gjb2 and gjb6 screening in tunisian patients with autosomal recessive deafness

International Journal of Pediatric Otorhinolaryngology xxx (2013) xxx–xxx

G Model

PEDOT-6532; No. of Pages 3

GJB2 and GJB6 screening in Tunisian patients with autosomal recessive deafness

Mediha Trabelsi a,b,*, Wafa Bahri b, Marwene Habibi b, Rim Zainine c, Faouzi Maazoul a,Besbes Ghazi c, Habiba Chaabouni a,b, Ridha Mrad a,b

a Charles Nicolle Hospital, Congenital and Hereditary Diseases, Tunis, Tunisiab Universite Tunis El Manar, Faculte de Medicine de Tunis, Laboratoire de Genetique Humaine, Tunisiac La Rabta Hospital, Otorhinolaryngology Diseases, Tunis, Tunisia

A R T I C L E I N F O

Article history:

Received 23 August 2012

Received in revised form 18 January 2013

Accepted 26 January 2013

Available online xxx

Keywords:

Hearing loss

Tunisian patients

GJB2

GJB6

A B S T R A C T

Autosomal recessive nonsyndromic deafness (ARNSD or DFNB) is a very common genetically

heterogenous disorder. Although DFNB1 mutations are known to be the most frequent cause of this

disorder, they are largely dependent on ethnic groups. The aims of our study are to specify the prevalence

and the spectrum of GJB2 mutations as well as the prevalence of GJB6 large deletion in Tunisian

population.

Patients and methods: 95 unrelated patients with moderate to severe sensorineural hearing loss have

been tested. The GJB2 coding region has been studied by PCR/Sequencing and the del(GJB6-D13S1830)

mutation has been screened by fluorescent PCR multiplex.

Results: 27.36% of patients present mutations on both alleles of GJB2 gene and no one has the del(GJB6-

D13S1830) mutation. The c.35delG mutation represents 86.5% of GJB2 deafness alleles and is found in

homozygous state in 22 patients and in heterozygous state in one patient. Four other mutations are

detected in four probands: two are compound heterozygous for the p.V37I/p.E47X and the c.35delG/

p.R184P mutations, and two are homozygous for the p.E47X and the c.333-334delAA mutations.

Conclusion: Our results showed that c.35delG is the most common but not the only GJB2 mutation and

that the del(GJB6-del D13S1830) is absent in our cohort. Consequently, we propose a systematic

sequencing of GJB2 coding region for ARNSD Tunisian patients and we suggest additional studies to

specify the real prevalence of del(GJB6-D13S1830) in our population.

� 2013 Elsevier Ireland Ltd. All rights reserved.

Contents lists available at SciVerse ScienceDirect

International Journal of Pediatric Otorhinolaryngology

jo ur n al ho m ep ag e: ww w.els evier . c om / lo cat e/ i jp o r l

1. Introduction

Deafness is a common sensory disorder that affects 1:300 to1:1000 children [1]. Its etiology is a genetic disorder in about 60%of cases, including syndromic and nonsyndromic forms. Amonghereditary nonsyndromic deafness, about 80% are inherited as anautosomal recessive trait (ARNSD) and are often profound [2]. Todate close to 95 ARNSD loci have been mapped and 42 deafnessgenes have been identified [3]. DFNB1 (13q11) is the first locusincriminated in autosomal recessive deafness and corresponds totwo genes GJB2 and GJB6 [4,5] that encode gap-junction proteinsconnexin 26 and connexin 30, respectively. These proteins belongto the large family of 6 connexins having four transmembranedomains and which assembly forms a hemichannel calledconnexon. The joining of two connexons from adjacent cells

* Corresponding author at: Address: EPS Charles Nicolle, Bd 9 Avril 1938, 1006,

Tunis, Tunisia. Tel.: +216 7 1 570 756; fax: +216 7 1 570 553.

E-mail addresses: [email protected] (M. Trabelsi), [email protected]

(F. Maazoul), [email protected] (H. Chaabouni), [email protected]

(R. Mrad).

Please cite this article in press as: M. Trabelsi, et al., GJB2 and GJB6 screJ. Pediatr. Otorhinolaryngol. (2013), http://dx.doi.org/10.1016/j.ijpor

0165-5876/$ – see front matter � 2013 Elsevier Ireland Ltd. All rights reserved.

http://dx.doi.org/10.1016/j.ijporl.2013.01.024

establishes gap-junctional intercellular communication by allow-ing the K+ recycling [6–8].

Mutations in gap junction beta 2 (GJB2) gene (OMIM No.121011) are noted in up to 50% of ARNSD cases [9,10]. To date,more than 100 mutations in GJB2 are described in deaf subjects [3].The distribution pattern of these variations differs considerablyamong ethnic groups. For example, the c.35delG is considered asthe major GJB2 mutation detected in North American, Europeanand Mediterranean populations [11].

Mutations in GJB6 gene are also described in deaf patients. Thelarge deletion del(GJB6-D13S1830) involving the first two exons, apart of the third exon and a large region of the upstream sequenceof this gene is found to be very common in France, Spain, Cuba andBrazil [5,12].

Previous studies realized in 172 ARNSD families, mainlyoriginated from the south of Tunisia, have revealed that theprevalence of mutations in GJB2 gene is relatively high and the del(GJB6-D13S1830) mutation is detected at heterozygous state inonly one among 102 families without any evidence of a secondmutation in GJB2, GJB6 or GJB3 genes. Except the p.E47X mutationwhich is noted in only one patient (0.5%), the c.35delG is the uniqueGJB2 mutation with prevalence close to 20.5%. Sequencing of the

ening in Tunisian patients with autosomal recessive deafness, Int.l.2013.01.024


mailto:[email protected]





http://www.sciencedirect.com/science/journal/01655876


Table 1GJB2 genotypes and percentage of consanguinity in 95 Tunisian patients with

ARNSD.

Genotype Frequency Consanguinity

35delG/35delG 22/95 11/22a

35delG/R184P 1/95 Non consanguineous

E47X/V37I 1/95 Non consanguineous

E47X/E47X 1/95 Consanguineous

333-334delAA/333-334delAA 1/95 Consanguineous

WT/WT 69/95 ND

ND, not determined.a Consanguinity was noted in 11 patients among 22.

M. Trabelsi et al. / International Journal of Pediatric Otorhinolaryngology xxx (2013) xxx–xxx2

G Model


promoter, the non-coding exon of GJB2 and the coding region ofGJB3 and GJB6 reveal no disorder [13,14].

The aims of the present study are to determine the prevalenceand the spectrum of GJB2 mutations as well as the prevalence of thedel(GJB6-D13S1830) mutation in ARNSD families originated fromthe north of Tunisia and to compare our results to those previouslydescribed in order to determine whether there is geneticheterogeneity within the different regions of Tunisia andconsequently to orientate the molecular diagnosis of such adisorder.

2. Patients and methods

2.1. Patients and samples

A total of 95 unrelated patients, sporadic and familial, withARNSD are included in our study. Syndromic forms, cases withpostlingual onset or an acquired etiology as well as cases ofunilateral hearing loss have been excluded from our study. Allpatients, of which 46 are male and 49 are female, are agedbetween 2 and 35 years. They were referred from the Oto RhinoLaryngology service at La Rabta Hospital for molecular analysis orgenetic counseling. The audiogram, realized for all patients,reveals the same profile with a severe (70–89 dB) or a profoundhearing loss (>90 dB). All patients are Tunisian, originatingfrom various regions of the north of Tunisia. EDTA-antic-oagulated blood samples have been obtained following informedconsent from the patients and/or parents for genomic DNAisolation.

2.2. Mutation detection methods

All 95 patients have been investigated for GJB2 mutations. Thetwo exons of this gene and their flanking intronic regions havebeen amplified, at 55 8C annealing temperature, using two primerpairs: F:CAGTCTCCGAGGGAAGAGG/R: GCAACCGCTCTGGGTCTCfor exon 1 and F: TCTTTTCCAGAGCAAACCGCC/R: TGAGCAC-GGGTTGCCTCATC for exon 2.

Their respective 294 and 777 pb PCR products have beenanalyzed by direct genomic sequencing using the dideoxy chainterminator method and the Applied Biosystems DNA sequencerABI 3130.

Probands who are negative or only have one GJB2 mutated allelehave been analyzed for the presence of the del(GJB6-D13S1830)mutation. As previously reported, multiplex PCR with threeprimers allowing identification of wild type and deleted productshas been performed [5]. As the forward primer is fluorescentlylabeled, PCR alleles have been analyzed with an ABI Prism 3130Genetic Analyzer (AppliedBiosystems).

3. Results

All GJB2 mutations are localized in the exon2. Among the 95tested patients, 26 (27.36%) present mutations on both alleles ofGJB2 gene and no one have the del(GJB6-D13S1830) mutation.

The c.35delG mutation is found in homozygous state in 22patients and in heterozygous state in one patient, which representsa total of 45 alleles c.35delG.

The heterozygote patient for the c.35delG mutation is alsoheterozygote for the c.551G>C (p.R184P).

Among the three remaining patients with GJB2 mutations, oneproband is compound heterozygous for the p.V37I and p.E47Xmutations, another is homozygote for the c.333-334delAAmutation and the third is homozygote for the p.E47X mutation(Table 1).

Consanguinity was noted in 50% of GJB2 mutated patients.


4. Discussion

DFNB1 mutations are known to be the most frequent cause ofARNSD in many populations like the Mediterranean ones [15].However, the spectrum and the frequency of GJB2 mutations mayvary between countries or even between regions of the samecountry [17]. Previous studies, realized in Tunisian population,have revealed that GJB2 related deafness account for 17–24%[13,14,16]. This level, which approximates the Moroccan (18.9%),the Iranian (16–26%) and the Turkish (25%) ones [17,18], is slightlyhigher in the present study (27.3%) but still lower than thosereported in western countries [19–21]. Among the 26 patients, 22are homozygous for the c.35delG, 2 are homozygous for the c.333-334delAA or the p.E47X mutations and 2 are compoundheterozygous (p.V37I/p.E47X and c.35delG/p.R184P). Thus, inaddition to the c.35delG, four other mutations are detected inseven alleles. Therefore, the c.35delG mutation represents 86.5% ofGJB2 deafness alleles. This lower proportion, compared to previousstudies in the south of Tunisia [13,16], underlines a variability ofthe c.35delG frequency between regions of Tunisia. Indeed, thisphenomenon could be explained by the lower frequency ofconsanguineous unions in the north of Tunisia and especially in thecapital city where the immigration movements are significant.Apart from the p.E47X mutation, which has been already describedin Tunisian population [14], we note three novel mutations. Thep.V37I missense mutation, which pathogenicity has been longdiscussed before retained [22], was previously noted in severalpopulations as American, Chinese, Italian and Moroccan [19,23–25] and with a high prevalence in Malaysia, where it represents themost frequent GJB2 mutation (62%) [26]. Its report in compoundheterozygosity with the p.E47X mutation has never been describedbefore this study. In contrast, the rare c.333-334delAA frameshiftmutation, which has been always reported in compound hetero-zygosity [27–29], is detected in homozygous state in one patient ofour cohort. The p.R184Q mutation, commonly described as a raremutation [19–21], is identified on only one chromosome. All GJB2-wildtype affected individuals have been tested for the commondeletion del(GJB6-D13S1830) but none of them present thismutation. These results differ slightly from those described in aprevious Tunisian study where this mutation has been identified atheterozygous state in only one patient [13]. Knowing that thismutation is also absent in Moroccan and Algerian populationswhile is very common in many western countries [18,25,30,31], weconclude that this deletion seems to be restricted to somepopulations. Consequently, systematic screening of this deletionin patients of our population, with no or one GJB2 mutated allele,should be discussed based on additional studies. For the 69remaining patients without GJB2 or GJB6 mutations, furtherinvestigations to screen other DFNB genes should be considered.However, previous Tunisian studies testing some DFNB genes asTMC1, CLDN14, WHRN and SRRB have showed that except theDFNB7/11 which may be a common cause for ARNSD in Tunisia,DFNB29, DFNB31 and DFNB35 are respectively unlikely to be of



M. Trabelsi et al. / International Journal of Pediatric Otorhinolaryngology xxx (2013) xxx–xxx 3

G Model


epidemiologic importance [13,32–34]. Consequently, screening ofgenes which mutations could be associated with a very geneticheterogeneous disease like the ARNSD, should use the next-generation sequencing technologies rather than the usual meth-ods, to lower the cost of DNA sequencing.

In summary, we have assessed in this study the contributionand the spectrum of GJB2 and GJB6 mutations in ARNSD familiesoriginated from the north of Tunisia. Our data confirm that,regardless the region, mutations in the GJB2 gene are prevalent inTunisian patients and the c.35delG was the most common GJB2

mutation. In addition, we have identified three GJB2 mutations notpreviously described in Tunisian studies and we did not detect anypatient with the GJB6 large deletions. According to these results,the most appropriate testing protocol for ARNSD Tunisian patientsshould cover the whole coding region of GJB2 gene. Inclusion ofGJB6 gene testing in this protocol should be orientated byadditional Tunisian studies to specify the real prevalence of thismutation in our population.

References

[1] A.L. Mehl, V. Thomson, The Colorado newborn hearing screening project, 1992–1999: on the threshold of effective population-based universal newborn hearingscreening, Pediatrics 109 (2002) E7.

[2] K. Cryns, E. Orzan, A. Murgia, P.L.M. Huygen, F. Moreno, I. del Castillo, et al., Agenotype–phenotype correlation for GJB2 (connexin 26) deafness, J. Med. Genet41 (2004) 147–154.

[3] The connexin-deafness homepage, available on: http://davinci.crg.es/deafness/.[4] D.P. Kelsell, J. Dunlop, H.P. Stevens, N.J. Lench, J.N. Liang, G. Parry, et al., Connexin

26 mutations in hereditary nonsyndromic sensorineural deafness, Nature 387(1997) 80–83.

[5] I. Del Castillo, M. Villamar, M.A. Moreno-Pelayo, F.J. del Castillo, A. Alvarez, D.Telleria, et al., A deletion involving the connexin 30 gene in nonsyndromic hearingimpairment, N. Engl. J. Med. 346 (2002) 243–249.

[6] N.M. Kumar, N.B. Gilula, The gap junction communication channel, Cell 84 (1996)381–388.

[7] J. Lautermann, H.G. Frank, K. Jahnke, O. Traub, E. Winterhager, Developmentalexpression patterns of connexin-26 and -30 in the rat cochlea, Dev. Genet. 25(1999) 306–311.

[8] M. Cohen-Salmon, T. Ott, V. Michel, J.P. Hardelin, I. Perfettini, M. Eybalin, et al.,Targeted ablation of connexin 26 in the inner ear epithelial gap junction networkcauses hearing impairment and cell death, Curr. Biol. 12 (2002) 1106–1111.

[9] E.S. Cohen, P.M. Kelley, Clinical phenotype and mutations in Cx26(DFNB1/GJB2),the most common cause of childhood hearing loss, Am. J. Med. Genet. 89 (1999)130–136.

[10] P. Guilford, S. Arab, S. BBlanchard, J. Levilliers, J. Weissenbach, et al., Anonsyn-dromic form of neurosensory recessive deafness maps to pericentromeric regionof chromosome 13q, Nat. Genet. 6 (1994) 24–28.

[11] F. Denoyelle, D. Weil, M.A. Maw, S.A. Wilcox, N.J. Lench, D.R. Allen-Powell, et al.,Prelingual deafness: high prevalence of a 30delG mutation in the connexin 26gene, Hum. Mol. Genet. 6 (1997) 2173–2177.

[12] A.C. Batissoco, R.S. Abreu-Silva, M.C. Braga, K. Lezirovitz, V. Della-Rosa, T. AlfredoJr., et al., Prevalence of GJB2 and GJB6 mutations in a cohort of 300 Brazilianhearing-impaired individuals: implications for diagnosis and genetic counseling,Ear Hear. 30 (1) (2009) 1–7.

[13] H. Belguith, A. Tlili, H. Dhouib, I. Ben Rebeh, I. Lahmar, I. Charfeddine, et al.,Mutation in gap and tight junctions in patients with non-syndromic hearing loss,Biochem. Biophys. Res. Commun. 385 (2009) 1–5.

[14] S. Masmoudi, A. Elgaied-Boulila, I. Kassab, S. Ben Arab, S. Blanchard, J.E. Bouzovita,et al., Determination of the frequency of connexin 26 mutations in inheritedsensorineural deafness and carrier rates in Tunisian population using DGGEmethod, J. Med. Genet. 37 (2000) E39.

[15] M.B. Petersenm, P.J. Willemsm, Non-syndromic, autosomal-recessive deafness,Clin. Genet. 69 (2006) 371–392.


[16] H. Belguith, S. Hajji, N. Salem, I. Charfeddine, I. Lahmar, M. Ben Amor, et al.,Analysis of GJB2 mutation: evidence for a Mediterranean ancestor for 35delGmutation, Clin. Genet. 68 (2005) 188–189.

[17] B. Davarnia, M. Babanejead, Z. Fattahi, N. Nikzat, N. Bazazzadegan, A. Pirzade,et al., Spectrum of GJB2 (Cx26) gene mutations in Iranian Azeri patients with nonsyndromic autosoaml recessive hearing loss, Int. J. Pediatr. Otorhinolaryngol. 76(2012) 268–271.

[18] B. Gazzaz, D. Weil, L. Rais, O. Akhyat, H. Azeddoug, S. Nadifi, et al., Autosomalrecessive and sporadic deafness in Morocco: high frequency of the 35 delGGJB2 mutation and absence of the 342-kb GJB6 variant, Hear. Res. 210 (2005)80–84.

[19] R. Rabionet, L. Zelante, N. Lopez-Bigas, L. D’Agruma, S. Melchionda, G. Restagno,et al., Molecular basis of childhood deafness resulting from mutations in the GJB2(connexin 26) gene, Hum. Genet. 106 ((Jan) 1) (2000) 40–44.

[20] A. Pampanos, J. Economides, V. Iliadou, P. Neou, P. Leotsakos, N. Voyiatzis, et al.,Prevalence of GJB2 mutations in prelingual deafness in the Greek population, Int.J. Pediatr. Otorhinolaryngol. 65 ((Sep) 2) (2002) 101–108.

[21] W. Wiszniewski, L. Sobieszczanska-Radoszewska, E. Nowakowska-Szyrwinska, E.Obersztyn, High frequency of GJB2 gene mutations in Polish patients withprelingual nonsyndromic deafness, Bal. J. Genet Test. 5 ((Summer) 2) (2001)147–148.

[22] P.M. Kelley, D.J. Harris, B.C. Comer, J.W. Askew, T. Fowler, S.D. Smith, et al., Novelmutations in the connexin 26 gene (GJB2) that cause autosomal recessive(DFNB1) hearing loss, Am. J. Hum. Genet. 62 (1998) 792–799.

[23] M.A. Kenna, B.L. Wu, D.A. Cotanche, B.R. Korf, H.L. Rehm, Connexin 26 studies inpatients with sensorineural hearing loss, Arch. Otolaryngol. Head Neck Surg. 127((Sep) 9) (2001) 1037–1042.

[24] X.Z. Liu, X.J. Xia, X.M. Ke, X.M. Ouyang, L.L. Du, Y.H. Liu, et al., The prevalence ofconnexin 26 (GJB2) mutations in the Chinese population, Hum. Genet. 111 ((Oct)4–5) (2002) 394–397 [Epub 2002 Aug 16].

[25] O. Abidi, R. Boulouiz, H. Nahili, M. Ridal, M.N. Alami, A. Tlili, et al., GJB2 (connexin26) gene mutations in Moroccan patients with autosomal recessive non-syn-dromic hearing loss and carrier frequency of the common GJB2-35delG mutation,Int. J. Pediatr. Otorhinolaryngol. 71 ((Aug) 8) (2007) 1239–1245 (Epub 2007 Jun5).

[26] B.H. Ruszymah, I.F. Wahida, Y. Zakinah, Z. Zahari, M.D. Norazlinda, L. Saim, et al.,Congenital deafness: high prevalence of a V37I mutation in the GJB2 geneamong deaf school children in Alor Setar, Med. J. Malaysia 60 ((Aug) 3) (2005)269–274.

[27] T. Szemes, I. Kadasi, Prevalence of DFNB1 mutations in Slovak patients with non-syndromic hearing loss. Gabriel Minarik, denisa tretinarova, Int. J. Pediatr. Otor-hinolaryngol. (2012), http://dx.doi.org/10.1016/j.ijporl.2011.12.020.

[28] N.A. Barashkov, L.U. Dzhemileva, S.A. Fedorova, N.R. Maksimova, E.K. Khusnutdi-nova, Connexin gene 26 (GJB2) mutations in patients with hereditary non-syndromic sensorineural loss of hearing in the Republic of Sakha (Yakutia), Vestn.Otorinolaringol. (5) (2008) 23–28 (Russian).

[29] R.L. Snoeckx, D.M. Hassan, N.M. Kamal, K. Van Den Bogaert, Guy Van Camp,Mutation analysis of the GJB2 (Connexin 26) gene in Egypt, Human Mutation inBrief No. 821, 2005, Online.

[30] F. Ammar-Khodja, V. Faugere, D. Baux, C. Giannesini, S. Leonard, M. Makrelouf,et al., Molecular screening of deafness in Algeria: high genetic heterogeneityinvolving DFNB1 and the Usher loci, DFNB2/USH1B, DFNB12/USH1D andDFNB23/USH1F, Eur. J. Med. Genet. 52 ((Jul–Aug) 4) (2009) 174–179 (Epub2009 Apr 16).

[31] I. del Castillo, M.A. Moreno-Pelayo, F.J. del Castillo, Z. Brownstein, S. Marlin, Q.Adina, et al., Prevalence and evolutionary origins of the del(GJB6-D13S1830)mutation in the DFNB1 locus in hearing-impaired subjects: a multicenter study,Am. J. Hum. Genet. 73 (2003) 1452–1458.

[32] A. Tlili, I.B. Rebeh, M. Aifa-Hmani, H. Dhouib, J. Moalla, J. Tlili-Chouchene, et al.,TMC1 but not TMC2 is responsible for autosomal recessive nonsyndromic hearingimpairment in Tunisian families, Audiol. Neurootol. 13 (4) (2008) 213–218 (Epub2008 Feb 7).

[33] A. Tlili, I. Charfedine, I. Lahmar, Z. Benzina, B.A. Mohamed, D. Weil, et al.,Identification of a novel frameshift mutation in the DFNB31/WHRN gene in aTunisian consanguineous family with hereditary non-syndromic recessive hear-ing loss, Hum. Mutat. 25 ((May) 5) (2005) 503.

[34] M. Ben Saıd, L. Ayedi, M. Mnejja, B. Hakim, A. Khalfallah, I. Charfeddine, et al., Anovel missense mutation in the ESRRB gene causes DFNB35 hearing loss in aTunisian family, Eur J Med Genet. 54 ((Nov–Dec) 6) (2011) e535–e541 (Epub2011 Jul 13).


http://davinci.crg.es/deafness/



gjb2 and gjb6 screening in tunisian patients with autosomal recessive deafness

Documents