effects of adenosine on lipid accumulation in a human hepatoma … · 2019. 4. 20. · protein...
TRANSCRIPT
![Page 1: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/1.jpg)
EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA CELL CULTURE MODEL WHEN CHALLENGED WITH EXCESS FATTY ACID
Undergraduate Honors Thesis
Michael B. Brown Major in Biology Thesis Advisor: Dr. Robin da Silva
College of Agricultural and Life Sciences | University of Florida 2019
![Page 2: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/2.jpg)
1
Abstract
Non-alcoholic fatty liver disease (NAFLD) is the most prevalent liver disorder in western
populations. Fully understanding lipid metabolism in the liver is necessary for further
understanding the progression of NAFLD to non-alcoholic steatohepatitis (NASH) and in finding
an alternative treatment to weight loss for those diagnosed with NAFLD. HepG2 cells treated with
oleic acid (OA) were used as a model of liver cell lipid accumulation. Methionine, choline and
purines are important metabolites and nutrients that are dysregulated in NAFLD, so we used
methionine and choline deficiency (MCD) and excess purines in cultured HepG2 cells to assess
the influence of these conditions. Triglyceride accumulation and the gene and protein expression
of regulators of lipid metabolism were analyzed. MCD HepG2 cells had fewer total triglycerides
and had higher expression of carnitine palmitoyltransferase 1 a (CPT-1a) and PPARa, genes
involved in b-oxidation, as compared to control cells. MCD cells treated with extracellular
adenosine or inosine with OA lowered phosphorylated-acetyl-CoA carboxylase (p-ACC).
Adenosine was found to affect lipid metabolism through its role in activating AMP-activated
protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway.
Aim
The primary goal of this thesis is to observe lipid accumulation in a human hepatoma
(HepG2) cells under various metabolic conditions. Specifically, lipid accumulation and changes
in gene expression and total protein expression of key regulators in fatty acid metabolism in HepG2
cells when influenced by methionine and choline deficiency and challenged with excess fatty acid.
Furthermore, can the treatment of HepG2 cells with the purines adenosine or inosine ameliorate
lipid loading and positively influence lipid metabolism. Cells cultured in a methionine and choline-
deficient medium and treated with OA are expected higher expression of genes promoting b-
![Page 3: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/3.jpg)
2
oxidation compared to control cells. Methionine and choline deficiency are known to hinder the
transport of lipids out of the liver by means of lipoproteins. The presence of more lipid in the liver
cells tends to lead to an increase in b-oxidation as the cells metabolize the extra lipid in order to
maintain lipid homeostasis. Research shows that extracellular adenosine can activate AMP-
activated protein kinase (AMPK). Active AMPK inhibits a main regulator of fatty acid synthesis
(ACC). Thus, shifting lipid metabolism from lipid synthesis to b-oxidation. Therefore, I expect
cells treated with adenosine to have a higher expression of genes promoting b-oxidation as
compared to control cells.
Introduction
Non-Alcoholic Fatty Liver Disease (NAFLD) is characterized by the deposition of free-
fatty acids and triglycerides in the liver that can cause damage to liver tissue. NAFLD has become
the most prevalent liver disorder in western populations (Benedict & Zhang, 2017). It is estimated
that NAFLD has affected up to a third of individuals worldwide (de Alwis & Day, 2008). It
encompasses a range of disease severity from modest steatosis, which is the accumulation of fat
in liver cells due to disruption in metabolism, to more advanced forms of steatosis with hepatitis,
cirrhosis, and fibrosis (Benedict & Zhang, 2017). Furthermore, the rise of NAFLD and its more
severe form, Non-Alcoholic Steatohepatitis (NASH) has accompanied the rise of obesity in
America. It is estimated that in Western populations, NAFLD can be present in approximately
30% of the population, and up to 90% in individuals who are morbidly obese (Dowman,
Tomlinson, & Newsome, 2010). While NAFLD affects a large population, a smaller number of
patients with NAFLD, around 4-5%, will progress to NASH with more severe steatosis, fibrosis,
and inflammation (Buzzetti, Pinzani, & Tsochatzis, 2016). NAFLD is also closely associated with
increased insulin resistance (IR), diabetes, metabolic syndrome, and dyslipidemia (de Alwis &
![Page 4: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/4.jpg)
3
Day, 2008). Projections show that within the next 20 years, NAFLD will become the leading cause
of liver transplantation and the leader in liver-related deaths (Benedict & Zhang, 2017).
There are very few options for patients suffering from NAFLD/NASH other than a change
in diet and lifestyle. Since NAFLD is strongly correlated with obesity, weight loss is a primary
treatment to ameliorate the fat content of the liver. However, weight loss can be difficult to achieve
and maintain. There are some medications that are used in the treatment of NAFLD/NASH but
there is no “silver bullet” to restrain the growing problem. It is important to understand the
progression and pathogenesis of NAFLD to NASH in order to properly treat these patients. The
most common theory used to characterize the pathogenesis of NASH is the ‘multi-hit hypothesis’.
The factors or ‘hits’ thought to be responsible for the development of a ‘fatty liver’ are diet,
environmental factors, and genetic factors, which lead to obesity, IR, and abnormal liver
metabolism (Buzzetti, Pinzani, & Tsochatzis, 2016). This results in an increase of free fatty acids
and triglycerides in hepatic cells, ultimately leading to lipotoxicity, which induces mitochondrial
damage, oxidative stress, and hinders DNA repair (Buzzetti, Pinzani, & Tsochatzis, 2016). These
sources of cellular stress induce an inflammatory response. Patients with NASH show increased
hepatic inflammation along with more expression of pro-inflammatory cytokines, such as TNF-a,
IL-1B, and IL-6 (Takaki, Kawai, & Yamamoto, 2013). In those diagnosed with NASH, the pro-
inflammatory signal elevates and never drops down back to baseline levels. An inflammatory
response can disrupt cell membranes and promote cell death and cell stress. In NASH patients,
chronic inflammation occurring over time results in liver tissue damage. Reducing the
inflammatory response and decreasing fatty acid and triglycerides in the liver shows promise in
helping NASH patients reverse liver damage and reduce patients with NAFLD from progressing
to NASH.
![Page 5: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/5.jpg)
4
Research has shown the adenosine receptors are promising targets for reducing
inflammation, however, the exact mechanisms that explain this effect are not well understood.
Preliminary results in our lab have shown that that the adenosine receptors can increase secretions
of the anti-inflammatory cytokine IL-10. Interlukin-10 plays a central role in immune signaling by
maintaining and controlling pro-inflammatory responses (Iyer & Cheng, 2012). Adenosine and the
adenosine receptors have been explored as a mechanism to reduce the pro-inflammatory response
in hepatic cells, but not investigated for their potential role in regulating lipid metabolism.
Therefore, this study will focus on understanding how purine metabolism relates to hepatic lipid
content and explore the role of purines, such as adenosine, and their potential to influence lipid
metabolism.
One-carbon Metabolism and Phosphatidylcholine Synthesis
The liver has a role in almost all the metabolic processes in the human body and it plays a
major role in macronutrient metabolism. There exists a connection to the one-carbon cycle or the
folate cycle (Walker 2016). The one-carbon cycle is a ‘network’ or a series of reactions
incorporating the folate cycle and methionine cycle (Mentch & Locasale 2015). The one-carbon
cycle showcases anabolic processes such as purine and pyrimidine synthesis, amino acid synthesis,
and transmethylation reactions (Mato et al. 2013). A series or cycle of reactions that is highlighted
in the one-carbon cycle is the conversion of the amino acid methionine to homocysteine. This
conversion maintains cellular homeostasis and nutrient availability (Mentch & Locasale 2015).
About 50% of all methionine metabolism takes place in the liver, along with 85% of the
transmethylation reactions that occur in the human body (Mato et al. 2013). In the one-carbon
cycle, methionine is converted to the methyl donor S-adenosylmethionine (SAM) with the addition
of an adenosyl group by the enzyme methionine adenosyltransferase (Figure 1). Transmethylation
![Page 6: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/6.jpg)
5
is a reaction in which a methyl group is transferred from a molecule of SAM to an acceptor
molecule. SAM participates as a methyl donor in nucleic acid methylation, amino acid
methylation, and phospholipid methylation. These reactions can regulate a range of cellular
processes including gene expression and lipid metabolism. Phospholipid methylation through the
one-carbon cycle in the liver is of interest to those studying NAFLD because of its link to lipid
levels in the liver.
The nutrient choline is required in phospholipid synthesis and is essential to synthesize
phosphatidylcholine (PC) (Zeisel 2009). There are two pathways to synthesize PC, the Kennedy
pathway and the phosphatidylethanolamine methyltransferase (PEMT) pathway. The Kennedy
pathway is the de novo synthesis of PC from choline (Figure 2). PEMT is a liver specific enzyme
and it accounts for almost a third of PC synthesis in the liver (Stead et al. 2006). The PEMT
pathway utilizes the methylation faculty of the one-carbon cycle to synthesize PC from
phosphatidylethanolamine (PE). Thus, SAM is an essential metabolite in the production of
phosphatidylcholine, acting as the methyl donor in the conversion of PE to PC. The PEMT
pathway relies on the one carbon cycle for its supply of SAM. In liver cells with a high demand
for PC, as much as 40% of SAM is used for the production of PC (Watkins et al. 2003). Individuals
who have diets low in choline and PC turn to de novo production of PC through the PEMT pathway
which happens primarily in the liver (Sherriff 2016).
PC is also a necessary building block of lipoproteins. Very low-density lipoproteins
(VLDL) and high-density lipoproteins (HDL) are tasked with the mobilization of triglycerides and
cholesterol from the liver to other parts of the body. Disruption in the synthesis of PC has been
shown to decrease the levels of VLDL and HDL (Cole & Vance 2012). Decreased levels of
lipoprotein hinder the liver’s ability to mobilize fats outside of hepatic cells. This results in an
increase in the livers lipid pool and is thought to eventually lead to steatosis. In those affected with
![Page 7: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/7.jpg)
6
NAFLD, it is known that the metabolites SAM and PC are correlated with initial liver lipid
accumulation which is the most direct link to the one carbon cycle (Jacobs et al. 2013).
Methionine and choline deficient diet feeding in mice is a widely used model for the study
of NAFLD and NASH. Since methionine is essential for the production of SAM, lower levels of
methionine lead to a smaller pool of available SAM. This directly impacts the liver’s ability to
synthesize PC through the PEMT pathway. Furthermore, choline deficiency impairs the synthesis
of PC from choline. Lower levels of PC lead to lower levels of lipoproteins and ultimately increase
the lipid pool inside of hepatic cells. This increase in lipid is thought to contribute to the
inflammatory condition seen in NAFLD.
Lipid Metabolism and Regulation by Purines
There are three sources of lipid that the body can use for energy. Lipid can be obtained
from dietary sources, storages in adipose tissue, or it can be synthesized in the liver from non-fat
nutrients. Lipid metabolism can be conceptualized as a switch with two states: lipolysis or
lipogenesis. Previous studies have shown that when metabolism is shifted toward lipolysis, hepatic
cells can reduce lipid accumulation and lower the effects of lipotoxicity (Steinberg & Kemp 2008).
One of the regulatory proteins that can control lipid and energy metabolism in cells is called AMP-
activated protein kinase (AMPK). AMPK is an energy sensor of the AMP:ATP ratio in the body
and it is activated during states of energy depletion or states of high levels of AMP. It is a regulator
of hepatic lipid metabolism through the phosphorylation of the rate-limiting enzyme acetyl-CoA
carboxylase (ACC) (Woods et al. 2017). During fatty acid synthesis, acetyl-CoA is converted to
malonyl-CoA by ACC. In its phosphorylated form, ACC is inactive, and therefore, cells would no
longer synthesize fatty acids. AMPK activation is also known to reduce hepatic lipid content by
![Page 8: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/8.jpg)
7
increaseing b-oxidation (Foretz, Even, & Viollet, 2018). Treatment of extracellur adenosine has
previously been found been found to activate AMPK (Aymerich et al. 2006).
Adenosine is a purine molecule that plays a role in metabolism and inflammation. It is a
byproduct of the one carbon cycle during the conversion of SAH to homocystiene. A low
methylation potential or a low SAM:SAH ratio, as seen in methionine deficiency, can lower
adenosine production through the methionine cycle. Treatment with extracellular adenosine, in an
epithelial cell line (IEC-6), has been found to activate AMPK (Aymerich et al. 2006). In the study
by Americh et al. 2006, AMPK activated by adenosine was able to phosphorylate and innactivate
ACC (Aymerich et al. 2006). Treatment with purines such as adenosine could also play a role in
the expression of genes involved lipid metabolism through the regulation of fatty acid synthesis
and oxidation. This paper will explore two genes that are involved in the regulation of fatty acid
b-oxidation: CPT-1a and PPARa. Carnitine palmitoyltransferase-1 (CPT-1) and peroxisome
proliferator activated receptor alpha (PPARa) are involed in fatty acid oxidation.
Peroxisome proliferating activating receptor (PPARa) is a powerful transcriptional
regulator present in the liver that is activated by fatty acids. Activation of PPARa enhances the
expression of genes involved in fatty acid and glucose oxidation (Chatelain et al. 1996) Most
importantly, PPARa was found to directly induce carnitine palmitoyltransferase (CPT-1a)
expression by binding as a transcription factor in the CPT-1a gene (Song et al. 2011). CPT-1a is
a multi-protein complex expressed in almost every cell and it is located on the outer membrane of
the mitochondira (Virmani et al. 2015). It is the rate limiting enzyme involed in transporting long
chain fatty acids into the mitochondia to be oxidized (Ruderman et al 2003). Increased expression
of the CPT-1a gene would promote more oxidation of fatty acids. I expect the expression of CPT-
1a and PPARa to have a direct relationship in the cells. This current work will explore two genes:
CPT-1a and PPARa.
![Page 9: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/9.jpg)
8
The product of ACC, malonyl-CoA, is an allosteric inhibitor of CPT-1a and thus, AMPK
is a part of a regulatory pathway that influences ACC activity, thereby regulating CPT-1a activity
(Park et al. 2012). Their relationship is known as the AMPK-ACC-CPT-1a pathway. Since
adenosine was found to activate AMPK, I expect extracelluar treatment of adensosine to have an
effect on the expression of CPT-1a and PPARa.. In those living with NAFLD it is hypothesized
that inhibiting fatty acid synthesis and promoting b-oxidation could offer a potential solution to
those suffering from steatosis of the liver. This paper looks to examine key regulatory steps that
are altered in response to lipid loading, exogenous purine, and MCD.
Methods
Cell Culture:
Human hepatoma HepG2 cells were cultured using MEM medium containing 10% fetal
bovine serum, 100 mg/ml of gentamycin, and 1mM of sodium pyruvate. The cells were incubated
in a humidified atmosphere of 5% CO2 at 37° Celsius using 100mm corning cell culture dishes.
For each cell passage, the medium in each dish was discarded, and each dish was washed with
2mL of PBS. 1mL of trypsin was added to each dish and allowed to incubate at 37° Celsius for 2-
3 mins. 3 mL of fresh MEM medium was added to stop the trypsinization. The cells were collected
in a sterile 50 mL tube and spun down at 1000 rpm for 3 mins using a centrifuge. The supernatant
was poured off and cells were resuspended in an appropriate amount of medium. Dishes should
have a 1:4 sub-cultivation ratio at high confluency. Dishes were usually split at 1:2 sub-cultivation
ratio at medium confluency to avoid cell overcrowding and clumping. Cells were passaged every
two days. For experiments, cells were cultured either in MEM treatment medium or methionine
and choline deficient medium (MCDM) containing gentamycin and sodium pyruvate. For
experiments, 20 x 10^5 cells plated on 100mm corning cell culture dishes and cells were incubated
![Page 10: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/10.jpg)
9
in 6mL of either treatment MEM or MCDM for 16 hours before treatments were added. Cells were
treated with 10mM at 100ul/mL of adenosine or inosine and 7.5mM OA in 10% BSA at 80uL/ml
for a four-hour incubation period. Cells were collected in either PBS, RNA-later (RLT) buffer or
RIPA buffer and stored at -80° Celsius for further analysis. Cells collected in PBS were analyzed
for total triglycerides. Cells collected in RLT buffer were used for qPCR analysis. Cells collected
in RIPA buffer were collected for analysis by western blot.
Quantitative real-time polymerase chain reaction:
Total RNA was isolated using the Qiagen RNA isolation kit according to the manufacturer
protocol. Isolated RNA was checked for purity and concentration using a nanophotometer
(Implen). RNA samples were diluted to 200ng/uL using molecular grade water. cDNA was
constructed using the Applied Biosystems cDNA synthesis kit. The program “App Bio HC RT”
was run on the thermocycler for at 25°C for 10mins, 37°C for 120 mins, 85°C for 5 mins. For
qPCR, the master mix contained 10x RT buffer, 25x dNTP, 10x Random primers, reverse
transcriptase and molecular grade water at a 1:1 ratio with RNA. The primers CPT1-a and PPAR-
a were used for qPCR. Primer sequences used for the detection of genes were designed as follows:
CPT1a Forward – 5’ TGAGTGGCGTCCTCTTTGG 3’,
CPT-1a Reverse – 5’ CAGCGAGTAGCGCATAGTCATG3’
PPARa-Forward -- 5’GACCTGAAAGATTCGGAAACT3’
PPARa Reverse – 5’CGTCTTCTCGGCCATACAC3’
CYBB Forward – 5’GACTGGACGGAGGGGCTAT 3’
CYBB Reverse – 5’CTTGAGAATGGAGGCAAAGG3’
![Page 11: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/11.jpg)
10
Cyclophilin B was used as a house keeping gene for reference CT values. SYBR green was used
as the detection dye and cycled at 95°C for 15 seconds and 60°C for 2 mins using a Quantstudio
3. Comparative quantification of RNA was expressed as the fold-change for each gene compared
to that of cyclophilin B using the 2^-DDCT method. All PCR products were checked for melting
temperature and gel-checked for size and purity. All experiments were carried out in triplicate.
Western Blot:
Cells collected in RIPA buffer were diluted in Laemmli 2x with 5% b-mercaptoethanol
and loading buffer. Gels were made using TGX stain-free 7.5% acrylamide kit (Bio-Rad).
Proteins were transferred to a 0.45um nitrocellulose membrane using a transblot turbo.
Membranes were blocked for 1 hour in 5% BSA in tris-buffered saline and tween 20 (TBST)
Membranes were incubated overnight in a 1:1000 dilution of primary antibody in 2% BSA in
TBST. Proteins were visualized using HRP- (chemiluminescence) or fluorescent-tagged
secondary antibodies using a Chemidoc Imager (BioRad). Antibodies are listed as follows:
Vinculin (Cell Signaling Technologies), p-ACC (Cell Signaling Technologies), ACC (Cell
Signaling Technologies), p-AMPK (Cell Signaling Technologies), and AMPK (Cell Signaling
Technologies) and anti-rabbit IgG (Cell Signaling Technologies).
Triglyceride Assay:
A modified method for the Folch lipid extraction was used to extract the lipids from the
cell culture samples. 100uL of cell lysate was transferred into glass test tubes and all procedures
were conducted on ice. 3mL of chloroform: methanol (2:1) and a 1 mL of PBS was added to the
test tubes and vortexed for 20 seconds. After the chloroform settled, the samples were vortexed
for another 20 seconds. The tubes were centrifuged for 5 mins at 2000 RPM. Using the double
![Page 12: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/12.jpg)
11
pipette technique, the lower phase of the samples was transferred to another test tube. Samples
were dried down using a steady stream of nitrogen gas at 40° Celsius for 40 minutes. Dried samples
were placed on ice. For the triglyceride assay, a glycerol standard curve was made used using a
stock 10mM glycerol solution in 2-propanol. The following concentrations were used: 2mM,
1mM, 0.5mM, 0.25mM, 0.125mM, 0.0625mM, and a blank. The dried lipid was dissolved in 100
uL of 2-propanol and vortexed for 15 seconds. 10uL of sample was added to 150 uL of TG-SL
(Sekisui Chemical Co.) reagent and mixed for 1 min in the assay plates. The plates were allowed
to incubate in the dark for 10 minutes. Absorbance values were read at 505 nm and 660 nm. The
660 nm reading was subtracted from the 505 nm reading and the lipid concentration was
determined.
Statistics:
Analysis for statistics and all figures were made using the software Prism (GraphPad). A one way-
ANOVA was used to test for statistical significance. P-value less than 0.05 was taken as significant
difference.
Results
Methionine and choline deficiency increase mRNA expression of PPARa and CPT-1a while
adenosine reverses its effect in HepG2 cells
The expression of PPARa and CPT-1a mRNA was significantly increased in the MCD
condition (Fig. 3a/3d). OA-challenged MCD hepatocytes had more than double the PPARa
mRNA expression than the control MCD hepatocytes (Fig. 3d). OA is a known ligand for PPARa
which could explain the significant increase (Bensinger et al. 2008). Control MCD hepatocytes
treated with inosine had a similar increase in PPARa and CPT-1a expression as the control MCD
![Page 13: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/13.jpg)
12
hepatocytes (Fig. 3b/3e). However, adenosine was shown to lower the expression of PPARa and
CPT-1a back to baseline levels in the MCD condition (Fig.3). Furthermore, adenosine lowered
PPARa and CPT-1a expression in control and MCD cells (Fig. 3c/3f). These results suggest
adenosine reduces fatty acid b-oxidation while the MCD condition enhances this pathway.
Methionine and choline deficiency reduces lipid accumulation in cells while purines enhance lipid
accumulation in HepG2 cells
OA-challenged hepatocytes that were MCD had about half the number of total triglycerides
as compared to control hepatocytes (Fig. 4) agreeing with a condition of increased b-oxidation.
Results from our lab show that MCD is known to lower purine metabolites in mouse livers.
Treatment with adenosine or inosine, in control and MCD cells, showed an increase in total
triglyceride accumulation in HepG2 cells (Fig. 4). Perhaps hepatocytes treated with purines would
increase the pool of adenosine triphosphate and therefore would not need to oxidize as much fatty
acid.
Total ACC and p-ACC & Total AMPK and p-AMPK
Due to time constraints, this experiment was only completed on a single experiment.
Thus, no definitive conclusions can be made due to the lack of statistics. More experiments
would shed light these processes. However, MCD treatment appeared to increase total ACC
protein and cells incubated with adenosine potentially had a reduction in ACC protein regardless
of MCD or OA treatment (Fig. 5). Control cells treated with OA seemed to exhibit a higher ratio
of p-ACC/ACC while the treatment of adenosine in those cells seemed to have a much lower
ratio (Fig. 5). MCD cells potentially had a modest increase in total AMPK protein (Fig. 5b).
Treatment of cells with purines seem to lower total ACC protein (Fig. 5b).
![Page 14: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/14.jpg)
13
Discussion
The purpose of this study was to explore the effect of methionine choline deficiency and
treatment with purines on lipid accumulation in HepG2 cells. By identifying the effects, we can
have a better understanding of how these factors influence lipid metabolism in liver cells and hence
the pathogenesis of NAFLD/NASH in hopes of finding novel treatments. It was hypothesized that
MCD would cause HepG2 cells to have a higher expression of genes promoting b-oxidation
compared to control cells. We found that methionine and choline deficiency in HepG2 cells caused
a shift toward more fatty acid b-oxidization. MCD cells have increased mRNA expression of CPT-
1a and PPARa, lower total triglycerides and less total active ACC. This agrees with data from
mouse studies that used an MCD diet. MCD mice were found to have a lower body weight,
increased expression of CPT-1a and PPARa, and an increased expression of inactive ACC
(Machado et al. 2015). MCD cells are not storing or synthesizing lipids, but rather are oxidizing
lipids. Furthermore, other studies in our lab from MCD fed mice found that MCD mice have lower
hepatic ATP concentrations. Reduced levels of ATP would cause the cells to transport more fatty
acids into the mitochondria for oxidation to produce more energy molecules (Steinberg & Kemp
2008). These results suggest that methionine and choline deficiency cause cells to have an overall
increase in demand for cellular energy production.
Based on the results from Aymerich et al. 2006, we hypothesized that cells treated with
adenosine will have higher a higher expression of mRNA for CPT-1a and PPARa. We deduced
that treatment of extracellular adenosine would activate AMPK, thus inhibiting fatty acid synthesis
through AMPK’s regulatory role of inactivating ACC. Reduced fatty acid synthesis would promote
more b-oxidation and increase genes like CPT-1a and PPARa (Zeng 2014). We found treatment
with purines alone had no effect on lipid metabolism gene expression. However, treatment with
adenosine in MCD and lipid-challenged cells was found to lower mRNA expression for CPT-1a
![Page 15: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/15.jpg)
14
and PPARa and increase the levels of TG. Lipid-challenged control and MCD cells had lighter
bands for ACC protein and darker bands for AMPK protein, meaning that adenosine potentially
influences the turnover of these enzymes in cells This suggests that adenosine treated cells are not
synthesizing fatty acids, which agrees with the results from Park et al. 2012. There is less active
ACC protein and less expression of CPT-1a and PPARa which agree with the finding of elevated
triglycerides in these cells. These results led us to reject our hypothesis that adenosine increased
expression of genes promoting b-oxidation and lead us to believe adenosine has a role limiting
lipolysis or least ameileorating the enhanced lipid oxidation in MCD cells.
The purine salvage pathway and its role in synthesizing AMP that can activate AMPK was
considered as a potential mechanism for adenosine’s observed influence on lipid accumulation. In
the purine salvage pathway, purines are recycled to replenish levels of ATP (Asby et al. 2015).
Inosine, which is also a purine, can be used through a number of enymatic reactions to synthesize
AMPK, while adenosine can be phosphorylated to directly produce AMP. Since inosine did not
have the same effect as adenosine on lipid metabolism, we are ruling out the purine salvage
pathway as a mechanism . More experiments are needed to further understand the mechanism
behind the observed effecst.
Methionine and choline deficient cells could have a role in increasing total AMPK. An
increase in AMPK could potentially mean that there is more inactive ACC in liver cells. In muscle
cells, it was found that higher levels of AMPK increase the phosphorylation and inactivation of
ACC (Park et al. 2002). We found that in the MCD cells, there was also fewer total triglycerides.
AMPK could have a role in conserving ATP by inhibiting lipogenesis. Furthermore, more total
AMPK could be a response to the cells having a higher ratio of AMP:ATP. Increased AMPK might
be an attempt to maintain energy homeostasis in the known energy challenged state during
methionine and choline deficiency. Active AMPK was increased in cells that were energy
![Page 16: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/16.jpg)
15
challenged and more AMPK could lead to less hepatic lipid accumulation in mice (Foretz, Even,
& Viollet 2018)
OA-treatment on control cells was found to induce a large ratio of p-ACC/ACC. We
expected this change because the cells do not need to synthesize lipids if they were treated with
excess lipid. A higher p-ACC/ACC ratio would suggest inactive lipogenesis. However, treatment
with adenosine in these cells potentially decreased the p-ACC/ACC ratio by a large amount and
showed less intense bands for total ACC in lipid challenged and MCD cells. Adenosine could
potentially have a role in halting lipid metabolism by regulating protein expression and activity of
AMPK and ACC. More experiments need to be completed in order to confirm the mechanisms
that are responsible for these observations.
For future experiments, the ratio of SAM/SAH should be quantified in the same treatment
groups as explored in this study. The SAM/SAH ratio would indicate the ability of the cell to carry
out methylation reactions necessary in maintaining macronutrient homeostasis. Also, exploring
more genes such as sterol regulatory element binding protein-1c (SREBP-1c) and fatty acid
synthase (FAS) would be useful in gaining more insight into the lipid metabolism in HepG2 cells.
Total protein SREBP-1C and FAS should also be measured. SREBP-1c is a transcription factor
that is activated by insulin and regulates a number of enzymes involved in lipid metabolism (Ferre
& Foufelle 2007) while FAS is the enzyme responsible for de novo fatty acid synthesis. These
types of experiments and others would complement our AMPK and ACC data and give a better
picture if the cells are in a lipogenesis or lipolysis.
To summarize, HepG2 cells under a methionine and choline deficient condition increased
fatty acid oxidation and prevented cells from lipid-loading after treatment with exogenous fatty
acids. Addition of excess purine molecules exacerbated lipid-loading in HepG2 cells in all
conditions by decreasing fatty acid oxidation and potentially by increasing fatty acid synthesis.
![Page 17: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/17.jpg)
16
These results suggest that impaired adenosine production in the MCD condition may reduce the
inhibition of fatty acid synthesis and result in enhanced lipid oxidation.
Acknowledgements
I first and foremost thank my mentors, Dr. Robin da Silva and Brandon Eudy for their
guidance, encouragement, and patience throughout this project. Without them, I would not have
been able to complete my honors thesis. I would also like to thank Caitlin McDermott for her
constant help and support with my lab work.
Figure 1. One-Carbon Cycle
This image simplifies One-Carbon Metabolism (1-CC). The purpose of this image is to show that
the 1-CC participates in amino acid synthesis, methylation reactions, and shows adenosine as a
product of from the conversion of SAM to homocysteine. Furthermore, figure 1 shows the complex
interactions or the ‘network’ that the one-carbon cycle encompasses. (Kharbanda 2009).
![Page 18: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/18.jpg)
17
Figure 2.
Phosphatidylcholine Synthesis
Fig. 2 simplifies phosphatidylcholine (PC) synthesis. It shows that PC can be synthesized through
the Kennedy pathway or the PEMT pathway. The PEMT pathway interacts with the One-Carbon
Cycle as pictured above (Michel & Yuan 2006).
Table 1. Summary of Treatment Groups
Abbreviation Treatment
T Control
MCD Methionine Choline Deficient
Veh Vehicle
Ado Adenosine
Ino Inosine
OA Oleic Acid
![Page 19: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/19.jpg)
18
Figure 3. Methionine and choline deficiency increases mRNA expression of PPARa and CPT-1a
while adenosine reverses its effect in HepG2 cells
a-f represent the fold change (2^-DDCT) of mRNA between treatment groups for the genes CPT-
1a and PPARa. Different letters denote statistical differences between treatment groups. A one-
way ANOVA was used to test for statistical significance and reported as a mean ± the standard
deviation. (n=3) P<.05.
![Page 20: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/20.jpg)
19
Figure 4.
Methionine and choline deficiency reduces lipid accumulation in cells while purines enhance
lipid accumulation in HepG2 cells
This figure shows the values of total triglycerides as measured in HepG2 cells as cultured control
and MCD medium using the Folch extraction. Triglycerides are measured in nanomoles of TG
per milligram of protein. Different letters denote statistical differences between treatment groups.
A one-way ANOVA was used to test for statistical significance and reported as a mean ± the
standard deviation. (n=3) P<.05.
![Page 21: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/21.jpg)
20
Figure 5.
Adenosine lowers total ACC in control and MCD hepatocytes
Representative western blot for total ACC, p-ACC, total AMPK, and p-AMPK from HepG2 cells
cultured in control and MCD medium. Vinculin was used as a loading control. The experiment is
an n=1. Data was normalized to the loading control and expressed as a ratio that is further
normalized to the vehicle.
A.
B.
![Page 22: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/22.jpg)
21
Works Cited
Asby, DJ., F. Cuda, M. Beyaert, F.D. Houghton, Felino R. Cagampang, A. Tavassoli, (2015). AMPK Activation via Modulation of De Novo Purine Biosynthesis with an Inhibitor of ATIC Homodimerization. Chemistry & Biology, 22, (7). 838-848,
Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J., & Pastor-Anglada, M. (2006). Extracellular
adenosine activates AMP-dependent protein kinase (AMPK). Journal of Cell Science, 119(8), 1612.
Benedict, M., & Zhang, X. (2017). Non-alcoholic fatty liver disease: An expanded review. World
Journal of Hepatology, 9(16), 715-732. Bensinger SJ, Tontonoz P. (2008).Integration of metabolism and inflammation by lipid-activated
nuclear receptors. Nature. 454(7203):470–7. Buzzetti, E., Pinzani, M., & Tsochatzis, E. A. The multiple-hit pathogenesis of non-alcoholic fatty
liver disease (NAFLD). Metabolism - Clinical and Experimental, 65(8), 1038-1048. Chatelain F, Kohl C, Esser V, McGarry JD, Girard J, Pegorier JP. Cyclic AMP and fatty acids
increase carnitine palmitoyltransferase I gene transcription in cultured fetal rat hepatocytes. Eur J Biochem. 1996;235:789–98.
Cole, L. K., Vance, J. E., & Vance, D. E. (2012). Phosphatidylcholine biosynthesis and lipoprotein
metabolism. Triglyceride Metabolism and Disease, 1821(5), 754-761. de Alwis, N. M. W., & Day, C. P. Non-alcoholic fatty liver disease: The mist gradually clears.
Journal of Hepatology, 48, S104-S112. Dowman, J. K., Tomlinson, J. W., & Newsome, P. N. (2010). Pathogenesis of non-alcoholic fatty
liver disease. QJM: An International Journal of Medicine, 103(2), 71-83. Ferre, P. and Foufelle, F. (2007). SREBP1c Transcription factor and lipid homeostasis: Clinical
Perspective. Hormone research in pediatrics. 68(2). 72-82. Foretz, M., Even, P. C., & Viollet, B. (2018). AMPK Activation Reduces Hepatic Lipid Content
by Increasing Fat Oxidation In Vivo. International Journal of Molecular Sciences, 19(9), 2826.
Iyer, S. S., & Cheng, G. (2012). Role of Interleukin 10 Transcriptional Regulation in Inflammation
and Autoimmune Disease. Critical reviews in immunology, 32(1), 23-63. Jacobs R.L., van der Veen JN, Vance DE. Finding the balance: the role of S-adenosylmethionine
and phosphatidylcholine metabolism in development of nonalcoholic fatty liver disease. Hepatology (Baltimore, Md) 2013;58(4):1207–1209.
![Page 23: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/23.jpg)
22
Kharbanda, K. (2009). Alcoholic Liver Disease and Methionine Metabolism. Thieme Publishing: Seminars in Liver Disease.
Mato, J. M., Martínez-Chantar, M. L., & Lu, S. C. (2013). S-adenosylmethionine metabolism and
liver disease. Annals of hepatology, 12(2), 183-189. Machado, M. V., Michelotti, G. A., Xie, G., Almeida Pereira, T., Boursier, J., Bohnic, B., …
Diehl, A. M. (2015). Mouse models of diet-induced nonalcoholic steatohepatitis reproduce the heterogeneity of the human disease. PloS one, 10(5).
Mentch, S. J., & Locasale, J. W. (2016). One-carbon metabolism and epigenetics: understanding
the specificity. Annals of the New York Academy of Sciences, 1363(1), 91-98. Michel, V., Yuan, Z., Ramsubir, S., & Bakovic, M. (2006). Choline transport for phospholipid
synthesis. Experimental biology and medicine, 231 5, 490-504. S. H. Park, S. R. Gammon, J. D. Knippers, S. R. Paulsen, D. S. Rubink, and W. W. Winder.
(2002). Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. Journal of Applied Physiology. 292:6, 2475-2482
Park, H. G., Yu, H. S., Kim, M. K., Kim, Y. S., Kim, S. H., Kang, U. G., & Ahn, Y. M. (2012).
The effect of clozapine on the AMPK-ACC-CPT1 pathway in the rat frontal cortex. International Journal of Neuropsychopharmacology, 15(7), 907-917.
Perla, F. M., Prelati, M., Lavorato, M., Visicchio, D., & Anania, C. (2017). The Role of Lipid and
Lipoprotein Metabolism in Non-Alcoholic Fatty Liver Disease. Children (Basel, Switzerland), 4(6), 46.
Ruderman, NB, Saha, AK, Kraegen EW (2003). Minireview: malonyl CoA, AMP-activated
protein kinase, and adiposity. Endocrinology. 144, 5166–5171. Sherriff, J. L., O'Sullivan, T. A., Properzi, C., Oddo, J.-L., & Adams, L. A. (2016). Choline, Its
Potential Role in Nonalcoholic Fatty Liver Disease, and the Case for Human and Bacterial Genes. Advances in nutrition (Bethesda, Md.), 7(1), 5-13.
Song, Shulan et al. “Peroxisome proliferator activated receptor alpha (PPARalpha) and PPAR
gamma coactivator (PGC-1alpha) induce carnitine palmitoyltransferase IA (CPT-1A) via independent gene elements.” Molecular and cellular endocrinology vol. 325,1-2 (2010): 54-63. doi:10.1016/j.mce.2010.05.019
Steinberg, G. R., & Kemp, B. E. (2009). AMPK in Health and Disease. Physiological Reviews,
89(3), 1025-1078. Takaki, A., Kawai, D., & Yamamoto, K. (2013). Multiple Hits, Including Oxidative Stress, as
Pathogenesis and Treatment Target in Non-Alcoholic Steatohepatitis (NASH). International Journal of Molecular Sciences, 14(10), 20704-20728.
![Page 24: EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA … · 2019. 4. 20. · protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway. Aim The primary goal of this thesis is](https://reader033.vdocuments.mx/reader033/viewer/2022060805/608983b4973ef95e1854adc5/html5/thumbnails/24.jpg)
23
Virmani, A., Pinto, L., Bauermann, O. et al. The Carnitine Palmitoyl Transferase (CPT) System and Possible Relevance for Neuropsychiatric and Neurological Conditions. Mol Neurobiol (2015) 52: 826
Wagner, C., Vance, D. E., Brosnan, J. T., Brosnan, M. E., Jacobs, R. L., Allen, R. H., . . . Mudd, S. H. (2007). Methyl balance and transmethylation fluxes in humans. The American Journal of Clinical Nutrition, 85(1), 19-25.
Walker, A. K. (2017). 1-Carbon Cycle Metabolites Methylate Their Way to Fatty Liver. Trends in
endocrinology and metabolism: TEM, 28(1), 63-72. Watkins SM, Zhu X, Zeisel SH. Phosphatidylethanolamine-N-methyltransferase activity and
dietary choline regulate liver-plasma lipid flux and essential fatty acid metabolism in mice. Journal of Nutrition. 2003;133(11):3386–91.
Woods, A., Williams, J. R., Muckett, P. J., Mayer, F. V., Liljevald, M., Bohlooly-Y, M., & Carling,
D. (2017). Liver-Specific Activation of AMPK Prevents Steatosis on a High-Fructose Diet. Cell reports, 18(13), 3043-3051.
Zeisel, S. H., & da Costa, K.-A. (2009). Choline: an essential nutrient for public health. Nutrition
Reviews, 67(11), 615-623. Zeng, L., Tang, W. J., Yin, J. J., & Zhou, B. J. (2014). Signal transductions and nonalcoholic
fatty liver: a mini-review. International journal of clinical and experimental medicine, 7(7), 1624–1631.