effect of tannic acid on the transcriptome of the soil bacterium … · 2013-04-09 · lim et al.,...

Lim et al., 2013 Effect of tannic acid on P. protegens Page S 1

Effect of tannic acid on the transcriptome of the soil bacterium Pseudomonas protegens Pf-5 Chee Kent Lim, Anahit Penesyan, Karl A. Hassan, Joyce E. Loper, and Ian T. Paulsen

Supplemental Material

Table S1. Transcripts induced by tannic acid (TA) treatment Genes regulated significantly by tannic acid (TA) as identified by a 2-fold change in transcript levels and Statistical Analysis of Microarrays (SAM) analysis with a false discovery rate (FDR) of less than 1 % (1). Some genes having less than a 2-fold change in transcript level were included for comparative purposes. Tables show the fold-changes (log2-based) of (A) up-regulated genes and (B) down-regulated genes in response to both low (20 µg/ml) and high TA concentration (160 µg/ml) treatments. A. Fold-changes of transcript levels of genes that were up-regulated in Mueller-Hinton (MH) medium amended with TA at either the low or high concentration. – FeCl2 and – FeCl3 represent the transcriptional fold-changes in Pf-5 grown in iron-limited media compared to media supplemented with FeCl2 or FeCl3, respectively, as determined from our previous study (2). – Zinc shows the transcriptional fold-changes in Pf-5 grown in zinc-limited versus zinc-supplemented media, as seen in another study on Pf-5 (3). Pseudomonas aeruginosa PAO1 orthologs of Pf-5 TA-regulated genes (identified by reciprocal BLASTp analysis with an E-value cutoff of 10-5) and relevant transcriptional regulation data on sulfate starvation in P. aeruginosa PAO1 performed by Tralau et al. (4) are included here.

Gene ID Annotated functions Log2 fold-change

Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_0026 quinone oxidoreductase, qor NS 1.2 NS NS NS PA0023 NS

PFL_0033 conserved hypothetical protein NS 1.1 NS NS NS — —


PFL_0078 transcriptional regulator, Zur family NS 1.2 NS NS 2.2 PA5499 NS


PFL_0093 protein of unknown function, DUF1328 family

NS 1.8 NS NS NS — —

PFL_0094 inhibitor of vertebrate lysozyme family protein


PFL_0108 conserved hypothetical protein NS 1.3 NS NS NS PA5463 NS


PFL_0126 sigma factor regulatory protein, FecR/PupR family

NS 1.1 2.3 NS NS PA2467 NS

PFL_0127 RNA polymerase sigma-70 factor, ECF subfamily

1.5 1.9 3.1 NS NS PA2468 NS

PFL_0145 RNA polymerase sigma-70 factor, ECF subfamily

2.8 2.6 4.4 NS NS — —

PFL_0154 transcriptional regulator, MarR family NS 1.3 NS NS NS — —

PFL_0189 fatty acid desaturase family protein NS 1.2 NS NS NS PA0286 NS

PFL_0191 conserved hypothetical protein 3.4 NS NS NS -1.2 — —

PFL_0192 sulfate ABC transporter, periplasmic sulfate-binding protein

2.5 NS -1.7 -1.2 NS PA0283 1.6

PFL_0193 sulfate ABC transporter, permease protein CysT

1.3 NS NS NS NS PA0282 1.7

PFL_0226 transporter, MotA/TolQ/ExbB proton channel family

2.2 NS NS -2.4 NS PA0198 5.8



Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.


1.7 NS NS -1.4 NS PA0201 NS

PFL_0229 sigma-54-binding protein 1.8 NS -1.1 -1.4 NS PA3932 2.2

PFL_0244 acyl-CoA dehydrogenase domain protein 1.9 NS NS NS NS PA2347 5.1

PFL_0245 acyl-CoA dehydrogenase family protein 3.7 NS NS NS NS PA2346 4.6

PFL_0250 serine acetyltransferase, putative NS 1.0 NS NS NS — —

PFL_0256 nitrilotriacetate monooxygenase component A

1.0 NS NS NS NS — —

PFL_0292 surface antigen protein, Rickettsia 17 kDa family

NS 1.2 NS NS NS PA5182 NS

PFL_0344 GABA permease NS 1.2 NS NS NS PA0129 NS


PFL_0354 conserved hypothetical protein NS 1.3 1.7 1.8 NS — —

PFL_0370 lipoprotein, putative 2.2 1.0 2.4 NS NS — —

PFL_0372 rhodanese-like domain protein NS 1.1 NS NS NS PA5130 NS

PFL_0373 Glutaredoxin 3, grxC NS 1.2 NS NS NS — —

PFL_0505 Protein of unknown function (DUF519) superfamily


PFL_0526 O-antigen polymerase family protein/toluene tolerance protein


PFL_0528 hypothetical protein NS 5.7 NS NS NS — —

PFL_0529 adenylylsulfate kinase NS 4.6 NS NS NS PA1393 NS

PFL_0530 bifunctional protein HldE NS 2.7 NS NS NS PA4996 NS

PFL_0538 thiamin biosynthesis protein ThiC NS 1.5 1.1 NS NS PA4973 NS

PFL_0539 probable hydroxymethylpyrimidine transporter CytX


PFL_0543 cyclic AMP phosphodiesterase NS 1.1 NS NS NS — —

PFL_0551 phosphoserine phosphatase NS 1.2 NS NS NS PA4960 NS

PFL_0573 iron ABC transporter, permease protein NS 2.6 1.4 NS NS PA4688 NS

PFL_0574 iron ABC transporter, periplasmic-binding protein

2.1 2.8 2.1 1.1 NS PA4687 -1.1

PFL_0663 membrane protein, MarC family NS 1.1 NS NS NS PA4857 NS

PFL_0906 fagA protein 3.1 4.5 4.9 2.1 NS PA4471 NS

PFL_0907 fumarate hydratase, class II 2.8 3.7 3.9 NS NS PA4470 -1.6

PFL_0908 conserved hypothetical protein 1.7 3.8 4.6 NS NS PA4469 NS

PFL_0909 superoxide dismutase, Mn NS 2.5 3.3 1.1 NS PA4468 NS

PFL_0910 metal cation transporter, zinc(II)-iron(II) permease (ZIP) family

NS 1.9 2.4 NS NS PA4467 NS

PFL_0945 thioredoxin-disulfide reductase NS 1.1 NS NS NS PA0849 NS

PFL_0957 LrgA family protein NS 2.5 -1.6 NS 1.4 PA3432 NS

PFL_0958 LrgB family membrane protein 1.1 4.4 -2.0 NS 1.1 PA3431 NS

PFL_0969 maleylacetoacetate isomerase NS 1.7 NS NS NS PA2007 NS

PFL_1097 ribosomal protein L19 NS 1.1 NS NS NS PA3742 NS


PFL_1165 succinyl-diaminopimelate desuccinylase dapE


PFL_1187 "(3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase FabZ




Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_1188 acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase



PFL_1257 AmpG-related permease NS 1.3 NS NS NS PA4393 NS

PFL_1261 deoxycytidine triphosphate deaminase NS 1.9 NS NS NS PA3480 NS

PFL_1285* surface antigen protein, Rickettsia 17 kDa family




PFL_1367 CobW/P47K family protein NS 1.0 NS NS NS — —

PFL_1433 lipoprotein, putative NS 1.9 NS NS 1.4 — —

PFL_1441 DNA-binding response regulator NS 1.1 NS NS NS PA0756 NS


PFL_1592 LTXXQ domain protein, putative Spy 2.6 2.8 NS NS NS PA3205 NS

PFL_1595 YciI family protein NS 1.0 NS NS NS PA3202 NS

PFL_1613 flagellar basal-body rod protein FlgF NS 1.4 -1.3 NS NS PA1081 NS

PFL_1751 calcium-binding protein NS 4.1 NS NS NS — —

PFL_1753 DNA-binding response regulator, OmpR family




PFL_1849 HAD hydrolase, family IA, variant 3 NS 1.0 NS NS NS — —

PFL_1871 regulator of ribonuclease activity A, putative


PFL_1900* DNA-binding protein 1.2 NS 1.2 NS NS — —

PFL_2083 FAD dependent oxidoreductase NS 1.5 NS NS NS PA2776 NS

PFL_2089 lipoprotein, putative NS 1.1 NS NS NS — —

PFL_2200 malate/L-lactate dehydrogenase family protein


PFL_2291* RNA polymerase sigma factor, FecI family 2.2 2.0 3.3 NS NS PA1912 NS

PFL_2363* RNA polymerase sigma factor, sigma-70 family

2.7 1.4 2.5 NS NS — —


PFL_2491* transcriptional regulator, TetR family NS 1.1 NS NS NS PA1315 NS

PFL_2563 putative membrane protein, DUF81 family



PFL_2665 transcriptional activator PfeR 1.3 NS NS NS NS PA2686 NS

PFL_2861 multidrug RND efflux transporter, permease protein MdtC-like


PFL_2899 lipoprotein, putative 1.5 5.4 NS NS NS — —

PFL_2901 conserved hypothetical protein NS 5.4 1.7 NS NS PA2384 NS

PFL_2902 acyl-homoserine lactone acylase PvdQ NS 3.7 NS NS NS PA2385 NS


PFL_2934 lactone-specific esterase, putative NS 3.3 NS NS NS — —

PFL_3024 SCO1/SenC family protein NS 2.2 NS NS NS — —

PFL_3025 Protein of unknown function (DUF461) family




Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_3158 lipoprotein, putative NS 1.3 NS NS NS PA0127 NS

PFL_3186 transcriptional regulator, AraC family NS 1.3 NS NS NS PA2332 NS

PFL_3187 ABC transporter, permease protein, authentic frameshift

1.1 NS NS NS NS — —

PFL_3188 ABC transporter, ATP-binding protein 1.3 NS NS NS NS — —

PFL_3189 lipoprotein, YaeC family 1.6 NS NS NS NS — —

PFL_3190 oxidoreductase, 2OG-Fe(II) oxygenase family

1.3 NS NS -1.2 NS — —

PFL_3191 TOBE domain protein 2.3 NS NS -1.6 NS — —

PFL_3255 ferrous iron permease EfeU NS 1.6 2.8 1.3 NS — —


PFL_3289 NADPH-dependent FMN reductase NS 1.3 NS NS NS PA1204 NS

PFL_3399 UTP-glucose-1-phosphate uridylyltransferase


PFL_3417 glyoxalase family protein NS 1.0 NS NS NS — —

PFL_3488 isochorismate synthase PchA NS 1.4 NS NS NS PA4231 NS

PFL_3489 isochorismate pyruvate-lyase PchB NS 1.5 NS NS NS — —

PFL_3490 enantio-pyochelin biosynthetic protein PchC

NS 3.3 1.2 NS NS PA4229 NS

PFL_3491 saccharopine dehydrogenase PchK NS 2.2 1.3 NS NS — —

PFL_3492 enantio-pyochelin synthetase F, pchF NS 2.7 1.1 NS NS PA4225 NS

PFL_3493 enantio-pyochelin synthetase E, pchE NS 3.4 NS NS NS PA4226 -2.1

PFL_3494 ABC transporter, permease/ATP-binding protein, putative, pchI


PFL_3495 ABC transporter, permease/ATP-binding protein, putative, pchH

NS 4.7 1.6 NS NS — —

PFL_3496 salicyl-AMP ligase, pchD NS 3.7 1.1 NS NS PA4228 NS

PFL_3497 regulatory protein PchR 1.2 2.7 3.4 1.5 NS PA4227 NS

PFL_3498 TonB-dependent outermembrane enantio-pyochelin receptor, fetA

NS 1.2 2.0 NS NS — —

PFL_3500 iron-chelate uptake ABC transporter, FeCT family, periplasmic iron-chelate-binding protein, putative

NS 3.0 1.9 NS NS — —

PFL_3501 iron-chelate uptake ABC transporter, FeCT family, permease protein

NS 1.4 1.2 NS NS — —

PFL_3502 iron-chelate uptake ABC transporter, FeCT family, ATP-binding protein

NS 2.2 1.2 NS NS — —

PFL_3503 transporter, major facilitator family NS 2.3 1.1 NS NS — —

PFL_3620 TonB-dependent receptor 1.2 NS 1.4 NS NS PA4156 NS

PFL_3623* ferric enterobactin ABC transporter, periplasmic ferric enterobactin-binding protein FepB

1.4 NS 2.7 NS NS PA4159 NS

PFL_3624 ferric enterobactin ABC transporter, permease protein FepD

NS 1.3 1.5 NS NS PA4160 NS

PFL_3631 riboflavin biosynthesis protein RibD C-terminal domain protein


PFL_3641 ornithine cyclodeaminase NS 1.6 NS NS NS — —

PFL_3992 bifunctional protein FolD NS 1.0 NS NS NS PA1796 NS


PFL_4059 membrane protein, DUF81 family NS 1.2 NS NS NS — —

PFL_4079 L-ornithine 5-monooxygenase PvdA NS 5.1 1.8 NS NS PA2386 NS



Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_4082 efflux ABC transporter, ATP-binding/permease protein

NS 3.3 1.1 NS NS PA2390 NS

PFL_4083 efflux transporter, outer membrane factor lipoprotein, NodT family

NS 2.1 1.1 NS NS PA2391 NS

PFL_4086 PvdP protein NS 2.7 1.2 NS NS PA2392 NS

PFL_4087 probable dipeptidase precursor NS 1.7 NS NS NS PA2393 -1.9

PFL_4088 aminotransferase, class V NS 2.2 NS NS NS PA2394 NS

PFL_4089 protein of unknown function DUF323 NS 3.2 NS NS NS PA2395 NS

PFL_4090 N(5)-hydroxyornithine transformylase PvdF


PFL_4091 pyoverdine ABC transporter, permease/ATP-binding protein PvdE


PFL_4092 TonB-dependent outermembrane ferripyoverdine receptor FpvA


PFL_4093 non-ribosomal peptide synthetase PvdD NS 5.2 1.7 NS NS — —

PFL_4095 non-ribosomal peptide synthetase PvdI NS 3.7 1.2 NS NS — —

PFL_4096 siderophore-interacting protein NS 3.1 1.2 1.2 NS PA2033 NS

PFL_4097 thioesterase NS 1.9 NS NS NS PA2411 NS

PFL_4155 NADH-dependent FMN reductase MsuE 2.0 NS NS NS NS PA2357 4.2

PFL_4156 methanesulfonate sulfonatase MsuD 1.7 NS NS NS NS PA2356 4.2

PFL_4158 sigma-54 dependent transcriptional regulator

1.3 NS NS NS NS PA2354 4.0

PFL_4169 PepSY-associated TM helix domain protein

NS 2.7 2.4 1.5 NS PA2403 NS


PFL_4171 conserved hypothetical protein NS 1.7 1.4 NS NS PA2405 NS


PFL_4173 cation ABC transporter, MZT family, periplasmic cation-binding protein


PFL_4174 cation ABC transporter, MZT family, ATP-binding protein


PFL_4175 cation ABC transporter, MZT family, permease protein



PFL_4178 MbtH-like protein 1.9 NS NS NS NS — —

PFL_4179 2,4-diaminobutyrate 4-transaminase NS 4.7 NS NS NS PA2413 NS


PFL_4189* non-ribosomal peptide synthetase PvdL NS 4.2 2.6 NS NS PA2424 NS

PFL_4190* RNA polymerase sigma-70 factor, ECF subfamily, PvdS

2.6 2.7 5.1 3.9 NS PA2426 -1.8

PFL_4191 pyoverdine biosynthesis protein, pvdY NS 5.2 NS NS NS — —

PFL_4222 molybdenum cofactor biosynthesis protein B, moaB


PFL_4236 hemolysin secretion/activation protein, ShlB family


PFL_4237 adhesin/hemagglutinin, HecA family NS 1.7 NS NS NS — —

PFL_4274 phospho-2-dehydro-3-deoxyheptonate aldolase


PFL_4339 sulfatase domain protein NS 1.6 NS 1.7 NS — —


PFL_4345 conserved hypothetical protein NS 1.1 NS NS -1.4 — —



Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.



PFL_4436 NLP/P60 family protein NS 1.7 NS NS NS PA1198 NS


PFL_4448 cysteine synthase B, cysM NS 1.1 NS NS NS PA0932 NS

PFL_4450 DNA-binding response regulator 1.1 2.8 3.2 1.1 NS PA0929 NS

PFL_4459 DNA-3-methyladenine glycosylase 1, tag NS 1.4 NS NS NS PA1193 NS

PFL_4480 flagellar basal-body rod protein FlgB NS 1.3 -1.1 NS NS PA1077 NS

PFL_4540 transcriptional regulator, AraC family, putative


PFL_4541 fatty acid hydroxylase family protein NS 1.3 NS NS NS PA0702 NS


PFL_4578 aminotransferase, classes I and II NS 1.6 NS NS NS PA4715 NS

PFL_4579 high-affinity gluconate transporter GntT NS 1.8 NS NS NS PA2322 NS

PFL_4580 gluconokinase GntK NS 2.3 NS NS NS PA2321 NS

PFL_4581 transcriptional regulator GntR NS 2.0 NS NS NS PA2320 NS

PFL_4605 protein of unknown function, CHP2284 family


PFL_4612 aldose 1-epimerase family protein NS 1.2 NS NS NS PA3185 NS

PFL_4628 heme oxygenase HemO NS 4.4 2.3 NS NS PA0672 -1.8

PFL_4730 lipoprotein, putative NS 2.0 NS NS NS PA2134 NS

PFL_4737 short chain dehydrogenase/reductase family protein



PFL_4825 arginine exporter protein ArgO NS 2.2 NS NS NS PA4365 NS

PFL_4828* insulin-cleaving metalloproteinase outer membrane protein

1.3 1.9 2.1 NS NS PA4370 -1.4

PFL_4830 imelysin family lipoprotein, putative NS 1.1 NS NS NS PA4372 NS



PFL_4840 cytoplasmic membrane family protein NS 1.9 NS 1.7 NS PA4387 NS

PFL_4841 pyridoxamine 5'-phosphate oxidase family protein

NS 2.7 NS 1.2 NS PA4388 NS

PFL_4856 ribonuclease T NS 1.1 NS NS NS PA3528 NS

PFL_4858* bacterioferritin-associated ferredoxin, putative

3.2 3.8 NS 4.8 -1.1 PA3530 NS

PFL_4863 ornithine carbamoyltransferase NS 1.6 NS NS NS PA3537 NS

PFL_4888 sigma-54 dependent DNA-binding response regulator


PFL_4896^ ribosomal protein L31, zinc-independent C- form

1.4 2.2 NS NS 5.2 PA3601 -3.1

PFL_4928 tRNA-specific adenosine deaminase, NS 1.1 NS NS NS PA3767 NS

PFL_4929 multicopper oxidase, CumA NS 1.2 NS NS NS PA3768 -1.3

PFL_4935 trehalose operon repressor, treR NS 1.1 NS NS NS — —

PFL_4944 exodeoxyribonuclease VII, large subunit, xseA

NS 1.7 1.6 NS 4.3 PA3777 NS

PFL_5032 cytochrome b561 family protein NS 1.3 NS NS NS — —

PFL_5033 protoheme IX farnesyltransferase, cyoE NS 1.3 NS NS NS PA1321 1.1



Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_5034 cytochrome o ubiquinol oxidase, subunit IV, cyoD


PFL_5035 cytochrome o ubiquinol oxidase, subunit III, cyoC

NS 1.8 NS NS NS PA1319 1.5

PFL_5036 cytochrome o ubiquinol oxidase, subunit I, cyoB

NS 2.0 NS NS NS PA1318 1.2

PFL_5037 cytochrome o ubiquinol oxidase, subunit II, cyoA

NS 1.6 NS 1.6 NS PA1317 1.8

PFL_5066 UDP-N-acetylmuramoylalanyl-D-glutamate--2,6-diaminopimelate ligase



PFL_5142 conserved hypothetical protein TIGR01777

NS 1.3 NS NS 1.7 PA4656 NS

PFL_5188 DNA-binding protein 1.5 1.8 NS NS NS — —


PFL_5286 putative phospholipid-binding domain protein


PFL_5289 type IV pilus prepilin peptidase PilD 1.5 NS NS NS NS PA4528 NS

PFL_5330 polyprenyl synthetase NS 1.6 NS NS NS PA4569 NS

PFL_5332* conserved hypothetical protein 3.3 5.4 4.7 4.3 NS PA4570 NS

PFL_5333 FKBP-type peptidyl-prolyl cis-trans isomerase FklB


PFL_5360 ferredoxin--NADP reductase, fpr NS 1.0 NS NS NS PA4615 NS

PFL_5375 type 1 secretion system membrane fusion protein HasE


PFL_5376 type 1 secretion system ATPase HasD NS 2.2 NS NS NS — —

PFL_5377 heme acquisition protein HasAp NS 5.6 3.7 NS NS PA3407 NS

PFL_5378* TonB-dependent outermembrane heme receptor HasR


PFL_5379 sigma factor regulatory protein HasS 1.4 4.4 2.7 NS NS PA3409 NS

PFL_5380* RNA polymerase sigma-70 factor, ECF subfamily, HasI

NS 1.6 1.7 NS NS PA3410 NS

PFL_5412 exonuclease family protein NS 1.1 NS NS NS — —

PFL_5416 endonuclease/exonuclease/phosphatase family protein



PFL_5424 AMP nucleosidase NS 1.5 NS NS NS PA3970 NS

PFL_5428 thiamine-phosphate pyrophosphorylase thiE


PFL_5433 PhoH family protein NS 1.2 NS NS NS PA3981 NS

PFL_5438 conserved hypothetical protein 1.5 NS 2.7 NS NS — —

PFL_5455 nicotinate (nicotinamide) nucleotide adenylyltransferase, nadD


PFL_5467 UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase



PFL_5496 glycosyl transferase, group 2 family protein


PFL_5498 putative cytoplasmic protein NS 1.7 NS NS NS — —

PFL_5499 putative periplasmic protein NS 2.0 NS NS NS — —

PFL_5504 alpha-2-macroglobulin domain protein NS 1.1 NS NS NS PA4489 NS





Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.


PFL_5514 GTP cyclohydrolase II NS 1.1 NS NS NS PA4047 NS

PFL_5523 transcriptional regulator NrdR NS 1.2 NS NS NS PA4057 NS

PFL_5611 N-acetyl-gamma-glutamyl-phosphate reductase


PFL_5670 amine oxidase, flavin-containing NS 1.0 NS NS NS — —

PFL_5671 hydrolase, carbon-nitrogen family protein NS 1.0 NS NS NS PA3598 NS

PFL_5679 protein of unknown function, UPF0057 family


PFL_5693 biotin synthetase NS 1.7 1.7 NS NS PA0500 NS

PFL_5704* RNA polymerase sigma-70 factor, ECF subfamily

1.1 2.3 3.1 NS NS PA0472 NS

PFL_5705 sigma factor regulatory protein, FecR/PupR family

NS 3.4 3.4 NS NS PA0471 NS


PFL_5803 cytochrome b561 family protein NS 1.8 NS NS NS PA0422 NS

PFL_5808 FAD dependent oxidoreductase NS 1.8 NS NS NS PA5084 NS

PFL_5911 D-3-phosphoglycerate dehydrogenase, putative


PFL_5917 hydrolase, alpha/beta fold family NS 1.3 NS NS NS PA0308 NS

PFL_5929 gamma-glutamyl-gamma-aminobutyrate hydrolase, putative


PFL_5930 gamma-glutamylputrescine synthetase, putative


PFL_5933 molybdenum-pterin-binding protein, ssuF 2.8 NS -1.8 NS NS — —

PFL_5934 aliphatic sulfonates ABC transporter, ATP-binding protein, ssuB

1.3 NS NS NS NS PA3442 2.1

PFL_5935 aliphatic sulfonates ABC transporter, permease protein, ssuC

1.4 NS -1.0 -1.1 NS PA3443 2.0

PFL_5936 alkanesulfonate monooxygenase, ssuD 1.0 NS NS NS NS PA3444 1.6

PFL_5937 sulfonate ABC transporter, periplasmic sulfonate-binding protein SsuA

2.5 NS NS -1.4 NS PA3445 1.6

PFL_5938 NADH-dependent FMN reductase SsuE 1.5 NS NS -1.2 NS PA3446 1.4

PFL_5939 thiol-specific antioxidant protein LsfA 4.1 1.3 -1.3 -1.2 -1.3 PA3450 1.6

PFL_5941 amino-acid N-acetyltransferase, argA NS 2.8 NS NS NS PA5204 NS

PFL_5989 YaiI/YqxD family protein NS 1.3 NS NS NS PA5247 NS

PFL_5990 cytochrome c/iron permease family protein


PFL_6012 diaminopimelate decarboxylase NS 1.1 NS NS NS PA5277 NS

PFL_6028 transcriptional regulator, LysR family NS 1.1 NS NS NS PA5293 NS

PFL_6056 orotate phosphoribosyltransferase NS 1.6 NS NS NS PA5331 NS

PFL_6066 ActC family protein NS 1.7 1.3 NS NS PA5343 NS

PFL_6067 TonB system transport protein ExbB 1.7 3.2 3.4 NS NS — —

PFL_6068 TonB system transport protein ExbD NS 2.2 2.9 NS NS — —

PFL_6069 periplasmic energy transduction protein TonB

NS 2.6 3.6 1.5 NS — —

PFL_6087 type VI secretion protein TssB NS 1.2 -1.3 NS NS PA0083 NS

PFL_6089 type VI secretion system effector Hcp NS 1.4 -1.0 NS NS PA0085 NS

PFL_6091 type VI secretion protein TssF NS 1.0 NS NS NS PA0088 NS




Low TA

High TA

– FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_6110 domain of unknown function/CBS domain/transporter associated domain protein


PFL_6126 phosphoribosylaminoimidazole carboxylase, catalytic subunit


PFL_6152 homocysteine S-methyltransferase family protein

1.2 2.6 NS NS NS — —

PFL_6195 CDP-alcohol phosphatidyltransferase family protein



* Genes in Pf-5 that contain Fur binding motifs upstream as determined by Hassan et al. (5) ^ Genes in Pf-5 that contain Zur binding motifs upstream as determined in the zinc limitation study on Pf-5 (3) NS means fold-changes are not significant according to the criteria used in this study or in study by Tralau et al. (4)


B. Fold-changes of transcript levels of genes that were down-regulated in MH medium amended with TA at either the low or high concentration. – FeCl2 and – FeCl3 represent the transcriptional fold-changes in Pf-5 grown in iron-limited media compared to media supplemented with FeCl2 or FeCl3,

respectively, as determined from our previous study (2). – Zinc shows the transcriptional fold-changes in Pf-5 grown in zinc-limited versus zinc-supplemented media, as seen in another study on Pf-5 (3). P. aeruginosa PAO1 orthologs of Pf-5 TA-regulated genes (identified by reciprocal BLASTp analysis with an E-value cutoff of 10-5) and relevant transcriptional regulation data on sulfate starvation in P. aeruginosa PAO1 performed by Tralau et al. (4) are included here.

Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_0040 conserved hypothetical protein NS -2.1 NS NS NS — —

PFL_0062 cytochrome c oxidase, subunit I, ctaD NS -1.7 NS NS NS PA0106 NS

PFL_0063 cytochrome c oxidase assembly protein, putative, ctaG

NS -1.6 NS NS NS PA0107 NS

PFL_0064 cytochrome c oxidase, subunit III, ctaE NS -1.6 NS NS NS PA0108 NS

PFL_0081 conserved hypothetical protein NS -1.0 NS NS NS PA5494 -1.2

PFL_0128 chemotactic transducer PctA NS -2.4 NS NS NS — —

PFL_0133 large adhesive protein NS -1.5 NS NS NS — —

PFL_0161 biofilm PGA synthesis protein PgaA NS -1.2 NS NS NS — —

PFL_0164 biofilm PGA synthesis protein PgaD, putative

NS -1.6 NS NS NS — —

PFL_0230 lipoprotein, NLPA family NS -1.6 NS NS NS PA3931 1.6

PFL_0238 RND transporter, hydrophobe/amphiphile efflux-1 (HAE1) family, permease protein


PFL_0260 transcriptional regulator, AraC family NS -1.5 NS NS NS — —

PFL_0266 rubredoxin NS -1.1 NS NS NS — —

PFL_0295 putative phospholipid-binding domain/LysM domain protein


PFL_0331 formate dehydrogenase, gamma subunit NS -1.1 NS NS NS — —

PFL_0338 FAD-binding domain protein NS -1.8 NS NS NS — —

PFL_0390 glycogen phosphorylase NS -1.1 NS NS NS PA2144 NS

PFL_0401 urocanate hydratase hutU NS -1.8 NS NS NS PA5100 NS

PFL_0402 cytosine/purine/uracil/thiamine/allantoin permease family protein


PFL_0403 histidine transporter, periplasmic histidine-binding protein hisX


PFL_0405 amino acid ABC transporter, ATP-binding protein hisV


PFL_0418 methyl-accepting chemotaxis protein NS -2.0 NS NS NS PA5072 NS

PFL_0429 poly(3-hydroxyalkanoate) granule-associated protein PhaI


PFL_0430 poly(3-hydroxyalkanoate) granule-associated protein PhaF


PFL_0434 poly(3-hydroxyalkanoate) polymerase 1 phaA


PFL_0555 motility protein, MotA family NS -2.0 NS NS NS PA4954 NS

PFL_0556 motility protein, MotB family NS -1.2 NS NS NS PA4953 NS

PFL_0572 methyl-accepting chemotaxis protein NS -1.0 NS NS NS — —


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_0598 branched-chain amino acid ABC transporter, periplasmic amino acid-binding protein livJ


PFL_0620 phosphate starvation-inducible protein PsiF


PFL_0647 PepSY-associated membrane protein NS -1.2 NS NS 1.6 PA3789 NS

PFL_0648 TonB-dependent outermembrane copper receptor OprC

NS -1.2 NS NS 1.8 PA3790 NS

PFL_0649 conserved hypothetical protein NS -1.5 -1.4 NS 3.0 — —

PFL_0650 Protein of unknown function (DUF461) family

NS -1.1 -1.1 NS 1.9 PA3785 NS

PFL_0675 response regulator/GGDEF domain protein


PFL_0692 tetratricopeptide repeat domain lipoprotein


PFL_0695 type II/IV secretion system protein NS -1.6 NS NS NS PA4302 NS

PFL_0700 response regulator receiver domain, putative

NS -1.9 1.3 NS NS — —

PFL_0701 POTRA domain, ShlB-type NS -1.1 NS NS NS — —

PFL_0704 MaoC-like domain protein NS -1.1 NS NS NS PA4788 NS



PFL_0734 methylmalonate-semialdehyde dehydrogenase


PFL_0776 glyoxalase family protein NS -3.8 NS NS NS — —

PFL_0778 methyl-accepting chemotaxis sensory transducer"


PFL_0834 putative RNA-binding protein, YhbY family NS -1.0 NS NS NS PA4753 NS

PFL_0875 dipeptide ABC transporter, ATP-binding protein DppD


PFL_0876 dipeptide ABC transporter, permease protein DppC


PFL_0877 dipeptide ABC transporter, permease protein DppB


PFL_0878 dipeptide ABC transporter, periplasmic dipeptide-binding protein DppA 1

NS -1.1 NS NS NS PA4502 -1.8

PFL_0881 dipeptide ABC transporter, periplasmic dipeptide-binding protein DppA 3


PFL_0887 hypothetical protein NS -1.3 NS NS NS — —

PFL_0888 phosphatidylcholine-hydrolyzing phospholipase C


PFL_0975 YebG family protein NS -1.6 NS NS NS — —

PFL_1028 RND transporter, hydrophobe/amphiphile efflux-1 (HAE1) family, putative


PFL_1034 GTP cyclohydrolase II, putative NS -1.2 NS NS NS — —

PFL_1036 methyltransferase, UbiE/COQ5 family NS -1.4 NS NS NS — —



PFL_1121 xenobiotic reductase A, putative xenA NS -1.5 NS NS NS PA3723 NS


PFL_1216 bacteriophage Mu tail sheath protein (GpL), putative



PFL_1218 sigma factor domain protein NS -1.1 NS NS NS — —


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_1229 putidacin L1 llpA1 NS -2.0 -1.1 NS NS — —

PFL_1267 histidine ABC transporter, periplasmic histidine-binding protein HisJ


PFL_1275 OmpA family protein NS -1.2 NS NS NS PA1041 NS


PFL_1384 amine oxidase, flavin-containing NS -1.4 NS NS NS — —



PFL_1429 (R)-3-hydroxydecanoyl-ACP:CoA transacylase phaG


PFL_1503 HNH endonuclease domain protein NS -1.2 NS NS NS — —



PFL_1618 flagellar hook-associated protein FlgK NS -1.0 NS NS NS PA1086 NS

PFL_1630 flagellar protein FlaG NS -2.4 NS NS NS — —

PFL_1631 Flagellar hook-associated protein 2 NS -1.4 NS NS NS — —

PFL_1632 flagellar protein FliS NS -1.8 NS NS NS PA1095 NS

PFL_1633 flagellar protein, FliT NS -1.7 NS NS NS — —



PFL_1667 motility sigma factor FliA NS -1.1 NS -1.4 NS PA1455 NS

PFL_1671 chemotaxis response regulator/protein-glutamate methylesterase CheB


PFL_1676 CheW-like domain protein NS -1.7 NS NS NS PA1464 NS


PFL_1678 conserved hypothetical protein NS -1.1 NS NS NS PA1473 NS

PFL_1684 cytochrome c-type biogenesis protein CcmE

NS -1.2 -1.2 NS NS PA1479 NS


PFL_1808 transcriptional regulator, GntR family/UbiC transcription regulator-associated domain protein


PFL_1827 lipid-binding start domain protein NS -1.1 NS NS NS PA1579 NS


PFL_1912 oxygen-independent coproporphyrinogen III oxidase

NS -2.0 -1.2 -1.5 NS PA1546 NS

PFL_1916 conserved hypothetical protein NS -1.8 -1.4 NS NS PA1550 NS

PFL_1922 cytochrome c oxidase, cbb3-type, subunit III ccoP

NS -2.3 NS -1.3 NS — —

PFL_1923 cytochrome c oxidase, cbb3-type, CcoQ subunit ccoQ

NS -2.2 -1.0 -1.4 NS — —

PFL_1924 cytochrome c oxidase, cbb3-type, subunit II ccoO

NS -2.3 -1.6 -1.5 NS — —

PFL_1927 aerotaxis receptor Aer NS -1.8 NS NS NS PA1561 NS

PFL_1968 conserved hypothetical protein NS -1.4 NS -1.0 NS — —


PFL_2031 ABC transporter, ATP-binding protein NS -1.5 NS NS NS — —

PFL_2090 chitin-binding protein NS -2.4 NS NS NS — —

PFL_2091 chitinase NS -1.9 NS NS NS PA2300 NS



Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_2099 glutaminase-asparaginase NS -1.0 -1.4 NS NS PA1337 NS


PFL_2127 putidacin L1 llpA2 NS -1.2 NS NS NS — —

PFL_2150 transcriptional regulator, LuxR family NS -1.6 NS NS NS — —







PFL_2312 methyl-accepting chemotaxis transducer NS -1.2 NS NS NS — —




PFL_2534 2-oxoisovalerate dehydrogenase E1 component, alpha subunit bkdA1



PFL_2545 transcriptional regulator, TetR family NS -1.2 NS NS NS PA0436 NS

PFL_2546 dihydroorotate dehydrogenase family/4Fe-4S binding domain protein


PFL_2547 pyridine nucleotide-disulphide oxidoreductase family protein


PFL_2548 Dihydropyrimidinase hydA NS -1.6 NS NS NS PA0441 NS

PFL_2550 N-carbamyl-L-amino acid amidohydrolase NS -1.2 NS NS NS PA0444 NS

PFL_2565 metallo-beta-lactamase family protein -2.0 NS NS NS NS PA2915 NS

PFL_2597 methyl-accepting chemotaxis protein NS -2.6 NS -1.1 NS PA4290 NS



PFL_2675 lipoprotein, putative NS -2.8 NS NS NS — —


PFL_2690 catalase/peroxidase HPI KatG NS -1.3 NS NS NS — —

PFL_2718 MFS transporter, anion:cation symporter (ACS) family


PFL_2720 AP endonuclease, family 2 NS -1.1 NS NS NS PA2260 NS

PFL_2721 transcriptional regulator, LacI family NS -1.4 NS NS NS PA2259 NS

PFL_2724 translocator protein, LysE family NS -1.4 NS NS NS PA2916 NS

PFL_2786 peptidyl carrier protein PltL NS -7.3 NS NS NS — —

PFL_2787 FADH2-dependent halogenase PltA NS -6.2 NS NS NS — —

PFL_2788 polyketide synthase PltB NS -3.5 NS NS NS — —

PFL_2790 putative halogenase PltD NS -2.6 NS NS NS — —

PFL_2791 acyl-CoA dehydrogenase PltE NS -2.7 NS NS NS — —

PFL_2792 L-prolyl-AMP Ligase PltF NS -2.3 NS NS NS — —

PFL_2793 thioesterase PltG NS -2.1 NS NS NS — —

PFL_2794 transcriptional regulator PltZ NS -2.4 NS NS NS — —

PFL_2795 membrane fusion protein, putative pltI NS -2.2 -1.8 NS NS — —


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_2796 ABC transporter, ATP binding/permease protein pltJ


PFL_2797 ABC transporter, ATP-binding protein/permease protein, putative pltK


PFL_2798 ABC transporter, permease protein, putative pltN


PFL_2799 multidrug efflux MFS outer membrane protein, putative, PltO


PFL_2800 LysE family efflux protein, putative pltP NS -2.9 NS NS NS — —



NS -1.0 -1.2 NS NS PA4129 NS

PFL_2842 sulfatase family protein NS -2.2 NS NS NS — —

PFL_2845 TPR domain protein, putative NS -1.2 NS NS NS — —





PFL_2869 cytochrome c oxidase accessory protein CcoG

NS -1.2 -1.0 NS NS PA4131 -1.4

PFL_2894 conserved hypothetical protein NS -1.8 1.4 NS NS — —


PFL_2904 hypothetical protein NS -2.0 NS 1.3 NS — —

PFL_2909 nitrilase family protein NS -2.1 -1.6 NS NS — —

PFL_2917 oxidoreductase membrane protein, FAD-binding

-1.6 -3.3 -1.9 -2.3 NS — —


PFL_2990 polyketide synthase RzxC NS -1.0 NS NS NS — —

PFL_2991 polyketide synthase RzxD NS -1.1 NS NS NS — —

PFL_2992 cytochrome P450 monooxygenase rzxH NS -1.5 NS NS NS — —

PFL_2994 polyketide synthase RzxF NS -1.0 NS NS NS — —

PFL_2995 S-adenosylmethionine-dependent methyltransferase rzxI








PFL_3004 type VI secretion system Vgr family protein


PFL_3013 DNA-cytosine methyltransferase NS -1.0 NS NS NS — —



PFL_3210 extracellular alkaline metalloprotease AprA



PFL_3310 putative transmembrane sensor/regulator PpyR

-1.8 NS NS NS NS PA2663 NS

http://www.pseudomonas.com/getAnnotation.do?locusID=PA2663


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_3316 3-demethylubiquinone-9 3-methyltransferase


PFL_3319 aerotaxis receptor Aer NS -1.8 NS NS NS — —

PFL_3324 response regulator NS -1.2 NS NS NS PA2572 NS

PFL_3325 response regulator/GGDEF domain/EAL domain protein


PFL_3326 cytochrome c551 peroxidase ccpA NS -1.6 NS NS NS PA4587 -2.7

PFL_3327 sensor histidine kinase, putative NS -1.7 NS NS NS — —

PFL_3328 response regulator/sensor histidine kinase


PFL_3380 transporter, major facilitator family NS -1.1 NS NS NS — —

PFL_3387 4-hydroxyphenylpyruvate dioxygenase hppD


PFL_3419 hypothetical protein NS -2.7 1.2 NS NS — —









PFL_3459 acetyltransferase, GNAT family family NS -1.4 1.2 NS NS — —

PFL_3551 amino acid ABC transporter, ATP-binding protein



PFL_3582 transcriptional regulator, IclR family NS -1.4 NS NS NS — —

PFL_3583 endoribonuclease L-PSP family protein NS -1.3 1.1 NS NS — —

PFL_3595 UDP-N-acetylglucosamine 2-epimerase wecB


PFL_3604 tryptophan halogenase PrnA NS -2.7 NS NS NS — —

PFL_3606 halogenase PrnC NS -1.8 NS NS NS — —

PFL_3607 aminopyrrolnitrin oxidase PrnD NS -1.4 NS NS NS — —

PFL_3609 flavin reductase domain protein NS -1.0 NS NS NS — —

PFL_3627 autoinducer-binding transcriptional regulator, LuxR family



PFL_3664 periplasmic sugar-binding domain protein/LacI transcriptional regulator


PFL_3669 SCP-2 sterol transfer family protein NS -1.0 NS NS NS PA1830 NS

PFL_3670 formyl transferase domain/enoyl-CoA hydratase/isomerase family protein


PFL_3688 adhesin/hemagglutinin, HecA family NS -1.5 NS NS NS — —




PFL_3811 threonine synthase, putative NS -1.5 NS NS NS — —

PFL_3819 cyclic diguanylate phosphodiesterase (EAL) domain protein

NS -1.8 -1.7 NS NS PA2133 NS


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.


PFL_3857 toluate 1,2-dioxygenase subunit beta xylY NS -1.6 NS NS NS PA2517 NS

PFL_3881 thioredoxin-disulfide reductase trxB NS -1.3 NS NS NS PA2616 NS

PFL_3887 cold shock domain protein CspD NS -1.6 NS NS NS — —

PFL_3896 type II/III secretion system short domain protein


PFL_3904 NADH-quinone oxidoreductase, I subunit nuoI

NS -1.3 -1.0 NS NS PA2644 NS

PFL_3914 peptidyl-prolyl cis-trans isomerase B NS -1.1 NS NS NS PA1793 NS

PFL_3967 cytochrome b561 cybB NS -1.4 NS NS NS PA0918 NS

PFL_3971 Fatty acid desaturase domain protein NS -1.4 -1.2 NS NS — —


PFL_4072 YcaC-related isochorismatase family protein


PFL_4131 amidohydrolase family protein NS -1.1 NS NS NS — —

PFL_4202 N-hydroxylated base analog detoxification protein YcbX, putative


PFL_4203 CheW-like domain protein NS -3.2 NS NS NS — —

PFL_4208 putative glycosyl transferase PslA NS -1.3 NS NS NS PA2231 NS

PFL_4209 mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase PslB


PFL_4210 polysaccharide biosynthesis/export protein PslD


PFL_4211 polysaccharide biosynthesis/export protein PslE


PFL_4213 putative glycosyl hydrolase PslG NS -1.0 NS NS NS PA2237 NS

PFL_4214 putative glycosyl transferase PslH NS -1.1 NS NS NS PA2238 NS

PFL_4215 putative glycosyl transferase PslI NS -1.2 NS NS -1.0 PA2239 NS

PFL_4216 membrane protein PslJ NS -1.3 NS NS -1.2 PA2240 NS

PFL_4217 conserved hypothetical protein NS -1.0 NS NS -1.0 — —

PFL_4269 universal stress protein family protein NS -1.4 NS NS NS PA1753 NS

PFL_4284 DoxD-like family protein NS -1.0 NS NS NS PA2864 NS

PFL_4285 transglycosylase, SLT family NS -1.5 NS NS NS PA2865 NS


PFL_4304 competence protein ComEA helix-hairpin-helix repeat protein



PFL_4387 ABC transporter, periplasmic substrate-binding protein


PFL_4410 C4-dicarboxylate transporter/malic acid transport protein

NS -2.1 -1.6 NS 1.5 — —



PFL_4433 L-sorbosone dehydrogenase NS -1.0 NS NS NS PA2414 NS

PFL_4482 response regulator receiver domain/CheW-like domain protein


PFL_4484 anti-sigma-28 factor, FlgM NS -1.2 NS NS NS — —

PFL_4485 FlgN family protein NS -1.0 NS NS NS — —

PFL_4486 type IV pilus assembly protein, PilZ family NS -1.2 NS NS NS PA3353 NS


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.

PFL_4490 sensor histidine kinase, putative NS -2.3 NS NS NS — —

PFL_4491 response regulator/TPR domain protein NS -1.2 NS NS NS — —


PFL_4524 ribonucleoside-diphosphate reductase, beta subunit


PFL_4532 diguanylate cyclase (GGDEF) domain protein, AdrA family


PFL_4542 peptidase propeptide and YPEB domain protein

NS -1.2 NS -1.7 NS — —

PFL_4576 transcription activator, effector binding NS -1.1 NS NS NS — —

PFL_4596 CsbD-like family protein NS -1.3 NS NS NS — —

PFL_4615 putative sugar ABC transporter, permease protein


PFL_4617 putative sugar ABC transporter, periplasmic sugar-binding protein


PFL_4618 N-acylglucosamine 2-epimerase NS -1.1 NS NS NS — —

PFL_4652 3-phosphoshikimate 1-carboxyvinyltransferase homolog


PFL_4669 integrating conjugative element protein, PFL__4669 family



PFL_4671 single-strand binding protein, putative NS -1.2 NS NS NS — —

PFL_4680 type IVB pilus biosythesis protein PliS NS -1.5 NS NS NS — —

PFL_4715 diguanylate cyclase (GGDEF) domain protein


PFL_4769 ferritin-like domain protein NS -1.7 NS NS NS PA0962 NS

PFL_4784 chemotactic transducer PctA NS -2.4 NS NS NS PA4309 NS

PFL_4854 OmpA family protein NS -1.5 NS NS NS PA3526 NS

PFL_4859 bacterioferritin bfr -1.7 NS NS NS NS PA3531 NS

PFL_4872 glutamate/aspartate ABC transporter, permease protein GltJ


PFL_4873 glutamate/aspartate ABC transporter, permease protein GltK


PFL_4904 hypothetical protein NS -1.6 -1.4 NS NS — —



PFL_4981 transcriptional regulator, putative NS -1.6 NS NS NS — —



PFL_4986 polyphosphate kinase 2 ppk2 NS -1.3 NS -1.5 NS PA0141 NS

PFL_5040 flavohemoprotein -2.2 NS NS NS NS PA2664 NS

PFL_5042 CheW-like domain protein NS -1.3 NS NS NS — —


PFL_5078 ubiquinol-cytochrome c reductase, cytochrome c1, putative

NS -1.2 -1.2 NS NS PA4429 NS

PFL_5079 ubiquinol-cytochrome c reductase, cytochrome b petB


PFL_5097 acetolactate synthase II, large subunit NS -1.3 NS NS NS — —

PFL_5100 O antigen biosynthesis abequosyltransferase rfbV, putative


PFL_5101 O-acetyltransferase, putative NS -1.6 NS NS NS — —


Gene ID

Annotated functions

Log2 fold-change

Low TA

High TA

–FeCl2

–FeCl3

– Zinc

ortholog in PAO1

Tralau et al.



PFL_5213 methyl-accepting chemotaxis transducer/sensory box protein


PFL_5260 pentapeptide repeat domain protein NS -2.7 NS NS NS PA4702 NS


-1.0 NS NS NS NS — —

PFL_5540 3-dehydroquinate synthase domain protein


PFL_5541 prenyltransferase, UbiA family NS -1.4 NS NS NS — —


PFL_5543 hydrolase, TatD family NS -1.6 NS NS NS — —

PFL_5545 type I phosphodiesterase/nucleotide pyrophosphatase family protein


PFL_5555 bacterioferritin bfr -1.5 -1.1 -2.5 NS NS PA4235 -1.3

PFL_5556 catalase KatA NS -2.1 -1.4 NS NS PA4236 NS

PFL_5653 protein kinase YeaG NS -1.4 NS NS NS PA0588 NS

PFL_5655 SpoVR family protein NS -1.7 NS -1.0 NS PA0586 NS

PFL_5662 DNA primase dnaG NS -1.8 NS NS NS PA0577 NS

PFL_5668 quinate/shikimate dehydrogenase quiA NS -1.2 NS NS NS — —

PFL_5686 diguanylate cyclase (GGDEF) domain membrane protein


PFL_5762 choline ABC transporter, periplasmic choline-binding protein choX




PFL_5798 adenosylhomocysteinase NS -1.1 -1.0 NS NS PA0432 NS

PFL_5873 SagB-type dehydrogenase domain protein NS -1.7 NS NS NS — —


PFL_5875 transporter, major facilitator family NS -1.1 NS NS -1.1 — —

PFL_5926 putrescine ABC transporter, periplasmic putrescine-binding protein potF1

-1.7 NS NS NS NS — —

PFL_5927 aminotransferase -1.7 NS NS NS NS PA0299 NS


PFL_5948 HflC/HflK family protein NS -1.9 NS NS NS PA0452 NS



PFL_6026 conserved domain protein NS -1.3 NS NS NS — —

PFL_6037 endoribonuclease L-PSP family protein NS -1.3 NS NS NS PA5303 NS

PFL_6114 response regulator NS -1.8 NS NS NS PA5364 NS

PFL_6187 cyclopropane-fatty-acyl-phospholipid synthase


NS means fold-changes are not significant according to the criteria used in this study or in study by Tralau et al. (4).


Table S2: List of gene-specific primers utilized for qRT-PCR

Genes Annotated functions Primer names Primer sequences Product

sizes (bp)

PFL_0906 fagA PFL_0906-qF PFL_0906-qR

TATTGATCGATACCGCAACC GCAATTGCACAAAGACAACC

113

PFL_0909 superoxide dismutase, Mn PFL_0909-qF PFL_0909-qR

AGAAACTGGTGGTGGAAAGC GACGTTGTAGAAGGCGTTGA

149

PFL_2291 RNA polymerase sigma factor, FecI family

PFL_2291-qF PFL_2291-qR

GCCTGCTGATCGATCTGTTT GAAAGCCTGTTTCACCTTGG

176

PFL_4190 RNA polymerase sigma-70 factor, ECF subfamily, PvdS


CAGATCACCTCCTCGTTCAA CGCCATGAATAACCACATTC

145

PFL_4858 bacterioferritin-associated ferredoxin, putative


CGACGGACAAATTCGCGAAGCG CACAGGGTAGGGGATTGCCGC

172

PFL_5938 NADH-dependent FMN reductase


ACCGGCGTCGCAATCAGCAA CGGGGTGCTGCTGGAGTTGG

180

PFL_2917 oxidoreductase membrane protein, FAD-binding


GCGCAGGCGTTGGGTGTAGT TGCGCGAACCCCATCCGTTC

101

PFL_5183* cytochrome c551 peroxidase PFL_5183-qF PFL_5183-qR

CGCGATGCTCATGCCGGAGT GACCCGCGCCTGTCCAAGTC

156

PFL_5555 bacterioferritin PFL_5555-qF PFL_5555-qR

CAGCATCTCCGGCACCGTGG AACACGCCGACGCCCTGATG

101

PFL_3806* ribosomal protein L36 PFL_3806-qF PFL_3806-qR

GGTTCTTCGCCCCGCCCTG TCGTCACCGCGACTGCCAGA

101

PFL_2578* hydrogen cyanide synthase HcnB


TTACCTGGGGCCGCGCTACT TGCTGCACCTGCTCTTCGCC

156

PFL_0245 acyl-CoA dehydrogenase family protein


ACGACGCCGAAGCCCTTCAG GGCGCGGGGCACGGAAATA

149

PFL_5040 flavohemoprotein PFL_5040-qF PFL_5040-qR

TGTGCCCCTGCTCGAAAGCG GTTGGTCGATGTGCCGGGCA

173

PFL_5939 thiol-specific antioxidant protein LsfA


CGACATCGCCCCCGACTTCG ATGGCCTTCACCCCGCGTTG

183

PFL_3497 regulatory protein PchR PFL_3497-qF PFL_3497-qR

TTCCCAACCCGCAGCACACC TTGAGCTGGCCGCTGAGCAC

148

PFL_4079 L-ornithine 5-monooxygenase PvdA


CAGGAGCACGGTCCGCTGGA GCGCAGGGTCACCAGGTCCT

126

PFL_4095 non-ribosomal peptide synthetase PvdI


GAGCGCGGCCTACAACCTGC CGCGCCTCCTGGATCACCTG

162

PFL_4093 non-ribosomal peptide synthetase PvdD


CCTATCTGCAGCCGCGGCG TGTGGTACGCGGTGCTGTCG

103

PFL_4054 beta-lactamase PFL_4054-qF PFL_4054-qR

GCAGCTGGGCACCTACACCG CAGGCCGATGCTGGGGTTGG

151

* The transcriptions for these genes did not exceed 2-fold change in SAM analysis


Table S3. Fold-changes of transcript levels of genes encoding methyl-accepting chemotaxis. The fold-changes are observed for Pf-5 grown in MH medium amended with TA at the high concentration (160 µg/ml) versus non-amended medium, and are reported as log2-based. The low TA concentration (20 µg/ml) had no significant effects on transcript levels of the genes shown.

Gene Annotations High TA

(Log2 fold-change) Orthologs in P. aeruginosa

PAO1

PFL_0128 chemotactic transducer PctA_2 -2.4 PA4310

PFL_0395 chemotactic transducer PctC NS PA4307

PFL_0418 methyl-accepting chemotaxis

protein -2.0 PA5072


protein NS —


protein NS —


protein NS —


protein -1.0 —


protein NS PA4844


protein -1.2 —


sensory transducer NS —


protein NS PA4520


protein NS PA3708


protein -1.9 —


protein NS PA1646

PFL_1901 aerotaxis receptor Aer_1 NS —

PFL_1927 aerotaxis receptor Aer_2 -1.8 PA1561


protein -2.1 —


protein -1.2 —


protein -2.0 —


protein -2.3 —


protein -1.1 —


protein -2.6 PA4290


protein NS —


protein -1.2 —

PFL_3319 aerotaxis receptor Aer_3 -1.8 —


protein PA1608


Gene Annotations High TA

(Log2 fold-change) Orthologs in P. aeruginosa

PAO1


protein -2.9 PA2652


protein NS PA2654


protein -1.7 PA2867

PFL_4533 biofilm dispersion protein BdlA NS PA1423


transducer NS PA2561


transducer NS —


protein NS —

PFL_4784 chemotactic transducer PctA_1 -2.4 PA4309


protein -1.1 —


protein NS PA4633


transducer NS —


transducer -1.9 —


transducer NS —

PFL_5824 type IV pilus biogenesis protein

PilJ NS PA0411


protein -1.4 PA2573


protein NS —


Figure S1. Light microscopic images of cells treated with varying concentrations of TA. Microscopic observations (at x1000 magnification) were performed on Gram-stained cells grown in planktonic culture in MH broth, treated with varying concentrations of TA. (A) no TA; (B) 300 µg/ml TA; (C) 600 µg/ml TA; (D) 1200 µg/ml TA. Filamentation and aggregation of cells was observed when induced with increasing concentrations of TA.


Figure S2. Role categories of genes regulated by TA. Genes that were up-regulated and down-regulated by TA were grouped according to their functional role category designation. Some genes fall into more than one category and therefore are counted more than once. The blue bars show the percentage of genes regulated significantly by the low TA concentration (20 µg/ml) whereas the red bars depict the percentage of genes regulated significantly by the high TA concentration (160 µg/ml).


Figure S3. Validation of the microarray data using qRT-PCR. (A) Validation of the microarray data derived from the low TA concentration (20 µg/ml) treatment experiment using qRT-PCR. The chart depicts the correlation of microarray data versus qRT-PCR fold-changes (log2-based) of 18 genes for the low TA concentration experiment. A correlation coefficient (R2) of 0.86 was observed. (B) The chart depicts the correlation of the microarray data versus qRT-PCR fold-changes (log2-based) of 18 genes for the high TA concentration (160 µg/ml) experiment. A correlation coefficient (R2) of 0.85 was observed.


Figure S4. Influence of TA on pyoverdine production. The relative level of pyoverdine in supernatants of Pf-5 cultures grown overnight (about 20 hours) in MH medium amended with TA or non-amended was assessed by absorbance at 403 nm, which is characteristic of pyoverdines (6). Bars represent standard deviations and P values were calculated using a two-tailed Student’s t-test.


Figure S5. Biofilm formation assay using flow cell system. (A) 3D reconstruction of laser scanning confocal microscopy images of biofilm formation of Pf-5 grown in the presence or absence of 160 µg/ml TA in a flow cell system for 72 and 120 hours and (B) their quantitative assessment (in volume) performed using the IMARIS software package (Bitplane). Red aggregates in images (A) might be attributed to TA complexes as well as dead bacterial cells, whereas green aggregates represent live bacteria, the same colour scheme is used in the graph (B). Scale bar in the confocal microscopy images denotes 50 μm. The procedure for this experiment is described in Method S1.


Figure S6. Swarming motility of Pf-5 on medium containing varying concentrations of TA. Inoculums were spotted on the center of the 0.6 % agar-containing Luria-Bertani media plate and incubated for two days at 25 oC. Increased concentrations of TA reduced swarming haloes of the bacteria.


Method S1. Assessment of biofilm formation in flow cells. Biofilms were cultivated in flow cell chambers as described by Christensen et al. (7) with some

modifications. Overnight cultures of Pf-5 (in triplicate) grown in MH medium were diluted 100-fold in the same medium and used to inoculate flow cell chambers. The chambers (Biocentrum-DTU, individual channel dimensions: 1 x 4 x 40 mm) were covered with a microscope glass coverslip (24 x 50 mm, st.1) (Knittel Glaser, Braunschweig, Germany), which served as a substratum for biofilm attachment. After inoculation of the bacterial suspension (500 μl) into the flow chamber, cells were allowed to incubate for 1 hour at ambient temperature, after which MH medium with and without TA (160 µg/ml) was pumped into the flow cell at a constant rate of 0.07 ml min−1 using an IPC-12 high precision peristaltic pump (Ismatec, Wertheim-Mondfeld, Germany).

Biofilms were prepared for laser scanning confocal microscopy (LSCM) by staining with the Live/Dead BacLight bacterial viability probe (Molecular Probes, Eugene, OR, USA), prepared according to the manufacturer's protocol. A working concentration (500 μl) of the probe was injected gently into flow cell chambers to minimize disruption of the biofilms. Biofilms were stained for 15 minutes after which the excess dye was removed by restarting the flow of the growth medium and flushing for 30 minutes.

Microscopic observation and image acquisition of biofilms were performed by using an FV300 confocal microscope (Olympus, Tokyo, Japan) equipped with argon and helium-neon lasers providing 488 and 543 nm excitation wavelengths, respectively. 510- to 530-nm interference and 610 nm longpass filters were used for emission. Images were captured by using an Olympus FV300 bundled program and were further processed using IMARIS v.7 software (Bitplane, Zurich, Switzerland).

References

1. Tusher VG, Tibshirani R, Chu G. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U. S. A. 98:5116-5121.

2. Lim CK, Hassan KA, Tetu SG, Loper JE, Paulsen IT. 2012. The effect of iron limitation on the transcriptome and proteome of Pseudomonas fluorescens Pf-5. PLoS ONE 7:e39139.

3. Lim CK, Hassan KA, Penesyan A, Loper JE, Paulsen IT. 2012. The effect of zinc limitation on the transcriptome of Pseudomonas protegens Pf-5. Environ. Microbiol.:DOI: 10.1111/j.1462-2920.2012.02849.x.

4. Tralau T, Vuilleumier S, Thibault C, Campbell BJ, Hart CA, Kertesz MA. 2007. Transcriptomic analysis of the sulfate starvation response of Pseudomonas aeruginosa. J. Bacteriol. 189:6743-6750.

5. Hassan KA, Johnson A, Shaffer BT, Ren Q, Kidarsa TA, Elbourne LDH, Hartney S, Duboy R, Goebel NC, Zabriskie TM, Paulsen IT, Loper JE. 2010. Inactivation of the GacA response regulator in Pseudomonas fluorescens Pf-5 has far-reaching transcriptomic consequences. Environ. Microbiol. 12:899-915.

6. Teintze M, Hossain MB, Barnes CL, Leong J, Van der Helm D. 1981. Structure of ferric pseudobactin: a siderophore from a plant growth promoting Pseudomonas. Biochemistry 20:6446-6457.

7. Christensen BB, Sternberg C, Andersen JB, Palmer RJ, Toftgaard Nielsen A, Givskov M, Molin S. 1999. Molecular tools for study of biofilm physiology. Methods Enzymol. 310:20-42.

effect of tannic acid on the transcriptome of the soil bacterium … · 2013-04-09 · lim et al.,...

Documents