and Mirault, M. E. Structure and expression of a gene coding for a71kDa heat shock “cognate” gene. Nucleic Acids Res.,15: 5181–5197, 1987.

23. Chappell, T. G., Konforti, B. B, Schmid, S. L., and Rothman, J. E. The ATPase corerof clathrin uncoating protein. J. Biol. Chem.,262: 746–751, 1987.

24. Hohfeld, J., Minami, Y., and Hartl, F-U. Hip, a novel cochaperone involved in theeukaryotic Hsc70/Hsp40 reaction cycle. Cell,83: 589–598, 1995.

25. Hohfeld, J., and Jentsch, S. GrpE-like regulation of the Hsc70 chaperone by anti-apoptotic protein BAG-1. EMBO J.,16: 6209–6216, 1997.

26. Lingle, W. L., Lutz, W. H., Ingle, J. N., Maihle, N. J., and Salisbury, J. L. Centrosomehypertrophy in human breast tumors: implications for genomic stability and cellpolarity. Proc. Natl. Acad. Sci. USA,95: 2950–2955, 1998.

4221

HSC70 MUTATIONS

on July 1, 2018. © 1999 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1999;59:4219-4221. Cancer Res   Christopher J. Bakkenist, John Koreth, Cory S. M. Williams, et al.   CarcinomaHeat Shock Cognate 70 Mutations in Sporadic Breast

  Updated version

  http://cancerres.aacrjournals.org/content/59/17/4219

Access the most recent version of this article at:

   

   

  Cited articles

  http://cancerres.aacrjournals.org/content/59/17/4219.full#ref-list-1

This article cites 24 articles, 13 of which you can access for free at:

  Citing articles

  http://cancerres.aacrjournals.org/content/59/17/4219.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/59/17/4219To request permission to re-use all or part of this article, use this link

on July 1, 2018. © 1999 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from