EFFECTS OF ADENOSINE ON LIPID ACCUMULATION IN A HUMAN HEPATOMA CELL CULTURE MODEL WHEN CHALLENGED WITH EXCESS FATTY ACID

Undergraduate Honors Thesis

Michael B. Brown Major in Biology Thesis Advisor: Dr. Robin da Silva

College of Agricultural and Life Sciences | University of Florida 2019

1

Abstract

Non-alcoholic fatty liver disease (NAFLD) is the most prevalent liver disorder in western

populations. Fully understanding lipid metabolism in the liver is necessary for further

understanding the progression of NAFLD to non-alcoholic steatohepatitis (NASH) and in finding

an alternative treatment to weight loss for those diagnosed with NAFLD. HepG2 cells treated with

oleic acid (OA) were used as a model of liver cell lipid accumulation. Methionine, choline and

purines are important metabolites and nutrients that are dysregulated in NAFLD, so we used

methionine and choline deficiency (MCD) and excess purines in cultured HepG2 cells to assess

the influence of these conditions. Triglyceride accumulation and the gene and protein expression

of regulators of lipid metabolism were analyzed. MCD HepG2 cells had fewer total triglycerides

and had higher expression of carnitine palmitoyltransferase 1 a (CPT-1a) and PPARa, genes

involved in b-oxidation, as compared to control cells. MCD cells treated with extracellular

adenosine or inosine with OA lowered phosphorylated-acetyl-CoA carboxylase (p-ACC).

Adenosine was found to affect lipid metabolism through its role in activating AMP-activated

protein kinase (AMPK) in the AMPK-ACC-CPT 1 pathway.

Aim

The primary goal of this thesis is to observe lipid accumulation in a human hepatoma

(HepG2) cells under various metabolic conditions. Specifically, lipid accumulation and changes

in gene expression and total protein expression of key regulators in fatty acid metabolism in HepG2

cells when influenced by methionine and choline deficiency and challenged with excess fatty acid.

Furthermore, can the treatment of HepG2 cells with the purines adenosine or inosine ameliorate

lipid loading and positively influence lipid metabolism. Cells cultured in a methionine and choline-

deficient medium and treated with OA are expected higher expression of genes promoting b-

2

oxidation compared to control cells. Methionine and choline deficiency are known to hinder the

transport of lipids out of the liver by means of lipoproteins. The presence of more lipid in the liver

cells tends to lead to an increase in b-oxidation as the cells metabolize the extra lipid in order to

maintain lipid homeostasis. Research shows that extracellular adenosine can activate AMP-

activated protein kinase (AMPK). Active AMPK inhibits a main regulator of fatty acid synthesis

(ACC). Thus, shifting lipid metabolism from lipid synthesis to b-oxidation. Therefore, I expect

cells treated with adenosine to have a higher expression of genes promoting b-oxidation as

compared to control cells.

Introduction

Non-Alcoholic Fatty Liver Disease (NAFLD) is characterized by the deposition of free-

fatty acids and triglycerides in the liver that can cause damage to liver tissue. NAFLD has become

the most prevalent liver disorder in western populations (Benedict & Zhang, 2017). It is estimated

that NAFLD has affected up to a third of individuals worldwide (de Alwis & Day, 2008). It

encompasses a range of disease severity from modest steatosis, which is the accumulation of fat

in liver cells due to disruption in metabolism, to more advanced forms of steatosis with hepatitis,

cirrhosis, and fibrosis (Benedict & Zhang, 2017). Furthermore, the rise of NAFLD and its more

severe form, Non-Alcoholic Steatohepatitis (NASH) has accompanied the rise of obesity in

America. It is estimated that in Western populations, NAFLD can be present in approximately

30% of the population, and up to 90% in individuals who are morbidly obese (Dowman,

Tomlinson, & Newsome, 2010). While NAFLD affects a large population, a smaller number of

patients with NAFLD, around 4-5%, will progress to NASH with more severe steatosis, fibrosis,

and inflammation (Buzzetti, Pinzani, & Tsochatzis, 2016). NAFLD is also closely associated with

increased insulin resistance (IR), diabetes, metabolic syndrome, and dyslipidemia (de Alwis &

3

Day, 2008). Projections show that within the next 20 years, NAFLD will become the leading cause

of liver transplantation and the leader in liver-related deaths (Benedict & Zhang, 2017).

There are very few options for patients suffering from NAFLD/NASH other than a change

in diet and lifestyle. Since NAFLD is strongly correlated with obesity, weight loss is a primary

treatment to ameliorate the fat content of the liver. However, weight loss can be difficult to achieve

and maintain. There are some medications that are used in the treatment of NAFLD/NASH but

there is no “silver bullet” to restrain the growing problem. It is important to understand the

progression and pathogenesis of NAFLD to NASH in order to properly treat these patients. The

most common theory used to characterize the pathogenesis of NASH is the ‘multi-hit hypothesis’.

The factors or ‘hits’ thought to be responsible for the development of a ‘fatty liver’ are diet,

environmental factors, and genetic factors, which lead to obesity, IR, and abnormal liver

metabolism (Buzzetti, Pinzani, & Tsochatzis, 2016). This results in an increase of free fatty acids

and triglycerides in hepatic cells, ultimately leading to lipotoxicity, which induces mitochondrial

damage, oxidative stress, and hinders DNA repair (Buzzetti, Pinzani, & Tsochatzis, 2016). These

sources of cellular stress induce an inflammatory response. Patients with NASH show increased

hepatic inflammation along with more expression of pro-inflammatory cytokines, such as TNF-a,

IL-1B, and IL-6 (Takaki, Kawai, & Yamamoto, 2013). In those diagnosed with NASH, the pro-

inflammatory signal elevates and never drops down back to baseline levels. An inflammatory

response can disrupt cell membranes and promote cell death and cell stress. In NASH patients,

chronic inflammation occurring over time results in liver tissue damage. Reducing the

inflammatory response and decreasing fatty acid and triglycerides in the liver shows promise in

helping NASH patients reverse liver damage and reduce patients with NAFLD from progressing

to NASH.

4

Research has shown the adenosine receptors are promising targets for reducing

inflammation, however, the exact mechanisms that explain this effect are not well understood.

Preliminary results in our lab have shown that that the adenosine receptors can increase secretions

of the anti-inflammatory cytokine IL-10. Interlukin-10 plays a central role in immune signaling by

maintaining and controlling pro-inflammatory responses (Iyer & Cheng, 2012). Adenosine and the

adenosine receptors have been explored as a mechanism to reduce the pro-inflammatory response

in hepatic cells, but not investigated for their potential role in regulating lipid metabolism.

Therefore, this study will focus on understanding how purine metabolism relates to hepatic lipid

content and explore the role of purines, such as adenosine, and their potential to influence lipid

metabolism.

One-carbon Metabolism and Phosphatidylcholine Synthesis

The liver has a role in almost all the metabolic processes in the human body and it plays a

major role in macronutrient metabolism. There exists a connection to the one-carbon cycle or the

folate cycle (Walker 2016). The one-carbon cycle is a ‘network’ or a series of reactions

incorporating the folate cycle and methionine cycle (Mentch & Locasale 2015). The one-carbon

cycle showcases anabolic processes such as purine and pyrimidine synthesis, amino acid synthesis,

and transmethylation reactions (Mato et al. 2013). A series or cycle of reactions that is highlighted

in the one-carbon cycle is the conversion of the amino acid methionine to homocysteine. This

conversion maintains cellular homeostasis and nutrient availability (Mentch & Locasale 2015).

About 50% of all methionine metabolism takes place in the liver, along with 85% of the

transmethylation reactions that occur in the human body (Mato et al. 2013). In the one-carbon

cycle, methionine is converted to the methyl donor S-adenosylmethionine (SAM) with the addition

of an adenosyl group by the enzyme methionine adenosyltransferase (Figure 1). Transmethylation

5

is a reaction in which a methyl group is transferred from a molecule of SAM to an acceptor

molecule. SAM participates as a methyl donor in nucleic acid methylation, amino acid

methylation, and phospholipid methylation. These reactions can regulate a range of cellular

processes including gene expression and lipid metabolism. Phospholipid methylation through the

one-carbon cycle in the liver is of interest to those studying NAFLD because of its link to lipid

levels in the liver.

The nutrient choline is required in phospholipid synthesis and is essential to synthesize

phosphatidylcholine (PC) (Zeisel 2009). There are two pathways to synthesize PC, the Kennedy

pathway and the phosphatidylethanolamine methyltransferase (PEMT) pathway. The Kennedy

pathway is the de novo synthesis of PC from choline (Figure 2). PEMT is a liver specific enzyme

and it accounts for almost a third of PC synthesis in the liver (Stead et al. 2006). The PEMT

pathway utilizes the methylation faculty of the one-carbon cycle to synthesize PC from

phosphatidylethanolamine (PE). Thus, SAM is an essential metabolite in the production of

phosphatidylcholine, acting as the methyl donor in the conversion of PE to PC. The PEMT

pathway relies on the one carbon cycle for its supply of SAM. In liver cells with a high demand

for PC, as much as 40% of SAM is used for the production of PC (Watkins et al. 2003). Individuals

who have diets low in choline and PC turn to de novo production of PC through the PEMT pathway

which happens primarily in the liver (Sherriff 2016).

PC is also a necessary building block of lipoproteins. Very low-density lipoproteins

(VLDL) and high-density lipoproteins (HDL) are tasked with the mobilization of triglycerides and

cholesterol from the liver to other parts of the body. Disruption in the synthesis of PC has been

shown to decrease the levels of VLDL and HDL (Cole & Vance 2012). Decreased levels of

lipoprotein hinder the liver’s ability to mobilize fats outside of hepatic cells. This results in an

increase in the livers lipid pool and is thought to eventually lead to steatosis. In those affected with

6

NAFLD, it is known that the metabolites SAM and PC are correlated with initial liver lipid

accumulation which is the most direct link to the one carbon cycle (Jacobs et al. 2013).

Methionine and choline deficient diet feeding in mice is a widely used model for the study

of NAFLD and NASH. Since methionine is essential for the production of SAM, lower levels of

methionine lead to a smaller pool of available SAM. This directly impacts the liver’s ability to

synthesize PC through the PEMT pathway. Furthermore, choline deficiency impairs the synthesis

of PC from choline. Lower levels of PC lead to lower levels of lipoproteins and ultimately increase

the lipid pool inside of hepatic cells. This increase in lipid is thought to contribute to the

inflammatory condition seen in NAFLD.

Lipid Metabolism and Regulation by Purines

There are three sources of lipid that the body can use for energy. Lipid can be obtained

from dietary sources, storages in adipose tissue, or it can be synthesized in the liver from non-fat

nutrients. Lipid metabolism can be conceptualized as a switch with two states: lipolysis or

lipogenesis. Previous studies have shown that when metabolism is shifted toward lipolysis, hepatic

cells can reduce lipid accumulation and lower the effects of lipotoxicity (Steinberg & Kemp 2008).

One of the regulatory proteins that can control lipid and energy metabolism in cells is called AMP-

activated protein kinase (AMPK). AMPK is an energy sensor of the AMP:ATP ratio in the body

and it is activated during states of energy depletion or states of high levels of AMP. It is a regulator

of hepatic lipid metabolism through the phosphorylation of the rate-limiting enzyme acetyl-CoA

carboxylase (ACC) (Woods et al. 2017). During fatty acid synthesis, acetyl-CoA is converted to

malonyl-CoA by ACC. In its phosphorylated form, ACC is inactive, and therefore, cells would no

longer synthesize fatty acids. AMPK activation is also known to reduce hepatic lipid content by

7

increaseing b-oxidation (Foretz, Even, & Viollet, 2018). Treatment of extracellur adenosine has

previously been found been found to activate AMPK (Aymerich et al. 2006).

Adenosine is a purine molecule that plays a role in metabolism and inflammation. It is a

byproduct of the one carbon cycle during the conversion of SAH to homocystiene. A low

methylation potential or a low SAM:SAH ratio, as seen in methionine deficiency, can lower

adenosine production through the methionine cycle. Treatment with extracellular adenosine, in an

epithelial cell line (IEC-6), has been found to activate AMPK (Aymerich et al. 2006). In the study

by Americh et al. 2006, AMPK activated by adenosine was able to phosphorylate and innactivate

ACC (Aymerich et al. 2006). Treatment with purines such as adenosine could also play a role in

the expression of genes involved lipid metabolism through the regulation of fatty acid synthesis

and oxidation. This paper will explore two genes that are involved in the regulation of fatty acid

b-oxidation: CPT-1a and PPARa. Carnitine palmitoyltransferase-1 (CPT-1) and peroxisome

proliferator activated receptor alpha (PPARa) are involed in fatty acid oxidation.

Peroxisome proliferating activating receptor (PPARa) is a powerful transcriptional

regulator present in the liver that is activated by fatty acids. Activation of PPARa enhances the

expression of genes involved in fatty acid and glucose oxidation (Chatelain et al. 1996) Most

importantly, PPARa was found to directly induce carnitine palmitoyltransferase (CPT-1a)

expression by binding as a transcription factor in the CPT-1a gene (Song et al. 2011). CPT-1a is

a multi-protein complex expressed in almost every cell and it is located on the outer membrane of

the mitochondira (Virmani et al. 2015). It is the rate limiting enzyme involed in transporting long

chain fatty acids into the mitochondia to be oxidized (Ruderman et al 2003). Increased expression

of the CPT-1a gene would promote more oxidation of fatty acids. I expect the expression of CPT-

1a and PPARa to have a direct relationship in the cells. This current work will explore two genes:

CPT-1a and PPARa.

8

The product of ACC, malonyl-CoA, is an allosteric inhibitor of CPT-1a and thus, AMPK

is a part of a regulatory pathway that influences ACC activity, thereby regulating CPT-1a activity

(Park et al. 2012). Their relationship is known as the AMPK-ACC-CPT-1a pathway. Since

adenosine was found to activate AMPK, I expect extracelluar treatment of adensosine to have an

effect on the expression of CPT-1a and PPARa.. In those living with NAFLD it is hypothesized

that inhibiting fatty acid synthesis and promoting b-oxidation could offer a potential solution to

those suffering from steatosis of the liver. This paper looks to examine key regulatory steps that

are altered in response to lipid loading, exogenous purine, and MCD.

Methods

Cell Culture:

Human hepatoma HepG2 cells were cultured using MEM medium containing 10% fetal

bovine serum, 100 mg/ml of gentamycin, and 1mM of sodium pyruvate. The cells were incubated

in a humidified atmosphere of 5% CO2 at 37° Celsius using 100mm corning cell culture dishes.

For each cell passage, the medium in each dish was discarded, and each dish was washed with

2mL of PBS. 1mL of trypsin was added to each dish and allowed to incubate at 37° Celsius for 2-

3 mins. 3 mL of fresh MEM medium was added to stop the trypsinization. The cells were collected

in a sterile 50 mL tube and spun down at 1000 rpm for 3 mins using a centrifuge. The supernatant

was poured off and cells were resuspended in an appropriate amount of medium. Dishes should

have a 1:4 sub-cultivation ratio at high confluency. Dishes were usually split at 1:2 sub-cultivation

ratio at medium confluency to avoid cell overcrowding and clumping. Cells were passaged every

two days. For experiments, cells were cultured either in MEM treatment medium or methionine

and choline deficient medium (MCDM) containing gentamycin and sodium pyruvate. For

experiments, 20 x 10^5 cells plated on 100mm corning cell culture dishes and cells were incubated

9

in 6mL of either treatment MEM or MCDM for 16 hours before treatments were added. Cells were

treated with 10mM at 100ul/mL of adenosine or inosine and 7.5mM OA in 10% BSA at 80uL/ml

for a four-hour incubation period. Cells were collected in either PBS, RNA-later (RLT) buffer or

RIPA buffer and stored at -80° Celsius for further analysis. Cells collected in PBS were analyzed

for total triglycerides. Cells collected in RLT buffer were used for qPCR analysis. Cells collected

in RIPA buffer were collected for analysis by western blot.

Quantitative real-time polymerase chain reaction:

Total RNA was isolated using the Qiagen RNA isolation kit according to the manufacturer

protocol. Isolated RNA was checked for purity and concentration using a nanophotometer

(Implen). RNA samples were diluted to 200ng/uL using molecular grade water. cDNA was

constructed using the Applied Biosystems cDNA synthesis kit. The program “App Bio HC RT”

was run on the thermocycler for at 25°C for 10mins, 37°C for 120 mins, 85°C for 5 mins. For

qPCR, the master mix contained 10x RT buffer, 25x dNTP, 10x Random primers, reverse

transcriptase and molecular grade water at a 1:1 ratio with RNA. The primers CPT1-a and PPAR-

a were used for qPCR. Primer sequences used for the detection of genes were designed as follows:

CPT1a Forward – 5’ TGAGTGGCGTCCTCTTTGG 3’,

CPT-1a Reverse – 5’ CAGCGAGTAGCGCATAGTCATG3’

PPARa-Forward -- 5’GACCTGAAAGATTCGGAAACT3’

PPARa Reverse – 5’CGTCTTCTCGGCCATACAC3’

CYBB Forward – 5’GACTGGACGGAGGGGCTAT 3’

CYBB Reverse – 5’CTTGAGAATGGAGGCAAAGG3’

10

Cyclophilin B was used as a house keeping gene for reference CT values. SYBR green was used

as the detection dye and cycled at 95°C for 15 seconds and 60°C for 2 mins using a Quantstudio

3. Comparative quantification of RNA was expressed as the fold-change for each gene compared

to that of cyclophilin B using the 2^-DDCT method. All PCR products were checked for melting

temperature and gel-checked for size and purity. All experiments were carried out in triplicate.

Western Blot:

Cells collected in RIPA buffer were diluted in Laemmli 2x with 5% b-mercaptoethanol

and loading buffer. Gels were made using TGX stain-free 7.5% acrylamide kit (Bio-Rad).

Proteins were transferred to a 0.45um nitrocellulose membrane using a transblot turbo.

Membranes were blocked for 1 hour in 5% BSA in tris-buffered saline and tween 20 (TBST)

Membranes were incubated overnight in a 1:1000 dilution of primary antibody in 2% BSA in

TBST. Proteins were visualized using HRP- (chemiluminescence) or fluorescent-tagged

secondary antibodies using a Chemidoc Imager (BioRad). Antibodies are listed as follows:

Vinculin (Cell Signaling Technologies), p-ACC (Cell Signaling Technologies), ACC (Cell

Signaling Technologies), p-AMPK (Cell Signaling Technologies), and AMPK (Cell Signaling

Technologies) and anti-rabbit IgG (Cell Signaling Technologies).

Triglyceride Assay:

A modified method for the Folch lipid extraction was used to extract the lipids from the

cell culture samples. 100uL of cell lysate was transferred into glass test tubes and all procedures

were conducted on ice. 3mL of chloroform: methanol (2:1) and a 1 mL of PBS was added to the

test tubes and vortexed for 20 seconds. After the chloroform settled, the samples were vortexed

for another 20 seconds. The tubes were centrifuged for 5 mins at 2000 RPM. Using the double

11

pipette technique, the lower phase of the samples was transferred to another test tube. Samples

were dried down using a steady stream of nitrogen gas at 40° Celsius for 40 minutes. Dried samples

were placed on ice. For the triglyceride assay, a glycerol standard curve was made used using a

stock 10mM glycerol solution in 2-propanol. The following concentrations were used: 2mM,

1mM, 0.5mM, 0.25mM, 0.125mM, 0.0625mM, and a blank. The dried lipid was dissolved in 100

uL of 2-propanol and vortexed for 15 seconds. 10uL of sample was added to 150 uL of TG-SL

(Sekisui Chemical Co.) reagent and mixed for 1 min in the assay plates. The plates were allowed

to incubate in the dark for 10 minutes. Absorbance values were read at 505 nm and 660 nm. The

660 nm reading was subtracted from the 505 nm reading and the lipid concentration was

determined.

Statistics:

Analysis for statistics and all figures were made using the software Prism (GraphPad). A one way-

ANOVA was used to test for statistical significance. P-value less than 0.05 was taken as significant

difference.

Results

Methionine and choline deficiency increase mRNA expression of PPARa and CPT-1a while

adenosine reverses its effect in HepG2 cells

The expression of PPARa and CPT-1a mRNA was significantly increased in the MCD

condition (Fig. 3a/3d). OA-challenged MCD hepatocytes had more than double the PPARa

mRNA expression than the control MCD hepatocytes (Fig. 3d). OA is a known ligand for PPARa

which could explain the significant increase (Bensinger et al. 2008). Control MCD hepatocytes

treated with inosine had a similar increase in PPARa and CPT-1a expression as the control MCD

12

hepatocytes (Fig. 3b/3e). However, adenosine was shown to lower the expression of PPARa and

CPT-1a back to baseline levels in the MCD condition (Fig.3). Furthermore, adenosine lowered

PPARa and CPT-1a expression in control and MCD cells (Fig. 3c/3f). These results suggest

adenosine reduces fatty acid b-oxidation while the MCD condition enhances this pathway.

Methionine and choline deficiency reduces lipid accumulation in cells while purines enhance lipid

accumulation in HepG2 cells

OA-challenged hepatocytes that were MCD had about half the number of total triglycerides

as compared to control hepatocytes (Fig. 4) agreeing with a condition of increased b-oxidation.

Results from our lab show that MCD is known to lower purine metabolites in mouse livers.

Treatment with adenosine or inosine, in control and MCD cells, showed an increase in total

triglyceride accumulation in HepG2 cells (Fig. 4). Perhaps hepatocytes treated with purines would

increase the pool of adenosine triphosphate and therefore would not need to oxidize as much fatty

acid.

Total ACC and p-ACC & Total AMPK and p-AMPK

Due to time constraints, this experiment was only completed on a single experiment.

Thus, no definitive conclusions can be made due to the lack of statistics. More experiments

would shed light these processes. However, MCD treatment appeared to increase total ACC

protein and cells incubated with adenosine potentially had a reduction in ACC protein regardless

of MCD or OA treatment (Fig. 5). Control cells treated with OA seemed to exhibit a higher ratio

of p-ACC/ACC while the treatment of adenosine in those cells seemed to have a much lower

ratio (Fig. 5). MCD cells potentially had a modest increase in total AMPK protein (Fig. 5b).

Treatment of cells with purines seem to lower total ACC protein (Fig. 5b).

13

Discussion

The purpose of this study was to explore the effect of methionine choline deficiency and

treatment with purines on lipid accumulation in HepG2 cells. By identifying the effects, we can

have a better understanding of how these factors influence lipid metabolism in liver cells and hence

the pathogenesis of NAFLD/NASH in hopes of finding novel treatments. It was hypothesized that

MCD would cause HepG2 cells to have a higher expression of genes promoting b-oxidation

compared to control cells. We found that methionine and choline deficiency in HepG2 cells caused

a shift toward more fatty acid b-oxidization. MCD cells have increased mRNA expression of CPT-

1a and PPARa, lower total triglycerides and less total active ACC. This agrees with data from

mouse studies that used an MCD diet. MCD mice were found to have a lower body weight,

increased expression of CPT-1a and PPARa, and an increased expression of inactive ACC

(Machado et al. 2015). MCD cells are not storing or synthesizing lipids, but rather are oxidizing

lipids. Furthermore, other studies in our lab from MCD fed mice found that MCD mice have lower

hepatic ATP concentrations. Reduced levels of ATP would cause the cells to transport more fatty

acids into the mitochondria for oxidation to produce more energy molecules (Steinberg & Kemp

2008). These results suggest that methionine and choline deficiency cause cells to have an overall

increase in demand for cellular energy production.

Based on the results from Aymerich et al. 2006, we hypothesized that cells treated with

adenosine will have higher a higher expression of mRNA for CPT-1a and PPARa. We deduced

that treatment of extracellular adenosine would activate AMPK, thus inhibiting fatty acid synthesis

through AMPK’s regulatory role of inactivating ACC. Reduced fatty acid synthesis would promote

more b-oxidation and increase genes like CPT-1a and PPARa (Zeng 2014). We found treatment

with purines alone had no effect on lipid metabolism gene expression. However, treatment with

adenosine in MCD and lipid-challenged cells was found to lower mRNA expression for CPT-1a

14

and PPARa and increase the levels of TG. Lipid-challenged control and MCD cells had lighter

bands for ACC protein and darker bands for AMPK protein, meaning that adenosine potentially

influences the turnover of these enzymes in cells This suggests that adenosine treated cells are not

synthesizing fatty acids, which agrees with the results from Park et al. 2012. There is less active

ACC protein and less expression of CPT-1a and PPARa which agree with the finding of elevated

triglycerides in these cells. These results led us to reject our hypothesis that adenosine increased

expression of genes promoting b-oxidation and lead us to believe adenosine has a role limiting

lipolysis or least ameileorating the enhanced lipid oxidation in MCD cells.

The purine salvage pathway and its role in synthesizing AMP that can activate AMPK was

considered as a potential mechanism for adenosine’s observed influence on lipid accumulation. In

the purine salvage pathway, purines are recycled to replenish levels of ATP (Asby et al. 2015).

Inosine, which is also a purine, can be used through a number of enymatic reactions to synthesize

AMPK, while adenosine can be phosphorylated to directly produce AMP. Since inosine did not

have the same effect as adenosine on lipid metabolism, we are ruling out the purine salvage

pathway as a mechanism . More experiments are needed to further understand the mechanism

behind the observed effecst.

Methionine and choline deficient cells could have a role in increasing total AMPK. An

increase in AMPK could potentially mean that there is more inactive ACC in liver cells. In muscle

cells, it was found that higher levels of AMPK increase the phosphorylation and inactivation of

ACC (Park et al. 2002). We found that in the MCD cells, there was also fewer total triglycerides.

AMPK could have a role in conserving ATP by inhibiting lipogenesis. Furthermore, more total

AMPK could be a response to the cells having a higher ratio of AMP:ATP. Increased AMPK might

be an attempt to maintain energy homeostasis in the known energy challenged state during

methionine and choline deficiency. Active AMPK was increased in cells that were energy

15

challenged and more AMPK could lead to less hepatic lipid accumulation in mice (Foretz, Even,

& Viollet 2018)

OA-treatment on control cells was found to induce a large ratio of p-ACC/ACC. We

expected this change because the cells do not need to synthesize lipids if they were treated with

excess lipid. A higher p-ACC/ACC ratio would suggest inactive lipogenesis. However, treatment

with adenosine in these cells potentially decreased the p-ACC/ACC ratio by a large amount and

showed less intense bands for total ACC in lipid challenged and MCD cells. Adenosine could

potentially have a role in halting lipid metabolism by regulating protein expression and activity of

AMPK and ACC. More experiments need to be completed in order to confirm the mechanisms

that are responsible for these observations.

For future experiments, the ratio of SAM/SAH should be quantified in the same treatment

groups as explored in this study. The SAM/SAH ratio would indicate the ability of the cell to carry

out methylation reactions necessary in maintaining macronutrient homeostasis. Also, exploring

more genes such as sterol regulatory element binding protein-1c (SREBP-1c) and fatty acid

synthase (FAS) would be useful in gaining more insight into the lipid metabolism in HepG2 cells.

Total protein SREBP-1C and FAS should also be measured. SREBP-1c is a transcription factor

that is activated by insulin and regulates a number of enzymes involved in lipid metabolism (Ferre

& Foufelle 2007) while FAS is the enzyme responsible for de novo fatty acid synthesis. These

types of experiments and others would complement our AMPK and ACC data and give a better

picture if the cells are in a lipogenesis or lipolysis.

To summarize, HepG2 cells under a methionine and choline deficient condition increased

fatty acid oxidation and prevented cells from lipid-loading after treatment with exogenous fatty

acids. Addition of excess purine molecules exacerbated lipid-loading in HepG2 cells in all

conditions by decreasing fatty acid oxidation and potentially by increasing fatty acid synthesis.

16

These results suggest that impaired adenosine production in the MCD condition may reduce the

inhibition of fatty acid synthesis and result in enhanced lipid oxidation.

Acknowledgements

I first and foremost thank my mentors, Dr. Robin da Silva and Brandon Eudy for their

guidance, encouragement, and patience throughout this project. Without them, I would not have

been able to complete my honors thesis. I would also like to thank Caitlin McDermott for her

constant help and support with my lab work.

Figure 1. One-Carbon Cycle

This image simplifies One-Carbon Metabolism (1-CC). The purpose of this image is to show that

the 1-CC participates in amino acid synthesis, methylation reactions, and shows adenosine as a

product of from the conversion of SAM to homocysteine. Furthermore, figure 1 shows the complex

interactions or the ‘network’ that the one-carbon cycle encompasses. (Kharbanda 2009).

17

Figure 2.

Phosphatidylcholine Synthesis

Fig. 2 simplifies phosphatidylcholine (PC) synthesis. It shows that PC can be synthesized through

the Kennedy pathway or the PEMT pathway. The PEMT pathway interacts with the One-Carbon

Cycle as pictured above (Michel & Yuan 2006).

Table 1. Summary of Treatment Groups

Abbreviation Treatment

T Control

MCD Methionine Choline Deficient

Veh Vehicle

Ado Adenosine

Ino Inosine

OA Oleic Acid

18

Figure 3. Methionine and choline deficiency increases mRNA expression of PPARa and CPT-1a

while adenosine reverses its effect in HepG2 cells

a-f represent the fold change (2^-DDCT) of mRNA between treatment groups for the genes CPT-

1a and PPARa. Different letters denote statistical differences between treatment groups. A one-

way ANOVA was used to test for statistical significance and reported as a mean ± the standard

deviation. (n=3) P<.05.

19

Figure 4.

Methionine and choline deficiency reduces lipid accumulation in cells while purines enhance

lipid accumulation in HepG2 cells

This figure shows the values of total triglycerides as measured in HepG2 cells as cultured control

and MCD medium using the Folch extraction. Triglycerides are measured in nanomoles of TG

per milligram of protein. Different letters denote statistical differences between treatment groups.

A one-way ANOVA was used to test for statistical significance and reported as a mean ± the

standard deviation. (n=3) P<.05.

20

Figure 5.

Adenosine lowers total ACC in control and MCD hepatocytes

Representative western blot for total ACC, p-ACC, total AMPK, and p-AMPK from HepG2 cells

cultured in control and MCD medium. Vinculin was used as a loading control. The experiment is

an n=1. Data was normalized to the loading control and expressed as a ratio that is further

normalized to the vehicle.

A.

B.

21

Works Cited

Asby, DJ., F. Cuda, M. Beyaert, F.D. Houghton, Felino R. Cagampang, A. Tavassoli, (2015). AMPK Activation via Modulation of De Novo Purine Biosynthesis with an Inhibitor of ATIC Homodimerization. Chemistry & Biology, 22, (7). 838-848,

Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J., & Pastor-Anglada, M. (2006). Extracellular

adenosine activates AMP-dependent protein kinase (AMPK). Journal of Cell Science, 119(8), 1612.

Benedict, M., & Zhang, X. (2017). Non-alcoholic fatty liver disease: An expanded review. World

Journal of Hepatology, 9(16), 715-732. Bensinger SJ, Tontonoz P. (2008).Integration of metabolism and inflammation by lipid-activated

nuclear receptors. Nature. 454(7203):470–7. Buzzetti, E., Pinzani, M., & Tsochatzis, E. A. The multiple-hit pathogenesis of non-alcoholic fatty

liver disease (NAFLD). Metabolism - Clinical and Experimental, 65(8), 1038-1048. Chatelain F, Kohl C, Esser V, McGarry JD, Girard J, Pegorier JP. Cyclic AMP and fatty acids

increase carnitine palmitoyltransferase I gene transcription in cultured fetal rat hepatocytes. Eur J Biochem. 1996;235:789–98.

Cole, L. K., Vance, J. E., & Vance, D. E. (2012). Phosphatidylcholine biosynthesis and lipoprotein

metabolism. Triglyceride Metabolism and Disease, 1821(5), 754-761. de Alwis, N. M. W., & Day, C. P. Non-alcoholic fatty liver disease: The mist gradually clears.

Journal of Hepatology, 48, S104-S112. Dowman, J. K., Tomlinson, J. W., & Newsome, P. N. (2010). Pathogenesis of non-alcoholic fatty

liver disease. QJM: An International Journal of Medicine, 103(2), 71-83. Ferre, P. and Foufelle, F. (2007). SREBP1c Transcription factor and lipid homeostasis: Clinical

Perspective. Hormone research in pediatrics. 68(2). 72-82. Foretz, M., Even, P. C., & Viollet, B. (2018). AMPK Activation Reduces Hepatic Lipid Content

by Increasing Fat Oxidation In Vivo. International Journal of Molecular Sciences, 19(9), 2826.

Iyer, S. S., & Cheng, G. (2012). Role of Interleukin 10 Transcriptional Regulation in Inflammation

and Autoimmune Disease. Critical reviews in immunology, 32(1), 23-63. Jacobs R.L., van der Veen JN, Vance DE. Finding the balance: the role of S-adenosylmethionine

and phosphatidylcholine metabolism in development of nonalcoholic fatty liver disease. Hepatology (Baltimore, Md) 2013;58(4):1207–1209.

22

Kharbanda, K. (2009). Alcoholic Liver Disease and Methionine Metabolism. Thieme Publishing: Seminars in Liver Disease.

Mato, J. M., Martínez-Chantar, M. L., & Lu, S. C. (2013). S-adenosylmethionine metabolism and

liver disease. Annals of hepatology, 12(2), 183-189. Machado, M. V., Michelotti, G. A., Xie, G., Almeida Pereira, T., Boursier, J., Bohnic, B., …

Diehl, A. M. (2015). Mouse models of diet-induced nonalcoholic steatohepatitis reproduce the heterogeneity of the human disease. PloS one, 10(5).

Mentch, S. J., & Locasale, J. W. (2016). One-carbon metabolism and epigenetics: understanding

the specificity. Annals of the New York Academy of Sciences, 1363(1), 91-98. Michel, V., Yuan, Z., Ramsubir, S., & Bakovic, M. (2006). Choline transport for phospholipid

synthesis. Experimental biology and medicine, 231 5, 490-504. S. H. Park, S. R. Gammon, J. D. Knippers, S. R. Paulsen, D. S. Rubink, and W. W. Winder.

(2002). Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. Journal of Applied Physiology. 292:6, 2475-2482

Park, H. G., Yu, H. S., Kim, M. K., Kim, Y. S., Kim, S. H., Kang, U. G., & Ahn, Y. M. (2012).

The effect of clozapine on the AMPK-ACC-CPT1 pathway in the rat frontal cortex. International Journal of Neuropsychopharmacology, 15(7), 907-917.

Perla, F. M., Prelati, M., Lavorato, M., Visicchio, D., & Anania, C. (2017). The Role of Lipid and

Lipoprotein Metabolism in Non-Alcoholic Fatty Liver Disease. Children (Basel, Switzerland), 4(6), 46.

Ruderman, NB, Saha, AK, Kraegen EW (2003). Minireview: malonyl CoA, AMP-activated

protein kinase, and adiposity. Endocrinology. 144, 5166–5171. Sherriff, J. L., O'Sullivan, T. A., Properzi, C., Oddo, J.-L., & Adams, L. A. (2016). Choline, Its

Potential Role in Nonalcoholic Fatty Liver Disease, and the Case for Human and Bacterial Genes. Advances in nutrition (Bethesda, Md.), 7(1), 5-13.

Song, Shulan et al. “Peroxisome proliferator activated receptor alpha (PPARalpha) and PPAR

gamma coactivator (PGC-1alpha) induce carnitine palmitoyltransferase IA (CPT-1A) via independent gene elements.” Molecular and cellular endocrinology vol. 325,1-2 (2010): 54-63. doi:10.1016/j.mce.2010.05.019

Steinberg, G. R., & Kemp, B. E. (2009). AMPK in Health and Disease. Physiological Reviews,

89(3), 1025-1078. Takaki, A., Kawai, D., & Yamamoto, K. (2013). Multiple Hits, Including Oxidative Stress, as

Pathogenesis and Treatment Target in Non-Alcoholic Steatohepatitis (NASH). International Journal of Molecular Sciences, 14(10), 20704-20728.

23

Virmani, A., Pinto, L., Bauermann, O. et al. The Carnitine Palmitoyl Transferase (CPT) System and Possible Relevance for Neuropsychiatric and Neurological Conditions. Mol Neurobiol (2015) 52: 826

Wagner, C., Vance, D. E., Brosnan, J. T., Brosnan, M. E., Jacobs, R. L., Allen, R. H., . . . Mudd, S. H. (2007). Methyl balance and transmethylation fluxes in humans. The American Journal of Clinical Nutrition, 85(1), 19-25.

Walker, A. K. (2017). 1-Carbon Cycle Metabolites Methylate Their Way to Fatty Liver. Trends in

endocrinology and metabolism: TEM, 28(1), 63-72. Watkins SM, Zhu X, Zeisel SH. Phosphatidylethanolamine-N-methyltransferase activity and

dietary choline regulate liver-plasma lipid flux and essential fatty acid metabolism in mice. Journal of Nutrition. 2003;133(11):3386–91.

Woods, A., Williams, J. R., Muckett, P. J., Mayer, F. V., Liljevald, M., Bohlooly-Y, M., & Carling,

D. (2017). Liver-Specific Activation of AMPK Prevents Steatosis on a High-Fructose Diet. Cell reports, 18(13), 3043-3051.

Zeisel, S. H., & da Costa, K.-A. (2009). Choline: an essential nutrient for public health. Nutrition

Reviews, 67(11), 615-623. Zeng, L., Tang, W. J., Yin, J. J., & Zhou, B. J. (2014). Signal transductions and nonalcoholic

fatty liver: a mini-review. International journal of clinical and experimental medicine, 7(7), 1624–1631.