Groucho corepressor functions as a cofactorfor the Knirps short-range transcriptional repressorSandhya Payankaulam and David N. Arnosti1

Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824

Edited by Michael S. Levine, University of California, Berkeley, CA, and approved August 25, 2009 (received for review April 24, 2009)

Despite the pervasive roles for repressors in transcriptional control,the range of action of these proteins on cis regulatory elementsremains poorly understood. Knirps has essential roles in patterningthe Drosophila embryo by means of short-range repression, anactivity that is essential for proper regulation of complex tran-scriptional control elements. Short-range repressors function in alocal fashion to interfere with the activity of activators or basalpromoters within �100 bp. In contrast, long-range repressors suchas Hairy act over distances >1 kb. The functional distinctionbetween these two classes of repressors has been suggested tostem from the differential recruitment of the CtBP corepressor toshort-range repressors and Groucho to long-range repressors.Contrary to this differential recruitment model, we report thatGroucho is a functional part of the Knirps short-range repressioncomplex. The corepressor interaction is mediated via an eh-1 likemotif present in the N terminus and a conserved region present inthe central portion of Knirps. We also show that this interaction isimportant for the CtBP-independent repression activity of Knirpsand is required for regulation of even-skipped. Our study uncoversa previously uncharacterized interaction between proteins previ-ously thought to function in distinct repression pathways, andindicates that the Groucho corepressor can be differentially har-nessed to execute short- and long-range repression.

Short-range transcriptional repression has a central role indevelopment, and perhaps nowhere have the molecularworkings of eukaryotic developmental gene networks been moreextensively analyzed than in the Drosophila blastoderm embryo.Here, both transcriptional activators and repressors transducetemporal and spatial information into characteristic patterns ofgene expression essential for development. Repressors have keyparts in this process, evidenced by the central position in thehierarchy of genes such as hairy, giant, knirps (kni), and Kruppel,all of which function as dedicated repressors. Transcriptionalrepressors have been characterized based on their range ofaction; short-range repressors such as Knirps work over dis-tances of �100 bp to quench activators or basal promoters (1).In contrast, long-range repressors such as Hairy function overdistances of 1 kb to silence their target genes in a processsuggested to involve extensive spreading of a recruited corepres-sor, Groucho (2, 3).

Seminal work in this area by the Levine laboratory hasprompted the suggestion that the functional differences in therange of action of the two classes of repressors reflect therecruiting of distinct corepressors (4). Short-range repressorssuch as Knirps, Kruppel, Giant, and Snail associate with theC-terminal binding protein (CtBP) corepressor, whereas Grou-cho is implicated in mediating long-range repression by Hairy (4,5). Both evolutionarily conserved corepressors have been linkedto chromatin-modifying enzymes, and each associates with se-quence-specific DNA binding factors by means of short charac-teristic motifs in the partner (2, 6, 7). CtBP, a homolog of D2hydroxy acid dehydrogenases, binds to NAD/NADH, as well asto histone deacetylases and demethylases. The corepressor isrecruited by a wide range of transcriptional factors, includingshort-range repressors in Drosophila, as well as many proteinswhose range of action is unknown (4, 7–9) .

Groucho is homologous to vertebrate TLE and yeast TUP1corepressors. The protein possesses a WD40 repeat that permitsbinding to transcription factors with a C-terminal WRPW motif,as found in Hairy, or alternatively, through a 7-aa ‘‘eh1’’ motif(2, 6, 10, 11). Groucho has been found to interact with the Rpd3histone deacetylase as well as histones (12, 13). Two Drosophilaproteins known to interact with Groucho are Hairy and Dorsal,which are well characterized long-range repressors (14, 15).

Current understanding of short-range repression comes fromstudies that defined CtBP-dependent and CtBP-independentactivities of these proteins, as well as their action on endogenousand synthetic promoters (1, 4, 16–22). Little is known about theactual mechanisms through which the proteins carry out thisfunction; however, our earlier study showed that Knirps is in alarge complex (450 kDa) including CtBP and the histonedeacetylase Rpd3 (23), indicating that additional components ofthe Knirps complex remain to be identified.

To gain a greater insight into the short-range repressionmechanism and further elucidate the CtBP-independent activityof Knirps, we identified proteins physically interacting withKnirps expressed in the blastoderm embryo. Unexpectedly,Groucho was identified as a part of the Knirps complex. Wedemonstrate here physical and genetic interactions betweenGroucho and Knirps, indicating that this corepressor is key to theCtBP-independent activity of Knirps. We provide evidence thatthis interaction is important for correct expression of eve blas-toderm stripes; thereby, establishing the significance of thisinteraction during Drosophila development.

ResultsIdentification of Groucho As a Component of the Knirps Complex. Wesought to identify constituents of the Knirps complex by ex-pressing epitope-tagged Knirps in Drosophila embryos. Previ-ously, we had verified that this Knirps protein is active inregulating bona fide targets of Knirps (22). Proteins from solubleextracts were first purified by metal affinity chromatography,and then by immunoprecipitation with antibody against theC-terminal Flag epitope. The immunoprecipitated sample wasthen analyzed by MS. In addition to Knirps and CtBP, weidentified two peptide fragments corresponding to Groucho; anunanticipated finding, considering the previous association ofthis corepressor with long-range repressors (data not shown).

To validate the association of Knirps and Groucho, partiallypurified fractions from the metal affinity chormatography weresubjected to DNA affinity purification using Knirps binding sitesimmobilized on Sepharose beads. Eluted samples were analyzedby Western blotting for Knirps and Groucho (Fig. 1A). Grouchowas found to copurify with Knirps, but was not present inaffinity-purified samples from uninduced embryo extracts lack-ing Flag-tagged Knirps. We also directly immunoprecipitated

Author contributions: S.P. and D.N.A. designed research; S.P. performed research; S.P. andD.N.A. analyzed data; and S.P. and D.N.A. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

1To whom correspondence should be addressed. E-mail: arnosti@msu.edu.

17314–17319 � PNAS � October 13, 2009 � vol. 106 � no. 41 www.pnas.org�cgi�doi�10.1073�pnas.0904507106

Dow

nloa

ded

by g

uest

on

July

10,

202

1

Knirps from crude extracts using antibodies specific for the Flagepitope, and using embryo extracts treated with Benzonase toremove nucleic acids. As shown in Fig. 1B, Groucho wasimmunoprecipitated only when Knirps was present, and thisassociation does not require DNA.

Genetic Interaction of Groucho with Knirps and eve. To determinewhether the physical association observed above was physiolog-ically relevant, we tested whether Groucho and Knirps interactgenetically on an endogenous target gene. The pair-rule gene eveis expressed in a seven stripe blastoderm pattern that is asensitive measure of Knirps activity. Knirps sets the internalexpression boundaries of eve stripes 3,7 and 4,6 by binding toenhancers with different thresholds of repression sensitivity (22,24). As was previously reported, embryos that are heterozygousfor kni9 or kni7G also exhibited defects in the eve patternobserved as fused stripes 4,6 or reduced stripe 5 expression (Fig.2 B and C; Table 1) (5). Ablation of maternal gro has pleiotropiceffects that preclude interpretation of the eve phenotype; there-fore, we tested the effects of partial depletion of gro in anotherwise WT or kni mutant background. Depletion of maternaland zygotic gro alone had a measurable effect on eve expression.In a heterozygous background for gro, �9–10% of the embryosshowed misregulation of eve in the presumptive abdominalregion where kni is expressed (Fig. 2D and Table 1). This effectdiffered from that observed in the kni heterozygote in that fusionof stripes 4–6 or loss of stripe 5 was less frequently observed,rather, a weaker expression of stripe 5. However, the restricted

location was consistent with a perturbation of kni function, as grois expressed throughout the embryo (25). Combining the gro andkni mutations in a double heterozygous background resulted ina more severe disruption (30–46%) in the eve pattern, whichincludes a greater percentage of embryos showing significantloss of stripe 5 expression (Fig. 2E and Table 1). The kni mRNAexpression pattern was not altered in gro mutants (Fig. 2F),suggesting that this effect on eve patterning is not due to alteredkni expression. To determine whether Groucho might influenceeve expression through changes in other gap genes, we examinedthe expression of hb, gt, Kr, tll, and hkb in both groE48 and kni9heterozygous backgrounds, but we did not observe any discern-able changes in their expression patterns (data not shown). Thesespecific perturbations of the eve pattern in response to changesin gro and kni levels provide evidence that gro and kni areinvolved in the same genetic pathway.

Evidence for Direct Physical Association Between Groucho and Knirps.We next tested whether Knirps and Groucho proteins directlyassociate with one another. Groucho binds proteins that contain ashort C-terminal tetrapeptide motif WRPW or an internal engrailedhomology motif (FXIXXIL) (6, 10). A close inspection of theKnirps protein sequence revealed an eh1-like motif at the Nterminus (residues 85–91; Fig. 3A). This motif is conserved inDrosophila as well as kni genes of Apis mellifera and Triboliumcastaneum. In Drosophila, this portion of Knirps contains a CtBP-

Fig. 1. Copurification of Knirps and Groucho. Extracts from 0- to 12-h embryos induced for Knirps expression with heat shock pretreatment (�) or uninduced (�).(A) Flag-tagged Knirps is present in crude lysate, NTA-Ni eluate, and DNA affinity eluate (Upper, lanes 1, 4, and 7). Groucho, present in crude extracts (Lower, lanes 1–3)is found in purified fractions containing Knirps (lanes 4 and 7). (B) Coimmunoprecipitation of Knirps and Groucho. Knirps was induced (�) or not (�), and theBenzonase-treated crude lysate was immunoprecipitated with anti-Flag antibody or IgG (negative control). Antibodies used for Western blotting are indicated.

Fig. 2. Evidence for genetic interaction between kni and gro. (A) WT eveexpression pattern. (B and C) Presumptive kni heterozygote showing evestripe 4–6 fusion and reduced eve stripe 5. (D) Presumptive gro heterozygoteshowing reduced stripe 4,5. (E) Progeny from gro/kni transheterozygous crossshowing absence of stripe 5. (F) The kni expression pattern in presumptive groheterozygote. Embryos are oriented with dorsal side up, anterior to the left.

Table 1. The eve expression in gro and kni heterozygousembryos

Fused eve stripe 4,6or weak 5,6; % N

groE48�yw67 10 534gro 1�yw67 9 215kni9�yw67 19 211kni7G�yw67 14 164(maternal) groE48 � kni9 43 245(paternal) groE48 � kni9 45 137groE48�kni7G 30 156gro1�kni9 38 72gro1�kni7G 46 58

The eve expression patterns were scored in blastoderm embryos fromcrosses of heterozygous individuals carrying mutations in gro and/or kni.Heterozygosity at the gro locus for two different alleles had specific effects oneve patterning (9%). As observed previously, heterozygosity at the kni locusled to 14–19% of the embryos exhibiting a fused 4–6 or reduced/missingstripe 5 phenotype. The frequency of this phenotype increased �2-fold in adouble heterozygous mutant background. This effect was regardless ofwhether the groE48 allele is maternally or paternally contributed to the doubleheterozygote. The groE48 is a null allele; gro1 is a hypomorphic allele; kni9 is anull allele; kni7 g is a loss of function mutation.

Payankaulam and Arnosti PNAS � October 13, 2009 � vol. 106 � no. 41 � 17315

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

July

10,

202

1

independent repression activity, and previous assays had delimitedthe CtBP-independent repression domains to residues 75–330 (17).Therefore, we expressed this domain as a GST fusion protein andtested it for the ability to interact with in vitro translated Groucho.As expected, the GST-Hairy protein bound Groucho effectively(Fig. 3B, lane 2), and GST-Hairy lacking the Groucho binding motifwas much less effective (Fig. 3B, lane 3). Groucho did not interactwith GST alone (Fig. 3B, lane 4) nor did any of the GST proteinsinteract with in vitro translated CSN4, an unrelated protein. TheKnirps 75–330 retained a substantial amount of Groucho (Fig. 3B,lane 5), whereas in contrast, a mutant form of Knirps lacking the

N terminus (139–330) displayed a weaker interaction (Fig. 3B, lane7). To test whether the eh1 motif in particular is essential for thisinteraction, we made point mutations in four of the conservedresidues (FXIXXLL), converting hydrophobic amino acids to ala-nine. This eh1mut showed reproducibly weaker interaction withGroucho (Fig. 3B, lane 6). A further truncation (189–330) abol-ished this interaction (Fig. 3B, lane 8). Interestingly, the ability ofthese proteins to bind Groucho correlates directly with their in vivoactivity as transcriptional repressors. Gal4-Kni 75–330 was highlyactive against an eve reporter, whereas Gal4-Kni 139–330 was lesspotent and Gal4-Kni 189–330 was inactive (17, 19) .

To further characterize the residual Groucho binding activityobserved in the Knirps mutants lacking the eh1 motif, weanalyzed an additional series of internal Knirps deletions (Fig.3A) in proteins in which the eh1-like motif was already removed.Those proteins with deletions between regions 139–149 and150–169 were able to interact with Groucho at a level similar tothat of the intact Kni 75–330 protein lacking the eh 1 motif (Fig.3B, lanes 9 and 10). However, deletions of residues 169–189abolished the association with Groucho, as did a larger deletionencompassing this region (139–189) (Fig. 3B, lanes 11 and 12).From these results, we conclude that Groucho can directlyinteract with Knirps, and that two regions in the N terminus ofKnirps contribute to the interaction with Groucho.

Groucho Interaction Motifs Are Essential for Repression Activity invivo. An earlier study showed that ectopic expression of theCtBP-independent form of Knirps (Kni 1–330) represses eve;particularly, the 3,7 and 4,6 enhancers (22). To test whether thephysical interaction we observed for Knirps and Groucho arefunctionally relevant, we created and assayed transgenic fliesexpressing the WT Kni 1–330 protein, as well as mutants lackingsolely the eh1-like motif or both the eh1-like motif and the regionbetween 169 and 189 (Kni 169–189�). Expression of the Knirpsproteins was induced by heat shock, and in situ hybridization wasperformed to monitor eve expression (Fig. 4). The expressionlevels of the various forms of the Knirps protein were quanti-tated by Western blotting. Under similar induction conditions,the WT and the Kni eh1mut proteins were expressed at similarlevels, whereas the Kni 169–189� protein was expressed at asomewhat lower level (Fig. 4Bi).

As expected, the CtBP-independent Kni 1–330 protein po-tently effected repression of eve stripes 3,7 and 4,6; 88% ofembryos showed this phenotype (Fig. 4Aii and Table 2). Theeh1mut was markedly less effective, repressing mainly eve stripe3; this phenotype was observed in only 24% of embryos (Fig.4Aiii and Table 2). The eve stripe 4 was affected to a lesser extent(6%), whereas stripe 6 was virtually unaffected. These observa-tions suggest that the presence of eh1-like motif is crucial forKnirps activity. A further mutation that removed the second setof residues important for Groucho interaction (169–189�) re-sulted in a protein that only weakly affected eve stripes 3 and 4in a small percentage of the embryos (Fig. 4Aiv and Table 2).When induced for equal amounts of time, this protein wasexpressed at somewhat lower levels than the Kni 1–330 and Knieh1mut; therefore, we heat shocked the embryos for longerperiods of time (35 min) to achieve higher levels of expression(Fig. 4Bii). Even after induction of higher levels of protein, onlya small fraction of the embryos showed a reduction in eve stripes3 and 4 (Table 2). Nontransgenic yw embryos heat shocked forsimilar periods of time did not show similar misreguation of theeve expression pattern (data not shown). Together, these resultsstrongly suggest that interaction with Groucho is essential for theCtBP-independent repression activity of Knirps, and that thiscorepressor contributes significantly to the total repressionpotential of Knirps.

Fig. 3. Physical association between Groucho and Knirps. (A) Alignment ofresidues 61–216 and 303–354 of insect Knirps proteins. Amino acid residues85–91 (eh1-like motif) are conserved among these Knirps homologs. Boxedregion between amino acids 187–194 indicates residues resembling an eh1-lkemotif that is partially disrupted by the 169–189 deletion. CtBP binding motifPMDLS (331–335), which is conserved only within Drosophila, is also indicated.Asterisks indicate alanine substitutions made in the eh1-like motif. Deletionstested in GST pull-down assays are also indicated. (B) GST- Hairy and Grouchointeraction assay. GST fusion proteins were bound to in vitro translated35S-met Groucho protein, and bound proteins were analyzed by SDS PAGE.The proteins showed differential binding ability to in vitro translated Grou-cho; strong binding was observed with Kni 75–330 (lane 5), whereas Kni eh1mut

(lane 6) and Kni 139–330 showed weaker interactions (lane 7). No interactionwas observed with Kni 189–330 (lane 8). In the context of protein lacking theeh1 motif, deletion of residues 139–149 or 150–169 had little further effect onGroucho binding (lanes 9 and 10), whereas deletion of residues 169–189 or139–189 strongly reduced Groucho binding (lanes 11 and 12). GST-Hairy anda mutant form of Hairy lacking the C-terminal WRPW motif serve as controls.(C) Coomassie stained gels showing equal amounts of GST fusion proteins usedin binding assays.

17316 � www.pnas.org�cgi�doi�10.1073�pnas.0904507106 Payankaulam and Arnosti

Dow

nloa

ded

by g

uest

on

July

10,

202

1

Role of Groucho in Knirps Specific Repression in S2 Cells. To study theimportance of Groucho for Knirps mediated repression inanother context, we used a Tet-Knirps chimeric repressor(Knirps amino acids 75–330) previously demonstrated to possessspecific short-range repression activity in S2 cells (21). Lucif-erase activity was assayed in untreated cells or those depleted ofGroucho by dsRNA treatment.

We were able to efficiently deplete cells of Groucho usingdsRNA treatment (Fig. 5B). In the absence of RNAi, theTet-Knirps repressor was capable of inhibiting reporter activity

2.5-fold, and this repression activity was significantly reduced ondepletion of Groucho by RNAi, but not by control lacZ RNAitreatment (Fig. 5A). Also, depletion of Groucho did not havesignificant effect on the repression activity of an unrelated fusionprotein, Tet-CtBP (data not shown; see ref. 21). We noted thatthe Tet-Knirps protein retained some activity in Groucho de-pleted cells. Removal of the Groucho interacting motifs reduced,but did not eliminate this residual activity (data not shown).Previous analysis of a Gal4-Knirps fusion protein suggested thatresidues 189–254 can mediate repression in S2 cells; this portionof Knirps is contained within our Tet-Knirps fusion protein andmay explain the residual Groucho-independent activity, whichmay function through other, as yet unidentified factors (26).

DiscussionGroucho mediates the CtBP-independent repression activity ofKnirps. The essential logic of Drosophila blastoderm transcrip-tion cascade is reliant on the short range of gap repressorsproteins such as Knirps, Kruppel, and Giant acting on modularenhancers. Thus, the functional features of these repressors,which set them apart from long-range acting proteins such asHairy, have been of special interest. Earlier studies suggestedthat the distinction between these classes of repressors may beattributed to differential recruitment of the CtBP corepressor toshort-range repressor and Groucho to long-range repressors (2,4, 10). The genetic and physical interactions of CtBP and Hairywere contradictory to this simple model, but further work hasindicated that CtBP may not in fact serve as a Hairy corepressor,but as an antagonist of Groucho (27, 28). In another case, theBrinker transcription factor can interact with Groucho and CtBPin vitro, but appears to rely on Groucho for repression of manytarget genes, whereas CtBP has a minor role (29). Significantly,the range of Brinker repression has never been elucidated.Foreshadowing our study, Andrioli et al. (30) showed that Slp1acts as a gap type regulator of pair-rule genes in the early

i ii

i ii

iii iv

Fig. 4. In vivo assay of Groucho binding mutants. (A) Phenotypes producedby Knirps proteins with impaired Groucho binding activities. (Ai) Pattern ofWT endogenous eve expression. (Aii) Embryos expressing Kni 1–330, withintact Groucho binding activity show repression of stripes 3,7 and partial lossof stripe 4. (Aiii) Embryos expressing the Kni eh1mut, a protein that has reducedGroucho binding activity, show at most some weakening of stripes 3 and 4.(Aiv) Embryos expressing the Kni 169–189� protein with no Groucho bindingactivity show little or no change to eve patterns. Both WT and mutant proteinswere localized to nuclei in embryos (data not shown). A minority of embryosexhibit a slight reduction in stripe 3. (B) Expression of Knirps mutant proteins.(Bi) Western blotting of protein extracts from embryos expressing Kni 1–330and Kni eh1mut heat shocked for 20 min and embryos from Kni 169–189� heatshocked for 25 min. (Bii) Kni 169–189� embryos were also heat shocked for 35min to equalize protein expression levels. M2 � Flag was used to detect therecombinant proteins and signals detected was quantified using a Fuji LAS3000 imager and Fuji Multigauge image analysis software. Relative levels areindicated below the lane numbers.

Table 2. Percentage of transgenic embryos showing complete orpartial loss of eve stripe after heat shock

Heat shock duration

20 min 25 min 35 min

eve stripe 1–330 Eh1mut 169–189� 169–189�

1 0 0 0 02 0 0 0 03 88 24 5 2.44 16 6.4 3 10.75 0 0 0 �16 16 3 0 07 88 3 1.7 1N 441 514 423 540

Fig. 5. Reduction of Knirps repression activity in Groucho depleted S2 cells.(A) Luciferase activity of reporter gene containing dual Tet binding sites at�75 bp in S2 cells transfected with reporter alone, reporter � Tet-Knirps75–330 (CtBP-independent repression domain of Knirps), or Tet-Stop (containsonly the Tet DNA binding domain). In parallel, cells were pretreated withdsGroucho or dslacZ RNA. Luciferase activity normalized to Renilla luciferaseactivity was expressed as fold change relative to appropriate controls. Errorbars represent SD; n � 11 for Knirps activity in WT and Groucho-depleted cells,n � 3 for lacZ RNAi and other controls; ***, P � 0.001; **, P � 0.01 using a twotailed Mann–Whitney–Wilcoxon method. (B) Western blotting showing levelsof Groucho and Tubulin in S2 cells treated as indicated. Proteins were assayedfrom samples of cells used in transfection assays.

Payankaulam and Arnosti PNAS � October 13, 2009 � vol. 106 � no. 41 � 17317

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

July

10,

202

1

embryo. The short-range nature of this regulation was apparenton eve, hairy, run, ftz, prd, and odd when the Slp1 protein wasexpressed in a ventral pattern. Consistent with a role forGroucho, a mutant form of the Slp1 protein lacking the eh1motif was reported to be inactive, but this assay was complicatedby the brief temporal window of repression. We show here thatthe well characterized short-range repressor Knirps physicallyand functionally interacts with Groucho, and this interaction ispivotal for the CtBP-independent repression potential of Knirps.These findings are definitely not consistent with the differentialrecruitment model of short- and long-range repression. Insteadour results suggest an alternative model, that Groucho functionsdistinctly in the context of short- and long-range repression.

One possible explanation for the diverse function of Grouchomay involve oligomerization. Recent studies have shown thatGroucho and its homolog can form oligomeric structures that havebeen proposed to spread along DNA (2, 3, 31). Mutations that blockGroucho oligomerization in vitro compromise the activity of thisprotein in vivo in the imaginal disc (2, 32). Thus, Groucho oli-gomerization has been assumed to be critical for its function andpotentially related to the long-range activity of repressors such asHairy. However, it seems likely that in the context of Knirpsrepressor complex, Groucho does not spread, because repressioneffects are clearly short range. Possibly the mode of recruitmentdictates whether Groucho oligomerizes or not. We hypothesize thatthe distinct eh1-like repression motifs in Knirps interact withGroucho in a unique conformation to restrain Groucho fromspreading and, thus, from mediating long-range repression. Crystalstructures of the WD domain of human Groucho homolog TLE1bound to either WRPW or eh1 peptide revealed that these peptidesadopt different conformations on the corepressor binding surface(33). Such differences may affect the ability of Groucho to oli-gomerize. Other components in the Knirps corepressor complexmay also control Groucho oligomerization. An ‘‘optional oligomer-ization’’ by Groucho model may explain earlier studies that foundHairy does not always cause dominant silencing of nearby enhanc-ers (34). Also, hypomorphic alleles of Groucho have been identifiedthat appear to compromise oligomerization but still retain someactivity (35).

What role might Groucho have in Knirps-mediated repres-sion? As shown previously, the CtBP-independent repressionactivity of Knirps is critical for full activity on some endogenousenhancers, underscoring the importance of Knirps-Grouchoassociation (22). The histone deacetylase Rpd3 is recruited byGroucho, and is also a part of the Knirps repression complex.CtBP proteins are known to interact with histone deacetylases;thus, both CtBP and Groucho may recruit Rpd3 cooperatively(13, 36). The deacetylase activity may then augment Groucho-histone interactions, bringing about local modification of thechromatin, resulting in enhanced repressor output. Consistentwith the cooperative recruitment of Rpd3, our purification ofKnirps complexes indicated that Rpd3 associates preferentiallywith the full-length protein, and not the CtBP-independentdomain alone (23). Therefore, in the context of Kni 1–330,Groucho may use another HDAC protein or rely on its HDAC-independent repression activity (13). The functional importanceof this association may be to achieve quantitatively correct levelsof Knirps activity, suggesting a similarity of function of these twocorepressors. For example, in the context of the composite evepromoter, both of these activities can have roles in repressingenhancers of differential sensitivity.

In conclusion, our study provides compelling evidence thatGroucho can mediate short-range repression; thus, the long- andshort-range effects of transcriptional repression do not appear tobe a simple function of differential recruitment of distinctcorepressors. Not only does this change the perspective ofGroucho, it changes the perspective of different repressor pro-teins. It appears that long-range repressors such as Hairy and

short-range repressors such as Knirps may function as modula-tors of the repression range of common machinery.

Interestingly, Knirps protein sequences from different insectgenomes indicate that Groucho binding by Knirps may be anancestral trait, because the Groucho-binding eh1-like motif ispresent in Drosophila species as well as Tribolium and Apis (Fig.3A). In contrast, the critical CtBP-interacting residues arepresent only in Drosophila, suggesting that the acquisition of anadditional corepressor may be a derived trait, possibly as a partof the remodeling of embryonic gene circuitry associated withthe unique syncytial environment.

Materials and MethodsAntibodies and Flies. Flag M2 monoclonal antibody (Sigma F 3165) was used at1:10,000 dilution. Rabbit polyclonal antiserum against fly CtBP (23) was gen-erated against full-length CtBP and used at 1:10,000 dilution. Groucho mono-clonal antibody was obtained from the Developmental Studies HybridomaBank and used at 1:20 dilution. Transgenic flies expressing double tagged(hexa-His at N terminus and flag at C terminus) Knirps (Kni 1–429 and Kni1–330) were previously described (22). The Kni 1–330 with eh1 substitutionsand deletions were generated by Quick Change mutagenesis (Stratagene)following the manufacturer’s protocol.

Heat Shock. To induce expression of recombinant full-length Knirps protein(1–429), 0- to 12-h transgenic embryos were collected on apple juice plates atroom temperature, and were incubated at 37 °C for 30 min in a water bath.After induction, the embryos were dechorionated, weighed, and were eitherfrozen at �80 °C until further use or were used to prepare lysate for subse-quent purification steps. To induce expressions of Kni 75–330, Kni eh1 mut andKni 169–189 �, 2- to 4-h embryos were collected on apple juice plates at roomtemperature, incubated for 20 min (Kni 75–330, Kni eh1 mut) and 25 or 35 min(Kni 169–189 �) at 38 °C in a water bath to ensure rapid and even heating.After induction, embryos were allowed to recover in a water bath at roomtemperature for 30 min before fixation for in situ hybridization experiments.In situ hybridization was performed using digoxigenin-UTP labeled antisenseRNA probe to eve.

Purification of Knirps Complex. Extracts were prepared from 0.5 g of heatshocked or nonheat shocked embryos after suspending and sonicating (fourcycles, 12–15 pulses per cycle, output 4, duty cycle 60%, 1 min on ice betweencycles) in 5 mL of lysis buffer containing 300 mM NaCl/50 mM Hepes, pH 7.9/10%glycerol/10 mM imidazole/10 mM � mercaptoethanol/1 mM PMSF/1 mM sodiummetabisulfite/1 mM benzamidine/10 mM pepstatin A. Lysates were then clearedby centrifugation (20 min at 14,000 rpm, twice), and to it 0.5 mL of preequili-brated Ni-NTA beads (His select, Sigma 6611) were added. Incubations werecarriedoutat4 °Cfor30–60min,andthebeadswerewashedseveral times in lysisbuffer supplemented with 20 mM imidazole. The Ni-NTA bound His-taggedproteinwasthenelutedtwiceby increasingtheconcentrationof imidazoleto150mM. The elutions were pooled and to them preequilibrated protein G coupledflag M2 antibody (200 �L of coupled beads to 500 �L of Ni elution) were added.Preequlibration was done in binding buffer containing 300 mM NaCl/50 mMHepes, pH7.9/12.5 mM MgCl2/10% glycerol/0.1 mM EDTA/2 mM DTT/1 mM so-dium metabisulfite/1 mM benzamidine/1 mM PMSF. Incubations were then car-ried out at 4 °C for 3 h with end to end shaking. The beads were washed thricewith binding buffer and twice with the same buffer without MgCl2. Proteinelutions were carried out in binding buffer without MgCl2, but supplementedwith 0.2% sarkosyl or with 0.5 mg/mL of 3� flag peptide (Sigma F4799). Theeluted proteins were subject to SDS/PAGE, digested in-gel with trypsin, chro-matographed on C-18 peptide trap columns, and analyzed by MS using Ther-moFisher LTQ Linear Ion trap mass spectrometer. Spectral assignments werevalidated using Scaffold software.

DNA Affinity Purification. Oligonucleotides containing Knirps binding sites (5GCA TCT GAT CTA GTT TGT ACT CTG ATC TAG TTT 3) were ligated and coupledto CNBr activated Sepharose beads following the protocol described previ-ously (37). In brief, for affinity purification 250 �L of the beads were added to500 �L of Ni elution, and the total binding volume was made up to 1 mL withbuffer containing 25 mM Hepes/7% glycerol/0.2 mM ZnSO4/0.2 mg BSA/4 mMDTT. Incubations were carried out for 3 h at room temperature, and the DNAbound Knirps was eluted using 700 mM NaCl. The salt was removed by dialysis,and the sample was then lyophilized and used for Western blotting afterresuspending in SDS buffer.

17318 � www.pnas.org�cgi�doi�10.1073�pnas.0904507106 Payankaulam and Arnosti

Dow

nloa

ded

by g

uest

on

July

10,

202

1

Immunoprecipitation. Embryos expressing Kni 1–429 were heat shocked for 30min at 38 °C in a water bath, and the protein extract was prepared bysonication in lysis buffer [150 mM NaCl/50 mM Hepes, pH 7.9/10% glycerol andcomplete protease inhibitor Tablets (Roche)]. Knirps protein was immunopre-cipitated using monoclonal M2 Flag antibody. The sample was separated ona 10% SDS PAGE gel and transferred to a PVDF membrane. The Grouchomonoclonal antibody was used for immunoblotting and was detected withHRP coupled secondary antibody (Pierce).

GST Pull Down. Appropriate expression plasmid was transformed in Esche-richia coli BL21 and was grown at 37 °C for 3 h. The Knirps-GST fusion proteinswere induced with IPTG for 17 h at 25 °C, whereas the Hairy fusion proteins(plasmids were a kind gift of G. Jiménez) were induced for 3 h at 30 °C. Theproteins were purified on glutathione Sepharose beads (GE Healthcare).S35methionine labeled Groucho was synthesized in vitro from pET Groucho(kind gift of G. Jiménez) using TNT-coupled reticulocyte lysate system (Pro-mega). In vitro translated protein was bound to preincubated immobilizedGST proteins, and the mixture was incubated for 1 h at 4 °C. Equal amounts offusion proteins were used in each experiment. The beads were washed fourtimes with 1 mL PBS/1 mM EDTA/0.2% Nonidet P-40. Bound protein wasreleased by boiling in gel sample buffer and analyzed by SDS page andautoradiography.

Genetic Interaction Assay. To test for a genetic interaction between kni and gro,transheterozygous flies for kni and gro were generated by crossing the groheterozygous mutant females to the kni heterozygous mutant males and viceversa, and the expression pattern of eve was monitored by in situ hybridization.The kni9 (Bloomington stock 3332) carries a null mutation. kni7G (Tübingen stockZ334) is a loss of function mutation. The gro E48 l(3)DE FRT82B/TM6B, kindlyprovided by Z. Paroush, is a presumptive null. The gro1 (Bloomington stock 511)carries a hypomorphic mutation. Heterozygous phenotypes for each kni and groallele were noted after crossing balanced lines to yw 67.

Cell Culture, RNAi, and Transient Transfections. The luciferase reporter and theTet repressor plasmids were generated as described previously in Ryu andArnosti (21). For transient transfections, Drosophila S2 cells were grown at24 °C in Schneider Drosophila medium (Gibco/BRL) containing 10% FBS andpencillin-streptomycin. For RNAi, gro cDNA was used to amplify the codingsequence using T7 tagged primers (38). The PCR product was then transcribedusing the megascript kit (Ambien). The primers used to amplify the lacZ regionfrom the C4 PLZ plasmid is as follows:

Forward: 5TTAATACGACTCACTATAGGGAGGCGTCGTTTAGAGCAGCAGAG 3Reverse: 5 TTAATACGACTCACTATAGGGAGTGGGATAGGTTACGTTGGTGT 3.S2 cells were incubated for 72 h with dsRNA (soaking) at a concentration of

15 �g/106 cells for gro and lacZ as negative control. After this step, the cellswere cotransfected with luciferase reporter alone (100 ng) or reporter (100ng) and Tet-Kni 75–330 (1 ng) or Tet-Stop (1 ng) plasmid using Effectene(Qiagen) according to manufacturers instructions. Renilla luciferase plasmid(250 ng) was also cotransfected to normalize transfection efficiencies. Ap-proximately 48 h later, cells were collected for Western blotting and luciferaseactivity measurements. The luciferase activity was measured by using the Dualglo Luciferase assay system (Promega). Immunoblotting was done to assess theefficiency of gro knock down.

ACKNOWLEDGMENTS. We thank R. W. Henry for critical reading of thismanuscript; Gerardo Jiménez (Institut de Biologia Molecular de Barcelona-CSIC, Spain) for providing the hairy, groucho, tailless, and huckebein plasmidsand Ze’ev Paroush (Hebrew University, Israel) for the groE48 fly lines; J. B.Jaynes (Thomas Jefferson University, Philadelphia), S. Small (New York Uni-versity, New York), and M. Fujioka (Thomas Jefferson University, Philadelphia)for their kind gift of the eve stripe reporter transgenic flies; Andrew Arm-strong for his help in scoring embryos; Sunil Nityanand for help with themanuscript; Rupinder Sayal for confocal imaging of embryos; the ProteomicsCore Facility, Michigan State University, for spectrometric analysis; the Bloom-ington stock center (Indiana) for fly stocks; and the Developmental StudiesHybridoma Bank at the University of Iowa for antibodies. This work wassupported by National Institutes of Health Grant GM-56976 (to D.N.A.).

1. Gray S, Levine M (1996) Short-range transcriptional repressors mediate both quench-ing and direct repression within complex loci in Drosophila. Genes Dev 10:700–710.

2. Courey AJ, Jia S (2001) Transcriptional repression: The long and the short of it. GenesDev 15:2786–2796.

3. Martinez CA, Arnosti DN (2008) Spreading of a corepressor linked to action of long-range repressor Hairy. Mol Cell Biol 8:2792–2802.

4. Nibu Y, Zhang H, Levine M (1998) Interaction of short-range repressors with DrosophilaCtBP in the embryo. Science 280:101–104.

5. Paroush Z, et al. (1994) Groucho is required for Drosophila neurogenesis, segmentationandsexdeterminationandinteractsdirectlywithhairy-relatedbHLHproteins.Cell79:805–815.

6. Smith ST, Jaynes JB (1996) A conserved regions of engrailed, shared among all en-, gsc-,Nk1-, Nk2-, and msh-class homeoproteins, mediates active transcriptional repression invivo. Development 122:3141–3150.

7. Chinnadurai G (2007) Transcriptional regulation by C-terminal binding proteins. IntJ Biochem Cell Biol 39:1593–1607.

8. Pagan JK, et al. (2007) A novel corepressor, BCoR-L1, represses transcription through aninteraction with CtBP. J Biol Chem 282:15248–15257.

9. Nibu Y, et al. (1998) dCtBP mediates transcriptional repression by Knirps, Kruppel andSnail in the Drosophila embryo. EMBO J 17:7009–7020.

10. Jimenez G, Paroush Z, Ish-Horowicz D (1997) Groucho acts as a corepressor for a subsetof negative regulators, including Hairy and Engrailed. Genes Dev 11:3072–3082.

11. Tolkunova EN, Fujioka M, Kobayashi M, Deka D, Jaynes JB (1998) Two distinct types ofrepression domain in Engrailed: One interacts with the Groucho corepressor and ispreferentially active on integrated target genes. Mol Cell Biol 18:2804–2814.

12. Flores-Saaib RD, Courey AJ (2000) Analysis of Groucho-histone interactions suggestsmechanistic similarities between Groucho- and Tup1-mediated repression. Nucleic AcidsRes 21:4189–4196.

13. Chen G, Fernandez J, Mische S, Courey AJ (1999) A functional interaction between thehistone deacetylase Rpd3 and the corepressor Groucho in Drosphila development.Genes Dev 13:2218–2230.

14. Cai HN, Arnosti DN, Levine M (1996) Long-range repression in the Drosophila embryo.Proc Natl Acad Sci USA 93:9309–9314.

15. Dubnicoff T, et al. (1997) Conversion of Dorsal from an activator to a repressor by theglobal corepressor Groucho. Genes Dev 11:2952–2957.

16. Strunk B, et al. (2001) Role of CtBP in transcriptional repression by the Drosophila Giantprotein. Dev Biol 15:229–240.

17. Keller S, et al. (2000) dCtBP-dependent and -independent repression activities of theDrosophila Knirps protein. Mol Cell Biol 20:7247–7258.

18. Hewitt GF, et al. (1999) Transcriptional repression by the Drosophila Giant protein: ciselement positioning provides an alternative means of interpreting an effector gradi-ent. Development 126:1201–1210.

19. Sutrias-Grau M, Arnosti DN (2004) CtBP contributes quantitatively to Knirps epressionactivity in an NAD binding-dependent manner. Mol Cell Biol 24:5953–5966.

20. Kulkarni MM, Arnosti DN (2005) cis-regulatory logic of short-range transcriptionalrepression in Drosophila melanogaster. Mol Cell Biol 25:3411–3420.

21. Ryu JR, Arnosti DN (2003) Functional similarity of Knirps CtBP-dependent and CtBP-independent transcriptional repressor activities. Nucleic Acids Res 31:4654–4662.

22. Struffi P, Corado M, Kulkarni M, Arnosti DN (2004) Quantitative contributions of CtBP-dependent and -independent repression activities of Knirps. Development 131:2419–2429.

23. Struffi P, Arnosti DN (2005) Functional interaction between the Drosophila Knirps short-range transcriptional repressor and RPD3 histone deacetylase. J Biol Chem 280:40757–40765.

24. Clyde DE, et al. (2003) A self-organizing system of repressor gradients establishessegmental complexity in Drosophila. Nature 426:849–853.

25. Delidakis C, Preiss A, Hartley DA, Artavanis-Tsakonas S (1991) Two genetically andmolecularly distinct functions involved in early neurogenesis reside within the En-hancer of split locus of Drosophila melanogaster. Genetics 129:803–823.

26. Gerwin N, et al. (1994) Functional and conserved domains of the Drosophila transcrip-tion factor encoded by the segmentation gene knirps. Mol Cell Biol 14:7899–7908.

27. Poortinga G, Watanabe M, Parkhurst SM (1998) Drosophila CtBP: A Hairy-interactingprotein required for embryonic segmentation and hairy-mediated transcriptionalrepression. EMBO J 17:2067–2078.

28. Zhang H, Levine M (1999) Groucho and dCtBP mediate separate pathways of tran-scriptional repression in the Drosophila embryo. Proc Natl Acad Sci USA 96:535–540.

29. Hasson P, Müller B, Basler K, Paroush Z (2001) Brinker requires two corepressors formaximal and versatile repression in Dpp signalling. EMBO J 20:5725–5736.

30. Andrioli LP, Oberstein AL, Corado MS, Yu D, Small S (2004) Groucho-dependentrepression by sloppy-paired 1 differentially positions anterior pair-rule stripes in theDrosophila embryo. Dev Biol 15:541–551.

31. Sekiya T, Zaret KS (2007) Repression by Groucho/TLE/Grg proteins: Genomic siterecruitment generates compacted chromatin in vitro and impairs activator binding invivo. Mol Cell 28:291–303.

32. Song H, Hasson P, Paroush Z, Courey AJ (2004) Groucho oligomerization is required forrepression in vivo. Mol Cell Biol 10:4341–4350.

33. Jennings BH, et al. (2006) Molecular recognition of transcriptional repressor motifs bythe WD domain of the Groucho/TLE corepressor. Mol Cell 22:645–655.

34. Nibu Y, Zhang H, Levine M (2001) Local action of long-range repressors in the Dro-sophila embryo. EMBO J 20:2246–2253.

35. Jennings BH, Wainwright SM, Ish-Horowicz D (2008) Differential in vivo requirementsfor oligomerization during Groucho-mediated repression. EMBO Rep 9:76–83.

36. Shi Y, et al. (2003) Coordinated histone modifications mediated by a CtBP co-repressorcomplex. Nature 422: 735–738.

37. Kadonaga JT, Tjian R (1986) Affinity purification of sequence-specific DNA bindingproteins. Proc Natl Acad Sci USA 83:5889–5893.

38. Orian A, et al. (2007) A Myc-Groucho complex integrates EGF and Notch signaling toregulate neural development. Proc Natl Acad Sci USA 104:15771–15776.

Payankaulam and Arnosti PNAS � October 13, 2009 � vol. 106 � no. 41 � 17319

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

July

10,

202

1