genetics & applications vol. 1, no. 1 · 2017-06-21 · university of sarajevo g vol. 1, no. 1...

Vol. 1, No. 1

June, 2017

Genetics & Applications

The Official Publication of the

Institute for Genetic Engineering and Biotechnology

University of Sarajevo

Genetics ● Genomics ● Genetic engineering ● Biotechnology ● Bioinformatics

ISSN 2566-2937

G&A

ISSN 2566-2937

Genetics &

Applications

Volume 1, Number 1

June, 2017

The Official Publication of the

Institute for Genetic Engineering and Biotechnology


Genetics & Applications Vol.1|No.1

Editor in Chief

Kasim Bajrović, University of Sarajevo,

Institute for Genetic Engineering and

Biotechnology, B&H

President of Editorial Board

Rifat Hadžiselimović, University of

Sarajevo, Institute for Genetic

Engineering and Biotechnology, B&H

Editorial Board

Nazif Alić, Institute of Healthy Ageing,

University College London, UK

Maja Barbalić, Univeristy of Split,

School of Medicine, Croatia

Jelena Begović, University of Belgrade,

Institute of Molecular Genetics and

Genetic Engineering, Serbia

Faruk Bogunić, University of Sarajevo,

Faculty of Forestry, B&H

José A. Bonilla, Centro de

Investigación en Biología Celular y

Molecular (CIBCM), Universidad de

Costa Rica, Costa Rica

Aparecido da Cruz, Núcleo de

Pesquisas Replicon, Departamento de

Biologia, Pontifícia Universidade

Católica de Goiás, Brazil

Magda Bou Dagher-Karrat, Saint

Joseph University, Faculty of Science

Beirut, Lebanon

Irena Drmic Hofman, University of

Split, School of Medicine, Croatia

Adaleta Durmić-Pašić, University of



Fuad Gaši, University of Sarajevo,

Faculty of Agriculture and Food

Science, B&H

Nermin Gözükirmizi, İstanbul

Üniversitesi, Moleküler Biyoloji Ve

Genetik Bölümü, Turkey

Sanin Haverić, University of Sarajevo,


Biotechnology, B&H

Oriane Hidalgo, Royal Botanic

Gardens, Kew, UK

Belma Kalamujić Stroil, University of



Lada Lukić Bilela, University of

Sarajevo, Faculty of Science, B&H

Saša Marić, University of Belgrade,

Faculty of Biology, Serbia

Damir Marjanović, Burch University,

B&H

Mladen Miloš, University of Split,

Department of Biochemistry, Croatia

Edina Muratović, University of

Sarajevo, Faculty of Science, B&H

Beate Niesler, University Hospital

Heidelberg, Institute of Human

Genetics, Department of Human

Molecular Genetics, Germany

Sonja Pavlovic, University of Belgrade,

Institute of Molecular Genetics and

Genetic Engineering, Serbia

Borut Peterlin, Ljubljana University

Medical Centre, Slovenia

Dijana Plaseska Karanfilska, Research

Center for Genetic Engineering and

Biotechnology “Georgi D. Efremov”,

Macedonian Academy of Sciences and

Arts, FYR Macedonia

Zoran Popovski, Ss. Cyril and

Methodius University, Department of

Biochemistry, FYR Macedonia

Lejla Pojskić, University of Sarajevo,


Biotechnology, B&H

Naris Pojskić, University of Sarajevo,


Biotechnology, B&H

Simona Sušnik Bajec, University of

Ljubljana, Department of Animal

Science, Slovenia

Emilija Šukarova Stefanovska,

Research Center for Genetic

Engineering and Biotechnology

“Georgi D. Efremov”, Macedonian

Academy of Sciences and Arts, FYR

Macedonia

Joan Vallès; Laboratori de Botànica,

Facultat de Farmàcia, Universitat de

Barcelona, Spain

Sonja Yakovlev, Université Paris-Sud

XI, Laboratoire Ecologie, Systématique

et Evolution, France

Macdonald Wick, The Ohio State

University, Departmant of Animal

Science, USA

Executive Editor

Jasmina Čakar, University of Sarajevo,


Biotechnology, B&H

Language Editor

Adaleta Durmić-Pašić, University of



Technical Editor

Semir Dorić, University of Sarajevo,


Biotechnology, B&H

Proofreading

Jasna Hanjalić, University of Sarajevo,


Biotechnology, B&H

Cover photography

Stoneflies (Plecoptera) in river Ribnica,

Kakanj. Provided by: Semir Dorić &

Adnan Čučuković. Copyright by the

University of Sarajevo, Institute for

Genetic Engineering and

Biotechnology, B&H

Publisher


Biotechnology, University of Sarajevo

Zmaja od Bosne 8, 71000 Sarajevo,

Bosnia and Herzegovina

www.ingeb.unsa.ba

Phone: +387 33 220-926

Fax: +387 33 442-891

[email protected]

Impressum


Contents

EDITOR’S PREFACE 1

GENETIC IDENTITY OF RASPBERRY ‘POLANA’ PLANTLINGS EXAMINED USING MICROSATELLITE MARKERS

Gaši F., Hodžić A., Hadžiavdić M., Kurtović M., Grahić J., Lasić L., Kalamujić Stroil B., Pojskić N.

3

AN OPTIMIZED DNA ISOLATION PROTOCOL ENABLES AN INSIGHT INTO MOLECULAR GENETIC BACKGROUND OF ENDEMIC Moltkia petraea (Tratt.) Griseb. FROM BOSNIA AND HERZEGOVINA

Hanjalić J., Dorić S., Lasić L., Kalamujić Stroil B., Hasičić S., Pojskić N.

7

MICROSATELLITE DIVERSITY OF CROSSBRED HORSES RAISED IN BOSNIA AND HERZEGOVINA

Rukavina D., Hasanbašić D., Kalamujić Stroil B., Pojskić N.

16

VALIDATION OF VAGINAL SELF-SAMPLING AS AN ALTERNATIVE OPTION IN PCR BASED DETECTION OF HPV IN CERVICAL CANCER SCREENING IN BOSNIA AND HERZEGOVINA

Radić K., Pojskić L., Tomić-Čiča A., Ramić J., Ler D., Lojo-Kadrić N., Pojskić N., Bajrović K.

23

SCREENING FOR GMO IN FERMENTED SOY SAUCE

Ahatović A., Ljekperić E., Nuhanović M., Durmić-Pašić A.

33

IN VITRO ANALYSIS OF TARTRAZINE GENOTOXICITY AND CYTOTOXICITY

Haverić A., Inajetović D., Vareškić A., Hadžić M., Haverić S.

37

INFLUENCE OF BASIC VARIABLES ON MICRONUCLEI FREQUENCY AND CHROMOSOMAL ABERRATIONS IN GENERAL POPULATION OF FB&H

Mačkić-Đurović M., Aganović-Mušinović I., Lepara O., Ibrulj S.

44

COMPARISON OF TWO DIFFERENT MULTIPLEX SYSTEMS IN CALCULATING KINSHIP AMONG CLOSE RELATIVES

Beribaka M., Hafizović S., Pilav A., Džehverović M., Marjanović D., Čakar J.

51

AIR POLLUTION TOLERANCE INDEX OF Plantago major IN STEELWORKS AREA OF ZENICA, BOSNIA AND HERZEGOVINA

Klisura T., Parić A., Karalija E., Subašić M.

59

PREDICTION OF THE SIZE OF NANOPARTICLES AND MICROSPORE SURFACE AREA USING ARTIFICIAL NEURAL NETWORK

Sarajlić Dž., Abdel-Ilah L., Fojnica A., Osmanović A.

65

https://academic.oup.com/biolreprod/search-results?f_TocHeadingTitle=Editor%E2%80%99s%20Preface


FROM THE ANNALS

The first known publication on populational genetics of B&H population

71

INSTRUCTIONS FOR CONTRIBUTORS 73

https://academic.oup.com/biolreprod/search-results?f_TocHeadingTitle=Editor%E2%80%99s%20Preface


1

Editor´s Preface

Science based phase of the development of biodiversity research in Bosnia and Herzegovina

(B&H) begins with the foundation of the Department of natural history within National

Museum of Bosnia and Herzegovina (1988), whose tradition gave rise to all the fields of

biology, biomedicine and biotechnology in our state.

The articles published in the 1930s are usually declared as pioneering works in genetics in

B&H; however, the first considerable contributions to the understanding of genetic

constitution of B&H population emerge in the 1960s. Although, research of similar type have

been initiated at the end of XIX century, before the establishment of genetics as a modern

science. Austrian military physicians have than described frequencies of highly heritable traits

in conscripts from five contemporary administrative counties. They observed eye, hair and

skin color, and did not delve into genetic basis of the traits which, at that time, was unknown.

Population-genetic research into qualitative variation within BH population was particularly

vigorous and organized over the past four decades, when basic parameters of genetic structure

were described.

The levels of data analysis are linked to particular timeline. Beginning with the onset of

anthropo-genetic research in this area those include:

(1) Analysis of gene and phenotype frequencies in certain phenotype systems in human:

- Period 1934-1935 and 1953-1966 includes the analysis of ABO, Rh and MN systems;

- Period 1967-1976 includes analyses of numerous biochemical, physiological and

morphological traits of mainly urban population;

(2) Complex research into inter-populational genetic distance in mainly rural populations,

beginning in 1977.

The formation of the Institute for Genetic Engineering and Biotechnology of Sarajevo

University and maturation of a new generation of geneticists, established in referent

databases, is a turning point in the development of B&H genetics.

The period of molecular-genetic research into intra-populational and inter-populational

variation of genetic markers in human, animal and plant populations in B&H includes a

series of studies reflected in completion of numerous research projects.

Earlier research into genetic structure of BH human, animal and plant populations are based

on the observation of nuclear and mitochondrial DNA markers using various methods.

In the observed groups of local human, animal and plant populations, allelic frequencies and

indicators of nuclear genetic heterogeneity were analyzed on the basis of as many as 15

genetic markers. B&H geneticists of the first and the second generation, with dozen

exceptions, have published the results of the indicated research predominantly in local

journals, unavailable to the wider scientific community.

Widening of the circle of classical and molecular geneticists and the establishment of Genetic

Association in B&H have necessitated an introduction of an aspiring local journal of genetic


2

research (in English), with competent international editorial board that would include

established researchers in the various fields of genetics.

We hereby expose this first issue of Genetics & Applications (G&A) to the public scrutiny,

and invite all the geneticists of the world to join us in our endeavor on advancing its quality

and international reputation.

Sarajevo, May 2017

Editor in Chief: President:

Prof. dr. Kasim Bajrović Prof. dr Rifat Hadžiselimović


3

GENETIC IDENTITY OF RASPBERRY ‘POLANA’ PLANTLINGS EXAMINED USING

MICROSATELLITE MARKERS

Fuad Gaši1*, Adnan Hodžić1, Mirza Hadžiavdić1, Mirsad Kurtović1, Jasmin Grahić1, Lejla

Lasić2, Belma Kalamujić Stroil2, Naris Pojskić2

1University of Sarajevo, Faculty of Agriculture and Food Sciences, Sarajevo, Bosnia and Herzegovina

2University of Sarajevo, Institute for Genetic Engineering and Biotechnology (INGEB), Sarajevo, B&H

Abstract

Raspberry cultivars are clonally propagated and therefore all plants

belonging to a single cultivar represent the same genotype. Cultivar

integrity of raspberry plantlings placed on the market in Bosnia and

Herzegovina (B&H) is based on examining of morphological traits, which

is not a reliable tool for genetic identification. In this study plantlings

declared as cultivar ‘Polana’ were genotyped using seven microsatellites, in

order to gain preliminary insight into the genetic integrity of raspberry

plantlings marketed in B&H. Plant tissue (leaves) from 10 raspberry plants

were randomly sampled from a batch of plantlings sold by major fruit

nursery in Bosnia and Herzegovina. Along with these samples, four

reference cultivars with confirmed identity (‘Polka’, ‘Autumn Bliss’,

‘Heritage’ and ‘Polana’) were also included in the study. Seven primer pairs

amplified 31 alleles, or on average 4.4 alleles per locus. UPGMA cluster

analysis, based on the Jaccard similarity coefficient, revealed that among

the ten samples declared as ‘Polana’ plantlings only five were genetically

identical to any of the other samples. The cluster analyses also exposed that

none of the ten samples declared as ‘Polana’ seedlings were in fact identical

or even closely related to the ‘Polana’ reference cultivar or any of the other

reference cultivars. These findings clearly show that the genetic identity of

primocane raspberry plantlings , currently sold in Bosnia and Herzegovina,

needs to be tested using objective and reliable methods rather than simple

morphologic observation.

Key words: cultivar integrity, morphological traits, DNA

Introduction

Red raspberry (Rubus idaeus), along with

strawberry, represents the most commercially

important berry fruit currently cultivated in

Bosnia and Herzegovina (B&H). Raspberry

cultivars are clonally propagated and therefore

all plants belonging to a single cultivar possess

an identical genetic makeup (same genotype). In

order for raspberry plantlings to be placed on

the market in B&H, they must be supervised

during the nursery production in order to ensure

the cultivar integrity. However, this supervision

is based on examining morphological traits,

*Correspondence

E-mail:

[email protected]

Received

January, 2017

Accepted

April, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The

Official Publication of

the Institute for

Genetic Engineering

and Biotechnology,


Short communication


4

which are oftentimes not a reliable tool for the

verification of genetic identity. Unlike

morphological traits, microsatellite DNA

markers have proven to be an excellent tool for

examining the cultivar integrity among

raspberry genotypes (Fernandez-Fernandez et

al., 2011). A number of different microsatellites

or SSRs (Simple Sequence Repeats) have been

developed for R. idaeus (Graham et al., 2002;

Castillo et al., 2010) and are available for this

purpose. Microsatellite markers have previously

been used in genetic studies of several fruit

crops in Bosnia: apple (Gasi et al., 2010; Gasi et

al., 2013a, Gasi et al., 2013d), pear (Gasi et al.,

2013b), plum (Halapija-Kazija et al., 2014) and

cherry (Gasi et al., 2013c). However, until now

SSRs have not been used for genetic analyses of

berry fruits in this country.

In this study, genetic identity of plantlings

declared as cultivar ‘Polana’ were genotyped

using microsatellites, in order to gain

preliminary insight into the genetic integrity of

raspberry plantlings marketed in Bosnia and

Herzegovina.

Materials and methods

Plant tissue (leaves) from 10 raspberry plants,

randomly sampled from a batch of plantlings

sold by a major fruit nursery in Bosnia and

Herzegovina, were used for the isolation of

genomic DNA applying CTAB method (Doyle

and Doyle, 1987). All of the sampled plants

were declared by the nursery to be the plantlings

derived from the primocane raspberry cultivar

‘Polana’. Along with these samples, four

reference cultivars with confirmed identity

(‘Polka’, ‘Autumn Bliss’, ‘Heritage’ and

‘Polana’) were also included in the study. Seven

primer pairs (Table 1) used for SSR

amplifications have previously been published

by Castillo et al. (2010). Polymerase chain

reaction (PCR) amplification of SSR sequences

was performed in a Veriti TM Thermal Cycler

(Applied Biosystems, Foster City, CA) using

fluorescently labelled primers. All PCR

amplifications were performed as described in

Castillo et al. (2010). The detection of SSR

products was conducted on ABI 310 automated

sequencer (Applied Biosystems). PCR product

(1 µL) was added to a master mix containing 9

µL of deionized formamide and 0.5 µL

GeneScan-350 Rox size-standard (Applied

Biosystems). Samples were heated at 95 ˚C for

5 min and immediately cooled down on ice.

SSR profiles were scored using GeneMapper

Software ID v3.2 (Applied Biosystems).

UPGMA cluster analysis, based on Jaccard

similarity coefficient, was calculated using the

obtained SSR data, in NTSYS software (Rohlf,

1993) and visualized by MEGA 5 software

(Molecular Evolutionary Genetics Analysis),

(Tamura et al., 2011).

SSR marker forward primer reverse primer

RhM001 GGTTCGGATAGTTAATCCTCCC CCAACTGTTGTAAATGCAGGAA

RhM003 CCATCTCCAATTCAGTTCTTCC AGCAGAATCGGTTCTTACAAGC

RiM019 ATTCAAGAGCTTAACTGTGGGC CAATATGCCATCCACAGAGAAA

RhM023 CGACAACGACAATTCTCACATT GTTATCAAGCGATCCTGCAGTT

RhM011 AAAGACAAGGCGTCCACAAC GGTTATGCTTTGATTAGGCTGG

RhM043 GGACACGGTTCTAACTATGGCT ATTGTCGCTCCAACGAAGATT

RiM015 CGACACCGATCAGAGCTAATTC ATAGTTGCATTGGCAGGCTTAT

Table 1. Seven SSR markers developed by Castillo et al. (2010), used in this study


5

Results and discussion

Seven primer pairs amplified 31 alleles (Table

2), or on average 4.4 alleles per locus, among all

the 14 analysed raspberry samples. Higher

values for the average alleles per locus (7.9),

among the same SSR loci, have been published

by Castillo et al. (2010). However, in that study

48 different raspberry genotypes were

examined. Overall, the seven primer pairs used

in our research provided sufficient variation for

clear distinction among four reference cultivars.

UPGMA cluster analysis, based on Jaccard

similarity coefficient, revealed that among the

reference cultivars, ‘Heritage’ and the reference

‘Polana’ samples clustered the closest (Figure

1). Similar findings have already been reported

by Bassil et al. (2012). Also, considering that

‘Heritage’ is a parent of the cultivar ‘Polana’

this result was entirely expected.

The same cluster analyses revealed that among

the ten samples declared as ‘Polana’ plantlings,

only five were genetically identical to any of the

other samples. Considering that raspberry

plantlings are clonally propagated, all true

offspring should share the same SSR profile.

The cluster analyses also revealed that none of

the ten samples declared as ‘Polana’ plantlings

were in fact identical or even closely related to

‘Polana’ reference cultivar or any of the other

reference cultivars. The obtained results indicate

that investigated samples are at least in

partgenerative offspring, which probably arose

through spontaneous hybridization between

unknown raspberry genotypes. These findings

clearly show that the supervision of nursery

production, based on morphological traits, does

not guaranty cultivar integrity.

Genotypes RhM001 RhM003 RiM019 RhM023 RhM011 RhM043 RiM015

‘Polka’ 239 241 202 202 180 182 195 195 289 291 371 373 351 351

‘Autumn Bliss’ 227 229 191 193 182 217 187 195 279 279 373 373 349 351

‘Heritage’ 227 236 193 202 180 182 187 195 281 291 371 371 349 351

‘Polana' ref. 236 236 200 202 182 195 187 195 281 281 371 373 351 351

Sample 1 227 236 200 202 174 182 187 195 279 279 373 373 349 351

Sample 2 227 236 195 202 170 178 187 195 285 285 373 373 349 359

Sample 3 227 236 200 202 174 182 187 195 279 279 373 373 349 351

Sample 4 227 236 200 202 174 182 187 195 279 279 373 373 349 349

Sample 5 227 236 200 202 182 182 187 195 279 279 373 373 349 351

Sample 6 227 236 200 204 180 182 187 195 285 285 373 373 349 349

Sample 7 227 236 191 193 174 182 187 195 279 279 373 373 349 351

Sample 8 227 236 191 193 174 182 187 195 279 279 373 373 349 351

Sample 9 227 236 191 193 174 182 187 195 279 279 373 373 349 351

Sample 10 227 236 200 202 182 182 187 195 279 279 373 373 335 339

Table 2. SSR profiles (allele sizes expressed in base pairs) of 10 raspberry plants, declared as plantlings of

the cultivar ‘Polana’, and four reference cultivars, obtained through the analyses of seven SSR loci.


6

Figure 1. UPGMA cluster analyses of 10 raspberry

plants, declared as plantlings of the cultivar

‘Polana’, and four reference cultivars

Conclusions

The genetic identity of primocane raspberry

seedlings, currently sold in Bosnia and

Herzegovina, needs to be tested using a more

objective and reliable method than simple

morphologic observation. The results of this

study indicate that DNA markers are a

necessary tool for this task, among which

microsatellites can be considered as highly

suitable.

References

Bassil NV, Nyberg A, Hummer KE, Graham J,

Dossett M, Finn CE (2012) A universal

fingerprinting set for red raspberry. Acta Hortic

946:83–87.

Castillo NRF, Reed BM, Graham J, Fernández-

Fernández F, Bassil NV (2010) Microsatellite

markers for raspberry and blackberry. J Am Soc

Hortic Sci 135:271–278.

Doyle JJ, Doyle JL (1987) A rapid DNA isolation

procedure for small quantities of fresh leaf tissue.

Phytochemical Bulletin 19, 11-15.

Fernandez-Fernandez F, Antanaviciute L, Govan

CL, Sargent DJ (2011) Development of a

multiplexed microsatellite set for fingerprinting red

raspberry (Rubus idaeus) germplasm and its

transferability to other Rubus species. Journal of

Berry Research 177–187.

Gasi F, Simon S, Pojskic N, Kurtovic M, Pejic I

(2010) Genetic assessment of apple germplasm in

Bosnia and Herzegovina using microsatellite and

morphologic markers. Sci Hortic 126:164–171.

Gasi F, Simon S, Pojskic N, Kurtovic M, Pejic I,

Meland M, Kaiser C (2013a) Evaluation of apple

(Malus x domestica) genetic resources in Bosnia

and Herzegovina using microsatellite markers.

Hort Sci 48:13–21.

Gasi F, Kurtovic M, Kalamujic B, Pojskic N, Grahic

J, Kasier C, Meland M (2013b) Assessment of

European pear (Pyrus communis L.) genetic

resources in Bosnia and Herzegovina using

microsatellite markers. Sci Hort 157:74–83.

Gaši F, Memić S, Kurtović M, Drkenda P, Memić S,

Skender A, Šimon S. (2013c) Determining the

identity of a promising new sour cherry cultivar

using SSR markers. The Journal of Ege University

Faculty of Agriculture 1: 53-56.

Gasi F, Zulj Mihaljevic M, Simon S, Grahic J,

Pojskic N., Kurtovic M., Nikolic D, Pejic I

(2013d). Genetic structure of apple accessions

maintained ex situ in Bosnia and Herzegovina

examined by microsatellite markers. Genetika

45(2):467–478.

Graham J, Smith K, Woodhead M, Russell J (2002)

Development and use of simple sequence repeat

SSR markers in Rubus species. Mol Ecol Notes

2:250–252.

Halapija-Kazija D, Jelacic T, Vujevic P, Milinovic

B, Cicek D, Bisko A, Pejic I, Simon S, Zulj

Mihaljevic M, Pecina M, Nikolic D, Grahic J,

Drkenda P, Gasi F (2014) Plum germplasm in

Croatia and neighbouring countries assessed by

microsatellites and DUS descriptors. Tree Genet

Genom 10, 761–778.

Rohlf FJ (1993) NTSysPC. Applied Biostatistics,

New York, NY.

Tamura K, Peterson D, Peterson N, Stecher G, Nei

M, Kumar S (2011) MEGA5: molecular

evolutionary genetics analysis using maximum

likelihood, evolutionary distance, and maximum

parsimony methods. Mol Biol Evol 28, 2731–

2739.


7

AN OPTIMIZED DNA ISOLATION PROTOCOL ENABLES AN INSIGHT INTO

MOLECULAR GENETIC BACKGROUND OF ENDEMIC Moltkia petraea (Tratt.)

Griseb. FROM BOSNIA AND HERZEGOVINA

Jasna Hanjalić 1*, Semir Dorić1, Lejla Lasić1, Belma Kalamujić Stroil1, Selma Hasičić1, Naris

Pojskić1


Abstract

The Dinaric endemic plant species Moltkia petraea (Tratt.) Griseb. is often

called a "living fossil" of ancient Tertiary flora, with great importance for

Bosnia and Herzegovina’s biodiversity. Considering its narrow and limited

distribution range, insufficient data on the molecular background of this

species is given so far. Due to the presence of various secondary

metabolites that interfere with the DNA, isolation of nucleic acids from

plant cells is known to be challenging. Even in closely related species it is

necessary to optimize DNA isolation protocol in order to obtain high

quality PCR amplifiable DNA. We collected 91 samples from five

populations in Herzegovina. Doyle and Doyle (1987) CTAB protocol was

modified by adding vitamin C (ascorbic acid) to the cell lysis buffer to

improve DNA yield and quality. trnL(UAA) intron and nrDNA (ITS1,

ITS2) molecular markers were applied to demonstrate amplifiability of

isolated DNA and elucidate the intra- and interpopulation genetic diversity.

Our results suggest a successful PCR amplification for 81% of the analyzed

samples. PCR-RFLP analysis of trnL(UAA) revealed that all individuals in

five populations have the same haplotype based on the obtained enzymatic

profile for three enzymes (TaqI, HinfI, HindII). Alignment and comparison

of ITS sequences didn’t reveal any hypervariable portion that could be

informative in elucidating the genetic diversity of M. petraea populations.

Further studies with additional application of microsatellite loci, RAPD and

AFLP methods are necessary in an attempt to get insights into the genetic

diversity of M. petraea.

Key words: Moltkia petraea, trnL, nrDNA, DNA isolation

Introduction

The angiosperm family Boraginaceae includes

approximately 1600 species distributed among

some 110 genera, characterized by a scorpioid

cymose inflorescence (Buys and Hilger, 2003).

Genus Moltkia Lehm. comprises five species

(Cohen, 2014), with Moltkia petraea (Tratt.)

Griseb growing mostly in Mediterranean and

Submediterranean regions (Kremer et al., 2016).

This species is a dense, dwarf shrub, up to 40

cm high, with deep violet–blue tubular flowers,

in simple forked or branching revolute cymes,

*Correspondence

E-mail:

[email protected]

nsa.ba

Received

January, 2017

Accepted

May, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


8

blooming from spring well into the summer

(Fernandes, 1972; Polunin, 1987). It thrives on

calcareous cliffs, in rock crevices, with altitude

distribution ranging from near the sea level to

1500 m a.s.l., although it has been recorded at

2000 m a.s.l. on Mt. Durmitor in Montenegro

(Trinajstić, 1974). While M. petraea withstands

wide range of ecological parameters, it finds the

optimal conditions at altitudes between 300 and

900 m a.s.l. (Marković, 1994). It is probably an

ancient or even relict species (Turrill, 1929).

The current presence of M. petraea in gorges is

probably due to its preservation within these

protected areas during the last Ice Age

(Georgiou et al., 1999). This species is

considered an element of the endemic Ilyric-

Balkan flora restricted to Bosnia and

Herzegovina, Albania, Montenegro, Croatia,

Macedonia and Greece (Jerković et al., 2017).

In B&H, it is present in the mountain regions:

Prenj, Čvrsnica, Plasa, Čabulja, Velež, Žaba,

Bijela Gora and Orijen (Šoljan et al., 2009).

Internal transcribed spacer (ITS) is commonly

used as one of the molecular markers in

phylogenetical studies in Boraginaceae (Cecchi

and Selvi, 2009; Cohen, 2014; Chacón et al.,

2016), an unplaced group in the current

angiosperm phylogeny. The knowledge on

intraindividual polymorphism of ITS in

Boraginaceae is scarce, although there is

evidence of limited intraindividual

polymorphism (Kook et al., 2014). Cecchi and

Selvi (2009) reported a phylogenetic study

based on ITS molecular markers. According to

them, genus Moltkia is a monophyletic and

somewhat isolated group belonging to single

clade with no direct relationship to the genera of

other clades. The characteristic deletion in ITS1

(11-bp deletion, pos. 235–245) shared by the

five species of this genus is a strong argument

for their common ancestry.

The only effort at surveying population

(genetic) diversity of M. petraea has been made

by Šamec (2013), who used RADP markers to

analyze M. petraea from Croatia. However, the

author reported that any attempt at getting an

amplicon failed. So far, M. petraea from Bosnia

and Herzegovina has only been analyzed for the

influence of soil properties on phenolic

compound accumulation (Kremer et al., 2016)

but no data on its genetic diversity exist.

Critical step for molecular characterization of

any plant species is DNA isolation. Generally, it

is quite difficult to extract and purify high-

quality DNA because of high content of

secondary metabolites (tannins, alkaloids, and

polyphenols), polysaccharides and proteins in

plants that mostly act as DNA polymerase

inhibitors. These compounds precipitate along

with DNA, degrade its quality, reduce yield and

often render the sample non-amplifiable and

DNA unstable for longer period (Sarwat et al.,

2006, Hassan et al., 2012). As these compounds

are ubiquitous in plant DNA extracts, numerous

isolation protocols have been modified and used

in various combinations. Due to the chemical

heterogeneity among species, even closely

related species may require different isolation

protocols (Sharma et al., 2002).

The objectives of this study were (i) to obtain

high quality DNA from fresh leaves of M.

petraea with rapid, cost efficient and simple

method for its extraction and purification, and

(ii) to inspect the population (genetic) diversity

using the trnL and ITS molecular genetic

markers.


Sample Collection

The total of 91 samples were collected from five

regions in Herzegovina (Table 1, Figure 1) and

stored at -20 ˚C. For the purposes of DNA

analysis, sampling procedure included: (i)

taking into account the distance between

individuals; (ii) sampling the branches (of each


9

individual) with a few leaves on it respecting

the fact that it is a rare plant species; (iii)

packing plant material into paper bags (each

specimen separately to avoid cross-

contamination).

Table 1. Absolute and relative number of

individuals collected by region and altitude

Region Number of

individuals

Elevation

(m a.s.l.) (%)

Mostarska

Bijela 8 600 9

Grabovica 31 400 34

Most

Begića i

Begovića

20 200 22

Tunel 19 200 21

Drežnica 13 200 14

DNA extraction and qualitative-quantitative

analysis

Frozen and fresh plant tissue (15 mg per sample

on average) was grounded using mortar and

pestle. Different protocols for DNA extraction

were used: CTAB protocol (Doyle and Doyle,

1987); DNeasy Plant Mini Kit (Qiagen),

protocol described by Jobes et al. (1995) and

eventually the optimized procedure based on

CTAB. The quality of genomic DNA was

analyzed using agarose gel electrophoresis. Five

microliters of genomic DNA were run in 1.5 %

(w/v) agarose gel, in 1x SB (Sodium borate)

buffer, pH8 (Brody and Kern, 2005) and

visualized under UV light after staining with

Midori green (Nippon Genetics Europe).

Spectrophotometry was used to determine the

concentration and quality of isolated DNA

(Gallagher, 1994).

Molecular markers

Chloroplast trnL and nrDNA regions were used

to demonstrate amplifiability of isolated DNA

and afterwards observed for the analysis of

genetic diversity. Amplification of trnL (UAA)

intron was performed in an optimized PCR

reaction using primers described by Taberlet et

al. (1991) in 15 µl reactions consisting of 1 µl of

template DNA, 2 mM Tris-HCl (pH 8.0), 10

mM KCl, 0.2 µM of each primer, 0.2 mM

dNTPs, 2.5 mM MgCl2 and 1 unit of TaqGold

DNA polymerase (Thermo Fisher Scientific).

PCR amplification was carried out in 30 cycles

(5 min at 95°C, 45s denaturation at 95°C, 30s

annealing at 51°C, 45s extension at 72°C and 10

min final extension at 72°C). Successfully

amplified trnL (UAA) intron was digested with

restriction enzymes (Taq I, HpyF3 I, Hinf I,

Hind III, Hind II, Rsa I, Ecor I, Ava II, Ban I

and Alu I) in order to create RFLP profiles.

Digestion was performed in individual reactions

according to the manufacturers' instructions

(BioLabs New England).

Figure 1. Geographical location of sampling sites

nrDNA regions of ITS1 and ITS2 (with

accompanying 5.8S rRNA) were amplified in

separate reactions using primers previously

described by White et al. (1990). Amplifications

were performed in 35 µl reactions consisting of

1 µl of template DNA, 2 mM Tris-HCl (pH 8.0),

10 mM KCl, 0.2 µM of each primer, 0.2 mM

dNTPs, 2.5 mM MgCl2 and 1 unit of TaqGold

DNA polymerase (Thermo Fisher Scientific).

PCR parameters were 3 min at 95°C, 30s

denaturation at 95°C, 30s annealing at 50°C, 1


10

min extension at 72°C and 10 min final

extension at the same temperature with the total

of 30 cycles. PCR products were sequenced by

Macrogen Inc. Europe as a part of their regular

capillary DNA sequencing services.

Sequence and genetic data analysis

Sequence identification analysis for nrDNA

from M. petraea was performed using the

FASTA program (Pearson, 1994). BLAST

network service (Benson et al., 2003) in

GenBank at NCBI was used for final sequence

identification, searching for the best identity and

similarity scores in local databases. Sequencing

reads were assembled using DNASTAR's

Lasergene software EditSeq (Burland, 2000).

Electropherograms were examined manually for

sequencing errors. Multiple sequence alignment

analyses for nrDNA sequences were performed

using ClustalW Ver.1.6 (Thompson et al., 2011)

under default parameters. MSA analyzed

sequences and outputs were optimized using

Jalview 2.9.0b2 (Waterhouse et al., 2009) and

edited by Bioedit v5.09 (Hall, 1999).

Analysis of genetic data included the generation

of haplotypes based on PCR-RFLP (site

polymorphism). ITS sequence variation within

and among observed population, intra- and

interpopulation nucleotide diversity, and

nucleotide differentiation were estimated using

MEGA6 (Nei, 1987; Nei and Kumar, 2000).


Isolation of nucleic acids from plant cells is

known to be challenging due to the presence of

various inhibiting substances that bind and/or

co-precipitate with them, interfere with the

DNA isolation procedure and downstream

applications such as PCR-based methods

(Salzman et al., 1999). Thus, it is very difficult

to create a universal isolation procedure and in

most cases optimization is necessary. The

content of biologically active compounds in

plants depends on various factors: influence of

soil traits, plant age, harvesting time, tissue type

etc. (Končić et al., 2010, Kremer et al., 2016,

Kolodziej and Sugier, 2013). Kremer et al.

(2016) analyzed biochemical properties of M.

petraea and reported the highest content of

polyphenols, flavonoids and phenolic acids in

leaves, the highest content of tannins highest in

flowers, with the lowest content of the analyzed

bioactive compounds in stems.

Šamec (2013) aimed to perform phytochemical

and genetic analyses in four endemic species,

i.e. Teucrium arduini, Moltkia petraea,

Micromeria croatica and Rhamnus intermedia.

Even after extensive optimization of DNA

isolation protocols and application of different

approaches, the author was not able to obtain an

amplicon for any of the selected markers. UV

and CD specter of DNA samples from M.

petraea revealed the presence of unidentified

compound with the maximum absorbance at

260 nm, overlapping the DNA specter.

In this study we applied several isolation

protocols to obtain high quality DNA from

leaves of M. petraea (Figure 2). Extraction

using CTAB method reported by Doyle and

Doyle (1987) gave low yield of DNA (Figure

2A), but samples were non-amplifiable.

Application of the DNeasy Plant Mini Kit

(Qiagen) (Figure 2B) and isolation protocol

described by Jobes et al. (1995) (Figure 2C)

resulted in DNA of even poorer quality. In order

to improve DNA yield and quality, Doyle and

Doyle (1987) CTAB protocol was modified.

Optimization included adding vitamin C

(ascorbic acid) to the cell lysis buffer (0.2%).

Vitamin C is known to prevent selective binding

of proteins and to have antioxidant properties.

This method solved the problem of low DNA

yield and co-precipitation of secondary

metabolites (Figure 2D) which was proven by a

successful PCR amplification for 81% of

analyzed samples.


11

Figure 2. Electrophoretic pattern of DNA isolated

by (A) CTAB protocol (Doyle and Doyle, 1987), (B)

DNeasy Plant Mini Kit (Qiagen) and (C) isolation

protocol described by Jobes et al. (1995). (D)

Optimization of CTAB method resulted in DNA that

was suitable for PCR-based analysis. The

electrophoresis was performed in 1.5% (w/v)

agarose gel

PCR-RFLP analysis

Chloroplast trnL (UAA) intron was successfully

amplified for 74 out of 91 collected samples.

Digestion was performed with ten different

enzymes but only three of them (TaqI, HinfI,

HindII) found recognition site within the

amplicon. RFLP profiles obtained after

digestion of trnL region with restriction

enzymes are shown in Table 2 and Figure 3.

Analysis of the restriction fragments revealed

that all individuals in five observed populations

have the same RFLP profile for every applied

enzyme. No polymorphism (intra- or

interpopulation) was detected. Consequently,

haplotype distance and intrapopulation

haplotype diversity equals 0.

Table 2. Restriction fragments sizes (bp) generated

by digestion of the trnL region

TaqI HinfI HindII

225 181 325

165 130 203

130 105 -

The trnL (UAA) intron is not the most variable

non-coding chloroplast region due to its

catalytic function and secondary structure

formations, but studies based on RFLP

polymorphisms of this region have been

reported in different plants (Taberlet et al.,

2007; Ridgway et al., 2003; Spaniolas et al.,

2010). The advantage of this molecular marker

is easy cross-amplification in a large number of

plants due to highly conserved primers, i.e.

flanking regions. However, Taberlet et al.

(2007) reported its relatively low resolution

(67.3%) at the species level in plants, and it

indeed proved to be insufficiently sensitive for

the detection of genetic diversity within species.

Figure 3. Restriction fragments generated using

restriction enzymes A) TaqI, B) HindII, C) HinfI. The

sizes of obtained fragments (given in Table 2) were

determined according to ΦX174 DNA/BsuRI Ladder

Analysis of ITS sequences

The sequence nucleotide composition was

successfully determined for 14 of 15 sequenced

samples. Length of the nrDNA region (642 bp)

concurs with the reference sequence in

GenBank (accession number: FJ763194). One

concatenated nrDNA consensus sequence [ITS1


12

(260 bp) - 5.8S RNA (163 bp) - ITS2 (219 bp)]

from this study was obtained and deposited in

the GenBank database (accession number:

KX343047).

Despite some previous evidence of ITS

intrapopulation diversity in some Boraginaceae

species (Kook et al., 2014), alignment and

comparison of sequences (ITS1 and ITS2)

obtained in this study revealed the absence of

polymorphisms and substitutions, as well as

lack of indel mutations.

Applied nrDNA population genetic analysis

showed no intrapopulation nucleotide diversity

among sequences. In relation to that, the

nucleotide differentiation (Nst) equals 0,

suggesting that there is no genetic

differentiation between the populations based on

ITS sequence polymorphisms. Notably, the

absence of genetic variation within and among

the populations is observed, regardless of the

type of marker observed.

M. petraea is considered to be paleoendemic

species which, according to classical Stebbins’

view (1942) are defined as depleted species,

with formerly wide distribution and high genetic

diversity, that had lost many or most of their

biotypes, resulting in endemism (Kay et al.,

2010). More often than not, restriction of habitat

has negative impact on genetic diversity,

causing the loss of infraspecific genetic

variability. This is true for number of

angiosperms (Gitzendanner and Soltis, 2000;

Hamrick and Godt, 1996) such as Halacsya

sendtneri (Boiss.) Dörfl., another endemic

member of Boraginaceae family with

distribution pattern similar to that of M. petraea.

Study by Coppi et al. (2014) revealed relatively

low total genetic diversity (HT=0.142) in this

species, based on AFLP analysis, even when

compared with several case-studies on rare

and/or endemic angiosperms. Although ITS

region proved to be very useful in elucidating

phylogenetic relationships in Boraginaceae

(Cecchi and Selvi, 2009; Cohen, 2014; Chacón

et al., 2016), as well as in distinguishing five

species of genus Moltkia from other

Mediterranean Lithospermeae by a unique 11-

bp deletion in ITS1 (positions 235–245) (Cecchi

and Selvi, 2009), it did not reveal any

hypervariable portion that could be informative

in elucidating the genetic diversity of

populations of M. petraea from the locations in

Bosnia and Herzegovina. Therefore, in order to

get an objective insight of M. petraea genetic

variability and to evaluate its status as a

paleoendem, future studies on this species

should be based on carefully selected molecular

markers.

Although application of microsatellite loci as

molecular markers are inevitable in plant

genetic studies for diversity estimation (Vieira

et al., 2016), so far no publications about

detected and described microsatellite regions

within the genome of M. petraea have been

published. In such cases, it could be more

suitable to apply AFLP method which is one of

the most valuable tools for investigating genetic

variation in plant populations because it is

simple, relatively cheap, reproducible, and

demands small amount of DNA which is

especially convenient for the research of rare,

endemic plant species. This method has been

successfully applied to diploid and polyploid

species from Boraginaceae family with

fragmented and/or restricted distribution

(Stehlik, 2003; Mengoni et al., 2006; Coppi et

al., 2008).

Optionally, RAPD markers could be used,

although Šamec (2013) failed to get a successful

amplification in M. petraea, most probably

because no DNA isolation protocol used in that

study yielded DNA of satisfactory purity.

Therefore, previous surveys on this species as

well as our study showed that it is of vital

importance to choose adequate approach for the


13

isolation of DNA since it greatly affects the

success of further analytical steps.

Conclusions

Addition of vitamin C (ascorbic acid) to the cell

lysis buffer solved the problem of low DNA

yield, co-precipitation of secondary metabolites

and provided high quality DNA useful for

further molecular genetic analysis of M.

petraea. However, no genetic diversity within

and among populations of M. petraea in Bosnia

and Herzegovina was found in this research,

based on the applied markers. This may be due

to the combination of these factors: (i) observed

molecular genetic markers are not sensitive

enough to detect intra- and interpopulation

genetic variation of M. petraea; (ii) observed

populations represent part of an old (relict)

population which has highly conserved trnL and

ITS regions. Therefore, we suggest that further

investigations of this species should employ

more methods for evaluation of genetic

variability in endemic plants such as AFLP or

RADP fingerprinting.

Acknowledgment

This research was funded by the Environmental

Fund of the Federation of Bosnia and

Herzegovina, grant no. 01-02-1069/2012.

References

Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell

J, Wheeler DL (2003) GenBank. Nucleic Acids

Research 31:23–27.

Brody JR, Kern SE (2005) Sodium broci acid: a Tris

– free, cooler conductive medium for DNA

electrophoresis. Biotechniques 38(1):60.

Burland TG (2000) DNASTAR's Lasergene

sequence analysis software. Methods in Molecular

Biology 132:71-91.

Buys MH, Hilger HH (2003) Boraginaceae cymes

are exclusively scorpioid and not helicoid. Taxon

52:719-724.

Cecchi L, Selvi F (2009) Phylogenetic relationships

of the monotypic genera Halacsya and

Paramoltkia and the origins of serpentine

adaptation in circum-mediterranean Lithospermeae

(Boraginaceae): insights from ITS and matK DNA

sequences. Taxon 58(3):700-714.

Chacón J, Luebert F, Hilger HH, Ovchinnikova S,

Selvi F, Cecchi L, Guilliams CM, Hasenstab-

Lehman K, Sutorý K, Simpson MG, Weigend M

(2016) The borage family (Boraginaceae s.str.): A

revised infrafamilial classification based on new

phylogenetic evidence, with emphasis on the

placement of some enigmatic genera. Taxon

65(3):523-546.

Cohen JI (2014) A phylogenetic analysis of

morphological and molecular characters of

Boraginaceae: evolutionary relationships,

taxonomy, and patterns of character evolution.

Cladistics, 30(2):139–169.

Coppi A, Cecchi L, Mengoni A, Pustahija F,

Tomović G, Selvi F (2014) Low genetic diversity

and contrasting patterns of differentiation in the

two monotypic genera Halacsya and Paramoltkia

(Boraginaceae) endemic to the Balkan serpentines.

Flora 209:5-14

Coppi A, Mengoni A, Selvi F (2008) AFLP

fingerprinting of Anchusa (Boraginaceae) in the

Corso-Sardinian system, genetic diversity,

population differentiation and conservation

priorities in an insular endemic group threatened

with extinction. Biological Conservation

141:2000–2011.

Doyle JJ, Doyle JL (1987) A rapid DNA isolation

procedure for small quantities of fresh leaf tissue.

Phytochemistry 19:11-15.

Fernandes R (1972) Moltkia Lehm. In: TG Tutin et

al. (eds), Flora Europaea, vol. 3: Diapensiaceae to

Myoporaceae. Cambridge University Press,

Cambridge, p. 95.

Gallagher SR (1994) Quantification of DNA and

RNA with Absorption and Fluorescence

Spectroscopy. Current Protocols in Molecular

Biology 3:1-3.

Georgiou O, Dimitrellos G, Georgiadis T (1999)

Moltkia petraea (Boraginaceae) in Greece. Phyton

40(1): 57-69.

Gitzendanner MA, Soltis PS (2000) Patterns of

genetic variation in rare and widespread plant


14

congeners. American Journal of Botany 87:777–

786.

Hall TA (1999) Bioedit: a user-friendly biological

sequence alignment editor and analysis program

for Windows 95/98/NT. Nucleic Acids Symposium

Series 41:95–98.

Hamrick JL, Godt MJW (1996) Conservation

genetics of endemic plant species. In: Avise JC,

Hamrick JL (Eds.) Conservation Genetics, Case

Histories from Nature. Chapman & Hall, New

York, pp. 281–304.

Hassan S, Prakash J, Vashishtha A, Sharma A,

Srivastava K, Sagar F, Khan N, Dwivedi K, Jain P,

Shukla S, Gupta SP, Mishra S (2012) Optimization

of DNA extraction from seeds and leaf tissues of

Chrysanthemum (Chrysanthemum indicum) for

polymerase chain reaction. Bioinformation, 8(5):

225–228.

Jerković I, Marijanović Z, Zekić M, Tuberoso CIG

(2017) First Report on Rare Unifloral Honey of

Endemic Moltkia petraea (Tratt.) Griseb. from

Croatia: Detailed Chemical Screening and

Antioxidant Capacity. Chemistry and Biodiversity

14.

Jobes DV, Hurley DL and Thien LB (1995) Plant

DNA isolation: a method to efficiently remove

polyphenolics, polysaccharides, and RNA. Taxon

44: 379-386.

Kay KM, Ward KL, Watt LR, Schemske DW (2010)

Plant speciation. In: Harrison S, Rajakaruna N

(Eds.), Serpentine, the Evolution and Ecology of a

Model System. University of California Press,

Berkeley, pp. 71–95.

Kolodziej B, Sugier D (2013) Influence of plants age

on the chemical composition of roseroot (Rhodiola

rosea L.). Acta Scientiarum Polonorum Hortorum

Cultus 12, 147–160.

Končić Z, Kremer D, Gruz J, Strnad M, Biševac G,

Kosalec I, Šamec D, Piljac Žegarac J, Karlović K

(2010) Antioxidant and antimicrobial properties of

Moltkia petraea (Tratt.) Griseb. flower, leaf and

stem infusions. Food and Chemical Toxicology 48,

1537–1542.

Kook E, Vedler E, Pussa K, Kalamees R, Reier U,

Pihu S (2014) Intra-individual ITS polymorphism

and hybridization in Pulmonaria obscura Dumort.

and Pulmonaria angustifolia L. (Boraginaceae).

Plant Systematics and Evolution DOI

10.1007/s00606-014-1123-8.

Kremer D, Jurišić Grubešić R, Ballian D, Stešević

D, Kosalec I, Vuković Rodríguez J, Vukobratović

M, Srečec S (2016) Influence of soil traits on

polyphenols level in Moltkia petraea (Tratt.)

Griseb. (Boraginaceae). Acta Botanica Croatica

75(2):266-271.

Marković L (1994) Moltkea petraea (Tratt). Gris. In:

I Šugar (ed) Red Book of Croatian Flora. Ministry

of Construction and Environmental Protection and

Institute for Nature protection, Zagreb, pp. 63–65.

Mengoni A, Selvi F, Cusimano N, Galardi F,

Gonnelli C (2006) Genetic diversity inferred from

AFLP fingerprinting in populations of Onosma

echioides (Boraginaceae) from serpentine and

calcareous soils. Plant Biosystems 140:211–219.

Nei M (1987) Molecular Evolutionary Genetics.

Columbia University Press, New York.

Nei M, Kumar S (2000) Molecular Evolution and

Phylogenetics. Oxford University Press, New

York.

Pearson WR (1994) Using the Fasta program to

search protein and DNA sequence databases.

Methods in Molecular Biology 24:307-31.

Polunin O (1987) Flowers of Greece and The

Balkans – A Field Guide. Oxford University Press,

Oxford, p. 381.

Ridgway KP, Duck JM, Young PW (2003)

Identification of roots from grass swards using

PCR-RFLP and FFLP of the plastid trnL (UAA)

intron. BMC Ecology 3:8.

Salzman RA, Fujita T, Zhu-Salzman K, Hasegawa

PM, Bressan RA (1999) An improved RNA

isolation method for plant tissues containing high

levels of phenolic compounds or carbohydrates.

Plant Molecular Biology Reporter 17:11–17.

Sarwat M, Singh Negi M, Lakshmikumaran M,

Kumar Tyagi A, Das S, Shankar Srivastava P

(2006) A standardized protocol for genomic DNA

isolation from Terminalia arjuna for genetic

diversity analysis. Electronic Journal of

Biotechnology 9:1.

Sharma AD, Gill PK, Singh P (2002). DNA isolation

from dry and fresh samples of polysaccharide rich

plants. Plant Molecular Biology Reporter 20, 415a-

15f.


15

Spaniolas S, Christos B, Spano T, Zoghby C,

Kalaitzis P (2010) The potential of plastid trnL

(UAA) intron polymorphisms for the identification

of the botanical origin of plant oils. Article in

Food Chemistry 122:850-856.

Stebbins GL (1942) The genetic approach to

problems of rare and endemic species. Madroño

6:241–272.

Stehlik I (2003) Resistance or emigration? Response

of alpine plants to the ice ages. Taxon 52:499–510.

Šamec D (2013) Phytochemical and genetic

investigation of endemic species Teucrium arduini,

Moltkia petraea, Micromeria croatica and

Rhamnus intermedia. PhD thesis, in Croatian with

abstract in English, Josip Juraj Strossmayer

University of Osijek.

Šoljan D, Muratović E, Abadžić S (2009) Biljke

planina Bosne i Hercegovine. TKD Šahinpašić,

Sarajevo.

Taberlet P, Coissac E, Pompanon F, Gielly L,

Miquel C, Valentini A, Vermat T, Corthier G,

Brochmann C, Willerslev E (2007) Power and

limitations of the chloroplast trnL (UAA) intron

for plant DNA barcoding. Nucleic Acids Research

35(3): e14.

Taberlet P, Gielly L, Pautou G, Bouvet J (1991)

Universal primers for amplification of three

noncoding regions of chloroplast DNA. Plant

Molecular Biology 17:1105-1109.

Thompson JD, Higgins DG, Gibson TJ (2011)

Clustal W: improving the sensitivity of progressive

multiple sequence alignment through sequence

weighting, positions-specific gap penalties and

weight matrix choice. Nucleic Acids Research

22(22):4673–4680.

Trinajstić I (1974) Moltkea petraea (Trait.) Griseb. u

flori otoka Mljeta. Glasnik Republičkog Zavoda

zaštite prirode Prirodnjačkog Muzeja Titograd

7:49-57.

Turrill BW (1929) Plant life of Balkan Peninsula. A

phytogeographical study. Oxford and The

Clarendon Press, London.

Vieira MLC, Santini L, Diniz AL, Munhoz CF

(2016) Microsatellite markers: what they mean and

why they are so useful. Genetics and Molecular

Biology 39(3):312-328.

Waterhouse AM, Procter JB, Martin DMA, Clamp

M, Barton GJ (2009) Jalview Version 2-a multiple

sequence alignment editor and analysis workbench.

Bioinformatics 25:1189-1191.

White TJ, Brims T, Lee S, Taylor J (1990)

Amplification and direct sequencing of fungal

ribosomal RNA genes for phylogenetics. In: M

Innis, D Gelfand, J Sninsky, T White. (eds) PCR

Protocols: A Guide to Methods and Applications

Academic Press, San Diego, pp. 315-322.


16

MICROSATELLITE DIVERSITY OF CROSSBRED HORSES RAISED IN BOSNIA

AND HERZEGOVINA

Dunja Rukavina1*, Danica Hasanbašić1, Belma Kalamujić Stroil2, Naris Pojskić2

1University of Sarajevo, Veterinary Faculty, Sarajevo, Bosnia and Herzegovina


Abstract

The focus of this study was microsatellite diversity of crossbred horses

raised in Bosnia and Herzegovina. Genomic DNA was extracted from

blood samples of 20 individuals (KBA group – 7 individuals, crosses

between Bosnian and Herzegovinian mountain horse and Arabian horse;

KBR group – 9 individuals, crosses between Bosnian and Herzegovinian

mountain and Belgian horses, crosses between Bosnian and Herzegovinian

mountain horses and Holstein, crosses between Bosnian and Herzegovinian

mountain and Lipizzaner horses and KBN group – 4 individuals, crosses

between Bosnian and Herzegovinian mountain horse with an unknown

origin of the other parent). The samples were profiled using 17

microsatellite markers. This method consisted of multiplex PCR procedure

and generated reasonable amplification across all the loci. All samples were

genotyped successfully. Considering all the observed parameters, VHL20

locus showed the highest microsatellite diversity. Locus HMS7 was the

least variable in KBR group, while HMS1 locus was the least diverse in

KBN group. The highest microsatellite diversity in KBA group was found

at AHT5 locus while HTG6 locus was the least diverse. Obtained results

suggest that the investigated populations of crossbred horses from Bosnia

and Herzegovina are not affected by substantial loss of genetic diversity, as

indicated by the presence of reasonably high level of genetic variation. An

increase in the inbreeding coefficient and sufficient heterogenity in KBN

group indicate occurrence of consanguineous mating. The present research

contributes to the knowledge of current status of genetic structure of the

investigated crossbred horses.

Key words: crossbred horse, genetic diversity, molecular markers

Introduction

Microsatellites (Short Tandem Repeats - STR)

are a class of genetic markers, currently the

most commonly used for diversity studies in

livestock (Fornal et al., 2013; Semik and Zabek,

2013). Due to their high level of polymorphism,

dispersion throughout eucariotic nuclear

genome and Mendelian co-dominant

inheritance, microsatellites are relatively easy to

score and are considered the markers of choice

in equine parentage testing and individual

identification (Zabek and Fornal, 2009;

Moshkelani et al., 2011). Microsatellites are

*Correspondence

E-mail:

[email protected]

nsa.ba

Received

February, 2017

Accepted

May, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


17

regions of repeated 2 to 7 nucleotide long units

that occur primarily in non-coding regions of

DNA (Moshkelani et al., 2011). Microsatellites

have been employed to construct linkage maps,

to examine population genetic structure and

genetic variation, to explore molecular

evolution, in studies of gene flow, in resolution

of forensic cases and as parentage testing

markers (Tozaki et al., 2003; Moshkelani et al.,

2011). Microsatellites loci constitute an

informative source concerning population

history, structure and genetic diversity and

microsatellite polymorphism still plays an

important role in the assessment of genetic

diversity of livestock (Semik and Zabek, 2013).

In this paper we report the results of the first

analysis of microsatellite diversity of crossbred

horses from Bosnia and Herzegovina (B&H)

using 17 microsatellite markers currently

recommended by International Society for

Animal Genetics (ISAG) (ISAG, 2014).

Number of different alleles, observed and

expected heterozygosity, polymorphic

information contents, inbreeding coefficient and

deviation from Hardy-Weinberg equilibrium

were estimated.


The study was performed on 20 blood samples

of horse crossbreeds (KBA group – 7

individuals, crosses between Bosnian and

Herzegovinian mountain horse and Arabian

horse; KBR group – 9 individuals, crosses

between Bosnian and Herzegovinian mountain

and Belgian horses, crosses between Bosnian

and Herzegovinian mountain horses and

Holstein, crosses between Bosnian and

Herzegovinian mountain and Lipizzaner horses

and KBN group – 4 individuals, crosses

between Bosnian and Herzegovinian mountain

horse with an unknown origin of the other

parent). All horses were raised in Bosnia and

Herzegovina (Rukavina et al., 2015b). Blood

samples were collected from v. jugularis using

sterile venipuncture needles and EDTA vacuum

containers. Genomic DNA was isolated using

salting-out method that was originally

developed for the isolation of DNA from human

blood (Miller et al., 1988). Necessary

modifications to the protocol were made in

order to accommodate for different properties of

horse blood as well as our laboratory conditions

(3ml of blood; 10ml of Lysis buffer; 4ml of

PBS; 4ml of Kern-lysis buffer; 150μl of 20%

SDS; 100μl of protease and 0,5ml 6M NaCl). In

total, 20 animals were genotyped for 17

microsatellite loci. This method consists of

multiplex PCR procedure and shows

satisfactory amplification of all analyzed

fragments. Fragment separation and allele sizing

were performed using ABI Prism 310 Genetic

Analyzer. All the genotypes were successfully

generated. Sizing of the amplified fragments

was performed using GeneMapper ID v3.2

software. Number of different alleles (AN),

polymorphic information content (PIC)

(Botstein et al., 1980), observed heterozygosity

(Ho), expected heterozygosity (HE) (Nei, 1987),

inbreeding coefficient (F) (Weir, 1996) and

deviation from Hardy-Weinberg equilibrium

(HWE) (Guo and Thompson, 1992) was

calculated using POWERMARKER 3.25 (Liu

and Muse, 2005).


The research described in this paper was the

first analysis of microsatellite diversity of

crossbred horses raised in B&H. All the equine

microsatellite markers, reported in the study,

were amplified successfully. Results for number

of alleles (AN), observed heterozygosity (HO),

expected heterozygosity (HE), polymorphic

information content (PIC), inbreeding

coefficient (F) and deviation from Hardy-

Weinberg equilibrium (HWE) are given in

Tables 1, 2 and 3. In KBR group the mean


18

Marker AN HE HO PIC F HWE

VHL20 7.0000 0.8333 1.0000 0.8119 -0.1111 1.0000

HTG4 5.0000 0.7222 0.6667 0.6800 0.1667 0.3010

AHT4 6.0000 0.7778 0.6667 0.7456 0.2308 0.4260

HMS7 3.0000 0.4861 0.3333 0.4235 0.3939 0.5050

HTG6 4.0000 0.5139 0.6667 0.4760 -0.2121 1.0000

AHT5 7.0000 0.7639 1.0000 0.7393 -0.2245 0.4350

HMS6 4.0000 0.5833 0.6667 0.5295 -0.0526 0.2290

ASB23 5.0000 0.7222 0.6667 0.6800 0.1667 0.3010

ASB2 4.0000 0.6528 0.6667 0.5994 0.0698 0.1430

HTG10 4.0000 0.7083 0.8333 0.6589 -0.0870 0.4800

HTG7 5.0000 0.7222 0.8333 0.6800 -0.0638 0.8100

HMS3 6.0000 0.7500 0.6667 0.7193 0.2000 0.2040

HMS2 5.0000 0.7361 0.8333 0.6920 -0.0417 0.7760

ASB17 7.0000 0.7639 0.8333 0.7393 0.0000 0.8910

LEX3 5.0000 0.7222 0.3333 0.6800 0.6000 0.0180

HMS1 3.0000 0.4861 0.6667 0.4235 -0.2903 1.0000

CA425 4.0000 0.6944 0.8333 0.6391 -0.1111 1.0000

Mean 4.9412 0.6846 0.7157 0.6422 0.0458


VHL20 6.0000 0.7551 0.8571 0.7186 -0.0588 0.7000

HTG4 6.0000 0.7653 1.0000 0.7308 -0.2353 1.0000

AHT4 5.0000 0.6735 0.8571 0.6319 -0.2000 0.5980

HMS7 4.0000 0.6633 0.7143 0.6003 0.0000 1.0000

HTG6 3.0000 0.4388 0.5714 0.3862 -0.2308 1.0000

AHT5 7.0000 0.8469 1.0000 0.8277 -0.1053 0.1720

HMS6 5.0000 0.7653 0.8571 0.7299 -0.0435 0.6170

ASB23 6.0000 0.6939 0.2857 0.6636 0.6364 0.0020

ASB2 7.0000 0.7959 0.7143 0.7719 0.1781 0.4420

HTG10 5.0000 0.7500 0.8333 0.7078 -0.0204 0.7110

HTG7 5.0000 0.7347 0.7143 0.6894 0.1045 0.1770

HMS3 6.0000 0.8163 0.8571 0.7898 0.0270 0.3980

HMS2 5.0000 0.7143 1.0000 0.6657 -0.3333 0.7890

ASB17 6.0000 0.7755 0.5714 0.7444 0.3333 0.2800

LEX3 7.0000 0.7959 0.4286 0.7681 0.5200 0.0060

HMS1 5.0000 0.7245 0.2857 0.6853 0.6522 0.0230

CA425 6.0000 0.6939 0.7143 0.6636 0.0476 0.2820

Mean 5.5294 0.7296 0.7213 0.6926 0.0892

Table 1. Number of alleles (AN), expected heterozygosity (HE), observed heterozygosity (HO),

polymorphic information content (PIC), inbreeding coefficient (F) and deviation from Hardy-Weinberg

equilibrium (HWE) at 17 microsatellite loci in KBR group

Table 2. Number of alleles (AN), expected heterozygosity (HE), observed heterozygosity (HO),

polymorphic information content (PIC), inbreeding coefficient (F) and deviation from Hardy-Weinberg

equilibrium (HWE) at 17 microsatellite loci in KBA group


19

number of alleles was 4.9412 and varied from 3

(HMS7, HMS1) to 7 (VHL20, AHT5, ASB17).

The observed heterozygosity ranged from

0.3333 (HMS7) to 1.000 (VHL20, AHT5) with

mean of 0.7157, while the expected

heterozygosity ranged from 0.4861 (HMS7,

HMS1) to 0.8333 (VHL20) with mean of

0.6846 (Table 1). The mean number of alleles in

KBA group was 5.5294, varied from 3 (HTG6)

to 7 (AHT5, ASB2, LEX3). The observed

heterozygosity ranged from 0.2857 (ASB23,

HMS1) to 1.000 (HTG4, AHT5, HMS2) with

mean of 0.7213, while the expected

heterozygosity ranged from 0.4388 (HTG6) to

0.8469 (AHT5) with mean of 0.7296 (Table 2).

In KBN group the mean number of alleles was 6

and varied from 4 (HTG4, HMS1) to 8 (VHL20,

ASB2). The observed heterozygosity ranged

from 0.4516 (HTG6) to 0.8548 (ASB2) with

mean of 0.6387 while the expected

heterozygosity ranged from 0.4286 (HMS7,

ASB23, HTG10, LEX3, HMS1) to 0.8469

(ASB23) with mean of 0.7461 (Table 3).

Our data of microsatellite diversity are

consistent with the data from previous studies.

Indicators of microsatellite diversity reported in

the literature for other horse breeds mostly

ranged from 3.3 to 10.7 for number of alleles,

from 0.45 to 0.78 for HO and from 0.47 to 0.82

for HE (Canon et al., 2000; Aberle et al., 2004;

Galov et al., 2005; Solis et al., 2005; Plante et

al., 2007; Di Stasio et al., 2008; Giacomoni et

al., 2008; Shasavarani and Rahimi-Mianji,

2010). Based on all the observed parameters, in

KBR and KBN groups VHL20 locus showed

the highest microsatellite diversity. Locus

HMS7 was the least diverse in KBR group,

while HMS1 locus was the least diverse in KBN

group. In KBA group the highest microsatellite

diversity showed AHT5 locus and HTG6 locus

was the least diverse. For the observed


VHL20 8.0000 0.8265 0.8571 0.8058 0.0400 0.8150

HTG4 4.0000 0.6429 0.5714 0.5849 0.1864 0.6240

AHT4 6.0000 0.7347 0.8571 0.7006 -0.0909 0.8260

HMS7 5.0000 0.7041 0.4286 0.6574 0.4545 0.0120

HTG6 5.0000 0.6224 0.5714 0.5874 0.1579 0.2930

AHT5 7.0000 0.8265 1.0000 0.8033 -0.1351 0.8150

HMS6 7.0000 0.8163 0.7143 0.7923 0.2000 0.0240

ASB23 7.0000 0.8469 0.4286 0.8277 0.5500 0.0060

ASB2 8.0000 0.8367 1.0000 0.8165 -0.1200 0.7510

HTG10 7.0000 0.7653 0.4286 0.7333 0.5000 0.0050

HTG7 5.0000 0.7755 0.5714 0.7397 0.3333 0.0310

HMS3 6.0000 0.7755 0.5714 0.7444 0.3333 0.0660

HMS2 5.0000 0.7245 0.5714 0.6853 0.2836 0.1980

ASB17 7.0000 0.8163 0.7143 0.7923 0.2000 0.0960

LEX3 6.0000 0.7755 0.4286 0.7444 0.5068 0.0060

HMS1 4.0000 0.6429 0.4286 0.5849 0.4000 0.1290

CA425 5.0000 0.5510 0.7143 0.5207 -0.2245 1.0000

Mean 6.0000 0.7461 0.6387 0.7130 0.2185

Table 3. Number of alleles (AN), expected heterozygosity (HE), observed heterozygosity (HO), polymorphic

information content (PIC), inbreeding coefficient (F) and deviation from Hardy-Weinberg equilibrium (HWE)

at 17 microsatellite loci in KBN group


20

heterozygosity, in KBR group values for

VHL20 and AHT5 loci reached the maximum

level (i.e. Ho = 1), in KBA group values for

HTG4, AHT5 and HMS2 loci reached the

maximum level and in KBN group values for

AHT5 and ASB2 loci reached the maximum

level. This result indicates that the studied

populations originated from the appropriate

number of parent generations. The average HE

in all investigated groups indicated the existence

of high genetic variability in populations of

crossbred horses in B&H.

The greatest differences between HO and HE in

our study were observed for LEX3 (KBR group)

and ASB23 (KBA and KBN groups) loci. The

same loci showed the highest inbreeding

coefficient, the highest deviation from HWE

and substantial heterozygote deficit. According

to Galov et al. (2013) highly significant

deviation from HWE combined with substantial

heterozygote deficit is likely to indicate locus-

specific genotyping problem due to null alleles.

The largest disproportion between observed and

expected heterozygosity was found in KBN

group. According to Berber et al. (2014) larger

disproportion between observed and expected

heterozygosity could be an indicator of within-

population inbreeding or conversely population

subdivision reduction.

In population genetic analysis, genetic markers

with PIC values higher than 0.5 are normally

considered to be informative (Shasavarani and

Rahimi-Mianji, 2010). The PIC values, detected

in our study, suggested that most of the markers

were quite informative (PIC > 0.5) in terms of

their suitability for genetic diversity studies.

An increased inbreeding coefficient was

detected in KBN group (0.2185). High level of

inbreeding coefficient in KBN group could be

due to small sample size. Inbreeding coefficient

values for KBR and KBA groups (0.0458,

0.0892, respectively) indicate no shortage of

heterozygotes. Deviation from HWE in KBR

group was found in one locus, in KBA group in

three loci. In KBN group deviation from HWE

was found in six loci. Possible causes for

disequilibrium in KBN group were small

population size and inbreeding. Overall

observed heterozygosity within KBR group is

higher then expected, indicating quite large

number of heterozygotes probably due to

expressed different genetic variants from

parental breeds. This is not a case in KBA and

KBN groups.

The numbers of detected alleles are within the

range for Arabian horse (Rukavina et al., 2015a)

and thoroughbred horse populations from

Bosnia and Herzegovina (Rukavina et al.,

2016). On the other hand, heterozygosity levels

are higher in these three types of crossbreeds

then in “pure” breeds observed in

abovementioned studies.

Conclusions

The results of the present study suggest that the

investigated populations of crossbred horses

raised in B&H are not affected by major loss of

genetic diversity. The applied set of 17

microsatellite markers proved to be specific

enough for use in study of genetic structure of

crossbred horses. An increase in inbreeding

coefficient and sufficient heterogenity between

animals in KBN group indicate occurrence of

consanguineous mating. The present research

contributes to the knowledge of population

structure and current status of genetic structure

of the investigated populations. Also, the results

offer basic information that may be helpful to

horse breeders in designing and managing

future breeding strategies.

References

Aberle KS, Hamann H, Drogemuller C, Distl O

(2004) Genetic diversity in German draught horse

breeds compared with a group of primitive, riding


21

and wild horses by means of microsatellite DNA

markers. Anim Genet 35:270-277.

Berber N, Gaouar S, Leroy G, Kididi S, Tabet Aouel

N, Saidi Mehtar N (2014) Molecular

characterization and differentiation of five horse

breeds raised in Algeria using polymorphic

microsatellite markers. J Anim Breed Genet

131:387-394.

Botstein D, White RL, Skolnick M, Davis RW

(1980) Construction of a genetic linkage map in

man using restriction fragment length

polymorphisms. Am J Hum Genet 32:314-331.

Canon J, Checa ML, Vega-Pla JL, Vallejo M,

Dunner S (2000) The genetic structure of Spanish

Celtic horse breeds inferred from microsatellite

data. Anim Genet 31:39-48.

Di Stasio L, Perrotta G, Blasi M, Lisa C (2008)

Genetic characterization of the Bardigiano horse

using microsatellite markers. Ital J Anim Sci

7:243-250.

Fornal A, Radko A, Piestrzynska-Kajtoch A (2013)

Genetic polymorphism of Hucul horse population

based on 17 microsatellite loci. Acta Biochim Pol

60:761-765.

Galov A, Byrne K, Đuras-Gomerčić M, Gomerčić T,

Nushol Z, Vincek D, Kocijan I, Tadić Z, Benković

V, Bašić I, Funk SM (2005) Effectivenes of nine

polymorphic microsatellite markers in parentage

testing in Posavina, Croatian Coldblood and

Lipizzaner horse breed in Croatia. Livest Prod Sci

93:277-282.

Galov A, Byrne K, Gomerčić T, Duras M, Arbanasić

H, Sindičić M, Mihelić D, Kovačić A, Funk SM

(2013) Genetic structure and admixture between

the Posavina and Croatian Coldblood in contrast to

Lipizzan horse from Croatia. Czech J Anim Sci

58:71-78.

Giacomoni EH, Fernandez-Stolz GP, Freitas TRO

(2008) Genetic diversity in the Pantaneiro horse

breed assessed using microsatellite DNA markers.

Genet Mol Res 7:261-270.

Guo SW, Thompson E (1992) Performing the exact

test of Hardy-Weinberg proportion for multiple

alleles. Biometrics 48:361-372.

ISAG 2014 Workshop Report.

(http://www.isag.us/committees.asp), Accessed:

February 17, 2016.

Liu K, Muse S (2005) Powermarker: Integrated

analysis enviroment for genetic marker data.

Bioinformatics 21:2128-2129.

Miller SA, Dykes DD, Polesky HF (1988) A simple

salting-out procedure for extracting DNA from

human nucleated cells. Nucleic Acids Res 16:1215.

Moshkelani S, Rabiee S, Javaheri-Koupaei M (2011)

DNA fingerprinting of Iranian Arab horse

using fourteen microsatellites marker. Res J Biol

Sci 6:402-405.

Nei M (1987) Molecular Evolutionary Genetics.

Columbia University Press, New York.

Plante Y, Vega-Pla JL, Lucas Z, Colling D, deMarch

B, Buchanan F (2007) Genetic diversity in a feral

horse population from Sable Island, Canada. J.

Hered 98:594-602.

Rukavina D, Hasanbašić D, Durmić-Pašić A,

Kalamujić B, Zahirović A, Ramić J, Pojskić N

(2015a) Genetic diversity of Arabian horse from

stud “Borike” (Bosnia and Herzegovina) using

microsatellite markers. Journal of veterinary

sciences 1:21-25.

Rukavina D, Hasanbašić D, Pojskić N, Ramić J,

Zahirović A, Ajanović A, Beganović K, Durmić-

Pašić A (2015b) Analysis of genetic diversity

among certain horse breeds from Bosnia and

Herzegovina. Veterinaria 64:25-29.

Rukavina D, Hasanbašić D, Ramić J, Zahirović A,

Ajanović A, Beganović K, Durmić-Pašić A,

Kalamujić B, Pojskić N (2016) Genetic diversity of

Thoroughbred horse population from Bosnia and

Herzegovina based on 17 microsatellite markers.

JJVR 64:215-220.

Semik E, Zabek T (2013) Application of 7STR

markers for parentage testing and genetic distance

study of Equidae. Ann Anim Sci 13:229-239.

Shasavarani H, Rahimi-Mianji G (2010) Analysis of

genetic diversity and estimation of inbreeding

coefficient within Caspian horse population using

microsatellite markers. Afr J Biotechnol 9:293-

299.

Solis A, Jugo BM, Meriaux JC, Iriondo M, Mazon

LI, Aguirre AI, Vicario A, Estomba A (2005)

Genetic diversity within and among four South

European native horse breeds based on

microsatellite DNA analysis: Implications for

conservation. J Heredity 96:670-678.


22

Tozaki T, Takezaki N, Hasegawa T, Ishida N,

Kurosawa M, Tomita M, Saitou N, Mukoyama H

(2003) Microsatellite variation in Japanese and

Asian horses and their phylogenetic relationships

using a European horse outgroup. J Heredity

94:374-380.

Weir BS (1996) Genetic data analysis II,

Sunderland, MA: Sinauer Associates, Inc.

Zabek T, Fornal A (2009) Evaluation of the 17-plex

STR Kit for parentage testing of Polish coldblood

and hucul horses. Ann Anim Sci 9:363-372.


23

VALIDATION OF VAGINAL SELF-SAMPLING AS AN ALTERNATIVE OPTION IN

PCR BASED DETECTION OF HPV IN CERVICAL CANCER SCREENING IN

BOSNIA AND HERZEGOVINA

Ksenija Radić1, Lejla Pojskić1*, Anja Tomić-Čiča2, Jasmin Ramić1, Daria Ler3, Naida Lojo-

Kadrić1, Naris Pojskić1, Kasim Bajrović1


2Femina, Private gynaecological practice, Sarajevo, Bosnia and Herzegovina

3International University of Sarajevo, Sarajevo, Bosnia and Herzegovina

Abstract

Cervical cancer represents a serious health problem affecting women

worldwide especially in developing countries due to low socioeconomic

status, inadequate health-care infrastructure, weaknesses in education on

this particular issue and lack of effective screening programmes. The

primary aim of this study was to assess alternative screening method for the

improvement of cervical cancer prevention in conditions of Bosnia and

Herzegovina (B&H), which could be applicable in other developing

countries as well. The study was conducted on 101 subjects who provided

their self-sampled vaginal swabs and/or cervical specimens collected by

their gynecologists. Universal Human Papilloma Virus (HPV) primer set

optimized to detect a wide range of HPV types was used for HPV

genotyping from obtained swab samples in multiplex PCR. Amplicons

were analyzed in agarose gel and Agilent 2100 bioanalyzer – a platform

based on microfluid technology. Inter-rater agreement kappa (MedCalc2)

was used to assess concordance between results of cervical and vaginal

sample analysis. Out of 39 subjects who provided their vaginal and cervical

samples, results of HPV detection mismatched in 10% of the cases. Inter-

rater agreement showed good strength of coincidence between the results

of cervical and vaginal sample analysis (kappa=0.748, CI=95 %). We

presented an alternative PCR method for the detection of HPV based on

vaginal self sampling which is affordable, informative, simple and

applicable with high coverage level of defined targeted population and

potentially significant in the given cultural and socioeconomic context.

Key words: HPV, cervical cancer, PCR, screening, self-sampling

Introduction

In spite of the advancement and rapid

improvement of technologies in the fields of

medicine, molecular biology and genetics,

cervical cancer still represents a serious health

problem affecting women worldwide and

causing death of approximately 250000 women

every year (WHO, 2007). According to the data

of World Health Organization from year 2002

(WHO, 2002), about half a million new cases

*Correspondence

E-mail:

[email protected]

sa.ba

Received

January, 2017

Accepted

April, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


24

are diagnosed each year, 80 % of which are

recorded in developing countries. Nobel laurate

Harald zur Hausen was the first to discover that

the cause of cervical cancer lies in persistent

infection with oncogenic types of the human

papillomavirus (HPV) (Boshart et al., 1984).

Human papilloma virus (HPV) is type of small

DNA virus which infects epithelial tissue of

higher vertebrates leading to cell proliferation,

which often results in the formation of

papillomas. Human papillomaviruses are

species specific. So far, over a hundred types of

HPV have been identified and most of them

infect anogenital system; those were the focus

of this research. Infection with these HPV types

is often asymptomatic, which makes regular

gynecologic examinations crucial in the

detection of possible precancerous and

cancerous lesions caused by this virus. Protein

L2 is a structural molecule of HPV and has

many important roles: it introduces HPV DNA

in viral particles formed by self-assembling of

L1 main structural protein (Munger et al., 2004;

Zhou et al., 2004); it helps virus enter the

epithelial cells; it incorporates viral components

in nucleus and also represents a potential target

for new generation of protective vaccines

(Pereira et al., 2009; Peter et al., 2013).

HPV genome covalently binds to mitotic

chromosomes (You, 2010) and thus ensures its

transfer and distribution to daughter cells.

Although HPV genome is usually found in

episomal form in the infected cells, it can also

be inserted into genome of the cell and viral

integration seems to be a crucial step in

progression of low-grade to high-grade cervical

intraepithelial lesions and cervical carcinoma

(Kalantari et al., 1998; Klaes et al., 1999). This

can explain the strong association between some

types of HPV and high-grade cervical lesions or

cervical carcinoma. Transcripts of integrated

genomes are more stable and, in case of HPV 16

it has been shown that infected cells with the

integrated HPV genomes had selective

advantage in their growth (Jeon et al., 1995).

Epigenetic factors associated with the

progression of HPV infection from subclinical

stage to invasive carcinoma are being

investigated as well. Demethylation of CpG

region happens before or at the same time with

neoplastic progression (Badal et al., 2003) and it

is probable that methylation pattern changes

during replication cycle of HPV.

Identifying the type of HPV has a clinical

significance with respect to different pathogenic

potentials of various types. It has also been

shown that the distribution of different HPV

types varies in different geographic regions

(Mammas et al., 2008), so knowledge of the

frequencies of certain HPV types is important in

creating appropriate screening strategies and

policies of cervical cancer screening and

prevention. Bosnia and Herzegovina, as many

other developing countries, has no developed

strategies of organized screening. Cervical

carcinoma is the second most common

carcinoma which affects women in Federation

of Bosnia and Herzegovina with rate 6.9 per

100000 inhabitants for malignant neoplasms of

cervix in 2011 (ZZJZ FBIH, 2011). Developing

countries have a huge problem with cervical

carcinoma because of factors such as: low

socioeconomic status, limited health

infrastructure, specific cultural context,

inadequate health-care and lack of effective

screening strategies. World Health Organization

particularly points out the importance of well-

organized screening in cervical carcinoma

prevention. In the development of effective

screening strategies special attention should be

paid to their good integration into the existing

health system, having in mind specific social,

economic and cultural conditions in developing

countries.

For all of the above-mentioned reasons, this

research focused on the development of


25

alternative methods for HPV detection which

could be potentially applicable for screening of

women in developing countries. The primary

aim of the study was optimization of the HPV

detection based on the PCR methods with the

special emphasis on the screening from self-

sampled vaginal swabs. Multiplex PCR method

was also developed to genotype some of the

most common HPV genotypes in European

population.


In this study, the participants were volunteers

who signed informed consent positively

evaluated by Scientific Council of research

institute where the study was conducted. The

participants also provided relevant information

for this study before biological sampling in the

form of questionnaire, which contained no

personal information.

The total of 101 female individuals accepted

participation in study during the study period of

two years (2009-2011). The sample was

geographically limited to the Canton Sarajevo

and divided into two groups:

1) general population (75 subjects who were

randomly chosen; contacted in their

firms/institutions or at home addresses),

2) special population (26 subjects addressed by

gynecological consulting rooms because of

the presence of certain cytological

abnormalities or positive history of HPV

infection).

Two methods of gynecological sampling were

conducted in this study: self-sampling of

vaginal swabs and sampling of cervical swabs

provided by medical professional. Examinees

were given detailed oral and written instructions

on self-sampling. All sample swabs were taken

using DNAPapTM Cervical SamplerTM

(QIAGEN GmbH, Germany). DNA was

isolated from all the collected cervical and

vaginal samples using simple salting-out

procedure (Miller et al., 1988). Agarose gel-

electrophoresis was used for qualitative

assessment of the obtained DNA. Concentration

of the obtained DNA was determined by

spectrophotometry (UV mini 1240, Shimadzu,

Japan). Control PCR was performed with

universal HPV primers as described before

(Maki et al., 1991) which can detect a broad

spectrum of HPV types yielding the product of

around 270bp. The amplification reaction

conditions were: 10% PCR buffer and 1 unit of

Taq DNA Polymerase per reaction (TrueStart

Taq Polymerase and Buffer, ThermoScientific,

USA), 25mM MgCl2 (Fermentas, Latvia), 50

pM each of forward and reverse universal

primer (Biotez GmbH, Germany). Thermal

conditions of PCR were 30 cycles of chain

reaction of denaturation step at 95°C for 60 s,

annealing at 34°C for 45 s and elongation at

72°C for 45 s, after single initial denaturation

step at 95°C for 5 min and followed by single

extension step at 72°C for 5 min. PCR reactions

were successfully optimized to the volume of 10

μl.

In addition to the optimization of universal

marker PCR, multiplex PCR was optimized as

well, in order to screen for the most common

HPV types in European population further into

the experiment. Positive controls for PCR

reaction were plasmids with integrated HPV

sequences and previously genotyped samples in

standardized laboratory (Genetic Lab,

Romania). Negative controls included validated

HPV negative sample and blind control (water).

Since we included two additional primer sets for

detection of HPV types 31 and 35, amplification

reaction was optimized with respect to the

annealing temperature and concentrations of the

chemicals and template.

Six primer pairs (Karlsen et al., 1996) were

included in simultaneous multilocus co-

amplification reaction to detect for HPV types


26

11, 16, 16 a, 18, 31 and 35 complementary

templates. Primer pairs were divided in two

reactions: (I) types 11, 16, 16a and (II) types 18,

31, 35 in order to avoid possible mispriming and

unspecific products.

PCR reaction was done in total volume of 10 μl

using 2 μl of DNA template and 20pM

oligonucleotide sequences from three primer

pairs in each primer set –set A (sequence

specific primers for HPV types 11, 16 and 16a)

and set B (sequence specific primers for HPV

types 18, 31 and 35). A touch-down PCR

technique was used to obtain high specificity of

annealing conditions for primer pairs in

multiplex reaction as follows: initial

denaturation at 94°C for 3 min, followed by 10

cycles of denaturation at 94°C for 30 s,

annealing at 58°C for 30 s and elongation at

72°C for 45 s, then 20 repetitions of

denaturation at 94°C for 30 s, annealing at 60°C

for 30 s and elongation at 72°C for 45 s,

completed with final extension at 72°C for 7

min.

A platform based on microfluid technology

(Agilent 2100, Agilent Technologies, USA), was

used for highly precise detection and evaluation

of the size of obtained PCR products. Statistical

analysis Inter-rater agreement (kappa) of

collected data was done using MedCalc2

statistical software.


Swab samples were collected from total of 101

subjects aged 20-60 from Canton Sarajevo.

DNA was successfully isolated from 98

individuals which represent 98% of the samples.

It was not possible to obtain DNA from three

samples of vaginal swabs.

Of 103 women who were contacted, 101

expressed interest to participate in the study,

which reflects high response rate (98%). There

were 39 participants who provided both cervical

and vaginal samples for the purpose of cross-

validation of the results obtained from two

different biological specimens (self-sampled

and sample taken by medical professional) of

the same individual.

The applicability of the plasmids with

incorporated sequences of HPV 11, 16, 16a, 18,

31 and 35 used as positive controls has been

confirmed with positive PCR signal with

respective primers. The reaction for each

plasmid was performed in duplicate with

accompanying negative control. Figure 1 shows

that, besides HPV detection in cervical swabs, it

was also possible to detect HPV infection in

self-sampled vaginal swabs using universal

HPV primer pairs.

Figure 1. HPV detection in cervical and vaginal

samples. DNA ladder (50 bp) in lane 1; lanes 2 to 7 –

PCR products of self-sampled vaginal swabs (four

HPV positive, two negative); lanes 8 and 9 – cervical

and vaginal samples of the HPV positive subject;

lanes 10 and 11 – cervical and vaginal samples of the

HPV negative subject; lanes 12 and 13 – positive and

negative controls previously genotyped by

standardized laboratory; lane 14 – PCR negative

control

Out of 101 collected vaginal samples we

detected amplification of universal HPV

sequence in 17 or 17.17% cases. Out of 17 HPV

positive samples 11 (11% of overall study

sample) had positive signal for high-risk HPV

targeted DNA sequence: HPV type 16 in 6

cases, 31 in 2 cases and 35 was positive in one

case.

Two specimens were positive for 2 high-risk

genotypes- in one case 16 and 35 and in second


27

case 18 and 31. HPV type 11 was not detected

in any of the analyzed samples. This finding

also indicates that 65% of vaginal HPV

infections are due to high-risk HPV genotypes.

PCR protocol with universal HPV primer

modified according to (Maki et al., 1991) could

be a valid template to detect targeted HPV

genotypes relevant for European population in

both cervical and vaginal – self-collected

samples (Figure 2). PCR reactions were

successfully optimized to the volume of 10 μl

using TrueStart Hot Start Taq DNA Polymerase

(ThermoScientific, USA) as minimum volume

reliable for succesful HPV detection. As the

reduction of volume reduces cost by 3-5 x per

reaction this is also qute cost-effective

approach.

Figure 2. HPV genotyping; L – DNA ladder; lane 1

– HPV negative sample; lane 2 – HPV positive

sample, type 31 (153 bp); lane 3 – HPV positive

sample, type 18 (172 bp); lane 4 – HPV positive

sample, type 35 (230 bp) and 16 (119 bp); lanes 5 and

6 – HPV negative samples; lane 7 – post-PCR mix of

plasmid controls (HPV 11 – 80 bp, HPV 16 – 119 bp,

HPV 31 – 153, HPV 18 – 172 bp, HPV 35 – 230 bp;

HPV 16a – 499 bp)

Out of 39 vaginal samples that had a cervical

sample counterpart, 35 (around 90%) showed

concordance in the results of cervical and

vaginal samples analysis. In four samples, HPV

was detected in cervical smears, while it was not

possible to detect it in vaginal swabs probably

due to low quantities of viral DNA template

retrieved during sampling. The quality of the

band signals from vaginal swabs varied among

the samples. Analysis of the disputed four

samples using Real-Time PCR based method

showed that the viral infection was present in

the vaginal swabs as well, but in the lower

quantity, which can be seen from the

amplification diagram (Figure 3) where signal

of the vaginal swab crosses threshold in the later

stages compared to the cervical smear of the

same patient.

Inter-rater agreement-kappa (Altman, 1991) of

0.74 (CI=95 %) showed good agreement

between the results of cervical and vaginal

sample analysis.

Figure 3. Real Time PCR Amplification Plot –

cervical (a) and vaginal (b) sample of the same

examinee showing successful PCR amplification in

both.

Salting out procedure is a simple, effective and

economical method for the extraction of DNA

from cervical and vaginal samples. The three

samples from which DNA extraction proved

impossible serve as a reminder that the subjects

should be thoroughly informed on the

importance of strict adherence to the

instructions on self-sampling. Compared to the

standard PCR, Papanicoulaou test (Papa-test),

the golden standard in detection of precancerous

changes, has lower sensitivity (61.3%) with

wider dispersion interval (18.6-94%); sensitivity

of PCR is far greater (90%), with more compact

interval (84.9-100%) (De Guglielmo et al.,

2010) which does not change with the age of

patients. However, the clinical importance of

such high PCR sensitivity in identification of

women with the increased risk for developing

a

b

HPV-11

HPV-35

HPV-31

HPV-16a

HPV-16

HPV-18


28

cervical cancer (women who already have

CIN2) is questionable and should be discussed.

PCR specificity is lower, because it detects also

transient HPV infections which are so common

among the younger population.

Since previous studies have already confirmed

high concordance rate between PCR and other

sequence based detection - Hybrid Capture

(HC) test (Soderlund-Strand et al., 2005), the

multiplex PCR method described here could be

validated in small-scale setting for the purpose

of evaluation of reliability of multiloci detection

sensitivity and specificity prior to further

application.

Nevertheless, it should be emphasized that: 1)

the link between viral load and progression

toward cervical carcinoma is still examined; 2)

in socioeconomically weak areas, especially

rural, some women rarely have a chance for

screening (Peter et al., 2013; Chou et al., 2016).

Having this in mind, HPV detection using less

costly methods can serve as an early indication

and warning and also motivate women to inform

themselves about this topic, pay attention to

their life-style and improve their overall health

(Arbyn et al., 2015). Combination of cytology

and molecular-genetic methods can have very

significant, high predictive value for cervical

cancer (98%) which can decrease screening

intervals for HPV negative patients and thus

contribute to cost reduction for health-care

programmes (De Guglielmo et al., 2010; Zehbe

et al., 2011; Vassilakos, 2016).

It was shown here that the universal HPV

primer pair can detect genotypes 31 and 35 as

well. Some of the HPV positive samples could

not be genotyped with the HPV specific primers

used in this study which corresponds with the

assumption that universal HPV primer pair can

detect wide range of HPV genotypes.

The fact that it was not possible to genotype

HPV from 35% of HPV positive examinees

could indicate the presence of more relatively

common HPV types in population of Bosnia and

Herzegovina. The most common type detected

in this study was HPV 16, but having in mind

that the sample was geographically limited it

cannot be concluded that this is the most

common HPV type in Bosnia and Herzegovina.

Since there is no official data for Bosnia and

Herzegovina, there is a need to conduct a

serious, large population study which would

provide a basis for taking the appropriate

preventive measures.

The discordance in results of four cases of

examined cervical and vaginal samples can be

explained by the lower amount of viral template

in vaginal swab since the highest concentration

of viral particles is in transformation zone of the

cervix.

The potential use of self-sampled vaginal

samples analysis for screening is concordant

with the earlier findings (Karwalajtys et al.,

2006; Petignat et al., 2007). In every study

which examined the acceptance of self-

sampling, women prefered self-sampling (Bidus

et al., 2005) – it is far less uncomfortable and

less embarrassing (Petignat et al., 2007).

Analysis of self-sampled vaginal swabs for

HPV detection could encourage women to

participate in screening programmes. This could

be particularly significant for women who do

not regularly attend gynecological examinations

for different reasons. The test could play role in

early detection of pathological changes of

cervix. Lower specificity of PCR test could be

overcome by increasing combination of direct

HPV detection and standard cytological

procedures or by applying this test to women

older than 35 (when prevalence of HPV positive

infections decreases and prevalence of cervical

intraepithelial neoplasias increases). While

standard diagnostic kits mostly require high

technical, financial and logistic support, this test

is affordable and could be significant in


29

screening strategies of developing countries, but

should be validated against the golden standard

and validated diagnostic kits. In that sense, tests

based on PCR technology could represent more

simple and economic alternative in screening

for cervical cancer prevention. It could be

particularly important in regions which lack

adequate infrastructure and cytologic analysis of

high quality and critical areas where women do

not have approach to health-care system or, for

some cultural or traditional reasons, do not go to

gynecological examinations.

For efficient screening programme it is

necessary to: define targeted population and

insure high rate of its coverage, offer health-care

services of high quality which will enable

identification, treatment and monitoring of the

patients, provide trainings for health-care

workers, inform and educate women and

develop strategies which can be incorporated

into national programme for tumor prevention.

There are several criteria which need to be

fulfilled in order to have a successful screening

based on HPV testing (WHO, 2012). The

applicability of the method used in this study

will be examined with regards to the given

criteria:

1) minimally invasive sampling – since it has

been shown that the virus can be detected in

self-samples vaginal swabs, self-sampling

could be applied as the minimally invasive

procedure which is the least uncomfortable

and economical as well.

2) high sensitivity and specificity of method to

detect wide range of genital HPV types –

although sensitivity and specificity of this

particular test should be validated against

standard diagnostic procedures, it has already

been shown that PCR itself is highly

sensitive method. Sensitivity can be

increased by amplification of internal control

(such as beta-globin gene) which could

enable detection of potential PCR inhibition.

Lower specificity, which is the main

disadvantage of HPV PCR test could be

overcome by using this test for screening

women older than 30-35. The main

advantage of the test with universal HPV

primer pair is possible detection of wide

spectrum of genital HPV types.

3) high level of intra- and interlaboratory

reproducibility – reproducibility of the test

can be checked by repeating the experiment

and comparing results with other

laboratories. Interlaboratory reproducibility

in this study was checked by comparison of

several samples with partner laboratory

Genetic Lab (Romania). Additional three

samples were analyzed by HC II test at the

Clinical Centre University of Sarajevo. The

complete concordance of the results was

obtained, although the number of compared

samples was limited. Functionality of the

method was examined by repeating

experiments in the laboratory – series of

samples were analyzed under the same,

controlled experimental conditions, with

controls.

4) suitability of the method for automatic

procedures and reading – PCR is automated

and widely used method. Agilent

Bioanalyzer also provides quick and precise

analysis of given PCR products.

5) possibility to analyze large number of

samples – this considers the possibility of

collecting large number of samples and the

existence of capacities for their analysis. This

study indicates that there is a possibility that

women activelly take part in the screening

programmes through self-sampling. It is

necessary to standardize the optimized PCR

method for HPV detection on the state level,

to provide training of the staff and to

improve effectiveness of existing laboratories

and available human and material capacities.


30

There are potential capacities to apply this

method but screening strategies need to

incorporate timely and planning measures for

effective usage of the available capacities on

the state level.

6) short testing time – in this research, it is

empirically estimated that the analysis of 20-

25 samples, on average, takes 2 days per one

analyst. The testing time could be improved

through the distribution of work within the

team.

7) economy – molecular-genetic HPV testing

within the screening programme could

quickly address HPV positive women to

colposcopy in order to detect precancerous

and cancerous lesions in time. HPV negative

women would have longer screening

intervals which would reduce the costs to

health-care system. Hybrid Capture tests are

validated but technically and financially

demanding for developing countries.

According to the study conducted in Brasil,

HPV testing costs with Hybrid Capture

technology are 3.84 times higher compared

to PCR method (Nomelini et al., 2007).

Detection of HPV based on PCR is more

accessible, affordable, sensitive and simple

method with high negative predictive value

and, according to some studies (Morris,

2005; Nomelini et al., 2007; Romero-

Pastrana, 2015) it will be the best option for

primary screening.

Conclusions

Based on our research results, it is possible to

successfully isolate DNA from cervical and

vaginal samples using Miller's salting-out

procedure. The modified PCR method with

universal HPV primer presented here is

sensitive to the level required to detect HPV

infection presence in both cervical and vaginal

samples. Having in mind that most of the

developed molecular-genetic tests require high

technical, financial and logistic support,

detection of HPV based on PCR technology is

simple, highly sensitive method with high

negative predictive value which is also more

affordable so it could represent a good

alternative for screening in developing

countries. Validated and clinically most

confident method, previously approved by the

relevant institutions, should be chosen for this

purpose. Kappa value recorded in this study

(0.784; CI=95%) indicates good agreement

between the results of cervical and vaginal

samples analysis. The optimized PCR method

with universal HPV primer enables HPV

detection in self-sampled vaginal swabs. This is

particularly important for screening in

developing countries. Analysis of self-sampled

vaginal swabs for HPV detection could motivate

women to participate in the screening programs

which would be extremely important in the

prevention of cervical cancer.

Acknowledgements

Authors would like to express gratitude to all

the participants in the study.

References

Altman DG (1991) Practical statistics for medical

research. Chapman and Hall, London.

Arbyn M, Snijders PJ, Meijer CJ, Berkhof J,

Cuschieri K, Kocjan BJ, Poljak M (2015) Which

high-risk HPV assays fulfil criteria for use in

primary cervical cancer screening? Clin Microbiol

Infect 21(9):817-26.

Arbyn M, Castle PE (2015) Offering Self-Sampling

Kits for HPV Testing to Reach Women Who Do

Not Attend in the Regular Cervical Cancer

Screening Program. Cancer Epidemiol Biomarkers

(5):769-72.

Badal V, Chuang LSH, Hwee-Hong Tan E, Badal S,

Villa LL, Wheeler CM, Li BFL, Bernard HU

(2003) CpGMethylation of Human Papillomavirus

Type 16 DNA in Cervical Cancer Cell Lines and in


31

Clinical Specimens: Genomic Hypomethylation

Correlates with Carcinogenic Progression. J Virol

77(11):6227-6234.

Bidus MA, Zahn CM, Maxwell LG, Rodriguez M,

Elkas JC, Rose GS (2005) The Role of Self-

Collection Devices for Cytology and Human

Papillomavirus DNA Testing in Cervical Cancer

Screening. Clinical Obstetrics and Gynecology

48(1):127-132.

Boshart M, Gissmann L, Ikenberg H, Kleinheinz A,

Scheurlen W, Hausen H (1984) A new type of

papillomavirus DNA, its presence in genital cancer

biopsies and in cell lines derived from cervical

cancer. EMBO J 3(5):1151-1157.

Chou H, Huang H, Cheng H, Chang C, Yang L,

Huang C, Chang W, Hsueh S, Chao A, Wang C

(2016) Self-sampling HPV test in women not

undergoing Pap smear for more than 5 years and

factors associated with under-screening in Taiwan.

Journal of the Formosan Medical Association

115(12):1089–1096.

De Guglielmo Z, Rodríguez A (2010) Métodos

utilizados en la identificación del virus de

papiloma humano. Anales Sis San Navarra 33(1).

Jeon S, Allen-Hoffmann BL, Lambert PF (1995)

Integration of human papillomavirus type 16 into

the human genome correlates with a selective

growth advantage of cells. J Virol 69, 2989-2997.

Kalantari M, Karlsen F, Kristensen G, Holm R,

Hagmar B, Johansson B (1998) Disruption of the

E1 and E2 reading frames of HPV 16 in cervical

carcinoma is associated with poor prognosis. Int J

Gynecol Pathol 17:146–153.

Karlsen F, Kalantari M, Jenkins A, Pettersen E,

Kristensen G, Holm R, Johansson B, Hagmar B

(1996) Use of multiple PCR primer sets for

optimal detection of human papillomavirus. J Clin

Microbiol 35(9):2095-2100.

Karwalajtys T, Howard M, Sellors JW, Kaczorowski

J (2006) Vaginal self sampling versus physician

cervical sampling for HPV among younger and

older women. Sex Transm Infect 82:337-339.

Klaes R, Woerner SM, Ridder R, Wentzensen N,

Duerst M, Schneider A, Lotz B, Melsheimer P, von

Knebel Doeberitz M (1999) Detection of high-risk

cervical intraepithelial neoplasia and cervical

cancer by amplification of transcripts derived from

integrated papillomavirus oncogenes. Cancer Res

59(24):6132-6136.

Maki H, Saito S, Ibaraki T, Ichijo M, Yoshie O

(1991) Use of universal and type-specific primers

in the polymerase chain reaction for the detection

and typing of genital human papillomaviruses. Jpn

J Cancer Res 82(4):411-419.

Mammas IN, Vageli D, Spandidos DA (2008)

Geographic variations of human papilloma virus

infection and their possible impact on the

effectiveness of the vaccination programme.

Oncology Reports 20:141-145.


salting out procedure for extracting DNA from

human nucleated cells. Nucleic Acids Res

16(3):1215.

Morris BJ (2005) Cervical human papillomavirus

screening by PCR: advantages of targeting the

E6/E7 region. Clin Chem Lab Med 43(11):1171-

1177.

Münger K, Baldwin A, Edwards KM, Hayakawa H,

Nguyen CL, Owens M, Grace M, Huh KW (2004)

Mechanisms of Human Papillomavirus-Induced

Oncogenesis. J Virol 78(21):11451-11460.

Nomelini RS, Barcelos ACM, Michelin MA, Adad

SJ, Murta EFC (2007) Utilization of human

papillomavirus testing for cervical cancer

prevention in a university hospital. Cad. Saúde

Pública vol.23 no.6 Rio de Janeiro

Pereira R, Hitzeroth II, Rybicki EP (2009) Insights

into the role and function of L2, the minor capsid

protein of papillomaviruses. Arch Virol

154(2):187-197.

Peter JF, Snijders PJF, Verhoef VMJ, Arbyn M,

Ogilvie G, Minozzi S, Banzi R, van Kemenade FJ,

Heideman DAM, Meijer CJLM (2013) High-risk

HPV testing on self-sampled versus clinician-

collected specimens: A review on the clinical

accuracy and impact on population attendance in

cervical cancer screening. International Journal of

Cancer, 132(10):2223–2236.

Petignat P, Faltin DL, Bruchim I, Tramèr MR,

Franco EL, Coutlèe F (2007) Are self-collected

samples comparable to physician-collected cervical

specimens for human papillomavirus DNA testing?

A systematic review and meta-analysis. Gynecol

Oncol 105(2):530-535.


32

Romero-Pastrana F (2012) Detection and Typing of

Human Papilloma Virus by Multiplex PCR with

Type-Specific Primers. ISRN Microbiology.

186915

Söderlund-Strand A, Rymark P, Andersson P,

Dillner J, Dillner L (2005) Comparison between

the Hybrid Capture II Test and a PCR-Based

Human Papillomavirus Detection Method for

Diagnosis and Posttreatment Follow-Up of

Cervical Intraepithelial Neoplasia. Journal of

Clinical Microbiology 43(7):3260-3266.

Vassilakos P, Catarino R, Bougel S, Munoz M,

Benski C, Meyer-Hamme U, Jinoro J,

Heriniainasolo JL, Petignat P (2016) Use of swabs

for dry collection of self-samples to detect human

papillomavirus among Malagasy women.

Infectious Agents and Cancer 11:13.

WHO (2002) Cervical Cancer Screening in

Developing Countries: Report of a WHO

consultation. World Health Organization, France.

WHO (2007) International Agency for Research on

Cancer. IARC Monographs on the Evaluation of

Carcinogenic Risks to Humans. Human

Papillomaviruses 90, France.

WHO (2012) WHO Guidelines for Screening and

Treatment of Precancerous Lesions for Cervical

Cancer Prevention. World Health Organization,

France.

Wong ELY, Chan PKS, Chor JSY, Cheung AWL,

Huang F, Wong SYS (2016) Evaluation of the

Impact of Human Papillomavirus DNA Self-

sampling on the Uptake of Cervical Cancer

Screening. Cancer Nursing 39(1):E1–E11.

You J (2010) Papillomavirus interaction with

cellular chromatin. Biochim Biophys Acta 1799(3-

4):192-199.

Zavod za javno zdravstvo FBiH (2003-2011) –

Maligne neoplazme u 2007. godini. (Malignant

neoplasms in 2007)

<http://www.zzjzfbih.ba/tag/rak/> accessed

14.12.2011.

Zehbe I, Jackson R, Wood B, Weaver B, Escott N,

Severini A, Krajden M, Bishop L, Morrisseau K,

Ogilvie G, Burchell AN, Little J (2016)

Community-randomised controlled trial embedded

in the Anishinaabek Cervical Cancer Screening

Study: human papillomavirus self-sampling versus

Papanicolaou cytology. BMJ Open

8;6(10):e011754.

Zhou J, Sun XY, Louis K, Frazer IH (1994)

Interaction of human papillomavirus (HPV) type

16 capsid proteins with HPV DNA requires an

intact L2 N-terminal sequence. J Virol 68(2):619-

625.


33

SCREENING FOR GMO IN FERMENTED SOY SAUCE

Anesa Ahatović1*, Edina Ljekperić2, Mirza Nuhanović2, Adaleta Durmić-Pašić1


2University of Sarajevo, Faculty of Science, Sarajevo, Bosnia and Herzegovina

Abstract

Soy sauce is worldwide popular condiment of Asian origin. With the advent

of GM soybean production, soy sauce drew the interest of food safety

control. Samples collected for inspection are generally of industrial grade

soy sauce type, which is produced from hydrolyzed soybean and grain.

Following the failure to perform RealTime PCR based GMO screening on a

number of submitted samples we tested our screening system on soy sauce

produced following traditional method based on fermentation. Four batches

of soy sauce were produced and DNA extracted. DNA concentration ranged

from 32.68 to 65.36 ng/µl. Amplification of taxon specific target was

successful with rather high Ct ( > 30). Promoter P-35S sequence was not

detected, but T-NOS was detected in three samples with values reaching or

exceeding LOD of the method. The results show that it is possible to detect

transgenic elements in traditionally produced soy sauce while DNA

extraction from industrial grade soy sauce is not possible.

Key words: Soy sauce, DNA extraction, RealTime PCR, GMO

Introduction

Soy sauce is an Asian condiment that originated

in China about 2500 years ago. Its use was later

spread to the other parts of Asia while, it was

brought to Europe in the 17th century. Its

recognition in the Western societies followed

the rise in popularity of Asian cuisine.

Traditional soy sauce is mature, fermented

product, made from soybeans, grains and salt.

The production process is slow and does not

achieve industrial scale. As current cumulative

consumption greatly surpasses the capacities of

traditional production, industrial grade soy

sauce is produced from hydrolyzed soy protein

and grain. While this process results in

affordable product of satisfactory sensory

qualities, acid hydrolyses renders this type of

product inaccessible for DNA based analysis

such as those applied in food safety sector. With

the increasing presence of GM soybean in food

supply, soy sauce became an object of scrutiny

from food safety perspective.

According to ISAAA report 83% (92.1 million

hectares) of the 111 million hectares of the

globally planted soy are biotech (James, 2015).

Legal framework on GMO of the European

Union and Law on GMO in Bosnia and

Herzegovina (2009) require labeling of products

*Correspondence

E-mail:

anesa.ahatovic@ingeb.

unsa.ba

Received

March, 2017

Accepted

April, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Short communication


34

that contain more than 0.9 % GM content per

species. Successful implementation of any legal

framework depends on the abilities of analytical

laboratories to provide correct information.

Therefore, official laboratories utilize validated

analytical methods and DNA based methods are

the methods of choice when it comes to GMO

analysis (Anklam et al., 2002). Unfortunately,

validation is generally performed on general

type of matrix such as grain or flour and does

not guarantee comparable performance on

different type of matrix. Thus, when DNA

extraction from industrial grade soy sauce

proved to be challenging, we decided to explore

the matrix rather than alter the method. We

hypothesized that the DNA extraction method

validated for soybean would provide sufficient

quantity of PCR grade DNA from soy sauce

produced by traditional method.


We prepared soy sauce by traditional method in

order to test the capacity of CTAB DNA

extraction procedure validated for soybean to

yield sufficient quantity of PCR grade DNA.

The production method was derived by

analyzing a number of traditional recipes and

extrapolating common ingredients and steps. All

ingredients were procured locally. Soybean,

being the target ingredient, was obtained from

different manufacturers (Tab. 1). Raw soybeans

were soaked in water for 15 hours and then

boiled for about an hour. Cooked and smashed

soybeans were mixed with ca. half the amount

of wheat flour to form a homogeneous mixture.

The obtained mixture was divided in smaller

cakes and left for about 20 days in a warm and

humid place and allowed for mold to develop.

Following the development of mold, the cakes

were dried in a warm place and soaked in salt

brine (6 % NaCl solution). Fermentation was

allowed to proceed slowly with occasional

agitation. The fully fermented mixture was

filtered to remove the solids while liquid soy

sauce was used for DNA extraction and GMO

screening.

Table 1. List of analyzed samples

Sample ID Country of origin GMO

label

1/16 Abu Dhabi, United

Arab Emirates

-

2/16 China -

3/16 Netherlands GMO free

4/16 Bulgaria -

Genomic DNA was extracted from 2 ml of soy

sauce using CTAB precipitation method

validated and recommended by the European

Union Reference Laboratory for GM Food and

Feed (EN ISO 21571: 2005. Annex A, par. A3).

The quality and quantity of extracted DNA was

measured by UV spectrophotometry (UV-VIS

Spectrophotometer, Shimadzu, Japan).

To test if the obtained DNA extracts contain

amplifiable DNA we used RealTime PCR

amplification of lectin ie. taxon specific target

for soy (EURL-GMFF & ENGL, 2010). GMO

screening was performed using RealTime PCR

methods which target most common elements of

transgene construct – cauliflower mosaic virus

promoter (p-35S) and nopaline synthase gene

terminator from Agrobacterium tumefaciens (t-

NOS).

These methods are validated by the Italian

National Reference Laboratory for GMO

(IZSLT, 2011). RealTime PCR reactions were

carried out in an ABI 7300 RealTime PCR

instrument (Applied Biosystems). Certified

reference materials by JRC-IRMM were

analyzed parallel to samples and used as

positive controls. The raw data were analyzed

using Sequence Detection Software (Applied

Biosystems).


35


Following traditional recipe we prepared four

batches of soy sauce originating from different

sources. Some physical and chemical

characteristics of the obtained soy sauces are

listed in Tab. 2. While soy sauces made by

industrial procedure have liquid consistency,

dark color and sour or salty flavor our

traditional products have thicker consistency

and lighter color.

Table 2. Physical and chemical characteristics of

soy sauces produced following the traditional recipe

Sample

ID

Color Consistency Flavor pH

value

1/16 Light

brown

Mash Sour,

salty

4.49

2/16 Light

brown

Mash Sour,

salty

3.70

3/16 Light

brown

Mash Sour,

salty

3.80

4/16 Dark

brown

Mash Sour,

salty

3.90

Genomic DNA was successfully extracted from

all samples. Absorbance at 260 nm, 280 nm and

230 nm showed sufficient purity and quantity of

DNA extracts for further analysis. However,

A260/A230 ratio showed carbohydrates

residues which were expected, considering the

type of starting material. DNA concentration

ranged from 32.68 to 65.36 ng/µl.

Taxon specific target was amplified in all

analyzed samples. Even though the amplicons

were detected in all samples Ct values were

quite high especially compared to CRM Ct

value. Despite approximate DNA concentration

of 2/16-4/16 samples Ct values varied. Sample

1/16 which showed the lowest DNA

concentration (32.68 ng/µl) had lower Ct value

compared to 3/16 and 4/16 (40 ng/µl). However,

if we consider that the total DNA also included

DNA of lactobacilli, the discrepancy in DNA

concentration and Ct values ratio is not

unexpected. Sample 1/16 also had the highest

pH value, indicating less advanced

fermentation.

High Ct values for lectine (30.69-34.53)

indicated low concentration of target DNA but

still within limit of detection (LOD) of the

method. All samples tested negative for p-35S,

while 3 samples tested positive for t-NOS. High

Ct values for t-NOS reactions (34.49-36.30)

indicated that concentration of the target DNA

approaches LOD of the method (LOD≥4C).

Considering LOD of the t-NOS method only

sample 1/16 tested positive.

According to high Ct values for lectine we can

conclude that concentration of target DNA was

low which reflected to Ct values for t-NOS.

Additional optimization of DNA extraction

protocol such as adjustment of amount of the

starting material and additional purification step

with chloroform are necessary to increase target

DNA yield.

Table 3. Ct values of RealTime PCR reactions

Sample

ID

Lectine p-35S t-NOS

1/16 32.58 - 34.49

2/16 30.69 - 35.28

3/16 34.53 - -

4/16 34.50 - 36.30

10 %

CRM

18.26 - 20.38

Previous analyses of industrial soy sauces in our

laboratory were unsuccessful regardless of used

DNA extraction protocol. Industrial soy sauce is


36

made from acid-hydrolyzed soy protein. It is

assumed that unssuccessful DNA extraction is a

consequence of absence of target DNA in the

substrate because it is also subjected to acid

hydrolysis. Amplification of lectin gene in DNA

extracted from soy sauce made following

traditional recipe once again confirmed that

industrial soy sauce is not suitable for GMO

screening using PCR methods.

Conclusions

Although DNA was successfully extracted from

traditional soy sauce low DNA concentration

and high Ct values for lectine (30.69-34.53)

indicated the necessity of additional

optimization of DNA extraction procedure. All

analyzed samples tested negative for p-35S,

while t-NOS was detected in three samples.

However, high Ct values for t-NOS reactions

(34.49-36.30) indicated that concentration of the

target DNA approaches LOD of the method

which is bellow the labeling threshold and only

sample 1/16 can be considered as positive. The

results show that it is possible to detect

transgenic elements in soy sauce made

following traditional recipe while DNA

extraction from industrial soy sauce is not

possible.

References

Anklam E, Gadani F, Heinze P, Pijenburg H, Van

den Eede G. (2002) Analytical methods for

detection and determination of genetically

modified organisms in agricultural crops and plant-

derived food products. Euro Food Res Technol

214:3-26.

EURL-GMFF & ENGL (2010) Compendium of

reference methods for GMO analysis, EU-JRC

IHCP, QT/GM/005, pp. 102-104; QT/ZM/020, pp.

54-56.

International Organization for Standardization. EN

ISO 21571: 2005. Annex A, par. A3

IZSLT (2011) Report of the collaborative study for

the validation of real time PCR methods for GMO

screening. Istituto Zooprofilattico Sperimentale

delle Regioni Lazio e Toscana, Roma, Italia.

James C (2015) Report on Global Status of

Commercialized Biotech/GM Crops: 2015.

International Service for the Acquisition of Agri-

biotech Applications (ISAAA).

Law on GMO (2009) Official Gazette B&H, No.

23/09.474.


37

IN VITRO ANALYSIS OF TARTRAZINE GENOTOXICITY AND CYTOTOXICITY

Anja Haverić1*, Damira Inajetović2, Aneta Vareškić2, Maida Hadžić1, Sanin Haverić1



Abstract

Tartrazine (E 102) is widely used yellow food colorant. It is used in

nonalcoholic and sports drinks, spicy chips, jams, jelly and chewing gum

and also found in many non-food products like soaps, cosmetics, shampoo,

vitamins and some drugs. Tartrazine belongs to the most important and

diverse group of synthetic dyes – azo dyes. Their use often creates

controversies in the public since some of them are toxic, carcinogenic,

mutagenic and cause different disorders or allergic reactions. In this study

we aimed to evaluate genotoxic potential of tartrazine in human

lymphocytes culture and its cytotoxic potential in human lymphocytes and

melanoma GR-M cell line. For testing of its genotoxic and cytotoxic

potential in human lymphocyte culture, we used chromosome aberration

analysis and cytokinesis-block micronucleus cytome assay. For the analysis

of its cytotoxic potential in human melanoma cell culture, we applied

trypan blue exclusion assay.

Key words: chromosome aberrations, micronuclei, trypan blue, human

cell culture

Introduction

Synthetic food dyes are extensively used in

many aspects of human life. The beginning of

synthetic dyes production dates back to the

middle of the 19th century and the use of natural

dyes is completely overshadowed.

Implementation of new analyses in the 20th

century revealed significant negative and

harmful impacts of certain food dyes on human

health thus inducing restrictions on their use.

Aside from their negative, mutagenic and

carcinogenic, impact on health, synthetic dyes

from household or industry also have negative

impact on the environment even at very low

concentrations (Forgacs et al, 2004; Hosseini et

al., 2011). Establishing of appropriate

mechanisms for the detection and monitoring of

food dyes negative effects on human health is

essential to define adequate protection and

prevention measures.

Although exacerbating effects of tartrazin in

chronic urticaria and asthma sufferers are long

known (Lockey, 1977), tartrazine (E 102) is

widely used yellow food colorant (Mittal et al.,

2007, Saxena and Sharma, 2015). Tartrazine is

used in nonalcoholic and sports drinks, spicy

chips, jams, jelly and chewing gum, bakery

goods, cereals, candies, gelatin and numerous

other commodities (Saxena and Sharma, 2015).

It is also found in non-food products like soaps,

*Correspondence

E-mail:

[email protected]

sa.ba

Received

January, 2017

Accepted

April, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


38

cosmetics, shampoos, vitamin supplements and

some drugs (Amin et al., 2010). In many

countries tartrazine is used in catering as an

alternative to saffron (Mehedi et al., 2009).

Tartrazine belongs to the most important and

diverse group of synthetic dyes – azo dyes,

which includes about 3000 different

compounds. They are widely used and

distributed in the environment due to their

convenient and inexpensive synthesis, stability

and wide range of shades in comparison to

natural dyes (Saratale et al., 2011). Use of azo

dyes often causes controversies in the public

since some of them are toxic, carcinogenic,

mutagenic and cause different disorders (Saxena

and Sharma, 2015) or allergic reactions in the

organism (Bhatia, 2000; Ardren and Ram, 2001;

Bourrier, 2006). Studies have also linked the

ingestion of dyes (mostly azo dyes) in candies

and drinks with hyperactivity and other

disruptive behavior in children (McCann et al.,

2007).

In this study we aimed to evaluate genotoxic

potential of tartrazine in human lymphocytes

culture and its cytotoxic potential in human

lymphocytes and melanoma GR-M cell line.


Lymphocyte culture

Peripheral blood was collected into heparinized

vacutainers from a healthy female volunteer

who signed informed consent form.

Lymphocyte cultures were induced in 15-mL

sterile, plastic tubes with conical base (Isolab

GmbH, Wertheim Germany), which contained 5

mL of PB-MAX Karyotyping Medium

(GIBCO-Life Technologies, Grand Island, NY,

USA) and 400 μl of peripheral blood. Cultures

were harvested after 72 hours of lymphocytes

cultivation at 37ºC, using standard procedure

(hypotonic treatment with 0.075M KCl, triple

ethanol-acetic acid fixation, followed by

microscope slide preparations and staining in

5% Giemsa).

Tested substance

Tartrazine (E-102) was dissolved in dH2O and

added to the cultures in the 25th hour of

cultivation to the final concentrations of 2.5, 5

and 10 mM. The concentrations were

determined according to literature

(Mpountoukas et al., 2010). Negative controls

with equivalent volume of dH2O and positive

controls with 0.25 µg/mL of mytomicine C

(Sigma-Aldrich Co, St Louis, MO, USA) were

set up as well.

Cytokinesis-block micronucleus cytome (CBMN

Cyt) assay

The analysis of genotoxic, cytotoxic and

cytostatic potential of tartrazine was evaluated

in human lymphocyte cultures by applying

cytokinesis-block micronucleus cytome assay in

vitro. In order to block cytokinesis, 4.5 μg/ mL

of cytochalasin B (Sigma-Aldrich Co., St Louis,

MO, USA) was added to the cultures in the 45th

hour of cultivation. Microscopic analysis at

400x magnification using Olympus BX51

microscope (Tokyo, Japan) included

observation of 2000 binuclear cells per each

treatment and controls, equally divided among

two replicates (OECD, 2014). The frequencies

of genotoxicity markers: micronuclei,

nucleoplasmic bridges and nuclear buds, were

determined according to the defined criteria

(Fenech, 2007; Fenech et al., 2003). Cytotoxic

and cytostatic effects were assessed by

calculating nuclear division index (NDI) and

nuclear division cytoxicity index (NDCI)

(Fenech, 2000). The frequencies of

mononuclear, binuclear, trinuclear, and

quadrinuclear cells, as well as apoptotic and

necrotic cells, were registered in the total

number of at least 1000 cells, counted per each

treatment and controls, equally divided among

two replicates.


39

Chromosome aberration assay

For the chromosome aberration analysis,

lymphocytes were arrested in metaphase by

addition of colcemid (0.18 μg/ml), 90 min

before cell harvesting. 300 metaphases (46±1

chromosome) were analyzed per treatment and

controls, equally divided among three replicates

(OECD, 1997) at 1000× magnification.

Structural chromosome aberrations were scored

and registered according to the International

System for Human Cytogenetic Nomenclature -

ISCN (Mitelman, 1995).

Melanoma cell line

Human GR-M melanoma cell line (Culture

Collections, Public Health England, London,

UK, Cat. No. 95032301) was cultured in RPMI

1640 (Gibco-Invitrogen, Grand Island, NY)

supplemented with L-glutamine, 10% of fetal

bovine serum (FBS) and penicillin/streptomycin

(Sigma-Aldrich, St. Louis, MO) in T-25 flasks

(NUNC, Rochester, NY) at 37˚C, 5%CO2

atmosphere with 95% humidity. At the

beginning of experiment cells were seeded at a

density of 1×105 cells, pre-incubated for 24 h

and finally incubated with the selected

concentrations of tartrazine for another 48 h.

Trypan blue exclusion assay

For the cytotoxicity analysis trypan blue

exclusion assay was performed after 48h of

incubation of melanoma cell cultures with

tartrazine. Each treatment was carried out in

triplicate. Cells were harvested by trypsinization

and cell viability (%) was determined as

[number of viable cells / (number of viable +

non-viable cells)] x 100.

Statistical analysis

Differences in observed frequencies of

genotoxic and cytotoxic parameters were

calculated using proportion comparison Z-test in

WINKS 4.5 Professional Software (TexaSoft,

Cedar Hill, TX). Statistical significance

threshold was set at 0.05.


Results of tartrazin genotoxicity analysis,

obtained in human lymphocytes cultures and

GR-M melanoma cell line appling CBMN Cyt

assay, chromosome aberration assay and trypan

blue exclusion assay are presented in tables 1-3.

Frequencies of genotoxicity biomarkers in

CBMN Cyt assay incrased with the increase of

tartrazin concentration (Table 1, Figure 1).

Table 1. Results of CBMN Cyt assay in human

lymphocyte culture

Note: MN – micronuclei; NB – nuclear buds;

NPB – nucleoplasmic bridges. Genotoxicity

analized on 1000 BN cells per culture, 2 replicate

cultures per treatment; Cytostasis/cytotoxicity

analized on 500 cells per culture, 2 replicates per

treatment. (a) Significantly different against

negative control; (b) Significantly different against

positive control.

However, comparison with negative controls

revealed no significant differences in MN and

NB frequencies. In concentrations of 5 mM and

10 mM of tartrazine, significant increase in

Treatment

Genotoxicity

biomarkers

Cytostasis/cyt

otoxicity

MN NB NPB NDI NDCI

Negative

control 2 0.5 0 1.768 1.752

2.5 mM 1b 0

b 1.5

b 1.816 1.303

5 mM 2b 0.5

b 6.5

a 1.584 1.573

10 mM 8b 1 8

a 1.586 1.574

Positive

control 65.5 6 8.5 1.308 1.303


40

frequency of NPB against negative control was

detected (p<0.5 for 5 mM; p=0.005 for 10 mM).

Figure 1. Average frequencies of genotoxicity

markers in CBMN Cyt assay expressed per 1000 BN

cells in human lymphocyte cultures (negative

controls + treatments)

Comparison against positive control were

significant for MN frequencies in all three tested

concentrations (p=0.0), for NB frequencies in

2.5 mM (p=0.01) and 5 mM (p=0.03)

concentrations and for NPB in the lowest tested

concentration of 2.5 mM (p=0.026). Neither

tartrazine nor mytomicin C induced significant

differences in nuclear division indexes (NDI

and NDCI) against negative control although

nuclear division indexes were decreased in the

highest tested concentrations and positive

control (Table 1, Figure 2). However, cytotoxic

effects of mytomicin C, an antitumor antibiotic,

are confirmed in several oral squamous cell

lines (HSC-2, HSC-3, HSC-4, Ca9-22 and NA)

and human promyelocytic leukemic cell line

HL-60 (Sasaki et al., 2006).

Figure 2. NDI and NDCI values calculated using

average frequencies of analyzed cells in cytokinesis

blocked human lymphocyte cultures, negative

controls and treatments

Proportion comparisson of observed

chromosome aberrations revealed the lack of

significant differences between each of three

tested concentrations and negative control while

positive control significantly differed for all

tested concentration in chromatid- (breaks and

minute fragments) and chromosome-type

aberrations (breaks, double minutes) and

chromosome rearrengements that were

calculated separately (p=0.0). Incidence of

pulverzations (pvz) and premature centromere

separations (pcs) did not differ between each of

three treatments or when compared with

positive or negative control (p>0.05).

Previously published data regarding tartrazine

genotoxicity are contradictory. Bastaki et al.

(2017) dismissed tartrazine genotoxicity in vivo,

while Khayyat et al. (2017) reported tartrazine

Treatment chtb, min chrb, ace,

dmin chre pvz pcs

Negative control 0 0 0 0 0

2,5 mM 1 1 0 0 0

5 mM 1 1 0 0 0

10 mM 0.666 1.333 0 0 0.666

Positive control 21 74 24 1 0.333

Table 2. Results of chromosome aberration analysis in human lymphocyte culture


41

potencial to induce structural and functional

aberrations and genotoxic effects in vivo. Atli-

Sekeroglu et al. (2017) also found that tartrazine

and its metabolites have genotoxic potential on

human lymphocyte cultures both with and

without metabolic activation (S9) and can

induce cytotoxic effects without S9 and in the

highest of concentrations tested (2500 μg/ml).

Tartrazin is shown to induce DNA-damage in

the gastrointestinal organs at low doses, even at

doses approaching the acceptable daily intake

(Sasaki et al., 2002) of 7.5 mg/kg/bw/day,

which is significant since many products, such

as ice creams, desserts, cakes are often

marketed without labeling (Elhkim et al., 2007).

Study of cytotoxic and genotoxic effects of

tartrazine on DNA repair in human lymphocytes

demonstrated no cytotoxic effects but revealed

significant genotoxic effects in all tested

concentrations ranging from 0.25-64.0 mM

(Soares et al., 2015), that are far below the

concentrations tested in our study (2.5; 5 and 10

mM).

Figure 3. Cytotoxicity analysis using Trypan blue

assay in human melanoma GR-M culture

Trypan blue exclusion assay was performed in

GR-M human melanoma cell culture in order to

estimate tartrazine cytotoxicity. The decrease in

cell viability (%) was obvious and significant

against negative control (p=0.0), contrasting

negligible cytotoxic effects recorded in human

lymphocytes culture by CBMN Cyt assay.

Table 3. Results of CBMN Cyt assay in human

lymphocyte culture

Note: (a) Significantly different against negative

control.

Overall results suggest that concerns regarding

tartrazine use are not unfounded, especially

regarding cytotoxicity of tartrazine that should

be further evaluated.

Conclusions

Obtained results and conducted statistical

analysis show that tartrazine is not genotoxic in

human lymphocytes in tested concentrations. Its

cytotoxic effects are negligible in human

lymphocyte culture but significant in GR-M

melanoma cell culture. This finding suggests

that future studies of tartrazine should be

focused on evaluation of cytotoxic effects using

human lymphocytes but also additional cell

models, cytotoxicity assays in comparison

against cytotoxic effects of other cytotoxicity

inducers.

References

Amin KA, Abdel Hameid II H, Abd Elsttar AH

(2010) Effect of food azo dyes tartrazine and

carmoisine on biochemical parameters related to

renal, hepatic function and oxidative stress

biomarkers in young male rats. Food Chem

Toxicol 48:2994-2999.

Ardern KD, Ram FS (2001) Tartrazine exclusion for

allergic asthma. Cochrane Database Syst Rev 4:

CD000460.

Atli-Sekeroglu Z, Gunes B, Kontas Yedier S,

Sekeroglu V, Aydin B (2017) Effects of tartrazine

Viable Nonviable Viability

%

Negative

control 277 7.75 97.28

2.5 mM 122 10.75 91.90a

5 mM 130.5 7.75 94.394a

10 mM 124.25 12.75 90.693a


42

on proliferation and genetic damage in human

lymphocytes. Toxicol Mech Methods 27(5): 370-

375.

Bastaki M, Farrell T, Bhusari S, Pant K, Kulkarni R

(2017) Lack of genotoxicity in vivo for food color

additive Tartrazine. Food Chem Toxicol 105:278-

284.

Bhatia M.S (2000) Allergy to tartrazine in

psychotropic drugs. J Clin Psychiatry 61:473-476.

Bourrier T (2006) Intolerance and allergy to

colorants and additives. Revue Française

D’allergologie et D’immunologie Clinique, 46: 68-

79. DOI: 10.1016/j.allerg.2005.12.002.

Elhkim M, Heraud F, Bemrah N, Gauchard F,

Lorino T, Lambre C, Fremy JM., Poul JM (2007)

New considerations regarding the risk assessment

on tartrazine An updated toxicological assessment,

intolerance reactions and maximum theoretical

daily intake in France. Regul Toxicol Pharmacol

47:308-316.

Fenech M (2000) The in vitro micronucleus

technique. Mutat Res 455:81-95.

Fenech M, Chang WP, Kirsch-Volders M, Holland

N, Bonassi S, Zeiger E (2003) HUMN project:

detailed description of the scoring criteria for the

cytokinesis–block micronucleus assay using

isolated human lymphocyte cultures. Mutat Res

534:65-75.

Fenech M (2007) Cytokinesis-block micronucleus

cytome assay. Nat Protoc 2:1084- 1104.

Forgacs E, Cserhati T, Oros G (2004) Removal of

synthetic dyes from wastewaters: a review.

Environ Int 30(7):953–971.

Hosseini KE, Alavi Moghaddam MR, Hashemi SH

(2011) Post-treatment of anaerobically degraded

azo dye Acid Red 18 using aerobic moving bed

biofilm process: Enhanced removal of aromatic

amines. J Hazar Mater 195:147–154.

Khayyat L, Essawy A, Sorour J, Soffar A (2017)

Tartrazine induces structural and functional

aberrations and genotoxic effects in vivo . PeerJ

5:e3041; DOI 10.7717/peerj.3041.

Lockey SD Sr. (1977) Hypersensitivity to tartrazine

(FD&C Yellow No. 5) and other dyes and

additives present in foods and pharmaceutical

products. Ann Allergy 38(3):206-10.

McCann D, Barrett A, Cooper A, Crumpler D,

Dalen L, Grimshaw K, Kitchin E, Lok K, Porteous

L, Prince E, Sonuga-Barke E, Warner JO,

Stevenson J (2007) Food additives and hyperactive

behaviour in 3-year-old and 8/9-year-old children

in the community: a randomised, double-blinded,

placebo-controlled trial. The Lancet 370:1560-

1567.

Mehedi N, Ainad-Tabet S, Mokrane N, Addou S,

Zaoui C, Kheroua O, Saidi D (2009) Reproductive

toxicology of tartrazine (FD and C Yellow No. 5)

in Swiss albino mice. Am J Pharmacol Toxicol

4(4):128–133.

Mitelman F (1995) ISCN - An International System

for Human Cytogenetic Nomenclature.

Cytogenetics and Cell genetics, S. Karger, Basel.

Mittal A, Kurup L, Mittal J (2007) Freundlich and

langmuir adsorption isotherms and kinetics for the

removal of tartrazine from aqueous solutions using

hen feathers. J Hazar Mater 146(1–2):243–248.

Mpountoukas P, Pantazaki A, Kostareli E,

Christodoulou P, Kareli D, Poliliou S, et al. (2010)

Cytogenetic evaluation and DNA interaction

studies of the food colorants amaranth, erythrosine

and tartrazine. Food Chem Toxicol 48(10):2934-

2944.

OECD Guideline for the testing of chemicals (1997)

In Vitro Mammalian Chromosome Aberration

Test. Test guideline 473.

OECD Guideline for the testing of chemicals (2014)

Mammalian Erythrocyte Micronucleus Test. Test

guideline 474.

Saratale RG, Saratale GD, Chang JS, Govindwar SP

(2011) Bacterial decolorization and degradation of

azo dyes: A review. J Taiwan Inst Chem Eng

42:138–157.

Sasaki YF, Kawaguchi S, Kamaya A, Ohshita M,

Kabasawa K, Iwama K, Taniguchi K, Tsuda S

(2002) The comet assay with 8 mouse organs:

results with 39 currently used food additives.

Mutat Res 519:103-119.

Sasaki M, Okamura M, Ideo A, Shimada J, Suzuki

F, Ishihara M, Kikuchi H, Kanda Y, Kunii S,

Sakagami H (2006) Re-evaluation of Tumor-

specific Cytotoxicity of Mitomycin C, Bleomycin

and Peplomycin. Anticancer Res 26:3373-3380.

Saxena B, Sharma S (2015) Food Color Induced

Hepatotoxicity in Swiss Albino Rats, Rattus

norvegicus. Toxicol Int 22(1):152-157.


43

Soares BM, Araujo TM, Ramos JA, Pinto LC,

Khayat BM, De Olivieira Bahia M, Montenegro

RC, Burbano RM, Khayat AS (2015) Effect on

DNA repair in human lymphocytes exposed to the

food dye tartrazine yellow. Anticancer Res

35(3):1465-1474.


44

INFLUENCE OF BASIC VARIABLES ON MICRONUCLEI FREQUENCY AND

CHROMOSOMAL ABERRATIONS IN GENERAL POPULATION OF FB&H

Mirela Mačkić-Đurović1*, Izeta Aganović-Mušinović1, Orhan Lepara2, Slavka Ibrulj1

1University of Sarajevo, Faculty of Medicine, Center for Genetics, Sarajevo, Bosnia and Herzegovina

2University of Sarajevo, Faculty of Medicine, Department of physiology, Bosnia and Herzegovina

Abstract

The aim of this study was to determine the values of micronuclei (MN) and

structural chromosomal aberrations (CA) in peripheral blood lymphocytes

from 200 healthy participants of both genders from general population of

FB&H, as well as to explore the influence of gender and age on MN and

CA frequencies. Standard protocols for MN test, cultivation and

micronuclei analysis from peripheral blood binuclear lymphocytes have

been applied. MN values ranged from 0 to 8 MN per 1000 binuclear cells.

The results suggest that gender and age influence MN frequency, with

pronounced effect on 2 MN frequencies. Females on average have higher

values of all observed variables of MN test than men. We have also found

significant effect of gender – females had increased number of CAs –

chromatid type; and of the age in both genders. Frequency distribution of

CTAs and CSAs between male and female groups showed predominance of

CTAs over CSAs, independently of gender. The results of this study will be

incorporated into reference data base for comparative research in future.

Key words: micronuclei, structural chromosomal aberrations, gender, age

Introduction

Bio-monitoring is important part of health care

for population that is either professionally or

environmentally exposed to physical and

chemical mutagens and/or carcinogens. It is

based on measurement (or) determination of

frequencies of different markers that point at the

earliest, repairable bioindicators, that appear

before the malignancies and/or other diseases

(Kopjar et al., 2010). The main postulate for

biomarker efficiency is the knowledge of its

values in general, unexposed, healthy

population.

Micronucleus test (MN) in peripheral blood

lymphocytes is one of the most important

methods in cytogenetic bio-monitoring. Besides

MN-test, analyses of structural chromosomal

aberrations (CA) and analysis of sister

chromatid exchange (SCE) are important, and

those are applied in the surveillance of

professionally exposed populations.

CAs include chromosomal breaks and

exchanges visible in cells arrested in metaphase-

stage They are usually classified into

chromosome-type aberrations (CSAs) and

chromatid-type aberrations (CTAs), which can

be distinguished morphologically (Collins,

2004).

MN test detects chromosomal aberrations

indirectly through nucleus chromatin loses that

*Correspondence

E-mail:

[email protected]

Received

March, 2017

Accepted

May, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


45

lead to MN formation in cell cytoplasm. MN are

defined as small, round cytoplasmic bodies, that

consist of DNA and are formed during cell

division from either acentric chromosomal

fragments or whole chromosome that are left

behind during anaphase. In vitro MN test is

reliable test for the detection of mutagenic

factors (Krishnaja and Sharma, 2004). It is also

reliable for the detection of genome instability

that is related to increased risk of malignancies.

Causal relation among increased number of MN

and some malignancies and other diseases

(diabetes and cardiovascular disease) is evident

(Fenech et al., 2011; Andreassi et al., 2011).

That justifies the use of MN test as suitable

biomarker for long-term estimation of

cytogenetic risk among human population.

In estimation of damaging and risk factors on

people health, it is extremely important to have

a database with biomarkers values measured or

determined on large number of individuals from

general (healthy) population. Regeneration of

database with fresh data is recommended (every

two years). According to the leading experts’

recommendation, the database should include at

least 20 individuals per gender per decade of

age (Fenech, 1993). That objective was fulfilled

by completion of this study.

The aim of this study was to determine the

values of MN test and CA from peripheral

blood lymphocytes in 198 healthy individuals

from general population of Federation of Bosnia

and Herzegovina (FB&H), with the inclusion of

both genders.


Study populations

The study as well as all procedures of blood

sampling and handling in laboratory conditions,

were performed according to ethical principles

and directions for bio-monitoring of human

populations. The subjects were informed about

the study aim; each subject fulfilled

questionnaire with the basic data needed for the

study and gave his/her written consent.

The main inclusion criterion was that the subject

has not been exposed to physical or chemical

agents, has no acute infections or medical

exposures to known agents that could interfere

with cytogenetic findings. 200 examinees

entered the study: 20 per gender per decade of

their age. Two men had to be excluded from the

study due to previous medical treatment.

Methods

Standard protocol of MN test for cultivation and

micronuclei analysis from peripheral blood

binuclear lymphocytes was applied. Per each

sample, 1000 binuclear lymphocytes were

analyzed and total number of MN, number of

cells with MN and their distribution (number in

cells) determined. Micronuclei were determined

in accordance with recommended criteria of

HUMN (Human Micro Nucleus) Project

(Fenech et al., 2003). Conventional Moorhead

method was used on short-term cultures for 48

hr, with all cells being in the first division

(Moorhead et al., 1960). Slides from each

culture were numbered and anonymously

scored. At least 200 well-spread metaphases

with 46 ± 1 centromeres were examined. CAs

were further subclassified as CSAs (including

chromosome-type breaks, ring chromosomes,

marker chromosomes, and dicentrics) and

chromatid-type aberrations (CTAs; including

chromatid-type breaks). Gaps were not scored

as aberrations.

Statistics

All variables were expressed as medians and

interquartile ranges for continuous data with or

without normal distribution, respectively.

Nonparametric data were compared between

groups using the independent samples Mann–

Whitney U-test. Additionally Spearman’s

correlation was used as measure of association


46

for continues variables. P-value <0.05 was

considered statistically significant. All statistical

analyses were performed using the computer

software Statistical Package for the Social

Sciences, version 20.0 (SPSS, Chicago, IL).


The study population comprised of 198

participants, 98 males and 100 females divided

in 5 age groups (20-29, 30-39, 40-49, 50-59,

and 60-69). In the total group MN median is

determined to be (0.00-2.00), average

1.05±0.07, while individual values ranged from

0 to 8 MN per 1000 binuclear cells. Median for

cells with one MN (1 MN) was 2.00, while for

two MN (2 MN) was 0.00.

In 21 female and 29 male samples no MN were

found. Out of total female samples (n=100),

cells with 1 MN were found in 79 of them.

While in the male group (n=98), cells with 1

MN were found in 69 samples (Table 1). Cells

with 2 MN were found in 25/100 female

samples, and in only 12/98 male participants

(Table 2). Correlation between gender and MN,

for cells with 1 MN showed rho=0.135 p=0.059,

while the values for cells with 2 MN were

rho=0.170 p=0.017. Thus, the correlation

between gender and 2 MN is stronger.

Relation between age and number of cells with

MN is statistically significant p<0.000. For each

additional year of age the risk of having 1MN

(odds ratio) increases by additional 12%, 95%

CI (8-16%). For each additional year of age the

risk of having 2 MN increases by 6%, 95% CI

(3%-10%). Risk for 2 MN is 3 x higher in

females, 95% CI (from 1 to 6 times).

As shown in Figure 1 increased frequency of

CAs correlates with age in both genders,

whereas in females the peak of CAs occurrence

is around the age of 50, which may be linked to

with the changes in hormonal status and

adjustment for menopause. In males, CAs

frequencies peaked at the age of 60 and all were

statistically significant according to Spearman’s

correlation (p<0.01; rho=0.463; rho=0.470;

rho=0.455; respectively). Significant positive

correlation between the age and number of

aberrations within all groups in healthy

population is evident. (rho=0.462; p<0.01)

Mann-Whitney U test was used to determine the

significance of CA frequency between male and

female groups. Number of aberrations in female

group is 1.0 (0.0-2.0) is higher than number of

aberrations in male group 0.0 (0.0 – 2.0). This

difference is statistically significant (p=0.046)

(Figure 2).

Cells with 1 MN Total

.00 1.00 2.00 3.00 4.00 5.00 6.00 8.00

gender

male

Number 29 23 22 15 6 3 0 0 98

% 29.6% 23.5% 22.4% 15.3% 6.1% 3.1% .0% .0% 100.0%

female

Number 21 23 22 15 9 5 4 1 100

% 21.0% 23.0% 22.0% 15.0% 9.0% 5.0% 4.0% 1.0% 100.0%

Total Number 50 46 44 30 15 8 4 1 198

% 25.3% 23.2% 22.2% 15.2% 7.6% 4.0% 2.0% .5% 100.0%

Table 1. Analysis of the influence of gender status on frequencies of cells with 1 MN


47

We have found significant effect of gender –

female had increased number of CAs –

chromatid type, and of the age in both genders.

Micronuclei in healthy population lymphocytes

are indicators of genome damage in single cell

accumulated over the years, and the mutations

that appear in the first in vitro cell division

(Kopjar et al., 2010). Today, cytogenetics

provides numerous biomarkers for evaluating

chromosomal instability and scoring of MN in

lymphocytes is one that draws a lot of interest

(Milošević-Djordjević et al., 2012). In this study

we have analyzed the level of cytogenetic

damage in healthy population from Bosnia and

Herzegovina, addressing both genders and

within the range of age approaching of

professionally exposed and actively working

population. That population could be controlled

using MN-test and CA, in the future. Contrary

to the published studies, in our research we did

not count the total number of micronuclei (1+2

MN) they were rather been given as number of

cells with 1 MN and number of cells with 2

MN. Considering that the subject group

included healthy individuals with no medical

record of acute infections or medical exposures

or records of exposure to chemical and/or

physical agents in the months preceding the

study the influence of large number of

environmental factors on single MN test values

were minimized. Therefore gender and age were

considered factors with largest influence on MN

formaiton (Fenech and Bonassi, 2010;

Battershill et al., 2008).

Figure 1. Relation among age and number of

aberrations at all groups.

Our research, as well as others presented, show

that females have higher MN count than males,

on average. According to Fenech (Fenech,

1998) the frequency of MN in females is 1.2 to

1.6 times higher. Our research shows that

females may have up to 3 times more cells with

2 MN than males, while this ratio is smaller

when 1 MN is considered. One of the reasons

Cells with 2 MN Total

.00 1.00 2.00 3.00

gender

male

Number 86 10 1 1 98

% 87.8% 10.2% 1.0% 1.0% 100.0%

female

Number 75 16 7 2 100

% 75.0% 16.0% 7.0% 2.0% 100.0%

Total Number 161 26 8 3 198

% 81.3% 13.1% 4.0% 1.5% 100.0%

Table 2. Analysis of the influence of gender status on frequencies of cells with 2 MN


48

why females do have increased frequency of

MN is the loss of one of X chromosomes

through MN (Bolognesi et al., 2006;

Kažimirova et al., 2006).

Figure 1. Relation among number of aberrations at

both genders.

Positive correlation among MN frequency and

age was reported in numerous studies

(Veerachari et al., 2011; Nefic and Handzic,

2013; Jones et al., 2012). According to our data,

age had statistically significant influence on the

counts of cells with both 1 and 2 MN. The

research showed that each additional year of age

adds additional 6% to the risk of increase of

number of cells with 2 MN, 95% CI, while that

percentage is 12%, even higher when

considering cells with 1 MN. Milosevic-

Djordjevic et al. (2012) showed a decrease of

MN frequencies in groups of older age and

explained that this might be the result of

declining in proliferation capacity of cells with

aging. Norppa and Falck (2003) upon extensive

analysis of numerous studies results, concluded

that 30% to 80% of spontaneously arisen MN

comprised whole chromosomes. In contrast to

sex chromosomes that are more often lost

through MN, autosomes appear randomly in

MN and cannot be lost by ageing only (Norppa

and Falck, 2003; Bukvic et al., 2001). It has also

been noted that apparently healthy individuals

may have large number of MN containing

specific chromosome (Kopjar et al., 2010). We

have found significant effect of gender – female

had increased number of CAs – chromatid type,

and of the age in both genders. Our results

concur with other investigations done recently

in other European countries, though we were

not able to correlate CAs frequency and cancer

risk due to inability to establish long-term

follow-up. Frequency distribution of CTAs and

CSAs between male and female showed

predominance of CTAs over CSAs,

independently of gender. An increase in

chromosomal aberrations may be due to either

genetic or acquired conditions conferring higher

susceptibility to genetic damage. Elevated levels

of chromosomal aberrations in peripheral blood

lymphocytes may be seen as an indicator of an

early phase of carcinogenesis, where various

genetic alterations are also generated in different

tissues (Mitelman et al., 2004).

Upon present experience and knowledge, MN

test has great advantage over other cytogenetic

tests since it allows damage estimation at

functional level and integration of mitotic

spindle, which other methods cannot achieve

(Bolognesi et al., 2006). It should be pointed

out that MN-test is useful in genome instability

discovery that is in relation with increased

cancer risk (Fenech and Crott, 2002). According

to Bonassi research, this study provides

preliminary evidence that MN frequency in

peripheral blood lymphocytes is predictive of

cancer risk, suggesting that increased MN

formation is associated with early events in

carcinogenesis (Bonassi et al., 2011).

Conclusions

The results of MN test and CA analyzed over

age and gender obtained in this study are in

accordance with the results determined on

general healthy population in other research.

These results will facilitate construction of

research database for multiple genetic


49

categorization and for comparing and

interpreting analysis in further research projects,

medical diagnostics, control and bio-monitoring

for professionally and environmentally exposed

populations and others. That is the applicable

character of this research. Also, the results are

the ground for further development of

laboratory database.

Acknowledgment

This research was funded by Federal Ministry of

education and science in 2010, Federation of

Bosnia and Herzegovina. It should be noted that

all the participants signed written informed

consent prior to the participation in the study.

References

Andreassi MG, Barale R, Iozzo P, Picano E (2011)

The association of micronucleus frequency with

obesity, diabetes and cardiovascular disease.

Mutagenesis 26:77–83.

Battershill JM, Burnett K, Bull S (2008) Factors

affecting the incidence of genotoxicity biomarkers

in peripheral blood lymphocytes: impact on design

of biomonitoring studies. Mutagenesis 23:423-37.

Bolognesi C, Lando C, Mateuca R, Lombaert N,

Aka PV, Decodier I, et al. (2006) Chromosomal

changes: induction, detection methods and

applicability in human biomonitoring. Biochemie

88:1515-1531.

Bonassi S, El-Zein R, Bolognesi C, Fenech M

(2011) Micronuclei frequency in peripheral blood

lymphocytes and cancer risk: evidence from

human studies. Mutagenesis 26(1):93–100.

Bukvic N, Gentile M, Susca F, Fanelli M, Serio G,

Buanadonna L, et al. (2001) Sex chromosome loss,

micronuclei, sister chromatid exchange and aging:

a study including 16 centenerians. Mutat Res

498:156-167.

Collins AR (2004) The comet assay for DNA

damage and repair: principles, applications, and

limitations. Mol Biotechnol 26:249-261.

Fenech M (1993) The cytokinesis-block

micronucleus technique: a detailed description of

the method and its application to genotoxicity

studies in human populations. Mutat Res 285:35-

44.

Fenech M (1998) Important variables that influence

base-line micronucleus frequency in cytokinesis-

blocked lymphocytesa biomarker for DNA damage

in human populations. Mutat Res 404:155-165.

Fenech M, Crott JW (2002) Micronuclei,

nucleoplasmic bridges and nuclear buds induced in

folic acid deficient human lymphocytes-evidence

for breakage-fusion-bridge cycles in the

cytokinesis-block micronucleus assay. Mutat Res

504:131-136.

Fenech M, Bolognesi C, Kirsch-Volders M, Bonassi

S, Zeiger E, Knasmuller S, et al. (2003) Human

Micronucleus project, “HUMN project: detailed

description of the scoring criteria for the

cytokinesis-block micronucleus assay using

isolated human lymphocyte cultures”. Mutat Res

534:65-75.

Fenech M, Bonassi S (2010) The effect of age,

gender, diet and lifestyle on DNA damage

measured using micronucleus frequency in human

peripheral blood lymphocytes. Mutagenesis 26:43-

49.

Fenech M, Holland N, Zeiger E, Chang WP, Burgaz

S, Thomas P, et al. (2011) The HUMN and

HUMNxL international collaboration projects on

human micronucleus assays in lymphocytes and

buccal cells—past. Mutagenesis 26(1):239-245.

Jones HK, York PT, Jackson-Cook C (2012)

Mechanism leading to the formation of

micronuclei containing sex chromosomes differ

with age. Mutat Res 742(2):207-217.

Kažimirova A, Barančokova M, Krajčovičova-

Kudlačkova M, Volkovova K, Staruchova M,

Valachovičova M, Paukova V, et al. (2006) The

relationship between micronuclei in human

lymphocytes and selected micronutrients in

vegetarians and non-vegetarians. Mutat Res

611:64-70.

Kopjar N, Kašuba V, Milić M, Rozgaj R, Želježić D,

Gajski G, Mladinić M, Garaj-Vrhovac V (2010)

Micronucleus assay in Croatian general population.

Arh Hig Rada Toksikol 61:219-234.

Krishnaja AP, Sharma NK (2004) Transmission of γ

– ray induced unstable chromosomal aberrations

through successive mitotic divisions in human

lymphocytes in vitro. Mutagenesis 19(4):295-305.


50

Milošević-Djordjević O, Stošić I, Grujičić I, Zelen I,

Sazdanović P (2012) Chromosomal instability in

peripheral blood lymphocytes of patients with

reproductive failure assessed by micronucleus

assay. Arh Hig Rada Toksikol 63:367-375.

Mitelman F, Johansson B, Mertens F (2004) Fusion

genes and rearranged genes as a linear function

of chromosome aberrations in cancer. Nat Gene

36:331-334.

Moorhead PS, Nowell PC, Mellman WJ, Battips

DM, Hungerford DA (1960) Chromosome

preparations of leukocytes cultured from human

peripheral blood. Exp Cell Res 20:613-616.

Nefic H, Handzic I (2013) The effect of age, sex and

lifestyle factors on micronucleus frequency in

peripheral blood lymphocytes of the Bosnian

population. Mutat Res 753:1-11.

Norppa H, Falck GCM (2003) What do human

micronuclei contain?. Mutagenesis 18:221-233.

Veerachari U, Venkatesh Sh, Yadav A, Narayanappa

R (2011) Biomonitoring genetic instability in

normal healthy population using a simple

cytogenetic marker for micronucleus test.

International Multidisciplinary Research Journal

1/2:01-09.


51

COMPARISON OF TWO DIFFERENT MULTIPLEX SYSTEMS IN CALCULATING

KINSHIP AMONG CLOSE RELATIVES

Mirjana Beribaka1*, Selma Hafizović2, Amela Pilav3, Mirela Džehverović3, Damir

Marjanović2,4,5, Jasmina Čakar3

1University of East Sarajevo, Faculty of Technology, Zvornik, Bosnia and Herzegovina


3Institute for Genetic Engineering and Biotechnology, Sarajevo, Bosnia and Herzegovina

4International Burch University (IBU), Sarajevo, Bosnia and Herzegovina

5Institute for Anthropological Research, Zagreb, Croatia

Abstract

This study compares the results obtained using two multiplex systems,

PowerPlex®

16 System and PowerPlex® Fusion System, to evaluate the

probability of a specific kinship relationship between the offspring of three

pairs of identical twins, such as full kinship (siblings), first-degree relatives

(first cousins) and half-siblings. Genomic DNA was isolated and amplified

from buccal swab and selected short tandem repeat (STR) markers were

detected. Electropherograms were generated and analyzed for all persons,

using two multiplex systems. Paternity testing for every nine offspring of

six examined couples was performed and in all cases the probability that the

alleged father is the true father, was over 99.9999%. Kinship analyses were

performed setting up two different hypotheses and calculating the

likelihood ratio (LR) and kinship probability. Determining the degree of

kinship between persons who were full siblings, likelihood ratio showed the

highest values contrary to other two types of kinship. Kinship analyses

between first cousins showed a higher probability that the examined

persons are half-siblings, rather than they are first cousins. In most cases,

the introduction of additional seven loci included in PowerPlex® Fusion

System increased the values of average likelihood ratios. It is

recommendable to use over 20 STR loci in complex kinship analyses.

Key words: kinship, identical twins, PowerPlex®

16 System, PowerPlex®

Fusion System, likelihood ratio

Introduction

Personal identification or complex kinship

analyses represents the most challenging tasks

for forensic investigators. Determining sibship

or half sibship among close relatives is a

frequent issue in kinship cases. These analyses

can be carried out by testing a set of STR (Short

Tandem Repeat) loci. STR allelic variants vary

from person to person, so it is not unusual that

two persons share the same alleles at STR loci,

or even to match at two or three STR loci.

However, the minimum theoretical probability

*Correspondence

E-mail:

mirjana.beribaka@gm

ail.com

Received

October, 2016

Accepted

February, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


52

that two individuals share identical alleles at all

15 STR loci included in the commercial

multiplex STR system PowerPlex® 16 for the

Caucasian population is 1/1.83 x 1017

(Marjanovic and Primorac, 2013).

STR markers became very popular in forensic

practice because they are based on PCR

technology, and they can be used when it comes

to a small amount, or degraded DNA. STR

markers are suitable for multiplex amplification

and include sensitive fluorescent detection,

which allows researchers to quickly collect the

data based on the markers. STR markers have a

great power of discrimination between persons

who are not related, but also between closely

related individuals (Butler, 2015).

A large number of multiplex STR systems have

been developed and they are used in forensic

practice for many purposes, like confirming or

excluding paternity, but also, for other types of

relationships between individuals. For example,

Thomson et al. (2001) analyzed the kinship

relations using multiplex STR loci and

Gaytmenn et al. (2002) studied the sensitivity

and specificity of kinship analysis. Reid et al.

(2004) compared the probability of sibship for

pairs of full siblings versus unrelated

individuals, using Identifiler multiplex STR kit

(15 STR loci plus amelogenin). In this study,

LR values for known full siblings ranged from

4.6 to over 1 billion and for unrelated

individuals from 0.000000045 to 0.12. All full

siblings had an LR > 1 and all nonsiblings had

an LR < 1.

PowerPlex® 16 System allows co-amplification

and three-color detection of sixteen loci (fifteen

STR loci and Amelogenin) including Penta E,

D18S51, D21S11, TH01, D3S1358, FGA,

TPOX, D8S1179, vWA, Penta D, CSF1PO,

D16S539, D7S820, D13S317 and D5S818

(Promega Corporation, 2013). The PowerPlex®

Fusion System is a 24-locus multiplex for

human identification applications and allows co-

amplification and fluorescent detection of the 13

core CODIS loci (CSF1PO, FGA, TH01,

TPOX, vWA, D3S1358, D5S818, D7S820,

D8S1179, D13S317, D16S539, D18S51 and

D21S11), the 12 core European Standard Set

loci (TH01, vWA, FGA, D21S11, D3S1358,

D8S1179, D18S51, D10S1248, D22S1045,

D2S441, D1S1656 and D12S391) and

Amelogenin for gender determination. This

system also includes DYS391, as a male

specific locus. Penta D and Penta E loci are

included in order to increase the discriminatory

power and enable searching the databases that

contain profiles with these loci. Finally,

D2S1338 and D19S433 loci, which are

contained within large number of databases, are

incorporated to further increase the power of

discrimination (Promega Corporation, 2014).

Appropriate application of statistical model

plays an important role in the determination of

kinship between individuals. To calculate the

kinship between two individuals, it is necessary

to define the relatedness coefficients for each

type of relations. The relatedness coefficients

are commonly referred as k0, 2k1, k2 (for two

observed persons, X and Y): k0 = P (none of

allele X is identical by descent to Y alleles); 2k1

= P (one allele X is identical by descent to one

of the Y allele, but the second one is not); k2 = P

(both X alleles are identical by descent to Y

alleles), where P is the probability for each

individually analyzed locus (Fung and Hu,

2008). The probability of kinship is calculated

based on these coefficients.

The aim of this study was to compare the

performance of two multiplex systems,

PowerPlex® 16 and PowerPlex

® Fusion, in the

process of statistical determination of kinship

between the descendants of three pairs of

identical twins. The specificity of this study is

that the descendants of identical twins are first

cousins, but regarding their DNA profiles, they

are half siblings. The main objective was to


53

investigate whether larger number of loci

contained within PowerPlex® Fusion System,

increases the possibility of discrimination

between three types of kinship: full sibship, first

cousins and half sibship.


Samples were collected from 21 individuals, of

which three pairs of identical twins with their

spouses and with a total of nine offspring (Fig.

1). The first twin pair is labeled as D and N,

their spouses are A and T, and their children are

DA1, DA2, NT1 and NT2. The second twin pair

is labeled as M and B, their spouses as V and

T1, and children as MV, BT1 and BT2. The

third twin pair is labeled as AD and AD1, their

spouses as SA and ME and their children as

ASA and AMS. All persons investigated gave

informed consent.

Sample

D

Sample

N

Sample

T

Sample

A

Sample

DA1

Sample

DA2

Sample

NT1

Sample

NT2

Sample

M

Sample

B

Sample

T1

Sample

V

Sample

MV

Sample

BT1

Sample

BT2

Sample

SA

Sample

ME

Sample

AD1

Sample

AD

Sample

ASA

Sample

AMS

Figure 1. Pedigrees for three pairs of identical twins

DNA was isolated and amplified from buccal

swab of all persons, according to the modified

Miller's protocol (Miller, Dykes and Polesky,

1987) and selected STR markers were detected

using ABI PRISM 310 Genetic Analyzer and

two multiplex systems.

Data analysis was performed using

GeneMapper® ID software, ver. 3.2. Paternity

testing for all the descendants of six examined

couples was performed. Kinship analyses were

performed by setting up two different

hypotheses and calculating the LR. Calculations

were performed using EasyDNA_2Persons

software, suggested by Fung and Hu (2008).

Before starting the software analysis, it was

necessary to make one input file, which contains

a list of all 15 loci, allelic variants and their

frequencies for PowerPlex® 16 System, or 22

for PowerPlex® Fusion System. This software

uses relatedness coefficients to describe the type

of relationship between two persons under the

hypothesis (Tab. 1).

Table 1. Relatedness coefficients (k0, 2k1, k2) for

some common relationships between two persons

(Fung and Hu, 2008)

Hypothesis testing and calculation of LR was

performed for each locus individually, using the

formulas for the calculation of probability, as

shown in Table 2.

Table 2. Likelihood ratio from with two opposing

hypotheses Hp: (Y, Z) ~ (x0, 2x1, k2) versus Hd: (Y,

Z) ~ (1, 0, 0) (Fung & Hu, 2008)

Y Z Likelihood ratio

AiAi AiAi k0 + 2k1/pi + k2/pi2

AiAi AiAj k0 + k1/pi

AiAi AjAj k0

AiAi AjAk k0

AiAj AiAj k0 + k1(pi+pj)/(2pipj) +

k2/(2pipj)

AiAj AiAk k0 + k1/(2pi)

AiAj AkAl k0

Relationship k0 2k1 k2

Parent-child 0 1 0

Full siblings 1/4 1/2 1/4

Half siblings 1/2 1/2 0

Grandparent-

grandchild

1/2 1/2 0

Uncle-nephew 1/2 1/2 0

First cousins 3/4 1/4 0

Second cousins 15/16 1/16 0


54

As an input file for EasyDNA_2Persons

software, we used the list of loci and allelic

variants for the Bosnian-Herzegovinian

population (Marjanovic et al., 2006). Profiles,

obtained using PowerPlex® Fusion System,

include seven additional loci, whose allelic

frequencies were taken from the data for

Croatian population (Curic, Gasic, Pluzaric and

Smiljcic, 2012).


Electropherograms were generated and analyzed

using two multiplex systems, where both

multiplex systems gave satisfactory results for

all individuals. DNA samples were profiled

using PowerPlex® 16 System and PowerPlex

®

Fusion System. Samples were analyzed using

the ABI PRISM 310 Genetic Analyzer and the

profiles were obtained using GeneMapper® ID

software, ver. 3.2.

In all the cases of paternity testing using the

PowerPlex® 16 System, probability that the

alleged father is the true father, was higher than

99.9999%. There were some variations in the

values of CPI in some samples, which reflected

on the probability of paternity. The chart shows

that the lowest probability of paternity had

parental couple labeled as M and V, for the

child labeled as sample MV (99.99998%) and a

parental couple labeled as B and T1, for the

child labeled as sample BT1 (99.999975%)

(Fig. 2).

Other samples had similar values, except for the

pair of samples AD and AD1, where in both

cases of paternity testing were obtained much

higher probabilities, compared to the other

tested samples. High CPI values resulted from

rare allelic variants present at several loci. In

this case, Penta E locus was especially

interesting, since twin pairs with the highest

probability of paternity, had allelic variant 20.

According to Marjanovic et al. (2006), this

allelic variant was not observed in a sample of

100 individuals in the Bosnian-Herzegovinian

population, so allelic frequency of variant 20 is

considered as 0.005. Another allelic variant that

was not observed by Marjanovic et al. (2006) is

14.3 at the D1S1656 locus, which was found in

the sample T.

Having confirmed the paternity for every

descendant of all twin pairs, calculation of the

degree of kinship could be performed. The

examined types of kinship were: full sibship,

first-degree relatives and half sibship. It

was

Figure 2. Paternity testing for all samples using the PowerPlex® 16 System


55

necessary to set up two hypotheses (Hp and Hd)

and to calculate LR or probability factor. If the

value of LR is greater than 1, it supports the

probability of Hp hypothesis, and if the value is

less than 1, it supports probability of Hd

hypothesis.

Firstly, we tested the following two hypotheses:

Hp - The relationship between the examined

persons is full kinship (brothers and sisters) and

Hd - The relationship between the examined

persons is first-degree relatives (first cousins).

The obtained average LRs for both multiplex

systems are presented in Table 3.

Average LRs for fully related samples using

PowerPlex® 16 were higher than 1, but varied in

their values. LR for DA1 and DA2 samples was

2.9458, for NT1 and NT2 samples was

921.7813 and for BT1 and BT2 samples was

2399.483. These differences between LRs

resulted from the fact that some samples have a

high number of loci where they share the same

alleles, whether they are homozygote or

heterozygote, or they share some rare alleles

with low allelic frequencies. For the same

reason, samples DA1 and NT2 have an average

LR over 1 (1.234). This result could indicate

that there is a probability that samples DA1 and

NT2 are full siblings, even though they are first

cousins. The use of 22 loci in PowerPlex®

Fusion System gave better confirmation of

supposed relations in 9 out of 10 sample pairs.

Additional loci solved the dilemma about the

samples DA1 and NT2, where the average LR

decreased under 1 (0.2656), so hypothesis Hp

could be rejected and the samples DA1 and NT2

could be considered as not full siblings.

Distinguishing between full siblings and first

degree relatives requires larger number of STR

loci than 15. The PowerPlex® Fusion profiles

also confirmed the full kinship relations

between samples DA1 and DA2, NT1 and NT2

and BT1 and BT2, but with much greater

reliability (10.1532, 34707.44 and 499822.1,

respectively). PowerPlex®

Fusion System

contains two loci (D2S1338 and D12S391) that

are recommended by Yuan et al. (2017) as loci

with higher discrimination power. STRs with

higher discrimination power values should be

included in analyses when additional autosomal

markers are required for full sibship

identification. Next, we tested the following two

hypotheses: Hp - The relationship between the

examined persons is full kinship (brothers and

sisters) and Hd - The relationship between the

examined samples is half siblings (half-brothers

and half-sisters). Results are presented in Table

4. Regarding the probabilities of full sibship

PowerPlex®

16 System PowerPlex®

Fusion System

Average LR Kinship

Probability (%)

Average LR Kinship

Probability (%)

Samples DA1 and DA2 2.9458 74.66% 10.1532 91.03%

Samples DA1 and NT1 0.5106 33.80% 0.9545 48.84%

Samples DA1 and NT2 1.234 55.24% 0.2656 20.99%

Samples DA2 and NT1 0.1114 10.02% 0.0021 0.2%

Samples DA2 and NT2 0.0789 7.31% 0.0058 0.58%

Samples NT1 and NT2 921.7813 99.89% 34707.44 99.99%

Samples BT1 and BT2 2399.483 99.96% 499822.1 99.99%

Samples MV and BT1 0.748 43.95% 0.1962 16.4%

Samples MV and BT2 0.0377 3.36% 0.0333 3.22%

Samples ASA and AMS 0.0337 3.26% 0.0054 0.54%

Table 3. Analysis of the relationships of full siblings versus first cousins, for all descendants


56

versus half sibship, average LRs in all samples

decreased (Tab. 4), comparing to analysis of full

sibship versus full cousins (Tab 3). This is the

result of relatedness coefficients being lower for

first degree relatives, than for half sibling. It

was also demonstrated in the study of Von

Wumb-Schwark et al. (2015) that LR decreased

in full related individuals after analyzing full

sibship versus half sibship, comparing to the full

sibship versus unrelated persons.

All cases of full sibship were again confirmed,

in both multiplex systems. It is also noticable

that in all analyses, additional loci in the

PowerPlex®

Fusion System gave higher support

to supposed relations, ie. higher values for full

sibship in fully related individuals and lower

values of full sibship in half related individuals.

Studies suggest that genotyping more than 20

autosomal STR loci improve forensic

personal identification, especially in the

sibship analyses (Allen et al., 2007; Carboni

et al., 2014; Von Wumb-Schwark et al.,

2015; Tamura et al., 2015; Turrina et al.,

2016), which corresponds to our findings.

Finally, two hypotheses were tested: Hp -

The relationship between the examined

samples is half siblings (half-brothers and

half-sisters) and Hd - The relationship

between the examined persons is first-degree

relatives (first cousins). The fully related

individuals were excluded from this analysis

(Tab. 5). All results obtained with the

PowerPlex®

16 System gave average LR

values

PowerPlex®


Fusion System

Average LR Kinship

Probability (%)

Average LR Kinship

Probability (%)

Samples DA1 and DA2 1.0358 50.88% 1.9523 66.13%

Samples DA1 and NT1 0.1258 11.17% 0.0647 6.08%

Samples DA1 and NT2 0.4324 30.19% 0.1055 9.54%

Samples DA2 and NT1 0.0579 5.47% 0.0027 0.27%

Samples DA2 and NT2 0.0487 4.64% 0.004 0.4%

Samples NT1 and NT2 43.376 97.75% 307.191 99.67%

Samples BT1 and BT2 188.626 99.47% 4963.224 99.98%

Samples MV and BT1 0.3554 26.22% 0.0534 5.07%

Samples MV and BT2 0.0130 1.28% 0.0033 0.33%


PowerPlex®


Fusion System

Average LR Kinship

Probability (%)

Average LR Kinship Probability (%)

Samples DA1 and NT1 4.0609 80.24% 10.2145 91.08%

Samples DA1 and NT2 2.8555 74.06% 2.5191 71.58%

Samples DA2 and NT1 1.9246 65.81% 0.7757 43.68%

Samples DA2 and NT2 1.6202 61.83% 1.4643 59.42%

Samples MV and BT1 2.1098 67.84% 3.6839 78.65%

Samples MV and BT2 2.8924 74.31% 10.0634 90.96%


Table 4. Analysis of the relationships of full siblings versus half siblings, for all descendants

Table 5. Analysis of the relationships of half siblings versus first cousins, for all descendants


57

higher than 1, indicating the confirmation of

half sibship. Considering the fact that identical

twins share the same DNA profile, their

descendants can be perceived as half siblings.

The introduction of additional seven loci used in

the PowerPlex® Fusion System increased the

values of LR in 5 out of 7 analyzed pairs.

Carboni et al. (2014) reported a case study of

two women who were cousins and they

suspected to be daughters of the same father.

Their mothers were sisters and were not

available for kinship testing. The analysis with a

commercial kit showed a probability value of

about 15, to support the hypothesis that they

were half-sisters. Including the additional

26Plex markers, the total of 41 loci, probability

value increased to 435, supporting the

hypothesis that the subjects were half-sisters.

Our results also suggest the use of larger

number of loci when distinguishing between full

and half sibship.

Conclusions

In this study, we compared two multiplex

systems, PowerPlex®

16 System and

PowerPlex® Fusion System, regarding the

determination of kinship between the

descendants of identical twins. Likelihood ratios

obtained by calculating the degree of kinship

between first cousins provided greater support

to the hypothesis that they are half siblings. In

all cases of full siblings, likelihood ratio the

most strongly supported the hypothesis of full

sibship.

Additional seven loci in PowerPlex® Fusion

System gave more accurate results, so it is

recommendable to use 20 or more STR loci in

analysis of different types of kinships to avoid

ambiguous results and to facilitate interpretation

of obtained results.

References

Allen RW, Fu J, Reid TM, Baird M (2007)

Considerations for the interpretation of STR results

in cases of questioned half-sibship. Transfusion,

47:515-519.

Butler J (2015) Advanced Topics in Forensic DNA

Typing: Interpretation. San Diego: Elsevier

Academic Press.

Carboni I, Iozzi S, Nutini AL, Torricelli F, Ricci U

(2014) Improving complex kinship analyses with

additional STR loci. Electrophoresis, 35:3145-

3151.

Curic G, Gasic V, Pluzaric V, Smiljcic D (2012)

Genetic parameters of five new European Standard

Set STR loci (D10S1248, D22S1045, D2S441,

D1S1656, D12S391) in the population of eastern

Croatia. Croat Med J 53:409-415.

Fung WK, Hu Y (2008) Statistical DNA Forensics:

Theory, Methods and Computation. Chichester:

John Wiley and Sons Ltd.

Gaytmenn R, Hildebrand DP, Sweet D, Pretty IA

(2002) Determination of the sensitivity and

specificity of sibship calculations using

AmpF/STR Profiler Plus. Int J Legal Med

116:161-164.

Marjanovic D, Bakal N, Pojskic N, Kapur L,

Drobnic K, Primorac D, Bajrovic K,

Hadziselimovic R (2006) Allele frequencies for 15

short tandem repeat loci in a representative sample

of Bosnians and Herzegovinians. Forensic Sci Int

156(1):79-81.

Marjanovic D, Primorac D (2013) Forenzicka

genetika: teorija i aplikacija. Sarajevo: Strucna i

naucna knjiga „Lelo“.


salting out procedure for extracting DNA from

human nucleated cells. Nucleic Acids Res

16(3):1215.

Promega Corporation (2013) PowerPlex® 16

System – Technical Manual (Rev. ed.). Madison:

Promega Corporation.

Promega Corporation (2014) PowerPlex® Fusion

System – Technical Manual (Rev. ed.). Madison:

Promega Corporation.

Reid TM, Wolf CA, Kraemer CM, Lee SC, Baird

ML, Lee RF (2004) Specificity of sibship


58

determination using the ABI Identifiler multiplex

system. J Forensic Science 49:1262-1264.

Tamura T, Osawa M, Ochiai E, Suzuki T, Nakamura

T (2015) Evaluation of advanced multiplex short

tandem repeat systems in pairwise kinship

analysis. Leg Med 17:320-325.

Thomson JA, Ayres KL, Pilotti V, Barrett MN,

Walker JIH, Debenham PG (2001) Analysis of

disputed single-parent/child and sibling

relationships using 16 STR loci. Int J Legal Med

115:128–134.

Turrina S, Ferrian M, Caratti S, Cosentino S, De Leo

D (2016) Kinship analysis: assessment of related

vs unrelated based on defined pedigrees. Int J

Legal Med 130:113-119.

Von Wurmb-Schwark N, Podruks N, Schwark T,

Göpel W, Fimmers R, Poetsch M (2015) About the

power of biostatistics in sibling analysis-

comparison of empirical and simulated data. Int J

Legal Med 129:1201-1209.

Yuan L, Xu X, Zhao D, Ren H, Hu C, Chen W, ...

Zhang L (2017) Study of autosomal STR loci with

IBS method in full sibling identification. Leg Med

26:14-17.


59

AIR POLLUTION TOLERANCE INDEX OF Plantago major IN STEELWORKS AREA

OF ZENICA, BOSNIA AND HERZEGOVINA

Tajna Klisura1, Adisa Parić1, Mirel Subašić2, Erna Karalija1*


2University of Sarajevo, Faculty of Forestry, Sarajevo, Bosnia and Herzegovina

Abstract

Atmospheric pollution is among the largest anthropogenic impacts on the

ecosystem. In numerous studies it was observed that plants, especially those

that grow in urban areas, are heavily influenced by different pollutants and

their survival is correlated with structural and metabolic adaptation to

stressful environmental conditions. Primary objective of this study was to

determine the index of tolerance to air pollution (APTI) of plantain

(Plantago major), on two locations in Zenica. The results indicated that

index of tolerance to air pollution of P. major, APTI, is higher in

individuals sampled from the contaminated site, than those in the control

area.

Key words: air pollution, plantain, APTI

Introduction

Plants take an active part in the circulation of

nutrients and gases such as carbon dioxide,

oxygen and also provide an enormous leaf

surface for the absorption and accumulation of

air pollutants resulting in reduction of the

pollution level in the environment (Escobedo et

al., 2008). Atmospheric pollution is among the

largest anthropogenic impacts on the ecosystem

(Hijano et al., 2005). In numerous studies it was

observed that the plants, especially those that

grow in urban areas, are heavily influenced by

different pollutants and their survival is

correlated with structural and metabolic

adaptation to stressful environmental conditions

(Gostin, 2009). Sensitivity and responses of

plants to air pollution are very variable. Plant

species that are more sensitive are used as

biological indicators of air pollution. Responses

of the plants to air pollution on physiological

and biochemical levels can be understood by

analysing the specific factors that determine the

resistance and sensitivity. Urban areas can be

contaminated by many pollutants such as SO2,

CO, NO and heavy metals and the plants that

grow there are exposed not just to one pollutant

but a variety of pollutants including their

complex interactions (Agarwal, 1985; Tiwari et

*Correspondence

E-mail:

[email protected]

m

Received

November, 2016

Accepted

May, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


60

al., 1993). The main objective of this study was

to determine the air pollution tolerance index

(APTI) of Plantago major, collected from two

sites in the Zenica area in order to determine the

tolerance of this species to the existing

atmospheric conditions.


Study area

Sampling of plant material was performed in

October 2015 in two localities in the area of

Zenica: Tetovo and Smetovi. Tetovo is located

at latitude 44°13'51.18" and longitude

17°53'19.71" and Smetovi at latitude 44°

14'41.77" and longitude 17° 58'42.05". Tetovo

is located near steelworks ArcelorMittal, the

source of air pollution. Plants collected at

Smetovi locality were used as control samples.

The samples were collected in three biological

replicates (fully developed leaves of P. major)

and transferred into the Laboratory of Plant

Physiology, Faculty of Science, University of

Sarajevo. The samples were stored in a

refrigerator at +4°C for the purpose of further

analysis.

Relative Water Content (RWC)

Relative water content was analysed according

to Liu and Ding (2008). Five leaf samples of

each individual per investigated site were

selected for analysis. Fresh weight was obtained

by weighing the fresh material. The leaves were

then immersed in water overnight, for the

purpose of determination of turgid mass. The

leaves were than dried in an oven at 70°C

overnight and reweighed to obtain the dry

weight. After determining the parameters of

fresh, dry and turgid weight of the leaves,

relative water content was calculated using the

formula:

where FW is fresh weight, DW is dry weight

and TW is turgid weight.

Leaf extract pH

Leaf extract pH was determined according to

Singh and Rao (1983). Fresh plant material was

homogenized in a mortar with the addition of 10

ml distilled water. The content of the mortar

was then filtered and pH of the leaf extract

determined using pH meter (872 pHlab

Metrohm, Swissmade) after calibration with

buffer solutions at pH 4 and pH 7.

Total chlorophyll and carotenoid content

Extraction of pigments was carried out from

fresh plant material (0.25 g), by maceration in

80% acetone (v/v). Following the centrifugation

of the macerate (Biofuge A centrifuge

manufacturer Heraeus sepatech) at 1000 rpm,

for 15 minutes, the supernatant was collected

for further analysis.

Quantities of chlorophyll a, chlorophyll b, total

chlorophyll and carotenoid were determined by

absorbance measurement at 663 nm

(chlorophyll a), 646 nm (chlorophyll b) and 440

nm (carotenoids) using spectrophotometer

(Perkin-Elmer spectrophotometer Lambda 25).

Calculation of chlorophyll a and chlorophyll b

and carotenoid contents was done according to

the formulas by Porra et al. (1989) and Holm

(1954):

Chl a = 12.25A663 - 2.55A646 (µg/g)

Chl b = 20.31A646 - 4.91A663 (µg/g)

Chl a + b = 17.76A646 + 7.34A663 (µg/g)

Car= 4.69A440 - 0.267Chl a + b (µg/g)

Ascorbic acid (AA)

Extraction of ascorbic acid was carried out from

0.5 g of fresh material, in 5 ml of distilled water

and 2-3 drops of glacial acetic acid (99.8%),

obtained supernatant was used for analyses.


61

Titrimetric analysis of ascorbic acid was carried

out according to the following procedure: a

solution of 10 ml of the filtrate, 50 ml of

distilled water and 0.5 ml of 1% starch was

mixed and immediately titrated to endpoint with

a standardized solution of iodine (0.002 mol L-

1). Titration was repeated twice for samples

from both sites. Results are expressed in mg/g

(Tahirović et al., 2012).

Air Pollution Tolerance Index (APTI)

Air Pollution Tolerance Index (APTI) was

determined by Singh and Rao (1983) using the

formula:

where A is ascorbic acid content (mg/g FW), T

is total chlorophyll content (mg/g FW), P is pH

of leaf extracts and R is relative water content

(% of the leaves).


Relative Water Content

To calculate relative water content in Plantago

major, values of fresh, turgid and dry mass of

leaves were determined. The results (Table 1)

indicate that individuals sampled at the site of

Tetovo, show increase in relative water content

in relation to the locality Smetovi, control site.

Dhanam et al. (2014) obtained similar results by

recording higher relative water content in leaves

from polluted sites than in those at the control

site.

These results suggest that relative water content

plays an important role in maintaining

homeostasis in plants that are under stress due

to air pollution. Plant species with high relative

water content are tolerant to pollutants. High

relative water content in plant allows it to

maintain physiological homeostasis when

exposed to pollutants when transpiration rates

are usually high. It also serves as an indicator of

plant resistance to drought conditions (Dhanam

et al., 2014).

Leaf extract pH

Leaf extract pH is another necessary parameter

in determination of APTI. Variation was

observed in pH values of leaf extracts

depending on sampling location. The pH of the

extract of leaves (Table 1) sampled from the

contaminated site (5.85) was lower than the

values recorded at control sites (8.6).

Leaf extract pH has a very important role in

determining the level of tolerance of plants to

any kind of pollution. High pH can affect the

efficiency of conversion of hexoses into

ascorbic acid, while at low pH revealed good

correlation with sensitivity to air pollution and

with reduced photosynthetic activity in plants.

Higher pH allows greater tolerance of plants to

air pollution (Dhanam et al., 2014).

Photosynthetic activity was reported to be very

dependent upon the pH of the leaf (Yan-ju and

Hui, 2008) and photosynthesis is reduced in

plants with low leaf pH values (Turk and Wirth,

1975). In a study on the individuals from two

different sites it was found that plants stationed

in the industrial contaminated area had an acidic

pH value, while individuals in the control area

showed neutral to slightly basic pH (Rai et al.,

2013), which is in line with the results obtained

on P. major.

Content of photosynthetic pigments

Analysis of the content of photosynthetic

pigments included the determination of the

concentrations of chlorophyll a, chlorophyll b,

total chlorophyll content and carotenoids.

Analysis showed higher content of chlorophyll

a, chlorophyll b and carotenoids in individuals

sampled from the contaminated area (Table 1).

Chandawat et al. (2011) found that the

chlorophyll content of all plant species tested

varied in accordance with the level of pollution


62

in a given area, as well as in accordance with

species tolerance and sensitivity to air pollution.

Certain air pollutants reduce and others increase

the content of total chlorophyll in the plant

(Dhanam et al., 2014).

Tripathi and Gautam (2007) recorded large loss

of chlorophyll in the leaves of plants that have

been exposed to high levels of air pollution,

which once again points to the role of

chloroplasts in the plant and supports the

argument that the chloroplast is a primary place

of attack of air pollutants on the plant.

Ascorbic acid

The results (Table 1) show that the content of

ascorbic acid is higher in individuals from

contaminated sites (1.23 mg) compared to

individuals in the control area (0.7 mg).

Ascorbic acid plays an important role in the

synthesis of the cell wall in plants,

photosynthetic carbon fixation and the cell

division (Lakshmi et al., 2008). The increased

value of ascorbic acid content may be caused by

the defence mechanisms of the plant itself. The

results obtained by Dhanam et al. (2014) concur

with the research of Chandawat et al. (2011) and

Rai et al. (2013) who observed higher levels of

ascorbic acid in the leaves of the most tolerant

plants and those plants stationed near polluted

areas (Dhanam et al., 2014). Tripathi and

Gautam (2007) noted large variations in the

levels of ascorbic acid among all samples

regardless of the collection site.

Elevated levels of ascorbic acid in plants that

were located in the area with high levels of air

pollution can be caused by higher rate of

production of reactive oxygen species during

photooxidation (Tripathi and Gautam, 2007).

Elevated levels of ascorbic acid recorded in P.

major from Tetovo locality could be attributed

to plant defence mechanisms in conditions of

high air pollution.

Air Pollution Tolerance Index (APTI)

APTI is calculated on the basis of biochemical

parameters that were analysed in the study. All

these parameters play very important role in

determining the resistance and sensitivity of

plant species. In this study, APTI values of

plants from contaminated sites were higher

when compared to the control (Table 1). Air

pollution in urban and industrial areas can be

Tetovo

Smetovi

Fresh weight (g) 0.72 0.47

Turgid weight (g) 0.82 0.54

Dry weight (g) 0.12 0.08

RWC (%) 85.32 82.96

Chlorophyll a (mg/g) 0.85 0.67

Chlorophyll b (mg/g) 0.22 0.21

Total chlorophyll (mg/g) 1.08 0.88

Carotenoids (mg/g) 0.28 0.25

pH 5.81 6.08

Ascorbic acid (mg/g) 1.23 0.70

APTI 9.37 8.78

Table 1. Air Pollution Tolerance Index (APTI) of Plantago major on two sites in Zenica


63

adsorbed, absorbed, accumulated or integrated

into the plant, and the toxin can cause a variety

of injuries to the plants. The level of injury will

be high for sensitive and low for tolerant plant

species. Sensitive species are indicators of air

pollution while tolerant ones could be used for

reducing levels of air pollution (Subrahmanyum

et al., 1985). Species with APTI lower than 10

are characterized as sensitive to air pollution

and can be used for biomonitoring levels of air

pollutants (Agrawal et al., 1991). Tolerant plant

species accumulate pollutants, so planting

polluted areas with these plants has great

benefit. Based on the data given in Table 1., it is

evident that APTI values (9.37 at contaminated

site; 8,78 at control site) place P. major among

sensitive plant species that may be used as

appropriate indicators of air pollution for

studied area.

Conclusions

The results of four parameters studied within

APTI support the hypothesis that Plantago

major belongs to the species sensitive to air

pollution, which is consistent with the

classification of plants based on APTI (Singh

and Rao, 1983). Air pollution is one of the

greatest threats to the disruption of the

ecological state of the environment. Due to the

rise in industrialization, there is constant danger

of deforestation caused by air pollution. These

facts indicate the importance of determining Air

Pollution Tolerance Index (APTI) for different

plant species, as well as the use of obtained

results in future planning and the establishment

of control measures against air pollution.

References

Agarwal M (1985) Plants factors as indicators of

SO2 and O3 pollutants. Symp. on Bio-Monitoring

state environment. New Delhi. Proceedings 225-

231.

Agrawal M, Singh SK, Singh J, Rao DN (1991)

Biomonitoring of air pollution around urban and

industrial sites. J. Environ. Biol. 12:211-212.

Chandawat DK, Verma PU, Solanki HA (2011) Air

pollution tolerance index (APTI) of tree species at

cross roads of Ahmedabad city. Life Sci. Leaflets

20:935-943.

Dhanam S, Rajapandian P, Elazaraj B (2014) Air

Pollution Toleranceindeks and Biochemical

constituents of some plants growing in Neyveli

Lignite Corporation (NLC), Tamil Nadu, India.

JETT 2(4):171-175.

Escobedo FJ, Wagner JE, Nowak DJ (2008)

Analyzing the cost effectiveness of Santiago,

Chile’s policy of using urban forests to improve air

quality. J. Environ. Manage. 86:148-157.

Goletić Š (1992) Uticaj teških metala na populacije

nekih kulturnih i divljih biljnih vrsta na području

Zenice, Magistarski rad. Univerzitet u Sarajevu,

Prirodno-matematički fakultet.

Gostin IN (2009) Structural modification induced by

air pollutants in Plantago lanceolata leaves.

Analele Universităţii din Oradea, Fascicula

Biologie 16(1):61-65.

Hijano CF, Petit-Domínguez MD, García-Gimínez

R, Sínchez PH, Sancho-García I (2005) Higher

plants as bioindicators of sulphur dioxide

emissions in urban environments. Environ Monit

Assess 111(1-3):75-88.

Holm G (1954) Chlorophyll mutations in barley.

Acta Agric Scand 4:457-461.

Lakshmi PS, Sravanti KL, Srinivas N (2008) Air

pollution tolerance index of various plant species

growing in industrial areas. Departement of

Environmental Studies, G.I.T.A.M. University,

Visakhapatnam, 2(2):203-206.

Liu Y-J, Ding H (2008) Variation in air pollution

tolerance index of plants near a steel factory:

Implications for landscape-plant species selection

for industrial areas. WSEAS Trans.Environ.Dev.

4(1):24-32.

Porra RJ, Thompson WA, Kriedelman PE (1989)

Determination of accurate extraction and

simultaneously equation for assaying chlorophyll a

and b extracted with different solvents: verification

of the concentration of chlorophyll standards by

atomic absorption spectroscopy. Biochim Biophys

Acta 975:384-394.


64

Rai PK, Panda LLS, Chutia BM, Singh MM (2013)

Comparative assessment of Air Pollution

Toleranceindeks (APTI) in the industrial area

(Aizawl) of India: an ecomanagement approach.

Afr J Environ Sci Tech 7(10):944-948.

Singh SK, Rao DN (1983) Evaluation of plants for

their tolerance to air pollution. Proc.Symp.

OnAirPollution Control held at IIT, Delhi: 210-

214.

Subrahmanyam GV, Rao DN, Varshney CK, Biswas

DK (1985) Air pollution and Plants: A state of the

art report, Ministry of Environment and forests,

146-171.

Tahirović A, Čopra–Janićijević A, Bašić N, Klepo

L, Subašić M (2012) Determination of vitamin C

in flowers of some Bosnian Crataegus L. species.

Works of the Faculty of Forestry University of

Sarajevo 2:1-12.

Tiwari S, Bansal S, Rai S (1993) Expected

performance indices of some planted trees of

Bhopal. Indian J Environ Health 35:282-286.

Tripathi AK, Gautam M (2007) Biochemical

parameters of plants as indicators of air pollution. J

Environ Biol 28(1):127-132.

Turk R, Wirth V (1975) The pH dependence of SO2

damage to lichens. Oecologia 19: 285-291.

Yan-ju L, Hui D (2008) Variation in air pollution

tolerance indeks of plants near steel factory:

implications for landscape-plant species selection

for industrial areas. WSEAS Transactions Environ

Develop 4(1):24-32.


65

PREDICTION OF THE SIZE OF NANOPARTICLES AND MICROSPORE SURFACE

AREA USING ARTIFICIAL NEURAL NETWORK

Dženana Sarajlić1, Layla Abdel-Ilah2, Adnan Fojnica1*, Ahmed Osmanović2*

1 Graz University of Technology, Graz, Austria

2 International Burch University, Sarajevo, Bosnia and Herzegovina

Abstract

This paper presents development of Artificial Neural Network (ANN) for

prediction of the size of nanoparticles (NP) and microspore surface area

(MSA). Developed neural network architecture has the following three

inputs: the concentration of the biodegradable polymer in the organic phase,

surfactant concentration in the aqueous phase and the homogenizing

pressure. Two-layer feedforward network with a sigmoid transfer function

in the hidden layer and a linear transfer function in the output layer is

trained, using Levenberg-Marquardt training algorithm. For training of this

network, as well as for subsequent validation, 36 samples were used. From

36 samples which were used for subsequent validation in this ANN, 80.5%

of them had highest accuracy while 19.5% of output data had insignificant

differences comparing to experimental values.

Key words: artificial neural network, nanoparticles, polymeric

nanoparticles, prediction, microspore surface area

Introduction

A nanoparticle is the most fundamental

component in the fabrication of a nanostructure,

and is far smaller than the world of everyday

objects that are described by Newton’s laws of

motion, but bigger than an atom or a simple

molecule that are governed by quantum

mechanics (Estelrich, 2014). In general, the size

of a nanoparticle spans the range between 1 and

100 nm. Metallic nanoparticles have different

physical and chemical properties from bulk

metals (e.g., lower melting points, higher

specific surface areas, specific optical

properties, mechanical strengths, and specific

magnetizations), properties that might prove

attractive in various industrial applications.

However, how a nanoparticle is viewed and is

defined depends very much on the specific

application (Horikoshi and Serpone, 2013).

Polymeric nanoparticles (PNPs) are structures

with diameter ranging from 10 to 100 nm. The

PNPs are obtained from synthetic polymers,

* Correspondence

E-mail:

ahmed_osmanovic@h

otmail.com

adnanfojnica@hotmail

.com

Received

January, 2017

Accepted

May, 2017

Published

June, 2017

Copyright: ©2017

Genetics &

Applications, The


the Institute for

Genetic Engineering

and Biotechnology,


Research article


66

such as poly-caprolactone, polyacrylamide and

polyacrylate or natural polymers, e.g., albumin,

DNA, chitosan gelatin (Hosseini et al., 2016).

Based on in vivo behavior, PNPs may be

classified as biodegradable, i.e., poly (L-lactide)

(PLA), polyglycolide (PGA), and non-

biodegradable, e.g., polyurethane. PNPs are

usually coated with nonionic surfactants in

order to reduce immunological interactions

(e.g., opsonization or presentation PNPs to CD8

T-lymphocytes) as well as intermolecular

interactions between the surface chemical

groups of PNPs (e.g., van der Waals forces,

hydrophobic interaction or hydrogen bond-ing).

The application of biodegradable nanosystems

in the development of nanomedicines is one of

the most successful ideas (Wilczewska et al.,

2012). Nanocarriers composed of biodegradable

polymers undergo hydrolysis in the body,

producing biodegradable metabolite monomers,

such as lactic acid and glycolic acid (Pavot et

al., 2014). Drug-biodegradable

polymericnanocarrier conjugates used for drug

delivery are stable in blood, non-toxic, and non-

thrombogenic. They are also non-immunogenic

as well as non-proinflammatory, and they

neither activate neutrophils nor affect reticulo-

endothelial system (Babahosseini, 2015). A few

strategies can be employed for polymeric

nanoparticles preparation: solvent evaporation,

salting-out, dialysis, supercritical fluid

technology, micro-emulsion, mini-emulsion,

surfactant-free emulsion, and interfacial

polymerization (Rao and Geckeler, 2011).

According to Rizkalla and Hildgen (2005),

prediction of size of nanoparticles can be done

using either Artificial Neural Network, Genetic

alghoritm or Polynomial Regression Analysis.

Based on their work, different batches were

prepared by varying surfactant and polymer

concentration as well as homogenization

pressure. Two commercial ANN programs were

used: Neuroshell predictor, a black-box

software adopting both neural and genetic

strategies and Neurosolutions, allowing a step-

by-step building of the network. Results are

then compared with those obtained by statistical

method. It has been stated that Artificial Neural

Networks offer a successful tool for

nanoparticle preparation analysis and modeling.


Obtaining desired nanoparticle’s property,

determination of their size, affinity and other

important features is generally time, money and

effort consuming (Giokas et al., 2010). Also,

instruments used to carry out experiments are

not widely available in any institute or research

laboratories, so other more applicable tools are

preferred to obtain results of interest. Artifical

Neural Network (ANN) is one of those tools

that are able to select data, create a network and

evaluate its performance using mean square

error (MSE) and regression analysis.

The network learns based on adjusting the

interconnection weights between layers of

input-output relations. Once the training is

completed, ANN can predict outputs for new set

of data when only input values are introduced.

This describes the generalization ability of the

network. Based on this, ANN system seems to

be ideal for prediction of size and surface area

determination (Singaram, 2011).

Feedforward, back-propagation, commonly used

network in this type of research (Horikoshi and

Serpone, 2013) is used for neural network

training. The typical back-propagation network

has an input layer- which consists of network

inputs only. It is then followed by a hidden layer

which consists of number of neurons, or hidden

units which are placed in parallel. The network

output is also formed by weighted summation

that consists of outputs of the neurons in the

hidden layer. Formed layer is called output

layer. Usually number of output neurons equals


67

the number of outputs of the approximation

problem. In this case, linear activation function

for the output layer is used, since it is

commonly used in regression problems, where

powerful tool for predicting and interpreting

information is needed (Wilczewska et al., 2012).

Figure 1. ANN architecture

TRAINLM is a network training function that

updates weight and predicts values according to

Levenberg-Marquardt optimization. Levenberg-

Marquardt Algorithm (LMA) is commonly used

training algorithm in data classification, as well

algorithm that was used in previous experiment

(Rizkalla and Hildgen, 2005). It is often the

fastest backpropagation algorithm, although it

does require more memory than other

algorithms (Fojnica et al., 2016). Network

performance function that is used is Mean

Squared Error. It measures the network's

performance according to the mean of squared

errors. Mean Squared Error measures the

network's performance according to the mean of

squared errors. It is an average of the squares of

differences between the actual observations and

those predicted. The squaring of errors tends to

heavily weight statistical outliers, affecting the

accuracy of the results (Fojnica et al., 2016).

Input layer consisted of three network inputs

that are followed by a hidden layer containing

20 neurons. Output layer consists of one neuron

and output value parameter is the nanoparticle

size (Figure 1). The network has been tested

with different number of neurons in hidden

layer so that best results for nanoparticle size

could be observed. Thus, it was tested with 3, 7,

15, 20 and 31 neurons. Figure 1 illustrates ANN

architecture and shows that with three

parameters and 20 neurons in hidden layer ANN

was trained to give final output-size of

nanoparticles.

Input parameters to developed ANN were:

concentration of biodegradable polymer in the

organic phase, surfactant concentration in the

aqueous phase and the homogenizing pressure.

Output data was nanoparticle size which we

have compared to experimental results in the

research we were following (Figure 2). Absolute

error was used for comparing the results

obtained as outputs and NP size. Small absolute

error means higher performance.

Absolute Error=ǀtarget(NP size)-ANNǀ

Figure 2. Block diagram of ANN for nanoparticle

size

Data used from research paper (Hosseini et al.,

2016), consisted of 36 samples implemented for

training purposes. Also, they were used for the

subsequent validation in order to determine the

percentage of overlap with experimental data.


In this study, impact of number of neurons in

hidden layer, training functions as well as

dataset distribution during training and transfer

function on ANN output accuracy was

examined. Based on the ANN performance, the

optimal architecture was chosen for solving

problem of prediction of the size of

nanoparticles (NP) and microspore surface area

(MSA). Five different networks were developed

with different number of neurons in the hidden

layers: 3, 7, 15, 20, and 31. The performance of

networks (obtained from performance plot) was

compared. As a result, network with 20 neurons

achieved the best performance. Figure 3


68

represents performance plot of the network with

20 neurons in the hidden layer. It is evident that

the training line perfectly follow its course

however, validation and testing lines do not

follow the training line and they almost overlap.

Regardless, good results were obtained at the

end of the process.

Figure 3. Performance plot of ANN

36 samples were used as a validation data.

Absolute errors between outputs and targets

were calculated and compared for each network.

As a result, network with 20 neurons in the

hidden layer has the lowest error rate, which

means it has the best performance.

Table 1 (Appendix I) represents the results

obtained from the validation process in terms of

absolute error. It is clear that 22 out of 36

samples achieved 0% errors which is the best

performance to be achieved. Errors appeared in

14 out of 36 samples.

Conclusions

In this study, Artificial Neural Networks

(ANNs) were used to predict nanoparticle size

and microspore surface area of polylactic acid

nanoparticles, prepared by double emulsion

method. Different batches were prepared while

varying polymer and surfactant concentration,

as well as homogenization pressure. In similar

studies, researchers used two commercial ANNs

programs: Neuroshell® Predictor, a black-box

software adopting both neural and genetic

strategies, and Neurosolutions®, allowing a

step-by-step building of the network.

Since we did not have an opportunity to work

with such commercial ANN programs, an

ordinary ANN tool was used to predict

nanoparticle size and microspore surface area of

polylactic acid nanoparticles. So, in order to

develop a system for prediction of nanoparticle

size and microspore surface area, three variables

were used as inputs: the concentration of the

biodegradable polymer in the organic phase

(5%, 7.5% and 10% w/v of PLA), surfactant

concentration in the aqueous phase (0.1%,

0.5%, and 1% w/v of PVA) and the

homogenizing pressure (5000, 10000, 15000

and 20000 psi of HP). NP size experimental

data, in this case target data, were already given

in the table of default research paper (Hosseini

et al., 2016).

Neural network was trained with 36 samples

and validated with 36 samples each with three

different input variables. Training of Neural

Network was performed on few occasions by

using Matlab and its nnstart fitting tool. Every

time the number of hidden neurons was changed

and performances, regressions and Mean Square

Errors (MSE) were recorded. So, at first ANN

was trained with 3 and then with 7, 15, 20 and

31 neurons, until conclusion that the best results

were recorded using 20 neurons. Thus, by

selecting 20 neurons, the best possible

performance and regression were reached and

after inserting all samples in order to do

subsequent validation, 22 out of 36 samples

were obtained which completely match target

data and show 0% relative error.

At the end, a comparison between two

commercial ANN programs used in the research

was made and we made the following

conclusions:


69

1. Artificial neural networks offered successful

tool for nanoparticle preparation analysis and

modeling. Genetic algorithm represented fast

and reliable method to determine the relative

importance of inputs. Predictions from ANNs

were closer to experimental values than those

obtained using polynomial regression

analysis.

2. Results obtained using NeuroSolutions®

confirmed that a fexible, rather than a “black-

box” program, was more advantageous as it

would enable the free selection of different

network parameters in manner appropriate

for each problem. Also, pre-processing of the

training data has proved to play an important

role in modeling applications by neural

computing.

Considering all things, ANNs represent a

promising tool for the analysis of processes

involving preparation of polymeric carriers and

for prediction of their physical properties.

References

Babahosseini H (2015) Nanoparticle-Based Drug

Delivery and the Impacts on Cancer Cell

Biophysical Markers (Doctoral dissertation,

Virginia Polytechnic Institute and State

University).

Estelrich J (2014) Introductory Aspects of Soft

Nanoparticles. Cambridge: Royal Society of

Chemistry.

Fojnica A, Osmanović A, Badnjević A (2016)

Dynamical Model of Tuberculosis-Multiple Strain

Prediction based on Artificial Neural Network.

IEEE (MECO), 290-293.

Giokas DL, Vlessidis AG, Tsogas GZ, Evmiridis NP

(2010) Nanoparticle-assisted chemiluminescence

and its applications in analytical chemistry. TrAC

Trends in Analytical Chemistry, 29(10):1113-

1126.

Horikoshi S, Serpone N (2013) Microwaves in

nanoparticle synthesis: fundamentals and

applications. John Wiley & Sons.

Hosseini M, Haji-Fatahaliha M, Jadidi-Niaragh F,

Majidi J, Yousefi M (2016) The use of

nanoparticles as a promising therapeutic approach

in cancer immunotherapy. Artificial cells,

nanomedicine, and biotechnology, 44(4):1051-

1061.

Pavot V, Berthet M, Rességuier J, Legaz S, Handké

N, Gilbert SC, Verrier B (2014) Poly (lactic acid)

and poly (lactic-co-glycolic acid) particles as

versatile carrier platforms for vaccine delivery.

Nanomedicine, 9(17):2703-2718.

Rao JP, Geckeler KE (2011) Polymer nanoparticles:

preparation techniques and size-control

parameters. Progress in Polymer Science,

36(7):887-913.

Rizkalla N, Hildgen P (2005) Artificial neural

networks: Comparison of two programs for

modeling a process of nanoparticle preparation.

Drug development and industrial pharmacy,

31(10):1019-1033.

Singaram L (2011) ANN prediction models for

mechanical properties of az 61 mg alloy fabricated

by equal channel angular pressing. International

Journal of Research and Reviews in Applied

Sciences, 8(3).

Wilczewska AZ, Niemirowicz K, Markiewicz KH,

Car H (2012) Nanoparticles as drug delivery

systems. Pharmacological reports, 64(5):1020-

1037.


70

Appendix 1

Table 1. Comparison of experimental target data with output data


71

From the Annals

The first known publication on populational genetics of B&H population.

Himmel H. (1887): Das Soldatenmaterial der Herzegowina in Antropologischer Beziehung.

Mitteilungen der Anthropologischen Gesellschaft in Wien, Neue Folge VII. Band: 84-85.

Das Soldatenmaterial der Herzegowina in Antropologischer Beziehung

7. Herr Oberstabsartzt Dr. A. Weisbach bespricht die der Anthropologischen Geselshaft zur

Publikation überstandte Arbeit des Herrn Hauptmanns HEINRICH HIMMEL:

Herrn Hauptmann H. HIMMEL'S sehr Verdienstvolle Arbeit umfasst eine Tabelle justicieller

Daten, weiters einen lateinischen Bericht über die Katholiken der Herzegowina aus dem

Ordensschematismus der Franziskaner im Jahre 1882, ferner „Sanitäres aus der

Herzegowina“ von Regimentsarzt Dr. HERRMANN des 99. Infant.-Reg., worin der Autor die

schlechten hygienischen Verhältnisse schildert, unter welchen die Ein gebornen leben,

welche, daher sehr häuftig an Malaria, acuten Exanthemen, Syphilis und Verletzungen

erkranken; – weiter eine Schilderung der Jugend dieses Landes vom Lehrer EMIL WOSKA,

der dieselbe als folgsam, ehrerbietig, gelehrig, strebsam und intelligent bezeichnet; –

endlich eine Beschreibung des Soldatenmateriales und des Volkes überhaupt von HIMMEL

selbst, mit photographischen Aufnahmen von Katolischen, orthodoxen und

mohamedanischen Hezegowinern.

In seinem geschichtlichen Ueberblicke das graue Alterthum mit seinen fast ganz

unzuverlässigen Angaben über dieses Land nur kurz erwähnend, gibt er an, dass zu

Ende des 6. Jahrhunderts die wahrscheinlich mit vielen Slaven gemischten Avaren dahin

gekommen sind, gegen welche Kaiser Heraklius im Jahre 619 die chrobathen aus dem

Karpathenlande berief, welche sich im Küstengebiete zwischen der Arsa und Cettina

niederliessen, die Avaren vertreibend und theilweise auch in sich aufnehmend; so sollen

die heutigen Liccaner Ueberbleibsel der Avaren sein.

Im Jahre 626 hiess derselbe Kaiser die Serben südlich von den Kroaten sich

niederlassen: An der Narenta und auf den vorliegenden Inseln, im einwärts gelegenen

Berglande, im Gebiete von Ragusa und Cattaro bis Antivari hinab, sammt dem

Hinterlande.

So hätten diese Länder seitdem ihre ständige slavische Bevölkerung erhalten, freilich an

der Küste der Adria italienischen Einflüssen ausgesetzt, während im Innenlande zeitweise

auch magyarische Einwirkungen und schliesslich der osmanische Einfluss sich geltend

machten.

HIMMEL findet den Herzegovzen sehr religiös, treu und redlich, mit hohem Familiensinne

und vorzüglichen geistigen Eigenschaften ausgestattet, jedoch dabei misstrauisch; als

Soldat ist er sehr ausdauernd und genügsam, zurückhaltend und wehleidig.

Den für uns wichtigsten Theil dieser umfangreichen, interessanten Arbeit bilden die an

180 Soldaten im Alter von 20–35 Jahren vorgenommenen Messungen nach VIRCHOWS'S,

dem BROCA'schen ganz ähnlichen Systeme, welches 40 Maasse an jedem Individuum

nebst Angaben über die Farbe der Haare und Augen und das Körpergewicht verlangt.

Nur wer selbst Lebende gemessen, kennt die dazu nothwendige, ermüdende Mühe, wird

aber deshalb umsomehr eine solche Arbeit zu schätzen wissen.


72

Nach diesen Messungen erfreut sich der Hezegowiner bedeutenden Körperlänge von 1752

mm, womit er selbst seine westlichen Brüder, die Festlands-Dalmatiner (1708 mm

WEISBACH) übertrifft.

Demgemäss gehören die Herzegowiner zu den Völkern grössten Schlages in Europa; ja sie

überragen an Wuchs sämmtliche bisher hierauf untersuchten europäischen Völker.

Ihr Haupthaar ist, ganz ähnlich wie bei den Südslaven an den Gestaden der Adria, weit

vorherrschend dunkel (169 = 93,8 %), indem die blonden Haare (11 = 6,1 %) nur

verschwindend spärlich vertreten sind; eigenthümlicher Weise kam unter allen 180

Männern kein einziger rothhaariger vor. Das Dunkel der Haare beschränkt sich

vorzüglich auf die Farbentöne hellbraun (52 = 28,8 %) und dunkelbraun (87 = 48,3 %),

ohne die dunkelste Nuance, schwarz (30 = 16,6 %), mit einer ansehnlichen Zahl zu

erreichen.

In Übereinstimmung mit den gleichen anderweitigen Erfahrungen verhält sich die Farbe

der Augen anders, bei welchen wohl immer noch die dunklen Schattirungen (104 = 57,7

%), aber in bedeutend minderem Grade als bei den Haare, die lichten (76 = 42,2 %)

überwiegen, worin sie mit den Adrislaven genau übereinstimmen.

Die blauen Augen (36 = 20 %) und die grauen (40 = 22,2 %) treten viel häufiger auf als

die lichten Haare; die meisten Männer haben hellbraune (51 = 27,7 %) und dunkelbraune

(53 = 29,4 %), die allerwenigsten schwarze Augen (nur 1 = 0,5 %).

An Körpergewicht erreichen sie 70,7 Kilo, die Dalmatiner blos 69, gehören also mit diesen

zu den gewichtigsten Männern Europas.

Ihr Kopf ist 180 mm lang und 157 mm breit, also nach seinem Index von 872

ausgesprochen brachycephal bei dem geringen Umfange von 548 mm.

Die Höhe des Gesichtes beträgt 183 mm, dessen Breite zwischen den Jochbogen 144

mm, was einen Gesichtsindex von 786 ergibt.

Ihre Schultern sind ansehnlich breit (416 mm), der Brustkasten sehr geräumig (Umfang

901 mm) und die Arme 773 mm lang; der Oberarm (313 mm) ist ansehnlich länger als

der Vorderarm (267 mm), die Hand 193 mm lang und 88 mm breit (Index 455).

Die untern Gliedmassen sind viel länger (902 mm) als die oberen, relativ zur Körperlänge

(1000) deren Hälfte übersteigend (514), wogegen die Arme (441) unter der selben bleiben,

also kurz, di Beine aber lang genannt werden müssen.

Ihr Oberschenkel (393 mm) ist bedeutend kürzer als der Unterschenkel (444 mm) – ganz

im Gegensatze zum Baue des Ober- und Vorderarmes – der Fuss zehr lang (273 mm) bei

mässiger Breite (104 mm); sein Längenbreitenindex (380) ist wie immer kleiner als jener

der Hand.

Die zahlreichen Messungen sollen etwas später von mir bearbeitet und mit jenen anderer

Völker eingehend verglichen und in den Mitteilungen veröffentlich werden.


73

Instructions for Contributors Last updated October, 2016

The Genetics and Applications (G&A) is the official journal of the Institute for genetic

engineering and biotechnology, University of Sarajevo. It is envisaged as an international

journal issued twice a year in print format, publishing peer-reviewed articles of novel and

significant discoveries in the fields of basic and applied genetics. Special issues or

supplements may also be produced from time to time upon agreement with the Editorial

Board.

Topics covered within Genetics and Applications (G&A) include:

o molecular genetics,

o cytogenetics,

o plant genetics,

o animal genetics,

o human genetics,

o medical genetics,

o population and evolutionary genetics,

o conservation genetics,

o genomics and functional genomics,

o genetic engineering and biotechnology, and

o bioinformatics.

The main article types include original research, short communication, review and letter to

the editor. Authors are encouraged to submit complete, unpublished, original works that

are not under review in any other journals. Acceptable papers are those that gather and

disseminate fundamental knowledge in all areas of genetics.

Manuscripts should be prepared using a standard word processing programme, and

presented in a clear readable format with easily identified sections and headings.

Manuscript layout directions

• Typed with 1.5 line spacing (A4 format) with numbered pages;

• Font Times New Roman 12 should be used for the text, and Times New Roman 11 for

tables and references;

• The sections should typically be assembled in the following order: Title, Authors,

Authors' full affiliations including department and post/zip codes, Corresponding

author, Abstract, Keywords, Introduction, Material and methods, Results and

Discussion, Conclusions, Acknowledgements, Conflict Of Interest, References, Tables,

List of figure captions;

• Footnotes in the main text are to be avoided


74

Title

The title needs to be concise and informative. It should:

(i) arrest the attention of a potential reader scanning a journal or a list of titles;

(ii) provide sufficient information to allow the reader to judge the relevance of a paper to

his/her interests;

(iii) contain no more than 170 characters including spaces.

Authors and affiliations

The names and affiliations of the authors should be presented as follows:

Example

Mirjana Beribaka1*, Selma Hafizović2, Amela Pilav3, Mirela Džehverović3, Damir Marjanović2,4,5,

Jasmina Čakar3

1University of East Sarajevo, Faculty of Technology, Zvornik, Bosnia and Herzegovina 2University of Sarajevo, Faculty of Science, Sarajevo, Bosnia and Herzegovina 3Institute for Genetic Engineering and Biotechnology, Sarajevo, Bosnia and Herzegovina 4International Burch University (IBU), Sarajevo, Bosnia and Herzegovina 5Institute for Anthropological Research, Zagreb, Croatia *Correspondence: E-mail: [email protected]

Abstract (max 250 words)

The abstract should be complete and understandable with no references. It is important to

attract the attention of potential readers. The context and the rationale of the study are

presented succinctly to support the objectives. The experimental methods and main results

are summarised but should not be overburdened by numerical or probability values. The

abstract ends with a short and clear conclusion.

Keywords (3 to 5 words)

Keywords should be short and specific.

Introduction

The introduction briefly outlines the context of the work, presents the current issues that

the authors are addressing and the rationale to support the objectives, and clearly defines

the objectives. For hypothesis driven research, the hypothesis under test should be clearly

stated.

Material and methods

Material and methods should be described in sufficient detail so that it is possible for

others to repeat the experiment.


75


This should present only the author's own results and observations on the results, their

significance for the subject-matter in question, and a comparison with the results of other

authors in the same field.

Conclusions

Provide a brief overview of the subject of the research, the methodology applied, and the

results achieved with a brief commentary.

Acknowledgment

In this section, the authors may acknowledge (max two sentences) their support staff, their

funding sources (with research funder and/or grant number), their credits to companies or

copyrighted material, etc.

Conflict Of Interest

In this section authors should declare any conflict of interest

References

References should be cited in the text as follows:

"The procedure used has been described elsewhere (Green, 1978), "or "Our observations

are in agreement with those of Brown and Black (1979) and of White et al. (1980),"or with

multiple references, in chronological order: "Earlier reports (Brown and Black, 1979, 1981;

White et al., 1980; Smith, 1982, 1984).... ". In the list of references papers should be given in

alphabetical order according to the surname of the first author.

Journal article

Hodgkin AL, Huxley AF (1952a) The components of membrane conductance in the giant

axon of Loligo. J Physiol (Lond) 116:473-496.

Hodgkin AL, Huxley AF (1952b) The dual effect of membrane potential on sodium

conductance in the giant axon of Loligo. J Physiol (Lond) 116:497-506.

Book

Shibamoto T, Bjeldanes LF (1993) Introduction to food toxicology. Academic Press Inc, San

Diego.

Chapter in a book


76

Rodricks JV (2009) Food. In: Lippmann M. (ed) Environmental toxicants: Human

exposures and their health effects. John Wiley & Sons Inc, Hoboken, pp. 197-239.

Tables

Tables with title should be submitted within manuscript file after the Reference section.

Figures

Figures (including graphs) should be submited in jpg. format named by “Figure 1”. Figure

title for each figure should be listed in main document after Tables or References section. A

legend must be supplied for each illustration.

Editorial Board

SEEIC17 www.seeic.eu [email protected]

1st SouthEast European

Ichtyological Conference

2017

SEEIC 2017 provides an ideal opportunity for researchers from the Southeast

Europe or those who are interested in the region’s ichthyofauna to meet and

share their research findings, ideas and proposals.

Peer-reviewed full-text papers from the conference will be published in the

journals Acta Adriatica (marine ecosystems) and the Croatian Journal of

Fisheries (freshwater ecosystems).

We cordially invite you to save

the date and join us in Sarajevo

in September 2017

27-29 September

Sarajevo

Conference Invitation

The 1st Southeast European Ichthyological Conference (SEEIC) is organised and supported by

genetics & applications vol. 1, no. 1 · 2017-06-21 · university of sarajevo g vol. 1, no. 1...

Documents