Evidence of Evolution

Biogeography

The Age of Earth and Fossils

Ancient artiodactyl

Modern whale

Ancestors of Whales

Ambulocetus could both

swim in shallow water

and walk on land.

AmbulocetusRodhocetusPakicetus

Ancient

artiodactyl

Rodhocetus

probably spent

most of its time in

water.

Evolution of Whales

Basilosaurus

Dorudon

Mysticetes

Odontocetes

Modern

whales

Basilosaurus

only swims.

Modern whales have

ancient structures

Gaps in the Fossil Record

Homology

►What does the word Homologous mean?

►Homology is the study of similarity between organisms

►There are three major branches of homology: Anatomical Homology

Embryological Homology

Molecular Homology

Homologous Structures

Ancient lobed-finned fish

Frog Alligator Chicken Horse

Vestigial Structures

Evidence of Evolution►Analogous Structures: structures similar in

function, but not inherited from a common

ancestor.

►Same function, different structure

Development

Embryological Homology

► The diagram below shows embryos of five different species: pig, chicken, fish, turtle, and human. Can you tell which is which?

Figured it out yet?

How about now?

Did you guess correctly?

Embryological Homology

► Did you know that when you were inside your mother’s womb, for a while you looked almost exactly like a fish?

► Vertebrate embryos all share a similar pattern of development, suggesting that they may share common ancestry

Human – 31 days

Chicken – 2 ½ days

Pig – 21 days

Genetics and Molecular Biology

Molecular Homology

►All living things contain DNA and RNA.

►Changes in Proteins, DNA and RNA can be traced from ancestors to their descendents.

►The fewer Amino Acid differences between organisms, the closer their inferred evolutionary relationship.

Hemoglobin and Cytochrome C are a group of proteins that are commonly found in manydifferent organisms

Our ancient DNA

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG

►Codes for an RNA enzyme that plays a crucial role in protein synthesis

►Present in EVERY cell in the world (and some viruses…)

►Evolved in the common ancestor of ALL life

Our modern DNA…

►There are around 100 mutations in your genome that are NOT present in your mother or father

Testing Natural Selection

Platyspiza strips bark with a beak

designed to grip and hold tightly,

like a pair of pliers.

Certhidea picks insects off surfaces

with a straight, narrow beak, like

needle-nose pliers.

Pinaroloxias probes for insects, fruit,

and nectar with a curved beak, like

needle-nose pliers.

Geospiza breaks large, thick seeds with

a beak that is thick, strong, and sharp,

like heavy-duty wire cutters.

Bird Survival Based on Beak Size

Genes and Variation

Genotype and PhenotypeGenotype: particular combination of alleles

Phenotype: physical, physiological, and behavioral characteristics

Genetics and Evolutionary Theory

Natural selection acts on an organism’s characteristics, not on

its alleles.

Allele Frequency

Number of times an allele occurs in a gene pool, as a percentage

of the total occurrence of all alleles

In 50 alleles:

20 alleles are B (black)

30 alleles are b (brown)

In 100 alleles:

are B (black)

are b (brown)

40

60

Alleles in a PopulationEvolution involves any change in the frequency of alleles in a

population over time. In a population of 25 mice, how many mice

are in each genotype?

4

12

9

Genetic Variation

Three evolutionary mechanisms

that generate genetic variation:

• mutation

• genetic recombination

• lateral gene transfer

Possible chromosome

combinations is 2n.

In humans, n = 23.

223 = 8,388,608

Single-Gene Traits

Traits controlled by only one gene

With bands

Without bands

Single-Gene Traits

Phenotypic ratios are determined by the frequency of alleles and

by whether the alleles are dominant or recessive.

23%

77%

Polygenic Traits

Traits controlled by two or more genes

Polygenic Traits

Height in humans is an example of a polygenic trait.

Evolution as Genetic Change

in Populations

How Natural Selection Works

An

is any genetically controlled trait

that increases an individual’s

fitness.

evolutionary adaptation

Natural Selection on Single-Gene Traits

Natural selection on single-gene traits can produce changes in allele

frequencies that may be reflected by simple changes in phenotype

frequencies.

Natural Selection on Polygenic Traits

Natural selection on polygenic traits can produce three types of

selection:

• directional selection

• stabilizing selection

• disruptive selection

Directional Selection

Individuals at one end of the curve have higher fitness than

individuals in the middle or at the other end.

Stabilizing Selection

Individuals near the center of the curve have higher fitness than

individuals at either end.

Disruptive Selection

Phenotypes at the upper and lower ends of the curve have higher

fitness than individuals near the middle.

Genetic Drift

Genetic drift is a random change in allele frequency.

• Genetic bottlenecks

• The founder effect

Founding

populationsDescendants

Evolution Versus Genetic Equilibrium

If a population is not evolving, the

population is in genetic equilibrium.

• Sexual reproduction

• Hardy–Weinberg principle

If p = 0.40 and q = 0.60:

Probability of genotype aa:

If p = 0.40 and q = 0.60:

Probability of genotype Aa:

If p = 0.40 and q = 0.60:

Probability of genotype AA:

Hardy–Weinberg Principle

and

In words, this is stated:

(frequency of AA) + (frequency of Aa) + (frequency of aa) = 100%

and

(frequency of A) + (frequency of a) = 100%

16%36%48%

Hardy–Weinberg Principle

To maintain genetic equilibrium there must be:

• Random mating

• Large population size

• No immigration or emigration

• No mutations

• No natural selection

The H-W Principle predicts that:

If any of these conditions occur

it can disturb genetic equilibrium,

causing evolution.