Planta (2007) 227:67–79

DOI 10.1007/s00425-007-0595-y

ORIGINAL ARTICLE

EVects of season-long high temperature growth conditions on sugar-to-starch metabolism in developing microspores of grain sorghum (Sorghum bicolor L. Moench)

Mukesh Jain · P. V. Vara Prasad · Kenneth J. Boote · Allen L. Hartwell Jr · Prem S. Chourey

Received: 22 June 2007 / Accepted: 17 July 2007 / Published online: 7 August 2007© Springer-Verlag 2007

Abstract High temperature stress-induced male sterilityis a critical problem in grain sorghum (Sorghum bicolor L.Moench) that signiWcantly compromises crop yields. Grainsorghum plants were grown season-long under ambient(30/20°C, day-time maximum/night-time minimum) andhigh temperature (36/26°C) conditions in sunlit Soil-Plant-Atmospheric-Research (SPAR) growth chambers. Wereport data on the eVects of high temperature on sugar lev-els and expression proWles of genes related to sugar-to-starch metabolism in microspore populations representedby pre- and post-meiotic “early” stages through post-mitotic “late” stages that show detectable levels of starchdeposition. Microspores from high temperature stress con-ditions showed starch-deWciency and considerably reducedgermination, translating into 27% loss in seed-set. SugarproWles showed signiWcant diVerences in hexose levels atboth “early” and “late” stages at the two temperature

regimes; and most notably, undetectable sucrose and »50%lower starch content in “late” microspores from heat-stressed plants. Northern blot, quantitative PCR, and immu-nolocalization data revealed a signiWcant reduction in thesteady-state transcript abundance of SbIncw1 gene andCWI proteins in both sporophytic as well as microgameto-phytic tissues under high temperature conditions. Northernblot analyses also indicated greatly altered temporal expres-sion proWles of various genes involved in sugar cleavageand utilization (SbIncw1, SbIvr2, Sh1, and Sus1), transport(Mha1 and MST1) and starch biosynthesis (Bt2, SU1,GBSS1, and UGPase) in heat-stressed plants. Collectively,these data suggest that impairment of CWI-mediatedsucrose hydrolysis and subsequent lack of sucrose biosyn-thesis may be the most upstream molecular dysfunctionsleading to altered carbohydrate metabolism and starch deW-ciency under elevated growth temperature conditions.

Keywords Cell wall invertase · Grain sorghum · Heat stress · Microsporogenesis · Pollen sterility · Starch biosynthesis

AbbreviationsADP-Glc Adenine 5�-diphosphate-glucoseAGPase ADP-pyrophosphorylaseBt2 Brittle 2CWI Cell wall invertaseDAS Days-after-sowingFrc FructoseGBSS1 Granule bound starch synthase-1Glc GlucoseINCW Cell wall invertase proteinMha1 Plasma membrane H+ATPase geneMST1 Monosaccharide transporter geneSbIncw1 Sorghum cell wall invertase gene

M. Jain · P. V. V. Prasad · K. J. Boote · P. S. ChoureyDepartment of Agronomy, University of Florida, Gainesville, FL 32611-0680, USA

P. S. Chourey (&)Department of Plant Pathology, University of Florida, Gainesville, FL 32611-0680, USAe-mail: pschourey@ifas.uX.edu

A. L. Hartwell Jr · P. S. ChoureyUS Department of Agriculture, Agricultural Research Service, Chemistry Research Unit, CMAVE, Gainesville, FL 32608-1069, USA

Present Address:P. V. V. PrasadAgronomy Department, Kansas State University, 2004 Throckmorton Hall, Manhattan, KS 66506-5501, USA

123

68 Planta (2007) 227:67–79

SbIvr2 Sorghum vacuolar invertase geneSh1 Shrunken 1SU1 Sugary 1Suc SucroseSus1 Sucrose synthase 1SuSy Sucrose synthaseUDP-Glc Uridine 5�-diphosphate-glucoseUGPase UDP-pyrophosphorylase gene

Introduction

Global climate changes, especially the increase in Earth’snear-surface temperatures (anticipated to increase by 1.8–5.8°C by end of this century; IPCC 2001) pose an imminentchallenge to crop production across the world. Plant repro-ductive stages are more sensitive to environmental stressthan the vegetative phase. Pollen development is one of themost heat-sensitive developmental stages in cereals (Stone2001; Abiko et al. 2005), vegetable crops (Peet et al. 1998;Aloni et al. 2001; Sato et al. 2002) and grain legumes (Pra-sad et al. 1999; Porch and Jahn 2001). In small-grain cere-als, stress-induced decline in crop yields is often attributedto pollen sterility (Boyer and Westgate 2004). The molecu-lar basis for the high sensitivity of developing pollen grainsto heat stress, on one hand, and pollen heat-tolerance, onthe other, is poorly understood.

Pollen development is initiated as the microspore mothercell yields a meiotic tetrad of haploid microspores that areheld together by callose walls, and are well-nourishedthrough the sporophytic cell layer, tapetum (McCormick2004). The young microspores become vacuolated aftertheir release from the tetrad and subsequent symplastic iso-lation from the mother plant. After a large centralized vacu-ole forms, the Wrst mitotic division produces a largevegetative cell and a generative cell, which further under-goes a second division to form two sperm cells. The pollenis shed after the second mitosis in a trinucleate stage inmany plants such as Arabidopsis, rice and maize (Raghavan1988; Tanaka 1997; Twell et al. 1998). The Wrst mitosis isregarded as a key developmental switch in male gameto-phyte formation and is marked by a decrease in vacuolesize, development of subcellular organelles, and extensionof the intine layer of the pollen wall (Raghavan 1988; Ari-izumi et al. 2004). Concurrently, the cytoplasm also under-goes several important metabolic changes, includingribosome biogenesis, lipid and protein biosynthesis (Nie-wiadomski et al. 2005), and most conspicuously, a rapidphase of starch biosynthesis leaving the cytoplasm heavily“engorged” with starch granules (Datta et al. 2001, 2002).The biochemical, physiological and molecular geneticaspects of sugar-to-starch metabolic transition are wellillustrated in the storage sink—the developing seed (James

et al. 2003); however, only limited information is availableon sugar unloading and subsequent uptake by youngmicrospores during microsporogenesis. Datta et al. (2001,2002) describe changes in temporal expression proWles fora number of metabolic and regulatory genes involved insugar-to-starch transition leading to starch deWciency andpollen sterility in cytoplasmic male sterile (CMS) lines ofsorghum and maize, respectively. Pollen-sterility in CMSlines of maize was associated with reduced sugar levelsthroughout microsporogenesis as well as reduced Xux ofsugars into starch biosynthesis.

Starch accumulated during the advanced stages of pol-len maturation is suggested to serve as a reserve source ofenergy for pollen tube germination and also provides ametabolic checkpoint of pollen maturity (Datta et al.2001, 2002; Pring and Tang 2004). Microspore develop-ment in maize ceases prematurely if starch levels remainlower than a certain threshold level as evident from sev-eral cytoplasmic male-sterile mutants where pollen non-viability is associated with starch-deWciency (Wen andChase 1999; Datta et al. 2002). Lee et al. (1980) showedcollapse of pollen structure during starch accumulationphase in a comparative ultrastructural study of the sterileand fertile pollen in S-type cytoplasmic male sterile (S-CMS) lines of maize. Stress-induced aberrant starch depo-sition proWles during microsporogenesis and reducedmale fertility has also been documented in rice (Sheoranand Saini 1996; Saini 1997), wheat (Saini et al. 1984;Dorion et al. 1996; Lalonde et al. 1997), barley (Sakataet al. 2000), tomato (Pressman et al. 2002, 2006; Satoet al. 2002) and bell peppers (Aloni et al. 2001; Karni andAloni 2002). Perturbed sugar utilization by developingmicrospores through targeted antisense repression ofanther-speciWc CWI gene in tobacco (Goetz et al. 2001)and SnRK1 in barley (Zhang et al. 2001) resulted in starchdeWcient and sterile pollen. Developing pollen grains ofthe Nicotiana sylvestris starch-less mutant NS458 exhib-ited increased sensitivity to high temperature stress andsigniWcant loss in pollen germination capacity, along withlow levels of starch accumulation (Firon and Pressman,personal communication). The biochemical signiWcanceof starch accumulation towards maintenance of high pol-len viability under heat stress conditions is not fullyunderstood. Kaplan et al. (2004) suggested an adaptiverole of carbohydrates as compatible solutes and signalingmolecules during development and stress tolerance.Increased sucrose levels following starch digestion 1–2 days prior to anthesis is believed to be associated withdesiccation tolerance in the developing pollen of Papaverdubium L. (Hoekstra and Roekel 1988). Likewise, thediVerential dehydration sensitivity of maize and Pennise-tum pollen was accredited to starch-derived sucrose con-tent (Hoekstra et al. 1989).

123

Planta (2007) 227:67–79 69

Sorghum (Sorghum bicolor L. Moench) is the Wfth mostimportant cereal crop worldwide (http://www.apps.fao.org/default.jsp), and its drought-hardiness makes sorghum animportant “failsafe” crop under arid and semi-arid condi-tions. Sorghum is an important C4 crop species that ispotentially more eYcient in carbon assimilation (at currentatmospheric CO2 concentrations) at high temperatures andin water-limited conditions as compared to C3 crops such asrice and wheat (Kresovich et al. 2005). In grain sorghum,the optimum mean temperature range for seed germinationis 21–35°C, and the optimum temperature ranges arebetween 26–34°C and 25–28°C for vegetative growth/development and reproductive maturity, respectively (Maiti1996). Adverse environmental conditions, such as cold(Wood et al. 2006) or high temperature stress (Prasad et al.2006a) have been shown to aVect male fertility and com-promise grain yield in sorghum. The following researchwas undertaken in order to determine the threshold levels ofchronic (season-long) and acute (short-term, coincidentwith microsporogenesis) high temperature stress treatmentsthat aVect pollen fertility and seed-set in grain sorghum.The speciWc objectives were to obtain a detailed temporaltranscript proWling of sugar-to-starch metabolic transitionin developing microspores of sorghum grown under ambi-ent or season-long elevated growth temperature regimes,and to deWne committed metabolic check-points (if any)that regulate the utilization of sugar into starch biosynthesisand establish microspore sink strength. Genes involved insucrose cleavage and utilization (SbIncw1, SbIvr2, Sh1,Sus1), microspore unloading from enriched locular Xuid(Mha1, MST1), and starch biosynthesis (Bt2, SU1, GBSS1,UGPase) were chosen based on the previously publishedevidence correlating gene expression data, starch deWciencyand male-sterility in maize and sorghum microspores(Datta et al. 2001, 2002).

Materials and methods

Plant growth, SPAR chambers and temperature treatments

Semi-dwarf and photoperiod-insensitive sorghum cv.DeKalb 28E was used for all experiments. Sowing, irriga-tion and fertilizer schedules were as described (Prasad et al.2006a). Experiments were conducted in eight sunlit Soil-Plant-Atmospheric-Research (SPAR) growth chambers(Pickering et al. 1994), with a stand density of 20 plants perm2. Air and dew point temperature (10°C below targetmean dry bulb air temperature) were typically controlled asa sinusoidal wave function during the day and a logarithmicdecay during the night. These environments providednearly constant relative humidity (55–58%) at 1500 hoursin all treatments. Daytime CO2 concentration was measured

continuously for each chamber using infrared gas analyzers(Model Ultramat 21P, Siemens, New York, NY, USA) andcontrolled at ambient set point (350 ppm) by injecting pureCO2 from a high pressure cylinder through a mass Xowcontroller (Model 5850i, Brooks Instruments, HatWeld, PA,USA). The data presented in the following research wasobtained from two sorghum experiments conducted in sum-mer 2005 and 2006.

Photosynthesis measurements

Individual attached leaf gas exchange measurements weremade during mid-day at respective growth temperatureconditions at the time of panicle emergence (35–40 DAS)using a LI-COR 6400 portable photosynthesis system (LI-COR, Lincoln, NE, USA). The growth chamber conditionswere simulated in the leaf chamber through an integratedPeltier temperature controller and CO2 injection system.Measurements were conducted on three topmost fullyexpanded leaves from three diVerent plants on a clear sunnyday. The internal light source (6400-02B red/blue) in theLI-COR 6400 was set at 1,800 �mol m¡2s¡1 to have con-stant and uniform light across all measurements.

Pollen viability and seed set measurements

In vitro pollen germination was carried out as described byTunistra and Wedel (2000) using a slightly modiWed germi-nation medium containing 150 mg H3BO3, 500 mgCa(NO3)2·4H2O, 200 mg MgSO4·7H2O, 100 mg KNO3,300 g sucrose and 15 gL¡1 agar. Pollen was collected priorto anthesis (between 0730 and 0800 hours) and dispersedon slides pre-warmed at 28°C for 30 min, incubated underdarkness for 45 min and monitored under microscope. Thepollen was scored as germinated if the length of the pollentube was greater than the diameter of the pollen grain. Pol-len viability was also tested using 2% tri-phenyl tetrazo-lium chloride stain that stains the live pollen reddish purpledue to the formation of insoluble red formazan. At matu-rity, the numbers of Wlled and unWlled seeds were countedon the tagged panicles. Seed-set was estimated as the ratioof Xorets with seed to the total number of Xorets, andexpressed as a percentage.

Preparation of microspores/young pollen

Panicles were harvested for microspore isolation asdescribed by Pring and Tang (2004). The pre-emergentpanicles were collected following appearance of the panicletip out of the Xag leaf sheath. At this stage, the microga-metophytes were approximately 7–11 days prior to anthe-sis, and included young early-mid microspores (pre- to postmeiotic) at the base of the panicle (referred to as stage D)

123

70 Planta (2007) 227:67–79

developmentally progressing through post-mitotic youngpollen (referred to as stage A) near the tip of the panicle.Complete Xorets including the glumes (at stages D throughA of microsporogenesis) were plucked free from paniclebranches and used for RNA extraction.

Northern blot analyses and real-time quantitative PCR

Total RNA was extracted in Trizol Reagent following themanufacture’s protocol. RNA was glyoxalated andresolved on a 1.2% (w/v) agarose gel, followed by transferto Nytran membranes (Schleicher & Schull, Keene, NH)and UV cross-linking. Probes were prepared from the full-length/partial cDNA clones and labeled using the randompriming method (Prime-It® RmT Random Primer LabelingKit, Stratagene, LaJolla, CA). Pre-hybridization, hybrid-ization and washing conditions were same as describedpreviously (Datta et al. 2001, 2002). The blots wereexposed to X-ray Wlm, in between two intensifyingscreens, for 1–4 days depending on the transcript abun-dance. Transcript size was estimated based on the positionof the rRNA species visualized in the ethidium bromide-stained gel prior to blotting.

Five �g total RNA was reverse transcribed using theSuperScript™ First-Strand Synthesis System (Invitrogen,Carlsbad, CA) according to the manufacturer’s protocol.Real-time quantitative PCR was performed using theDyNAmo™ HS SYBR® Green qPCR Kit (Finnzymes,Espoo, Finland) and Chromo 4™ CFD supported by Opti-con Monitor™ Software version 2.03 (MJ Research, Ala-meda, CA). The PCR reactions were prepared according to

the manufacturer’s instructions and contained 400 nM ofboth the forward and reverse gene-speciWc primers and 2 �lof the Wvefold diluted RT reaction in a Wnal volume of20 �l. The thermal cycling protocol entailed 50°C incuba-tion for 2 min, followed by Tbr DNA polymerase activationat 95°C for 15 min. The PCR ampliWcation was carried outfor 35 cycles with denaturation at 94°C for 10 s, and primerannealing and extension at 55 and 72°C for 30 s each,respectively. Optical data were acquired following theextension step, and the PCR reactions were subject to melt-ing curve analysis beginning at 55°C through 95°C, at0.1°C s¡1. The data are presented as average §SD of threeindependently made RT preparations used for PCR run,each having three replicates.

Gene speciWc primers used for PCR cloning, real-timePCR analyses and cDNA probes are listed in Table 1. TheampliWcation products were cloned in pCR®2.1 vectorusing the TA Cloning® kit (Invitrogen, Carlsbad, CA), andsequenced to verify the Wdelity of the PCR ampliWcation.

Sugar assays

Microspore samples were homogenized and the solublesugars extracted in hot ethanol to separate soluble sugarsfrom starch. After centrifugation, the supernatant was usedfor glucose, sucrose and fructose analyses, in a microtiterplate assay as described (Datta et al. 2002). Starch contentwas determined in the pellet fraction following amyloglu-cosidase digestion (EC 3.2.13, from Aspergillus niger,Roche Diagnostics, Indianapolis, IN), and quantiWcation ofreleased glucose moieties.

Table 1 Primers used for cDNA cloning and real-time quantitative PCR for genes investigated in the present study

a Primers used for RT-PCR cloning of SbIncw1 genes from 6- to 12 DAP sorghum seedb Primers used for real-time quantitative PCRc Primers used for making cDNA probes from 12 to 16 DAP maize endospermd The soluble invertase (SbIvr2) and �-tubulin 1 (SbTua1) cDNA clones were ampliWed from immature sorghum microspore RNA

NA Not available

(UGPase cDNA was kindly provided by J R Sovokinos, University of Minnesota)

Gene GenBank Acc. # Forward primer (seq. 5�!3�) Reverse primer (seq. 5�!3�)

SbIncw1a EF177465 TGTACTACAAGGGGTGGTACCA TCAAGCTCCATTCATGAGTGGCTTCTTCAT

SbIncw1b EF177465 GCAAAGTCGGTCACTCTCAGGAA AAATCCTGCAAATGTCGGGCG

SbIvr2d NA CTCACCAACTGGACCAAGTACGA CCATGTAGTCGTGGTTGTATGACG

Sh1c X02400 ACTACAAGGGCACGACGATGATGT TTCCCGCGATTTCTTGGAATGTGC

Sus1c L29418 TTCCTCAACAGGCACCTGTCATCA TCCAGGTACGGCCAGACTTCAAAT

Mha1c U09989 ATCCAACACAGGGCTTACCGATCA TTCAGAGCTGGAGCGTCGTTTACA

MST1c AY683004 AAATCAGTCCGTGCCTGTGTACCT ATGAGGGAGGCGTCGTTCTTGAAT

Bt2c AF334959 TCAAGAGCCTACGGGAGCAACATT GCATTTCCTTTGCCCTCACGTCAT

GBSS1c AF079261 AGGGACAAGTACATCGCCGTGAA TCATGCAGTTCCTCACCATCTCCT

SU1c AF030882 ACATGCTTGCACCTAAGGGAGAGT ATGACCGTGCCATTTCAACCGTTC

SbTua1d NA CCTGAGGTTCGATGGTGCTCT CCATCATCACCTTCCTCACCC

123

Planta (2007) 227:67–79 71

Immunolocalization of cell wall invertase

Florets from pre-emergent panicles were harvested andimmediately Wxed in cold formalin acetic alcohol (FAA;3.7% formaldehyde, 5% acetic acid and 50% ethanol) for24 h, followed by dehydration in a series of ethanol and ter-tiary butyl alcohol (TBA), inWltration and embedding inParaplast Plus paraYn (Sherwood Medical Co., St Louis,MO). ParaYn embedded Xorets were sectioned with arotary microtome (Microm 325, Carl Zeiss, Germany).Polyclonal antibodies of maize CWI (Shanker et al. 1995)were used for immunodetection of INCW, and the immuno-gold signal was visualized using the ZYMED kit (ZymedLaboratories Inc, San Francisco, CA).

Results

EVects of high temperature conditions on the growth of grain sorghum

Grain sorghum plants were grown at sinusoidal day-timemaximum/night-time minimum temperature regimes of30/20°C (ambient), 36/26°C (high), 40/30°C and 44/34°C(extremely high) in naturally sun-lit, controlled environ-mental growth chambers equipped with real-time controlof relative humidity (55–58% at 1500 hours) and day-timeambient CO2 set point (350 ppm). Panicle emergenceoccurred at 35–40 days-after-sowing (DAS) at 30/20 and36/26°C treatments. Panicle emergence was delayed to 60DAS and occurred in only 10–12% of plants grown at 40/30°C. Despite a vigorous and highly robust vegetativegrowth, the Xoral transition was completely arrested at 44/34°C. Anthesis occurred within a 4–5 day period after pan-icle emergence at both 30/20 and 36/26°C temperaturetreatments. The eVects of season-long exposure to highgrowth temperature (36/26°C) conditions imposed fromseedling emergence to maturity on leaf photosynthesis,pollen germination, seed-set and grain yield, dry matterproduction are documented in Figs. 1, 2. Data on leaf pho-tosynthesis, percent seed set, and dry matter productionwere collected at 60 DAS and showed no signiWcantadverse eVects of high temperature on leaf photosynthesisrates, leaf area, leaf dry weight and total plant dry weightaccumulation. The highest two temperatures treatments(40/30 and 44/34°C) failed to produce grain, and will notbe further discussed here (see Prasad et al. 2006a). Expo-sure to season-long moderate high temperature stress (36/26°C) resulted in 27% loss in grain yield, and was corre-lated with signiWcantly reduced germination potentialscored in vitro (Fig. 1). Even though the microspores thatwere collected at both temperature treatments stained via-ble with tri-phenyl tetrazolium chloride (data not shown),

remained turgid and exhibited normal diameter, themicrospores at ambient growth temperature were starch-packed whereas the ones at 36/26 °C were deWcient instarch (Fig. 2a, b, respectively). Short-term exposure tohigh temperature at the time of panicle initiation (i.e. 10 or5 days prior to emergence) resulted in localized sectors ofXoral necrosis causing signiWcant decrease in paniclelength (20–9.2%), diameter (37–27%) and dry weight (52–45%), and 40–35% loss in seed-set (Fig. 2e, g). However,100-unit-seed weight (or seed size) was not signiWcantlyaVected by either chronic or short-term high temperaturestress, and averaged 2.74 § 0.43 g at 30/20°C,2.71 § 0.21 g at 36/26°C (chronic), and 2.54 § 0.25 g and2.53 § 0.23 g at 36/26°C (imposed at either 10 or 5 daysprior to emergence), respectively. Notably, decreasedyield at chronic high temperature treatment could beattributed to failed fertilization (as evident by reduced pol-len germination and high number of unWlled Xoral sites,Figs. 1, 2d, f), whereas the panicles exposed to short-termhigh temperature stress prior to emergence also suVeredloss of Xoral primordia in addition to failed seed set(Fig. 2e, g). Even though the reduced grain yields and har-vest index can be ascribed to high temperature stress-induced detrimental eVects on pollen quality and reducedpollen germination, decreased pollen production (notdetermined in the present study) and role of stigma recep-tivity can not be ruled out. Prasad et al. (2006b) haveshown that high temperature reduces pollen production aswell as pollen reception by stigma thus lowering spikeletfertility and grain Wlling in rice. Reduced pollen produc-tion and lower viability at high growth temperature can berelated to aberrant tapetum development (Suzuki et al.2001), carbohydrate metabolism (Karni and Aloni 2002;Pressman et al. 2002) and anther indehiscence (Porch andJahn 2001).

Fig. 1 EVects of ambient (30/20°C) and season-long high (36/26°C)temperature growth conditions on various growth traits as shown. Theyield data were collected at 60 days-after-sowing for six randomlytagged plants from two independent experiments, and representaverage § SD

Total d

ry w

eight

Seed

-set (

%)

Polle

n

germ

inatio

n (%

)Ph

otosy

nthes

is

(µmol

m-2 s-

1 )

Leaf d

ry w

eight

(g pl

ant-1

)(g

plan

t-1)

Leaf a

rea

(cm2 pl

ant-1

)

30/20 °C 36/26 °C

0

20

40

60

80

100

0

200

400

600

800

1000

1200

1400

123

72 Planta (2007) 227:67–79

EVect of growth temperature on carbohydrate proWles during microspore maturation

In sorghum, microsporogenesis and starch deposition pro-Wles are highly synchronized and proceed in a basipetalmanner. For all experimental purposes, pre-emergent pani-cles (approximately 7–11 days prior to anthesis) were sec-tioned as detailed in Fig. 2. The microgametophytes at thebase of the panicle included young early-mid microspores(pre- to post-meiotic) (stage D) whereas microgameto-phytes towards the tip of the panicle (stage A) had pro-gressed through Wrst mitotic division and stained positivefor starch content. To better understand the eVect of highgrowth temperature on starch biosynthesis in developingmicrospores, the relative levels of soluble sugars Glc, Frcand Suc, and starch were determined in pre- and post-mei-otic (stage D, approximately 11 days before anthesis) andpost-mitotic (stage A, approximately 7 days before anthe-sis) microspores (Fig. 3). Even though the levels of totalsoluble sugars at the two developmental stages were notsigniWcantly diVerent between either temperature treat-ments (visually indicated by normal turgor and diameter),the individual proWles of reducing and non-reducing sugarsshowed notable diVerences. Remarkably, Suc was belowthe detection limit in stage D at both temperature treat-ments, and Frc represented nearly the total pool of non-reducing sugars (Fig. 3a). In stage A microspores, sucrosewas present only under ambient growth temperature condi-tions (Fig. 3b). Hence total soluble sugars were representedby Glc, Frc and Suc at 30/20°C, and only by Glc and Frc at

36/26°C, with Glc levels being moderately higher than Frcin all the respective microspore populations. At stage D,starch was below the detection limit at both the growth tem-peratures, but was reduced by about 50% in microspores at

Fig. 2 a, b Pollen starch and c, g seed set at ambient (30/20°C) and high (36/26°C) temperature growth conditions. I2/KI staining for starch in immature pollen, at 7 days prior to anthesis, from plants grown season-long at a ambient (30/20°C) and b high temperature (36/26°C); seed-set at c ambient, d season-long high temperature, and e short-term (10 days prior to panicle emer-gence) high temperature growth conditions after ambient envi-ronment. Arrows indicate sec-tors of failed seed-set f and necrotic Xorets g under season-long and short-term stress treat-ments, respectively

g

fc d e

a bStage A

Stage B

Stage C

Stage DPre- to post-meiotic, 11 days before anthesis

Post-mitotic, 7 days before anthesis

Fig. 3 Carbohydrate proWles of pre- and post-meiotic “early” andpost-mitotic “late” microspores (stages D and A, respectively, in theschematic drawing in Fig. 2) from sorghum plants grown season-longat ambient (30/20°C) and high (36/26°C) temperature growth condi-tions. The data presented are average § SD of three independentextractions with each assay having six replicates

Growth temperature (°C)30/20 36/26

0

20

40

60

80

µg s

tarc

h m

g-1

fres

h

cLate, stage A

2

4

6

8

10

12

µg s

ugar

s m

g-1

fres

h a

2

4

6

8

b

0

Glucose

Fructose

Sucrose

Total

sugarsGluco

se

Fructose

Sucrose

Total

sugars

30/20 °C36/26 °C

Late, stage A Early, stage D w

eigh

t

wei

ght

123

Planta (2007) 227:67–79 73

high growth temperature at stage A (Fig. 3c), as was alsoevident by reduced I2/KI staining (Fig. 2b).

Spatiotemporal expression of cell wall invertase gene SbIncw1 in developing microspores

Invertases catalyze the irreversible hydrolysis of Suc intoFrc and Glc and are classiWed as soluble acid invertasespresent in vacuoles; whereas the insoluble acid invertasesare cell wall-bound and localized to the apoplast. Cell wallinvertase-mediated sugar inversion has been shown to becrucial for source-to-sink sucrose unloading, and henceestablishment and maintenance of sink strength in develop-ing seeds (Cheng et al. 1996) as well as microspores (Goetzet al. 2001). Figure 4 shows (a) Northern blot and (b) real-time quantitative PCR analyses of CWI gene SbIncw1 inRNA extracted from young microspores as well as totalRNA extracts of intact Xoral whorls at similar developmen-tal stages. A SbIncw1 cDNA clone (1.6 kb; GeneBankaccession no. EF 177465) from sorghum endosperm wasused as the probe (Jain et al. 2007). Under ambient growthtemperature conditions, a signiWcant rise in SbIncw1 expres-sion was observed during the starch deposition phase (stageA) in RNA extracted from intact Xorets, but not in the iso-lated microspores, reXective of developmental stage-speciWcSbIncw1 contribution of sporophytic origin. However, thistemporal rise in SbIncw1 expression during starch-deposi-

tion phase was not evident under high temperature stress.Additionally, steady state transcription of the SbIncw1 genein microspores through post-mitotic stages was signiWcantlyreduced in plants exposed to high temperature stress.

Immunolocalization of cell wall invertase in sorghum Xorets

Polyclonal antisera against maize INCW1 and INCW2were used to examine spatial localization of CWI proteinsin transverse sections of sorghum Xorets (Fig. 5). Althoughthese antibodies do not discriminate the two isoforms inmaize (Shanker et al. 1995), spatially distinctive patterns ofimmunolocalization were observed with these antibodies insorghum (Fig. 5a, f). Florets at two developmental stages,“early” (stage D, pre- and post-meiotic microspores) and“late” (stage A, post-mitotic microspores at the beginningof starch deposition phase) were sampled from the base andthe tip of the pre-emergent panicle, respectively. Immunol-ocalization with the INCW1 antiserum detected antigenicsignal in tapetum and vascular parenchyma of anther Wla-ments at the “early” stages (Fig. 5a, b), and also in themicrospores at the “late” stages of Xorets grown at ambientgrowth temperature conditions (Fig. 5d). However, nocross-reactive antigen was detected under high temperaturegrowth conditions (Fig. 5c, e; respectively). The INCW2-speciWc signal was detected in the cortical parenchyma inthe biWd style and anther Wlaments (Fig. 5f, g), and in “late”stages the signal was in vascular parenchyma of the antherWlaments and microspores in addition to the feathery stigmatissue (Fig. 5i). A signiWcant reduction in cross-reactiveprotein with INCW2 antiserum was discernible under heat-stress conditions that was restricted only to the female spo-rophyte (Fig. 5h); and no qualitative diVerences in antigenpresence were observed in anther vasculature and youngmicrospores in “late” Xorets from high temperature growthconditions (Fig. 5i, j). Overall, high temperature growthconditions resulted in signiWcant loss of the INCW proteinsin male sporophytic and gametophytic tissues.

Transcript analyses of genes involved in sugar metabolism, transport, and starch biosynthesis

We also examined the eVect of ambient and season-longhigh growth temperature on comparative transcript proWlesof various genes involved in the cleavage, transport and uti-lization of sucrose during early stages of microsporogenesisthrough beginning of starch biosynthesis phase (stage Dthrough stage A, see Fig. 2). Figure 6a shows the RNAexpression levels of two other key metabolic enzymesinvolved in sucrose utilization, namely, soluble invertase(SbIvr2) and two maize sucrose synthase orthologs, Sh1and Sus1. Soluble invertase (SbIvr2) expression was

Fig. 4 a RNA gel blot and b real-time quantitative-PCR analysesshowing expression of sorghum cell wall invertase gene, SbIncw1(GenBank accession no. EF 177465), in microspores and Xorets fromplants grown at ambient (30/20°C) and season-long high (36/26°C)temperature. The Xoral and microspore developmental stages are asindicated (Fig. 2, schematic drawing). All lanes were loaded with15 �g total RNA for the RNA gel blot analyses (a). For the q-PCR, thedata represents average § SD (100 ng¡1 total RNA) for three indepen-dently made RT preparations and three replicates for each PCR run (b)

Microspores

Florets

D C B A

(30/20 °C)

D C B A

(36/26 °C)a

b

0

20

40

60

80

100

120

140

16030/20 °C36/26 °C

1wc nIbS

ecnadnubat pi rcsnart( ×

014

00 1selucelo

m1-

)A

NR

gn

Microspores

D C B A

Florets

D C B A

123

74 Planta (2007) 227:67–79

evident throughout the development of microspores withmoderately elevated levels towards beginning of starchdeposition phase, and was also upregulated due to highgrowth temperature. Sucrose synthase (SuSy) provides bothsubstrates and precursors for cellulose, callose and starchbiosynthesis in various plants. Two SuSy genes (maize Sh1and Sus1 orthologs) have been described in sorghum(Chourey et al. 1991). A gradual decrease in steady statetranscript abundance of Sus1 was seen during microsporedevelopment; however, the steady state levels at compara-ble stages were higher in case of high temperature treat-ment. Likewise, Sh1 transcription was also considerablyreduced during starch deposition stages, but no signiWcanteVects of high growth temperature was apparent on theRNA levels; except for in the pre- and post-meiotic stageD, where Sh1 levels were greatly reduced at ambient ascompared to the high temperature growth conditions.

Developmental progression of microspores to starch Wll-ing phase under ambient growth conditions was associatedwith coordinated up-regulation of transporter genes plasmamembrane H+ATPase (Mha1) and monosaccharide trans-porter (MST1) (Fig. 6b). However, the steady state tempo-ral expression proWle of MST1 was down-regulated during

microspore development under high temperature growthconditions. On the other hand, there was a qualitative rever-sal in the expression proWle of Mha1 under stress condi-tions. On the whole, such changes are consistent with theenergy-dependent role of these transporter proteins inabsorption of hexose sugars from the nutrient rich locularbroth into the microspore sink (Zhao et al. 2000).

Figure 6c illustrates eVects of high growth temperatureconditions on the temporal expression proWles of starch bio-synthesis genes in sorghum microspores. In cereal seed endo-sperm, AGPase is a heterotetrameric protein, encoded by twononallelic genes, Sh2 and Bt2 (Bhave et al. 1990) catalyzingthe formation of ADP-Glc, the soluble precursor and sub-strate for starch synthases. We show Bt2 transcripts as a rep-resentative of the AGPase transcript levels. Furthermore,AGPase activity is often coupled to UDP-Glc utilization byUGPase resulting in equimolar production of ADP-Glc fromUDP-Glc (Kleczkowski et al. 2004). Granule-bound starchsynthase-1 (GBSS1, encoded by the Waxy gene in maize)transfers the glucose moieties from ADP-Glc to the non-reducing ends of starch molecules inside the growing starchgranules making starch amylose (largely unbranched �-(1 ! 4)-linked glucan chains). Sugary1 (SU1) is a starch

Fig. 5 Immunolocalization of cell wall invertase in sorghum Xorets grown at ambient (30/20°C) and season-long high (36/26°C) temperature growth con-ditions. Transverse sections a-e and f-j were immunodeveloped using polyclonal antisera for maize INCW1 and INCW2, respectively. The developmental stages (“early” vs. “late”) and the growth temperatures (ambi-ent vs. high) are marked in the Wgure. Primary INCW1 and INCW2 antibodies were used at 1:1000 dilution. Presence of cell wall invertase is indicated by precipitation of silver grains. The line diagram shows a sche-matic of Xoral architecture in sorghum, and the dotted lines approximately depict the planes of transverse sections used for immunolocalization. An anther lobes, Fi Wlament, Gl glume, Le lemma, Lod lodicule, Mi mi-crospores, Pa palea, St style, Stg stigma, Ta tapetum. MagniWca-tion bars: 200 �m (a, f); 100 �m (h, j); 50 �m (b-e, g, i)

An

Le

Stg

St

Fi

PaLod

Gl Gl

d, e, i

a-c, f-h, j

f

An

Fi

St

30/20 °C, early

i j

Fi

St

StAn

Mi

Fi St

Stg

Mi

St

Fi

An

30/20 °C, early 36/26 °C, early

36/26 °C, late30/20 °C, late

g h

Fi

Fi

St

Stg

Fi

Stg

30/20 °C, late 36/26 °C, late

b

e

c

d

Fi

Ta

Fi

Mi

St

30/20 °C, early 36/26 °C, early

a

An

St

Fi

Gl

LePa

Lod

30/20 °C, early

Ta

TaTa

123

Planta (2007) 227:67–79 75

debranching enzyme hydrolyzing �-(1 ! 6)-glucosidic link-ages, and is also involved in starch biosynthesis and deter-mines the amylopectin component of starch granule. Agradual temporal increase in Bt2 transcript abundance wasseen during the maturation phase coincident with starch bio-synthesis. Although totally undetectable during meioticstages, GBSS1 transcript was seen in great abundance duringthe starch biosynthesis phase under ambient growth condi-tions. Sugary1 did not show any temporal variability inexpression proWle during microspore development. Hightemperature stress conditions did not aVect the temporalspeciWcity of expression, but signiWcantly reduced the steadystate transcript levels of all the three genes, Bt2, GBSS1 andSU1, at any comparable developmental stage under stressconditions. The abundant increase in the steady state levelsof UGPase evident prior to the beginning of starch biosyn-thesis phase under ambient temperature conditions, wastranscriptionally repressed under stress conditions.

Discussion

Heat stress-induced reduction in crop yields has previouslybeen documented across a range of crop species including

grain sorghum (Prasad et al. 2006), and is attributed to fail-ure of starch deposition consequently impairing pollendevelopment and germination processes. The molecularmechanisms governing heat stress-induced male sterilityare sparsely understood. In this regard, our data indicatestrong parallels with heat, cold and drought stress-induceddown-regulation in CWI expression and activity causingpollen sterility in tomato (Pressman et al. 2006), rice (Oli-ver et al. 2005) and wheat (Koonjul et al. 2005), respec-tively. It is axiomatic that post-phloem unloading andassimilate partitioning into symplastically isolated sink tis-sues via apoplasmic space will rely primarily upon cell wallbound invertase activity, with additional checkpoints at thelevel of transport across the cell membrane.

Carbohydrate proWles in the developing microspores

The results from sugar analyses (Fig. 3) showed that thetotal soluble sugar proWle at the ambient temperature wasrepresented primarily by Frc during “early” stages ofmicrosporogenesis, and by Glc, Frc and Suc later duringdevelopment. However, for “late, stage A” microspores, thepresence of Suc in ambient but not in high temperatureplants is of signiWcant interest because this trait is also cor-related with starch accumulation; i.e., much higher propor-tion of pollen from ambient plants exhibit starchaccumulation than the high temperature plants. In maize, bycontrast, our previous studies showed no sucrose in bothearly and late microspores, including the genotype thataccumulated starch and, ultimately, fertile pollen (Dattaet al. 2002). Sucrose accumulation may thus be unique tosorghum and it is most probably synthesized in themicrospores from hexoses transported from the sporophytictapetal cell layer. A “futile cycle” of Suc synthesis andcleavage reactions, similar to developing maize endosperm(Cheng and Chourey 1999), may be operational in the latephases of microspores of plants grown in ambient but not inhigh temperature plants. The higher hexose sugar levelsaccumulating in the “late, stage A” microspores at hightemperature may be an indication that Suc synthesis isblocked which would in turn limit this “futile cycle” of car-bon transfer to starch biosynthesis.

Elevated growth temperature-induced inhibition of CWI expression in sorghum Xorets

Sugar metabolism and its control, and assimilate partitioningare critical to all parts of the plant, including developingseeds and microspores—major sites of sugar utilization. Animportant role of CWI in providing carbohydrates to themale gametophyte is demonstrated with the presence ofanther—expressed CWI isoforms in Vicia faba (Weber et al.1996), Lilium longiforum (Clément et al. 1996) and L. hyb-

Fig. 6 EVect of season-long high temperature (36/26°C) growth con-ditions on temporal expression of a soluble invertase (SbIvr2) and su-crose synthases (Sh1, Sus1), b transporter proteins (Mha1, MST1), andc starch biosynthesis enzymes (Bt2, GBSS1, SU1 and UGPase) in sor-ghum microspores at the developmental stages as indicated (Fig. 2,schematic drawing). All lanes were loaded with 15 �g total RNA. RNAloading controls are represented by �-tubulin 1 (SbTua1) and ethidiumbromide stained rRNA bands

D C B A

(30/20 °C)

D C B A

(36/26 °C)

c

SU1

UGPase

GBSS1

Bt2

b Mha1

MST1

SbTua1

rRNA

SbIvr2

Sus1

Sh1

a

123

76 Planta (2007) 227:67–79

rida (Castro and Clément 2007), potato (Maddison et al.1999), tobacco (Goetz et al. 2001), tomato (Godt and Roi-tsch 1997; Pressman et al. 2006), maize (Xu et al. 1996;Kim et al. 2000), wheat (Koonjul et al. 2005), rice (Ji et al.2005; Oliver et al. 2005) and sorghum (present study). Tran-script analyses (Fig. 4a, b) and immunolocalization (Fig. 5)data collectively reemphasize the critical role of INCWactivity in driving sucrose unloading from the nutritive tape-tum layer into apoplast surrounding the developing microsp-ores and its utilization for starch biosynthesis. However, thepossibility of multiple SbIncw isoforms in sorghum anthersreceptive to diVerential spatiotemporal and stress-inducedsignals can not be ruled out. Heat stress-induced transcrip-tional down regulation of SbIncw1 expression in youngmicrospores as well as the sporophytic Xoral whorls (tape-tum, anther Wlaments, stigma and styler tissues) appears tobe the most upstream metabolic aberration (Figs. 4, 5) lead-ing to altered sucrose uptake and associated changes in tran-scriptional activity of genes involved in sugar transport andmetabolic transition to starch biosynthesis phase (Fig. 6).Goetz et al. (2001) reported that tapetum-speciWc antisenserepression of CWI gene Nin88 leads to failure of microspo-rogenesis beyond the unicellular stage in tobacco. Interest-ingly, exogenous carbohydrate supply could only partiallyalleviate the metabolic arrest in an in vitro pollen maturationassay, reXective of an absolute requirement for substrateavailability for heterotrophic growth as well as sugar-medi-ated developmental signal cues for maturation of symplasti-cally isolated microspores. Notably, a similar requirementfor INCW2-mediated metabolic release of hexoses wasshown to be critical for normal endosperm development inmaize (Cheng and Chourey 1999). Koonjul et al. (2005)reported selective transcriptional down regulation of onevacuolar and one cell wall-bound invertase gene and the cor-responding enzyme activities in the anthers leading to failedpollen development in water deWcient wheat plants. Like-wise, in rice, cold-stress induced transcriptional repressionof a tapetum-speciWc CWI gene OSINV4 and pollen sterilitywas evident only in the cold-sensitive and not in the tolerantcultivar (Oliver et al. 2005). A few diVerences in the tempo-ral overlap of transcriptional down-regulation of CWI genesand microsporogenesis events are, however, apparentbetween wheat, rice, and sorghum. In wheat and rice, stress-induced eVects on the transcription of CWI genes andenzyme activity were coincident with the transition of mei-ospores to early unicellular stage (Koonjul et al. 2005; Oli-ver et al. 2005). Although a similar role in sorghum is notruled out, the reduction in sporophytic component of CWIabundance was evident only prior to the starch depositionphase and the microspore-associated changes were observedthroughout microsporogenesis (Fig. 4).

The data on heat stress-induced changes in transcrip-tional levels of SbIncw1 were further corroborated by our

immunolocalization data of distinct CWI isoforms in vari-ous Xoral tissues shown in Fig. 5. It is apparent that starchdeWciency of pollen is associated with stress-induced devia-tion from spatial and developmental speciWcity of CWI iso-forms in tapetum, anther Wlaments and young microspores.With the onset of tapetal degeneration and isolation ofmicrospores from the mother plant, the apoplastic sugarcleavage and utilization pathway is likely controlled bothby the surrounding tapetum layer as well as the developingpollen in a sequential manner (Goetz et al. 2001; Oliveret al. 2005). It is conceivable that heat-stress induced lossof CWI activity in tapetum cells will have deleteriouseVects on its secretory functions responsible for nutritionalenrichment of locular Xuids in the apoplast, that are subse-quently taken up by microspores as they grow and matureinto pollen grains. Also, decreased CWI activity in symp-lastically discontinuous microspores will adversely aVectsugar import from the surrounding locular Xuid, furthercausing changes in carbohydrate metabolism. The residualINCW isoform in the young heat-stressed microsporesimmunolocalized by INCW2 antiserum (Fig. 5i, j) mayonly fulWll the partial sucrose requirement for basic respira-tory needs and maintaining cell viability. Notably, whilecold-stressed anthers in rice showed lack of pollen viabilityat the time of anthesis (Oliver et al. 2005), dehisced pollenin heat-stressed sorghum score positive upon staining withthe vital dye tri-phenyl tetrazolium chloride (data notshown) but display starch-deWcient phenotype as a probablecause leading to infertility. Also, adequate CWI activity inthe anther Wlaments may be necessary for assimilateunloading from phloem termini en route to the tapetumcells. Additionally, sucrose inversion in the anther Wla-ments through late stages of Xower development may beessential for supporting cellular turgor and expansion lead-ing to exertion of anther lobes prior to anthesis. Such a roleof CWI genes has been proposed in drought-stressed ricefor coordination of anther dehiscence, panicle exertion andheading (Ji et al. 2005). We also observed heat stress-induced down-regulation in CWI activity in female sporo-phytic tissue as a probable cause for reduced pollen recep-tivity and compromised seed set.

EVect of elevated growth temperature on expression of genes involved in sugar transport, metabolism, and utilization

The data summarized in Fig. 6a show that under ambientgrowth conditions SbIvr2 transcript levels were associatedwith a temporal increase in steady state levels during pollenmaturation (A stage was greater than the D); whereas, theSus1 transcript abundance was slightly higher in youngerthan the advanced stages of microspores (i.e., D > A).These data agree well with the proposed roles of soluble

123

Planta (2007) 227:67–79 77

invertase and SuSy in supporting transient storage ofsucrose in the vacuoles. Similar to its role in developingendosperm (Chourey et al. 1998; Jain et al. 2007), it is pos-sible that Sus1 has only a minor contribution (if any)towards starch biosynthesis in developing microspores andmay provide UDP-Glc for callose biosynthesis. By virtueof its reversible reaction kinetics, SuSy may also providefor intracellular transient storage of sucrose in the vacuoles.

Previously, Datta et al. (2001) have shown temporal spec-iWcity of Sus1 expression limited to the “early” stages of sor-ghum pollen derived from male-fertile lines and higherabundance at “late” stages in starch-deWcient male-sterilepollen. Also, Sus1-encoded mRNA and protein were athigher level in the “early” stages in both male-sterile as wellas fertile lines of maize (Datta et al. 2002). Higher Ivr2expression levels were reported for male-fertile and sterilelines of sorghum and male-fertile lines of maize (Datta et al.2001, 2002). In contrast, however, Ivr2 transcription wasnearly undetectable at “late” stages of male-sterile lines ofmaize (Datta et al. 2002). DiVerences in Ivr2 transcriptabundance in starch-deWcient male-sterile pollen in maize(Datta et al. 2002) and heat-stressed pollen in sorghum(present study) may be reXective of the primary cause ofphysiological aberration, genetic in the former as comparedto abiotic stress in the latter case. Additionally, the heatstress-induced rise in transcriptional activity of SbIvr2 insorghum microspores does not agree with the data publishedin wheat and rice subject to drought stress. Depression insoluble acid invertase activity has been reported precedingany visual developmental anomaly in wheat (Dorion et al.1996; Lalonde et al. 1997; Koonjul et al. 2005) and rice(Sheoran and Saini 1996) anthers during meiotic-stage waterdeWcit. Water stress-induced inhibition of soluble invertaseactivity was irreversible and highly speciWc without anyaccompanying changes in the activities of other enzymes ofstarch biosynthesis. This apparent discrepancy may be dueto diVerential isoform sensitivities and their spatial localiza-tion (anthers in wheat and rice; and microspores in sor-ghum), and also diVerences in the severity of the imposedstress conditions. The observation that vacuolar invertasegene OsVIN2 is repressed during cold stress (Oliver et al.2005) and up-regulated by drought stress in rice anthers (Jiet al. 2005) further lends credence to such speculations.

The important role of CWI genes in sugar partitioningand regulation of source–sink relationship is functionallycoupled and coordinately regulated with expression oftransporter proteins (Ehness and Roitsch 1997). Heat-stressinduced changes in temporal expression proWle of theSbIncw1 gene closely follows suit with reduced transcrip-tional activity of transporter genes MST1 and Mha1(Fig. 6b) which indicated less loading ability from apoplast.Zhao et al. (2000) reported co-suppression of endogenousand transgenic PM H+-ATPase in tobacco resulting in

reduced pollen uptake of sugars and impaired male fertilityin tobacco. Regulation of plasma membrane bound H+-ATPase activity may also be important as a cellular defensemechanism under stress conditions.

In conclusion, heat-stress induced failure of starch depo-sition in sorghum microspores is evidently the culminationof altered sugar hydrolysis in CWI compromised back-ground in the secretory tapetum cells and also in the devel-oping microspores, preceding changes in the subsequentsugar uptake and downstream carbohydrate metabolism.Reduced steady-state transcript levels of Bt2, GBSS1 andSU1 in starch-deWcient sorghum pollen under high-temper-ature growth conditions are reXective of inadequate sucrosesynthesis, and subsequent utilization for starch biosynthe-sis. Under heat stress, the lower loading ability (MST1 andMha1) would eventually lead to the observed total lack ofsucrose in heat stressed pollen and reduced starch accumu-lation. Even though the importance of CWI-mediated sugarcatalysis during microsporogenesis in assuring reproduc-tive success is emerging, the role of pollen receptivity bystigma can not be ruled out (Prasad et al. 2006b). Stressinduced-changes in INCW expression seen in female spo-rophytic tissue in sorghum warrants further work in thisdirection, especially in view of the documented presence ofspeciWc CWI genes in maize (Kim et al. 2000) and tomato(Godt and Roitsch 1997) ovaries.

Acknowledgments Mention of trade names or commercial productsin this publication is solely for the purpose of providing speciWc infor-mation and does not imply recommendation or endorsement by the USDepartment of Agriculture. We thank Drs. D. R. Pring and C. L. Guyfor critical reading of the manuscript and Mr. A. Funk for excellenttechnical assistance. This work was supported in part by the USDepartment of Agriculture (USDA)-Agricultural Research Service(ARS) and by the United States-Israel Binational Agricultural Re-search and Development Fund (grant no. IS-3738-05 R). It was a coop-erative investigation between USDA-ARS and the Institute of Foodand Agricultural Science, University of Florida.

References

Abiko M, Akibayashi K, Sakata T, Kimura M, Kihara M, Itoh K, As-amizu E, Sato S, Takahashi H, Higashitani A (2005) High-tem-perature induction of male sterility during barley (Hordeumvulgare L.) anther development is mediated by transcriptionalinhibition. Sex Plant Reprod 18:91–100

Aloni B, Peet M, Pharr M, Karni L (2001) The eVect of high tempera-ture and high atmospheric CO2 on carbohydrate changes in bellpepper (Capsicum annuum) pollen in relation to its germination.Physiol Plant 112:505–512

Ariizumi T, Hatakeyama K, Hinata K, Inatsugi R, Nishida I, Sato S,Kato T, Tabata S, Toriyama K (2004) Disruption of the novelplant protein NEF1 aVects lipid accumulation in the plastids of thetapetum and exine formation of pollen, resulting in male sterilityin Arabidopsis thaliana. Plant J 39:170–181

Bhave MR, Lawrence S, Barton C, Hannah LC (1990) IdentiWcationand molecular characterization of Shrunken-2 cDNA clones ofmaize. Plant Cell 2:581–588

123

78 Planta (2007) 227:67–79

Boyer JS, Westgate ME (2004) Grain yields with limited water. J ExpBot 55:2385–2394

Castro AJ, Clément C (2007) Sucrose and starch catabolism in the an-ther of Lilium during its development: a comparative studyamong the anther wall, locular Xuid and microspore/pollen frac-tions. Planta 225:1573–1582

Cheng WH, Chourey PS (1999) Genetic evidence that invertase medi-ated release of hexoses is critical for appropriate carbon partition-ing and normal seed development in maize. Theor Appl Genet98:485–495

Cheng WH, Taliercio EW, Chourey PS (1996) The Miniature1 seed lo-cus of maize encodes a cell wall invertase required for normaldevelopment of endosperm and maternal cells in the pedicel.Plant Cell 8:971–983

Chourey PS, Taliercio EW, Kane EJ (1991) Tissue speciWc expressionand anaerobically induced posttranscriptional modulation of su-crose synthase genes in Sorghum bicolor M. Plant Physiol96:485–490

Chourey PS, Taliercio EW, Carlson SJ, Ruan YL (1998) Genetic evi-dence that the two isozymes of sucrose synthase present in devel-oping maize endosperm are critical, one for cell wall integrity andthe other for starch biosynthesis. Mol Gen Genet 259:88–96

Clément C, Burrus M, Audran JC (1996) Floral organ growth and car-bohydrate content during pollen development in Lilium. Am J Bot83:459–469

Datta R, Chourey PS, Pring DR, Tang HV (2001) Gene expressionanalysis of sucrose-starch metabolism during pollen maturation incytoplasmic male-sterile and fertile lines of sorghum. Sex PlantReprod 14:127–134

Datta R, Chamusco KC, Chourey PS (2002) Starch biosynthesis duringpollen maturation is associated with altered patterns of geneexpression in maize. Plant Physiol 130:1645–1656

Dorion S, Lalonde S, Saini HS (1996) Induction of male sterility inwheat by meiotic-stage water deWcit is preceded by a decline ininvertase activity and changes in carbohydrate metabolism in an-thers. Plant Physiol 111:137–145

Ehness R, Roitsch T (1997) Co-ordinated induction of mRNAs forextracellular invertase and a glucose transporter in Chenopodiumrubrum by cytokinins. Plant J 11:539–548

Godt DE, Roitsch T (1997) Regulation and tissue-speciWc distributionof mRNAs for three extracellular invertase isoenzymes of tomatosuggests an important function in establishing and maintainingsink metabolism. Plant Physiol 115:273–282

Goetz M, Godt DE, Guivarc’h A, Kahmann U, Chriqui D, Roitsch T(2001) Induction of male sterility in plants by metabolic engineer-ing of the carbohydrate supply. Proc Natl Acad Sci USA98:6522–6527

Hoekstra FA, Roekel VT (1988) Desiccation tolerance of Papaver du-bium L. pollen during its development in the anther: possible roleof phospholipid composition and sucrose content. Plant Physiol88:626–632

Hoekstra FA, Crowe LM, Crowe JH (1989) DiVerential desiccationsensitivity of corn and Pennisetum pollen linked to their sucrosecontents. Plant Cell Environ 12:83–91

IPCC (2001) A contribution of working group I to the third assessmentreport of the intergovernmental panel of climate change. In:Houghton JT, Ding Y, Griggs DJ, Noguer M, van der Linden PJ,Dai X, Maskell K, Johnson CA (eds) Climate change 2001: thescientiWc basis. Cambridge University Press, Cambridge, UK, pp881

Jain M, Chourey PS, Li QB, Pring DR (2007) Expression of cell wallinvertase and several other genes of sugar metabolism in relationto seed development in sorghum (Sorghum bicolor). J Plant Phys,doi: 10.1016/j.jplph.2006.12.003

James MG, Denyer K, Myers AM (2003) Starch synthesis in the cerealendosperm. Curr Opin Plant Biol 6:215–222

Ji XM, Raveendran M, Oane R, Ismail A, LaWtte R, Bruskiewich R,Cheng SH, Bennett J (2005) Tissue-speciWc expression anddrought responsiveness of cell-wall invertase genes of rice atXowering. Plant Mol Biol 59:945–964

Kaplan F, Kopka J, Haskell DW, Zhao W, Schiller KC, Gatzke N,Sung DY, Guy CL (2004) Exploring the temperature-stress me-tabolome of Arabidopsis. Plant Physiol 136:4159–4168

Karni L, Aloni B (2002) Fructokinase and hexokinase from pollengrains of bell pepper (Capsicum annuum L.): possible role in pol-len germination under conditions of high temperature and CO2enrichment. Ann Bot 90:607–612

Kim JY, Mahé A, Guy S, Brangeon J, Roche O, Chourey PS, Prioul JL(2000) Characterization of two members of the maize gene fam-ily, Incw3 and Incw4, encoding cell-wall invertases. Gene245:89–102

Kleczkowski LA, Geisler M, Ciereszko I, Johansson H (2004) UDP-Glucose pyrophosphorylase. An old protein with new tricks. PlantPhysiol 134:912–918

Koonjul PK, Minhas JS, Nunes C, Sheoran IS, Saini HS (2005) Selec-tive transcriptional down-regulation of anther invertases precedesthe failure of pollen development in water-stressed wheat. J ExpBot 56:179–190

Kresowich S, Barbazuk B, Bedell JA et al (2005) Towards sequencingthe Sorghum genome. A US National Science Foundation-spon-sored workshop report. Plant Physiol 138:1898–1902

Lalonde S, Dwight UB, Saini HS (1997) Early signs of disruption ofwheat anther development associated with the induction of malesterility by meiotic-stage water deWcit. Sex Plant Reprod 10:40–48

Lee SLJ, Earle ED, Gracen VE (1980) The cytology of pollen abortionin S cytoplasmic male sterile corn anthers. Am J Bot 67:237–245

Maddison AL, Hedeley PE, Meyer RC, Aziz N, Davidson D, MachrayGC (1999) Expression of tandem invertase genes associated withsexual and vegetative growth cycles in potato. Plant Mol Biol41:741–751

Maiti RK (1996) Sorghum science. Science Publishers Inc., Lebanon,USA

McCormick S (2004) Control of male gametophyte development.Plant Cell 16:S142–S153

Niewiadomski P, Knappe S, Geimer S, Fischer K, Schulz B, Unte US,Rosso MG, Ache P, Flugge UI, Schneider A (2005) The Arabid-opsis plastidic glucose 6-phosphate/phosphate translocator GPT1is essential for pollen maturation and embryo sac development.Plant Cell 17:760–775

Oliver SN, Dongen VJT, Alfred SC, Mamun EA, Zhao X, Saini HS,Fernandes SF, Blanchard CL, Sutton BG, Geigenberger P, DennisES, Dolferus R (2005) Cold-induced repression of the rice anther-speciWc cell wall invertase gene OSINV4 is correlated with su-crose accumulation and pollen sterility. Plant Cell Environ28:1534–1551

Peet MM, Sato S, Gardner RG (1998) Comparing heat stress eVects onmale-fertile and male-sterile tomatoes. Plant Cell Environ21:225–231

Pickering NB, Allen Jr LH, Albrecht SL, Jones P, Jones JW, Baker JT(1994) Environmental plant chambers: controls and measure-ments using CR-10T data loggers. In: Watson DG, Zuzueta FS,Harrison TV (eds) Computers in agriculture: proceedings of theWfth international conference, Orlando, Florida, 5–9 February.American Society of Agricultural Engineers, St Joseph, USA, pp.29–35

Porch TG, Jahn M (2001) EVects of high-temperature stress on micro-sporogenesis in heat-sensitive and heat-tolerant genotypes ofPhaseolus vulgaris. Plant Cell Environ 24:723–731

Prasad PVV, Crawfurd PQ, SummerWeld RJ (1999) Fruit number inrelation to pollen production and viability in groundnut exposedto short episodes of heat stress. Ann Bot 84:381–386

123

Planta (2007) 227:67–79 79

Prasad PVV, Boote KJ, Allen Jr HL (2006a) Adverse high temperatureeVects on pollen viability, seed-set, seed yield and harvest indexof grain-sorghum [Sorghum bicolor (L.) Moench] are more se-vere at elevated carbon dioxide due to higher tissue tempera-tures.Agri Forest Meteor 139:237–251

Prasad PVV, Boote KJ, Allen Jr HL, Sheehy JE, Thomas JMG (2006b)Species, ecotype and cultivar diVerences in spikelet fertility andharvest index of rice in response to high temperature stress. FieldCrop Res 95:398–411

Pressman E, Peet MM, Pharr MD (2002) The eVect of heat-stress ontomato pollen characteristics is associated with changes in carbo-hydrate concentration in the developing anthers. Ann Bot 90:631–636

Pressman E, Harel D, Zamski E, Shaked R, Althan L, Rosenfeld K,Firon N (2006) The eVect of high temperatures on the expressionand activity of sucrose-cleaving enzymes during tomato (Lycop-ersicon esculentum) anther development. J Hort Sci Biotechnol81:341–348

Pring DR, Tang HV (2004) Transcript proWling of male-fertile andmale-sterile sorghum indicates extensive alterations in geneexpression during microgametogenesis. Sex Plant Reprod16:289–297

Raghavan V (1988) Anther and pollen development in rice (Oryza sa-tiva). Am J Bot 75:183–186

Saini HS (1997) EVects of water stress on male gametophyte develop-ment in plants. Sex Plant Reprod 10:67–73

Saini HS, Sedgley M, Aspinall D (1984) Developmental anatomy inwheat male sterility induced by heat stress, water deWcit or absci-sic acid. Aust J Plant Physiol 11:243–253

Sakata T, Takahashi H, Nishiyama I, Higahsitani A (2000) EVects ofhigh temperature on the development of pollen mother cells and mi-crospores in barley Hordeum vulgare L. J Plant Res 113:395–402

Sato S, Peet MM, Thomas JF (2002) Determining critical pre- andpost-anthesis periods and physiological processes in Lycopers-icon esculentum Mill. exposed to moderately elevated tempera-tures. J Exp Bot 53:1187–1195

Shanker S, Salazar RW, Taliercio EW, Chourey PS (1995) Cloningand characterization of full-length cDNA encoding cell-wallinvertase from maize. Plant Physiol 108:873–874

Sheoran IS, Saini HS (1996) Drought-induced male sterility in rice:changes in carbohydrate levels and enzyme activities associatedwith the inhibition of starch accumulation in pollen. Sex Plant Re-prod 9:161–169

Stone P (2001) The eVects of heat stress on cereal yield and quality. In:Basra AS (ed) Crop responses and adaptations to temperaturestress. Food Products Press, Binghampton, pp 243–291

Suzuki K, Tsukaguchi T, Takeda H, Egawa Y (2001) Decrease of pol-len stainability of green bean at high temperatures and relation-ship to heat tolerance. J Am Soc Hort Sci 126:571–574

Tanaka I (1997) DiVerentiation of generative and vegetative cells inangiosperm pollen. Sex Plant Reprod 10:1–7

Tunistra MR, Wedel J (2000) Estimation of pollen viability in grainsorghum. Crop Sci 40:968–970

Twell D, Park SK, Lalanne E (1998) Asymmetric division and cell-fatedetermination in developing pollen. Trends Plant Sci 3:305–310

Weber H, Borisjuk L, Wobus U (1996) Controlling seed developmentand seed size in Vicia faba: a role for seed coat-associated inver-tases and carbohydrate state. Plant J 10:823–834

Wen LY, Chase CD (1999) Mitochondrial gene expression in develop-ing male gametophytes of male-fertile and S male-sterile maize.Sex Plant Reprod 11:323–330

Wood AW, Tan DKY, Mamun EA, Sutton BG (2006) Sorghum cancompensate for chilling- induced grain loss. J Agro Crop Sci192:445–451

Xu J, Avigne WT, McCarty DR, Koch KE (1996) A similar dichotomyof sugar modulation and developmental expression aVects bothpaths of sucrose metabolism: evidence from maize invertase genefamily. Plant Cell 8:1209–1220

Zhang YH, Shewry PR, Jones H, Barcelo P, Lazzeri PA, Halford NG(2001) Expression of antisense SnRK1 protein kinase sequencecauses abnormal pollen development and male sterility in trans-genic barley. Plant J 28:431–441

Zhao R, Dielen V, Kinet J-M, Boutry M (2000) Cosuppression of aplasma membrane H+-ATPase isoform impairs sucrose transloca-tion, stomatal opening, plant growth, and male fertility. Plant Cell12:535–546

123