ww.sciencedirect.com

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0

Available online at w

ScienceDirect

journal homepage: www.elsevier .com/locate /watres

Enhanced anaerobic digestion of waste activatedsludge digestion by the addition of zero valent iron

Yinghong Feng, Yaobin Zhang*, Xie Quan, Suo Chen

Key Laboratory of Industrial Ecology and Environmental Engineering, Ministry of Education, School of Environmental

Science and Technology, Dalian University of Technology, Dalian 116024, China

a r t i c l e i n f o

Article history:

Received 20 July 2013

Received in revised form

27 October 2013

Accepted 31 October 2013

Available online 12 November 2013

Keywords:

Waste activated sludge

Anaerobic digestion

Zero-valent iron

Methane production

Sludge reduction

* Corresponding author. Tel.: þ86 411 8470 6E-mail addresses: zhangyb@dlut.edu.cn,

0043-1354/$ e see front matter ª 2013 Elsevhttp://dx.doi.org/10.1016/j.watres.2013.10.072

a b s t r a c t

Anaerobic digestion is promising technology to recover energy from waste activated

sludge. However, the sludge digestion is limited by its low efficiency of hydrolysis

eacidification. Zero valent iron (ZVI) as a reducing material is expected to enhance

anaerobic process including the hydrolysiseacidification process. Considering that, ZVI

was added into an anaerobic sludge digestion system to accelerate the sludge digestion in

this study. The results indicated that ZVI effectively enhanced the decomposition of pro-

tein and cellulose, the two main components of the sludge. Compared to the control test

without ZVI, the degradation of protein increased 21.9% and the volatile fatty acids pro-

duction increased 37.3% with adding ZVI. More acetate and less propionate are found

during the hydrolysiseacidification with ZVI. The activities of several key enzymes in the

hydrolysis and acidification increased 0.6e1 time. ZVI made the methane production raise

43.5% and sludge reduction ratio increase 12.2 percent points. Fluorescence in situ hy-

bridization analysis showed that the abundances of hydrogen-consuming microorganisms

including homoacetogens and hydrogenotrophic methanogens with ZVI were higher than

the control, which reduced the H2 accumulation to create a beneficial condition for the

sludge digestion in thermodynamics.

ª 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Waste activated sludge (WAS) produced from municipal

wastewater treatment plant is a problem with growing

importance because of its huge production, potentially

environmental risk and high cost for disposal. Anaerobic

digestion is considered to be the most energy efficient

method for destroying and stabilizing waste sludge and

methane byproduct as a form of fuel may reduce treatment

cost (Wang et al., 2013). Three stages are involved in the

anaerobic digestion of sludge, e.g. (i) hydrolysis of biological

460; fax: þ86 411 8470 626yaobinzhang@163.com (Y

ier Ltd. All rights reserve

polymers with subsequent production of H2, acetate and

other VFAs, (ii) conversion of these VFAs to H2 and acetate

by syntrophic bacteria under a low hydrogen partial pres-

sure and (iii) conversion of acetate and H2 to methane (Lv

et al., 2010). Of them, hydrolysis is recognized as the rate-

limiting step in the anaerobic sludge digestion (Tiehm

et al., 2001; Bougrier et al., 2006). To accelerate the sludge

digestion, various pre-treatments have been used to

improve the hydrolysis of the sludge, including thermal

(Imbierowicz and Chacuk, 2012), chemical (Chiu et al., 1997;

Ibeid et al., 2013) and mechanical methods (Nah et al., 2000).

3.. Zhang).

d.

Table 1 e Characteristics of the raw sludge and alkaline-pretreated sludge.

Parameters Raw WAS Alkaline-pretreatedWAS

pH 7.16 � 0.1 7.06 � 0.1

TSS (total suspended

solids)

13.4 � 0.954 11.7 � 0.412

VSS (volatile suspended

solids)

8.57 � 0.104 6.54 � 0.142

TCOD (total chemical

oxygen demand)

12875 � 784 10829 � 697

SCOD (soluble chemical

oxygen demand)

634 � 75 4336 � 324

Total protein (as COD) 7725 � 575 6820 � 543

Total polysaccharide

(as COD)

1545 � 215 1332 � 148

Soluble protein

(as COD)

348 � 76 2454 � 286

Soluble polysaccharide

(as COD)

81 � 47 516 � 176

All values are expressed in mg/L except pH.

Average data and standard deviation obtained from three tests.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0 243

On the other hand, themicrobiology of anaerobic digestion

is complicated and each microbial stage has their optimal

functioning conditions. They are sensitive to and possibly

inhibited by operational parameters such as pH, hydrogen,

volatile fatty acids and others. H2, a byproduct during acidifi-

cation of organics, is considered as a thermodynamically un-

favorable intermediate during anaerobic methanogenesis

because it may impede the decomposition of organic acids

(Fukuzaki et al., 1990). For example, propionic acid and butyric

acid, twomain VFA forms in acidification, can be decomposed

into acetate only when pH2 is less than 10�4 for n-butyric acid

and 10�5 atm for propionic acid (Siriwongrungson et al., 2007).

However the partial pressure of hydrogen in practice usually

exceeds this range especially as the substrates are rich in

carbohydrate such as WAS (Hawkes et al., 2002). Until now,

very few publications are focused on accelerating the anaer-

obic digestion of sludge by reducing the accumulation of

hydrogen.

Zero-valent iron (ZVI), a reductive material, has been

widely applied in wastewater treatment, groundwater purifi-

cation and soil remediation (Jiang et al., 2011). ZVImay decline

the oxidation-reduction potential (ORP) when added into

anaerobic systems, enabling to create a more favorable envi-

ronment for anaerobic biological processes (Liu et al., 2012a). It

could significantly improve conversion of complex organics

into volatile fatty acids (VFAs) and methanogenesis. It was

found that propionate production dropped with addition of

ZVI because propionic-type fermentation did not prefer low

ORP (Alkaya and Demirer, 2011; Ren et al., 2007). Although the

effects of ZVI on anaerobic degradation of sucrose were pri-

marily investigated in our previous work, the functions of ZVI

in the anaerobic sludge digestion still remain unknown. As

mentioned above, the sludge digestion is different with the

digestion of simple organics in terms of the limiting step and

H2 production rate. In this study, ZVI was added into an

anaerobic digestion system for accelerating the sludge diges-

tion. To our best knowledge, it is the first time to enhance the

anaerobic digestion of sludge through adding ZVI. The effects

of ZVI on hydrolysiseacidification and methanogenesis of the

sludgewere investigated, with the aim to provide a simple and

effective method to accelerate the anaerobic digestion of

sludge.

2. Materials and methods

2.1. Sludge pretreatment

WAS used in this study was obtained from the secondary

sedimentation tank of municipal wastewater treatment

plant in Dalian, China. The sludge was concentrated by

settling at 24 h, and storage at 4 �C before use. To enhance

the hydrolysis, the sludge was pretreated using alkaline-

method before the anaerobic fermentation according to

the reference (Chu et al., 2009). The pH of sludge was

adjusted to 12 using 4 mol/L of sodium hydroxide, and then

the sludge was stirred at 80 rpm for 6 h. After pretreatment,

the pH of sludge was adjusted to 7 for anaerobic digestion.

The characteristics of raw sludge and alkaline-pretreated

sludge are compared in Table 1.

2.2. Operation

The seed sludge was collected from a UASB reactor in our

laboratory. The alkaline-pretreated sludge and seed sludge

was mixed with a ratio of 9:1 for the anaerobic digestion. To

investigate the effects of ZVI on hydrolysis and methano-

genesis, respectively, the experiments were divided into the

two stages. The first experiment was lasted only for 3 d to

explore the effect of ZVI on hydrolysiseacidification, and the

second experiment was conducted for 20 d to investigate the

effect on whole anaerobic digestion of sludge including

hydrolysiseacidification and methanogenesis.

2.2.1. Effects of ZVI dosage on hydrolysiseacidificationThe VFAs produced tended to be consumed by methanogens,

and then it was necessary to eliminate its interference in the

experiment of this first stage. Heat treatment and BESA (2-

bromoethanesulfonic acid) addition have been reported to

efficiently get rid of methanogens from anaerobic fermenta-

tion system (Oh et al., 2003; Basu et al., 2005). Therefore, in

the experiment of the first stage, the mixture sludge

including alkaline-pretreated sludge and seed sludge was

heated at 102 �C for 30 min. After the mixture was cooled

down to room temperature, BESA with a concentration of

50 mM was mixed in for use. 250 mL of the mixed sludge

above was added into four serum bottles with working vol-

ume of 250 mL, respectively. Afterwards, 0, 1, 4 and 20 g/L of

ZVI powder (diameter of 0.2 mm, BET surface area of 0.05 m2/

g, purity >98%) were added into the four bottles, respectively.

All bottles were capped with rubber stoppers and flushed

with nitrogen gas to remove oxygen before the anaerobic

digestion. The bottles were placed in an air-bath shaker

(120 rpm) at 35 � 1 �C for 72 h. During the digestion, the

biogas produced from each bottle was collected into gasbag

for analysis. After the digestion, the mixture was poured out,

and their supernatant and remainder sludge were analyzed,

respectively.

Initial 0 1 4 200

1000

2000

3000

4000

5000

Dosage of ZVI (g/L)

Unknow Protein Polysaccharide VFA

So

lu

ble

o

rg

an

ic

c

om

po

un

d (m

g C

OD

/L

)

Fig. 1 e Effects of ZVI on supernatant component after the

fermentation for 3 d.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0244

2.2.2. Effects of ZVI dosage on methanogenesisIn order to study the effect of ZVI on whole anaerobic process

including methanogenesis, another experiment was operated

under the same conditions as the hydrolysiseacidification

experiment in the first stage but without the heat treatment

and BESA addition. The digestion was lasted for 20 d to ensure

the complete anaerobic digestion. All the experiments were

conducted in triplicate.

2.3. Analytical methods

Sludge samples from the reactors were analyzed for total

suspended solid (TSS), volatile suspended solids (VSS), total

protein and total polysaccharide. Then the samples were

centrifuged at 8000 rpm for 10 min and immediately filtered

through a cellulose membrane with a pore size of 0.45 mm

for analysis of soluble COD (SCOD), soluble protein, soluble

polysaccharide and VFAs. TSS, VSS and SCOD were deter-

mined according to Standard Methods for the Examination

of Water and Wastewater (Association, 1994). Proteins were

measured with Lowry’s method using bovine serum albu-

min as a standard solution (Fr et al., 1995). Polysaccharide

was measured with phenol-sulfuric acid method using

glucose as a standard solution (Chaplin, 1994). The equiva-

lent relationships between COD and substrates were as

follows: 1.5 g-COD/g protein, 1.06 g-COD/g carbohydrate,

1.07 g-COD/g acetate, 1.51 g-COD/g propionate, 1.82 g-COD/g

butyrate, and 2.04 g-COD/g valerate (Lu et al., 2012). The ORP

was measured using an ORP combination glass-body redox

electrode (Sartorius PY-R01, Germany). Fe2þ was analyzed by

an adaptation of the ferrozine technique (Cooper et al.,

2000). The composition of the biogas was analyzed with a

gas chromatograph (Shimadzu, GC-14C/TCD, Japan) equip-

ped with a thermal conductivity detector (TCD). The volume

of biogas was calculated as the value at standard tempera-

ture and pressure (STP). The concentrations of VFAs,

including acetate, propionate, butyrate, were determined

using another GC (Shimadzu, GC-2010/FID, Japan) equipped

with a flame ionization detector (FID).

The activities of protease, cellulase, acetate kinase (AK),

phosphotransacetylase (PTA), butyrate kinase (BK) and

phosphotransbutyrylase (PTB) were assayed. The enzyme

was extracted according to the reported method (Zhao et al.,

2010). Specially, 25 mL of the mixture from the reactors was

washed and resuspended in 10 mL of 100 mM sodium

phosphate buffer (pH ¼ 7.4). The suspension was sonicated at

20 kHz and 4 �C for 30 min to break down the sludge and then

centrifuged at 10,000 rpm and 4 �C for 30 min to remove

debris. The extracts were kept cold on ice before they were

used for the enzyme activity assay. Protease activity was

determined according to Karadzic et al. (2004) with casein as

the substrate. Cellulose activity was assayed with the method

of Zhang and Lynd (2003) using cellulose as substrate. The

assays for PTA and PTB were based on the method of

Andersch et al. (1983) with acetyl-CoA and butyryl-CoA as

substrates, respectively. The AK and BK activities were

analyzed using the method of Allen et al. (1964) with potas-

sium acetate and sodium butyrate as the substrates,

respectively. The specific enzyme activity was defined as unit

of enzyme activity per milligram of VSS.

Fluorescence in situ hybridization (FISH) was used to

determine the abundance of homoacetogens and hydro-

genotrophic methanogens in the reactors. FISH was con-

ducted according to the method described by Wu et al. (2001).

Fluorescence labels of the oligonucleotide probes used in this

study included EUB338 (Bacteria, GCTGCCTCCCGTAGGAGT),

ARC915 (Archaebacteria, GTGCTCCCCCGCCAATTCCT), AW

(Acetobacterium sp. E. limosum, GGCTATTCCTTTCCATAGGG,

homoacetogens) and MB 1174 (Methanobacteriaceae, TACCGT

CGTCCACTCCTTCCTC, hydrogenotrophic methanogens)

(Zhang et al., 2010; Yanagita et al., 2000; Kusel et al., 1999;

Lettinga et al., 2001). After hybridization, the specimens

were stained with 4,6-diamidino-2-phenylindole (DAPI). The

samples were observed under a confocal laser scanning mi-

croscope (Leica SP2, Heidelberger, Germany). The FISH images

obtained were imported to Image-Pro Plus 6.0 for analysis of

the relative abundance of microorganisms.

3. Results and discussion

3.1. Effect of ZVI on the hydrolysis and acidification

3.1.1. Supernatant component and VFAs production after 3 dConverting particulate matters to soluble substrates is the

first step and is also the limiting step of the anaerobic

digestion of sludge, occurring in the process of hydro-

lysiseacidification. Microbial cell walls contain glycan cross

linked by peptide chains, causing resistance to biodegrada-

tion. During pretreatment, cell walls were ruptured and

extracellular polymeric substances were degraded, and then

release polysaccharide and protein as the main two com-

ponents (Jimenez et al., 2012). To investigate the effect of

ZVI on the hydrolysiseacidification of sludge, the dosages of

ZVI with 0, 1, 4 and e20 g/L were added into in the four

sludge digestion systems after removing methanogens,

respectively. The digestion was lasted for 3 d. The protein,

polysaccharide and VFAs including acetate, propionate,

butyrate and valerate in the supernatant were determined

after the fermentation for 3 d and the results are shown in

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0 245

Fig. 1. Acetate, propionate, butyrate and valerate were

summed as VFAs.

Protein contributed about 60% of soluble TCOD in the

sludge. From Fig. 1, with the increase of ZVI from 0 to 4 g/L, the

content of soluble protein decreased from 878.2 to 341.3 mg/L,

and the soluble polysaccharide declined from 144.7 to

124.9 mg/L. The unknown organics in the supernatant also

decreased obviously. Correspondingly, as the products of the

hydrolysiseacidification, the VFAs increased from 2055.8 to

2822.1 mg/L as increasing ZVI from 0 to 4 g/L. It indicated that

the VFA production at ZVI of 4 g/L was 37.3% higher than that

of no-ZVI dosage. When further increasing ZVI to 20 g/L, the

degradations of protein and polysaccharide and the produc-

tion of VFAs had insignificant change approaching to the test

at 4 g/L. The above results suggested that the ZVI could

effectively accelerate the hydrolysiseacidification of the

sludge.

3.1.2. Composition of VFAs in the supernatant after 3 dAfter the fermentation for 3 d, the VFA components under

different dosages of ZVI were detected and shown in Fig. 2.

The VFA produced mainly included acetate, propionate,

butyrate and valerate, and acetate was the prevailing product.

At the dosages of 0, 1, 4 and 20 g/L, the acetate concentration

was 759.2, 971.0, 1373.2 and 1303.1 mg/L and its percentage in

the total VFAswas 36.9%, 41.3%, 48.7% and 47.5%, respectively.

It indicated that ZVI could enhance the acetate production.

The result was in agreement with our previous report, in

which with the addition of ZVI the acetate production from

the anaerobic digestion of sucrose in solution increased 20%

(Liu et al., 2012b). Themaximal acetate production occurred at

ZVI of 4 g/L, 80.9% higher than that of no-ZVI dosage. It also

can be seen that the percentage of propionate decreased from

20.6% to 11.7%with the increase of ZVI from 0 to 4 g/L. It is well

known that acetic-type, propionic-type and butyric-type

fermentation are three major fermenting pathways in anaer-

obic digestion. The butyric-type fermentation converts

organic matters to butyric and acetic acids, and the propionic-

type fermentation mainly produces propionic acid, whereas

the acetic-type fermentation may directly decompose or-

ganics to acetate. Propionic-type fermentation is believed as a

0

200

400

600

800

1000

1200

1400

0 1 204Dosage of ZVI (g/L)

Acetate Propionate Butyrate Valerate

In

div

id

ua

lm

V

FA

(m

g C

OD

/L

)

Fig. 2 e Composition of VFAs after the fermentation for 3 d.

facultative anaerobic process occurring at an ORP higher than

�278mV, while acetic-type and butyric-type fermentation are

obligate anaerobic processes occurring at amore negative ORP

(Ren et al., 2007; Wang et al., 2006). ZVI as a reductive material

could create amore reductive atmosphere to enhance butyric-

type and acetic-type fermentation and to decline propionate

production. Meng et al. (2013) reported that propionate con-

version rate increased from 43e77% to 67e89% by ZVI addi-

tion. It might be one reason for the increase of acetate and

decrease of propionate, which might provide a favorable

substrate form for methanogenesis.

3.1.3. Total protein and polysaccharide in the remaindersludge and mass balance calculation after 3 dAs shown in Fig. 3, the sludge used in this experiment con-

tained 6820.5 mg-COD/L of protein and 1332.1 mg-COD/L of

polysaccharide, accounting for 63.0% and 12.3% of organic

matters in the sludge, respectively. At ZVI of 0, 1, 4 and 20 g/L,

after the fermentation for 3 d, the total protein was reduced to

5077.4, 4723.5, 4317.1 and 4330 mg/L, respectively, and the

total polysaccharide was reduced to 1028.6, 1008.6, 937.8 and

939.6 mg/L, respectively. It meant that the highest decompo-

sition ratio of protein and polysaccharide, happening at the

dosage of 4 g/L, was 36.7% and 29.6%, respectively. The

decomposition of these two complex organics at the dosage of

20 g/L approached to that of 4 g/L. Their decomposition with

no ZVI was slowest, only 25.6% for total protein and 22.9% for

polysaccharide. The results were in agreement with the pro-

duction of VFAs in the supernatant. It further suggested ZVI

accelerated the hydrolysiseacidification of sludge.

A mass balance based on COD was conducted after 3 d

fermentation (see Fig. S1A in Supplementary material). The

COD in the sludge anaerobic digestion included the COD from

solid organic matters, soluble hydrolysis products (hydroly-

sate) produced from the alkaline-pretreatment, VFA, methane

and others products. Before the fermentation, solid organic

matters and hydrolysate produced from the alkaline-

pretreatment were the prevalent component, accounting for

60.0% and 37.3% of total organics, respectively. After the

fermentation, the maximum ratio of solid sludge hydrolysis

(or solubilization) and VFA accumulation, achieving at 4 g/L of

Initial 0 1 4 200

1000

2000

3000

4000

5000

6000

7000

8000

Dosage of ZVI (g/L)

Co

nc

en

tra

tio

n (m

g C

OD

/L

)

Total protein• Total polysacchride•

Fig. 3 e Changes in total organic matters after 3 d.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0246

ZVI, was 14.49% and 23.31%, respectively. For no-ZVI dosage,

therewas only 9.05% for solid sludge hydrolysis and 16.23% for

VFA accumulation. This result was in agreement with the

conclusion that ZVI enhanced the hydrolysis and acidification

of sludge. Methane was detected, but only accounting for less

than 3% of total organics. Hydrogen productionwas decreased

from 3.70 mL/g-VSS to 2.04 mL/g-VSS with increasing the ZVI

dosage from 0 g/L to 20 g/L. Carbon dioxide was the major

component in the biogas (see Fig. S2 in Supplementary

material). Its production increased significantly from

26.3 mL/g-VSS with no ZVI to 34.2 mL/g-VSS with 4 g/L of ZVI,

but decreased to 27.8 mL/g-VSS at 20 g/L of ZVI.

3.2. Effect of ZVI on the full-scale digestion of sludge

3.2.1. Biogas production after 20 dTo investigate effects of ZVI on the whole anaerobic sludge

digestion, another experimentwas conductedwith no removal

of methanogenesis and the fermentation was lasted for 20 d.

The biogas production vs. fermentation time is recorded in

Fig. 4. From Fig. 4a, themethane production increasedwith the

increase of the ZVI dosage. At ZVI of 0, 1, 4 and 20 g/L, the

cumulative methane production after 20 d was 192.6, 211.1,

233.8 and 276.4mL/VSS, respectively. Themethane production

0

50

100

150

200

250

300

Cu

mu

la

tiv

e C

H4

(m

L/g

-V

SS

)

Fermentation time (d)

0 g/L 1 g/L 4 g/L 20 g/L

a. CH4 production

0

10

20

30

40

50

60

70

80

90

Fe

2+

c

on

ce

ntra

tio

n (m

g/L

)

Fermentation time (d)

1 g/L 4 g/L 20 g/L

b. Fe2+ concentration

8 1 0 12 14 1 6 1 8 2 0

0 5 1 0 15 2 0

0 2 4 6

Fig. 4 e Effect of ZVI on biogas production after 20 d (a) CH4 pro

partial pressure.

without dosing ZVI approached to references (Heo et al., 2003).

The methane production enhancing by ZVI in this study was

significantly higher than those produced by raw sludge of

150 mL/g-VSS (Ferrer et al., 2008) or alkaline-pretreated sludge

of 220 mL/g-VSS (Carrere et al., 2010). The methane produc-

tivity at the dosage of 20 g/L increased by 43.5% compared to

the no-ZVI dosage. Different with the highest performance of

hydrolysiseacidification at ZVI of 4 g/L, the highest production

of methane was obtained at ZVI of 20 g/L. The percentage of

methane in the biogas was also affected by ZVI dosage. The

methane concentration increased gradually from 58.5% to

61.4% with the increase of ZVI dosage from 0 g/L to 4 g/L, and

then increased significantly to 68.9% when further increasing

ZVI dosage to 20 g/L. It indicated that dosage of ZVI improved

the methane production in a wider extent. ZVI reportedly

enhanced the activity of methanogens (Dinh et al., 2004;

Daniels et al., 1987). Besides, ZVI could also increase the

methane production from the following two aspects. Firstly,

the enhanced generation of acetate in the presence of ZVI

provided a suitable substrate for methanogenesis. Generally,

organic acids could not be directly utilized by methanogens

until they were decomposed into acetate by syntrophic ace-

togenic bacteria (Karakashev et al., 2006; Yang and Okos, 1987).

Secondly, Fe could directly serve as an electron donor for

0 2 4 6 8 10 12 1 4 1 6 1 8 2 00

50

100

150

Cu

mu

la

tiv

e C

O2

(m

L/g

-V

SS

)

Fermentation time (d)

0 g/L 1 g/l 4 g/l 20 g/l

c. CO2 production

0 2 4 6 8 10 12 1 4 16 18 200

10

20

30

40

50

60

H2 p

artial p

ressu

re (P

a)

Fermentation time (d)

0 g/L 1 g/l 4 g/l 20 g/l

d. H 2 partial pressure

duction, (d) Fe2D concentration, (c) CO2 production, (d) H2

3.0

3.5

4.0

4.5

5.0

5.5a

VSS

rem

oval

ratio

VS

S (m

g/L

)

VSS

4 201020

25

30

35

40

45

Dosage of ZVI (g/L)

Removal ratio

20

30

40

50

60

70

80

Dosage of ZVI (g/L)

b

Re

mo

va

l ra

tio

(%

)

Total protein Total polysaccharide

0 2041

Fig. 5 e (a) Reduction of VSS after 20 d, (b) Reduction of

protein and polysaccharide after 20 d.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0 247

reducing CO2 into CH4 through autotrophic methanogenesis

based on the following reaction:

CO2þ4Fe0þ8Hþ ¼ CH4þ4Fe2þþ2H2O (1)

CO2þ4H2 ¼ CH4þ2H2O (2)

In the reaction (2), H2might be produced from the chemical

corrosion of Fe0 or/and from the hydrolysiseacidification.

From the Fe2þ release in Fig. 4b, after the digestion for 20 d,

Fe2þ in the supernatant was about 79.9 mg/L at ZVI of 20 g/L

and 43.1 mg/L at 4 g/L. Even if all of Fe2þ was produced from

the reaction (1), the production of CH4 from Fewas only 2.0mL

at 20 g/L and 1.1 mL at 4 g/L, whose contribution for the

methane production wasminor compared to the increment of

methanewith ZVI in Fig. 4a. In the other hand, the high dosage

of ZVI unnecessarily meant the great consumption. From the

Fe2þ released (79.9 mg/L), the ZVI dosage of 20 g/L could be

repeatedly utilized for 250 batch (20 � 1000/79.9) of the sludge

digestion if ignoring the loss of solid ZVI through effluent. For

20 g/L of ZVI, V (mL CH4/g Fe) ¼ DV (mL CH4/g VSS) � VSS (g/

L) � Available batch/ZVI dosage (g/L) ¼ (276.4e192.6)

� 6.54� 250/20¼ 6531 (mL/g-Fe). It meant that 1 kg of Fe could

increase 6531 L of methane production. Moreover, it could

reduce the remainder organics in the supernatant and sludge

at a considerable level, saving considerable operating costs in

the following treating processes.

From Fig. 4c, when increasing ZVI from 0 to 4 g/L, the CO2

production rose from 123.8 to 145.7 mL/VSS. It was because

CO2 was a byproduct from the hydrolysiseacidification

process of sludge. However the lower CO2 production at ZVI

of 20 g/L was observed. It was a result from the balance

between the accelerated CO2 production and the enhanced

CO2 utilization by hydrogen-utilizing microorganisms ac-

cording to the reaction (1) and (2). From Fig. 4d, with the

increase of ZVI, the H2 partial pressure in the biogas

decreased. It further confirmed that ZVI could enhance the

hydrogen-utilizing biological processes to decrease its con-

tent in the anaerobic system. Apart from autotrophic mi-

croorganisms, homoacetogens could also use CO2/H2 to

decrease their contents in the biogas based on the reaction

of 2CO2þ4H2 ¼ CH3COOHþ2H2O.

3.2.2. Sludge reduction after 20 dAnaerobic digestion can only partially decompose the organic

fraction due to the limitation of digestion time. Volatile solid

reduction is frequently used as a parameter to characterize the

performance of anaerobic sludge digestion (Arnaiz et al., 2006).

From Fig. 5a, the sludge reduction without dosing ZVI

approached to references (Lv et al., 2010). The content of vola-

tile solid (VSS) was 6.54mg/L before the digestion, and after the

digestion its contents decreased to 4.73, 4.33, 4.31 and 3.93 g/L at

the ZVI of 0, 1, 4, 20 g/L, respectively. It indicated that the sludge

reduction increased from 27.7% to 39.9% as increasing ZVI from

0 to 20 g/L. If considering the sludge reduction caused by alkali-

pretreatment (Table 1), the whole reduction ratio with 20 g/L

ZVI would be 54.1%, higher than many references, such as

ozone pretreatment (36% VSS reduction in 30 d), ultrasonic

pretreatment (38.9% VSS reduction in 25 d) and microwave

pretreatment (23.2%VSS reduction, 15 d) (Erden et al., 2010; Kim

et al., 2003; Park et al., 2004). After the digestion, the total pro-

tein and total polysaccharide in the sludge and supernatant

decreased correspondingly (Fig. 5b). As increasing ZVI from 0 to

20 g/L, the removal of total protein increased from 59.1% to

67.8%, and the removal of total polysaccharide increased from

32.3% to 43.4%. The enhanced sludge reduction not only

reduced the sludge amount but also decreased the residual

organics in the sludge and liquid. It would facilitate to save

operating costs in the following treating processes. A mass

balance calculation base on COD was conducted after 20d

fermentation (see Fig. S1B in Supplementary material). Solid

organicmatter andhydrolysatewas the twomajor components

before fermentation, and then decomposed and converted to

methane during the fermentation process. The percentage of

methane increased with the increasing of ZVI dosage, reaching

a maximum ratio of 41.4% with 20 g/L ZVI. Other unknown

component was accounting for less than 9%.

3.3. Specific activities of key enzymes relevant tohydrolysis and VFA production

Protease is responsible for the decomposition of proteins to

amino acids and cellulose is capable of catalyzing hydrolysis

of polysaccharide to monoses, respectively.

Table 2 e Specific activities of key enzymes.

ZVI dosage Protease Cellulase AK PTA BK PTB

0 3.99 � 0.03 0.133 � 0.02 1.56 � 0.03 0.124 � 0.001 0.090 � 0.003 0.007 � 0.04

1 4.95 � 0.03 0.165 � 0.02 1.87 � 0.04 0.164 � 0.001 0.106 � 0.004 0.008 � 0.03

4 7.39 � 0.04 0.246 � 0.03 2.61 � 0.05 0.202 � 0.02 0.137 � 0.005 0.011 � 0.05

20 7.66 � 0.04 0.255 � 0.02 2.86 � 0.05 0.225 � 0.01 0.142 � 0.003 0.011 � 0.04

The specific enzyme activity was defined as unit of enzyme activity per milligram of VSS.

The data are the averages from triple tests.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0248

The small-size organic matters are further converted to

VFAs with the function of acid-forming enzyme such as AK,

PTA, BK and PTB. Specifically, PTA and PTB can decompose

acetyl-CoA and butyryl-CoA to acetyl and butyryl phosphate,

respectively, and then are further converted to acetate and

butyrate with the function of AK and BK, respectively. As

shown in Table 2, the dosage of ZVI significantly improved the

activities of these key enzymes above. The activities of pro-

tease and cellulose at the dosage of 20 g/L increased 92.0% and

91.7%, respectively. It was a reason for the higher performance

in the hydrolysis of protease and cellulose with the presence

of ZVI. The activities of acid-forming enzymes including AK,

PTA, BK and PTB increased about 57%e83% at ZVI of 20 g/L. It

was in agreement with the accelerated decomposition of VFAs

and more acetate production during the acidification.

3.4. FISH analysis for hydrogen-consumingmicroorganisms

Acetogenesis of fatty acids may happen if hydrogen is not

accumulated but is consumed by hydrogen-consuming mi-

croorganisms (Appels et al., 2008). FISH was used to analyze

the major hydrogen-consuming microorganisms including

homoacetogens and hydrogenotrophic methanogens. The

abundance of homoacetogens in bacteria was 38.3% at ZVI of

20 g/L, while it was only 23.8% at no dosage of ZVI (see Fig. S3

in Supplementary material). The abundance of hydro-

genotrophic methanogens in archaea was 77.7% at 20 g/L

compared to 54.3% without ZVI. It further proved that ZVI

enhanced the growth of hydrogen-consuming microorgan-

isms, thereby improving the production of acetate or

methane.

3.5. Possibility of using scrap iron

The function of ZVI was assumedly depended on the surface

reaction of ZVI, i.e. Fe0þ2Hþ ¼ Fe2þþH2. Increase of the dosage

provided a bigger surface to releasemore Fe2þ. From this point

of view, the waste scrap iron widely existing in machinery

industriesmay be used as ZVI. A possible doubt of utilizing the

scrap iron is that the scrap has a small surface area. However,

the scrap iron usually with a size of about decimeter level

possibly had a better mass transfer in the high concentration

sludge under mixing condition. Comparatively, the powder

iron was easily immersed into sludge to slow down its func-

tion. The released Fe2þ at 20 g/L of dosage was only 80 mg/L

after 20 d, while Fe2þ reached 15.7 mg/L when the scrap iron

was used in anaerobic system with a HRT of 2 d in our previ-

ous study (Liu et al., 2012b). It suggested that mass transfer in

the surface of the scrap did not decrease but increase. More

importantly, the scrap iron ismore compatible for application.

Apart from its lower cost, the scrap is more convenient to be

recycled than the powder. The further investigation on the

scrap iron would be conducted in the next study. Neverthe-

less, the study provided a novel and useful method to accel-

erate the anaerobic sludge digestion and to enhance methane

production.

4. Conclusions

The anaerobic digestion of sludge was limited by the low

rate of hydrolysis and acidification. This study showed that

the anaerobic digestion of sludge was accelerated by the

addition of ZVI. The production of VFAs was enhanced by

37.3% with ZVI during the hydrolysis and acidification. After

the digestion for 20 d, the methane productivity at ZVI of

20 g/L increased by 43.5%, and the sludge reduction ratio

increased by 12.2 percent points. The reasons could be

ascribed to the following aspects. Firstly, the activities of

major enzymes related to hydrolysis and acidification were

enhanced after adding ZVI. It made the digestion better

catalyzed in the conversion of solid sludge and other com-

plex organics to VFAs. Secondly, ZVI could enhance the

growth of H2-utilizing microorganisms including homoace-

togens and hydrogenotrophic methanogens to consume H2

and then drive the anaerobic digestion.

Acknowledgments

The authors acknowledge the financial support from the Na-

tional Basic Research Program of China (21177015), the Na-

tional Crucial Research Project for Water Pollution Control of

China (2012ZX07202006), the New Century Excellent Talent

Program of theMinistry of Education of China (NCET-10-0289).

Appendix A. Supplementary data

Supplementary data related to this article can be found at

http://dx.doi.org/10.1016/j.watres.2013.10.072.

r e f e r e n c e s

Alkaya, E., Demirer, G.N., 2011. Anaerobic acidification of sugar-beet processing wastes: effect of operational parameters.Biomass and Bioenergy 35 (1), 32e39.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0 249

Allen, S., Kellermeyer, R., Stjernholm, R., Wood, H.G., 1964.Purification and properties of enzymes involved in thepropionic acid fermentation. J. Bacteriol. 87 (1), 171e187.

Andersch, W., Bahl, H., Gottschalk, G., 1983. Level of enzymesinvolved in acetate, butyrate, acetone and butanol formationby Clostridium acetobutylicum. Eur. J. Appl. Microbiol.Biotechnol. 18 (6), 327e332.

Appels, L., Baeyens, J., Degreve, J., Dewil, R., 2008. Principles andpotential of the anaerobic digestion of waste-activated sludge.Prog. Energy Combustion Sci. 34 (6), 755e781.

Arnaiz, C., Gutierrez, J., Lebrato, J., 2006. Biomass stabilization inthe anaerobic digestion of wastewater sludges. Bioresour.Technol. 97 (10), 1179e1184.

Association, A.P.H, 1994. Water Environment Federation (1998)Standard Methods for the Examination of Water andWastewater (Washington, DC).

Basu, S., Oleszkiewicz, J., Sparling, R., 2005. Effect of sulfidogenicand methanogenic inhibitors on reductive dehalogenation of2-chlorophenol. Environ. Technol. 26 (12), 1383e1392.

Bougrier, C., Albasi, C., Delgenes, J., Carrere, H., 2006. Effect ofultrasonic, thermal and ozone pre-treatments on wasteactivated sludge solubilisation and anaerobic biodegradability.Chem. Eng. Process. Process Intensification 45 (8), 711e718.

Carrere, H., Dumas, C., Battimelli, A., Batstone, D.J., Delgenes, J.P.,Steyer, J.P., Ferrer, I., 2010. Pretreatment methods to improvesludge anaerobic degradability: a review. J. Hazard. Mater. 183(1), 1e15.

Chaplin, M.F., 1994. Carbohydrate Analysis. Wiley Online Library.Chiu, Y.C., Chang, C.N., Lin, J.G., Huang, S.J., 1997. Alkaline and

ultrasonic pretreatment of sludge before anaerobic digestion.Water Sci. Technol. 36 (11), 155e162.

Chu, L., Yan, S., Xing, X.H., Sun, X., Jurcik, B., 2009. Progress andperspectives of sludge ozonation as a powerful pretreatmentmethod for minimization of excess sludge production. WaterRes. 43 (7), 1811e1822.

Cooper, D.C., Picardal, F., Rivera, J., Talbot, C., 2000. Zincimmobilization and magnetite formation via ferric oxidereduction by Shewanella putrefaciens 200. Environ. Sci.Technol. 34 (1), 100e106.

Daniels, L., Belay, N., Rajagopal, B.S., Weimer, P.J., 1987. Bacterialmethanogenesis and growth from CO2 with elemental iron asthe sole source of electrons. Science 237 (4814), 509e511.

Dinh, H.T., Kuever, J., Mußmann, M., Hassel, A.W., Stratmann, M.,Widdel, F., 2004. Iron corrosion by novel anaerobicmicroorganisms. Nature 427 (6977), 829e832.

Erden, G., Demir, O., Filibeli, A., 2010. Disintegration of biologicalsludge: effect of ozone oxidation and ultrasonic treatment onaerobic digestibility. Bioresour. Technol. 101 (21), 8093e8098.

Ferrer, I., Ponsa, S., Vazquez, F., Font, X., 2008. Increasing biogasproduction by thermal (70�C) sludge pre-treatment prior tothermophilic anaerobic digestion. Biochem. Eng. J. 42 (2),186e192.

Fr, B., Griebe, T., Nielsen, P., 1995. Enzymatic activity in theactivated-sludge floc matrix. Appl. Microbiol. Biotechnol. 43(4), 755e761.

Fukuzaki, S., Nishio, N., Shobayashi, M., Nagai, S., 1990. Inhibitionof the fermentation of propionate to methane by hydrogen,acetate, and propionate. Appl. Environ. Microbiol. 56 (3),719e723.

Hawkes, F., Dinsdale, R., Hawkes, D., Hussy, I., 2002. Sustainablefermentative hydrogen production: challenges for processoptimisation. Int. J. Hydrogen Energy 27 (11), 1339e1347.

Heo, N., Park, S., Lee, J., Kang, H., 2003. Solubilization of wasteactivated sludge by alkaline pretreatment and biochemicalmethane potential (BMP) tests for anaerobic co-digestion ofmunicipal organic waste. Water Sci. Technol. 48 (8), 211e219.

Ibeid, S., Elektorowicz, M., Oleszkiewicz, J., 2013. Modification ofactivated sludge properties caused by application of

continuous and intermittent current. Water Res. 47 (2),903e910.

Imbierowicz, M., Chacuk, A., 2012. Kinetic model of excessactivated sludge thermohydrolysis. Water Res. 46 (17),5747e5755.

Jiang, Z., Lv, L., Zhang, W., Du, Q., Pan, B., Yang, L., Zhang, Q.,2011. Nitrate reduction using nanosized zero-valent ironsupported by polystyrene resins: role of surface functionalgroups. Water Res. 45 (6), 2191e2198.

Jimenez, J., Vedrenne, F., Denis, C., Mottet, A., Deleris, S.,Steyer, J.-P., Cacho Rivero, J.A., 2012. A statistical comparisonof protein and carbohydrate characterisation methodologyapplied on sewage sludge samples. Water Res. 47 (5),1751e1762.

Karadzic, I., Masui, A., Fujiwara, N., 2004. Purification andcharacterization of a protease from Pseudomonas aeruginosagrown in cutting oil. J. Biosci. Bioeng. 98 (3), 145e152.

Karakashev, D., Batstone, D.J., Trably, E., Angelidaki, I., 2006.Acetate oxidation is the dominant methanogenic pathwayfrom acetate in the absence of Methanosaetaceae. Appl.Environ. Microbiol. 72 (7), 5138e5141.

Kim, J., Park, C., Kim, T.H., Lee, M., Kim, S., Kim, S.W., Lee, J., 2003.Effects of various pretreatments for enhanced anaerobicdigestion with waste activated sludge. J. Biosci. Bioeng. 95 (3),271e275.

Kusel, K., Pinkart, H.C., Drake, H.L., Devereux, R., 1999. Acetogenicand sulfate-reducing bacteria inhabiting the rhizoplane anddeep cortex cells of the sea grass Halodule wrightii. Appl.Environ. Microbiol. 65 (11), 5117e5123.

Lettinga, G., Rebac, S., Zeeman, G., 2001. Challenge ofpsychrophilic anaerobic wastewater treatment. Trends.Biotechnol. 19 (9), 363e370.

Liu, Y., Zhang, Y., Quan, X., Li, Y., Zhao, Z., Meng, X., Chen, S.,2012a. Optimization of anaerobic acidogenesis by adding Fe0powder to enhance anaerobic wastewater treatment. Chem.Eng. J. 192 (1), 179e185.

Liu, Y., Zhang,Y., Zhao, Z., Li, Y., Quan, X., Chen, S., 2012b. Enhancedazo dye wastewater treatment in a two-stage anaerobic systemwith Fe0 dosing. Bioresour. Technol. 121, 148e153.

Lu, L., Xing, D., Liu, B., Ren, N., 2012. Enhanced hydrogenproduction from waste activated sludge by cascade utilizationof organic matter in microbial electrolysis cells. Water Res. 46(4), 1015e1026.

Lv, W., Schanbacher, F.L., Yu, Z., 2010. Putting microbes to workin sequence: recent advances in temperature-phasedanaerobic digestion processes. Bioresour. Technol. 101 (24),9409e9414.

Meng, X., Zhang, Y., Li, Q., Quan, X., 2013. Adding Fe0 powder toenhance the anaerobic conversion of propionate to acetate.Biochem. Eng. J. 73 (15), 80e85.

Nah, I.W., Kang, Y.W., Hwang, K.-Y., Song, W.-K., 2000.Mechanical pretreatment of waste activated sludge foranaerobic digestion process. Water Res. 34 (8), 2362e2368.

Oh, S.-E., Van Ginkel, S., Logan, B.E., 2003. The relativeeffectiveness of pH control and heat treatment for enhancingbiohydrogen gas production. Environ. Sci. Technol. 37 (22),5186e5190.

Park, B., Ahn, J.H., Kim, J., Hwang, S., 2004. Use of microwavepretreatment for enhanced anaerobiosis of secondary sludge.Resour. Sludge: Forging New Front. 50 (9), 17e23.

Ren, N., Chua, H., Chan, S., Tsang, Y., Wang, Y., Sin, N., 2007.Assessing optimal fermentation type for bio-hydrogenproduction in continuous-flow acidogenic reactors. Bioresour.Technol. 98 (9), 1774e1780.

Siriwongrungson, V., Zeng, R.J., Angelidaki, I., 2007.Homoacetogenesis as the alternative pathway for H2 sinkduring thermophilic anaerobic degradation of butyrate undersuppressed methanogenesis. Water Res. 41 (18), 4204e4210.

wat e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2e2 5 0250

Tiehm, A., Nickel, K., Zellhorn, M., Neis, U., 2001. Ultrasonic wasteactivated sludge disintegration for improving anaerobicstabilization. Water Res. 35 (8), 2003e2009.

Wang,L.,Aziz,T.N., de losReyes III, F.L., 2013.Determining the limitsof anaerobic co-digestion of thickened waste activated sludgewith grease interceptor waste. Water Res. 47 (11), 3835e3844.

Wang, L., Zhou, Q., Li, F., 2006. Avoiding propionic acidaccumulation in the anaerobic process for biohydrogenproduction. Biomass and Bioenergy 30 (2), 177e182.

Wu, J.-H., Liu, W.-T., Tseng, I.-C., Cheng, S.-S., 2001.Characterization of microbial consortia in a terephthalate-degrading anaerobic granular sludge system. Microbiology 147(2), 373e382.

Yanagita, K., Kamagata, Y., Kawaharasaki, M., Suzuki, T.,Nakamura, Y., Minato, H., 2000. Phylogenetic analysis ofmethanogens in sheep rumen ecosystem and detection ofMethanomicrobium mobile by fluorescence in situhybridization. Biosci. Biotechnol. Biochem. 64 (8), 1737e1742.

Yang, S.-T., Okos, M., 1987. Kinetic study and mathematicalmodeling of methanogenesis of acetate using pure cultures ofmethanogens. Biotechnol. Bioeng. 30 (5), 661e667.

Zhang, P., Chen, Y., Zhou, Q., Zheng, X., Zhu, X., Zhao, Y., 2010.Understanding short-chain fatty acids accumulationenhanced in waste activated sludge alkaline fermentation:kinetics and microbiology. Environ. Sci. Technol. 44 (24),9343e9348.

Zhang, Y., Lynd, L.R., 2003. Quantification of cell and cellulasemass concentrations during anaerobic cellulose fermentation:development of an enzyme-linked immunosorbent assay-based method with application to Clostridium thermocellumbatch cultures. Anal. Chem. 75 (2), 219e227.

Zhao, Y., Chen, Y., Zhang, D., Zhu, X., 2010. Waste activatedsludge fermentation for hydrogen production enhanced byanaerobic process improvement and acetobacteria inhibition:the role of fermentation pH. Environ. Sci. Technol. 44 (9),3317e3323.