effect of moisture of municipal biowaste on start-up and efficiency of mesophilic and thermophilic...

Bioresource Technology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier .com/locate /bior tech

Effect of moisture of municipal biowaste on start-up and efficiencyof mesophilic and thermophilic dry anaerobic digestion

http://dx.doi.org/10.1016/j.biortech.2014.02.1180960-8524/� 2014 Elsevier Ltd. All rights reserved.

⇑ Corresponding author. Tel.: +49 721 60842297.E-mail addresses: [email protected] (C. Li), [email protected]

(C. Mörtelmaier), [email protected] (J. Winter), [email protected], [email protected] (C. Gallert).

1 Tel.: +49 4921 8071586.

Please cite this article in press as: Li, C., et al. Effect of moisture of municipal biowaste on start-up and efficiency of mesophilic and thermophilic dryobic digestion. Bioresour. Technol. (2014), http://dx.doi.org/10.1016/j.biortech.2014.02.118

Chaoran Li a, Christoph Mörtelmaier a, Josef Winter a,⇑, Claudia Gallert a,b,1

a Institute of Biology for Engineers and Biotechnology of Wastewater, Karlsruhe Institute of Technology KIT, Am Fasanengarten, D-76128 Karlsruhe, Germanyb University of Applied Science, Hochschule Emden Leer, Faculty of Technology, Microbiology – Biotechnology, Constantia Platz 4, D-26723 Emden, Germany

h i g h l i g h t s

� Dry anaerobic digestion needs P75% moisture.� Methanosarcinales dominate, no Methanosaeta spec.� Biogas/methane rates and amounts are equal at 37 and 55 �C.

a r t i c l e i n f o

Article history:Received 19 December 2013Received in revised form 23 February 2014Accepted 25 February 2014Available online xxxx

Keywords:Dry anaerobic digestionWater activityBiogas productionVolatile fatty acid degradationMicrobial population

a b s t r a c t

Methane production from biowaste with 20–30% dry matter (DM) by box-type dry anaerobic digestionand contributing bacteria were determined for incubation at 20, 37 and 55 �C. The same digestion effi-ciency as for wet anaerobic digestion of biowaste was obtained for dry anaerobic digestion with 20%DM content at 20, 37 and 55 �C and with 25% DM content at 37 and 55 �C. No or only little methanewas produced in dry anaerobic reactors with 30% DM at 20, 37 or 55 �C.

Population densities in the 20–30% DM-containing biowaste reactors were similar although in meso-philic and thermophilic biowaste reactors with 30% DM content significantly less but phylogeneticallymore diverse archaea existed. Biogas production in the 20% and 25% DM assays was catalyzed by Meth-anosarcinales and Methanomicrobiales. In all assays Pelotomaculum and Syntrophobacter species weredominant propionate degraders.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Biowaste is the moist organic fraction of municipal garbagewith a high percentage of organic matter and is collected sepa-rately in many municipalities of Germany. After separation ofnon-digestible material it can be treated by wet or dry anaerobicdigestion (e.g., Lissens et al., 2001; Luning et al., 2003; de Baere,2000; Nayono et al., 2009). Reports on dry anaerobic digestion(DAD) were dealing with stirred tank reactors and biowaste frac-tions that contained up to 25% dry matter (DM) (e.g., Cecchiet al., 1991; Mata-Alvarez et al., 1993; Pavan et al., 2000; Bolzonel-la et al., 2006). Only Abbassi-Guendouz et al. (2012) reported suc-cessful DAD of artificial biowaste (card boards) with a DM contentof 30% in 2 of 4 parallel reactors. Model equations for batch fer-mentation revealed that mass transfer was strongly limited in

the DAD reactors with P30% DM content, leading to local acidifi-cation and reduced methanogenic activity (Abbassi-Guendouzet al., 2012). Even if an almost complete hydrolysis of biowastesolids could be obtained by thermochemical or biological pre-treatment to increase the soluble COD (Fernandez-Güelfo et al.,2011) the synergistic action of fermentative bacteria with metha-nogens and that of acetogenic bacteria with acetate cleaving andhydrogenolytic methanogenic bacteria was still required for stablemethane production (Gallert and Winter, 2005).

Although in praxi DAD often is established in low-tech box fer-menters (‘‘garage fermenters’’) and in high-tech stirred tank verti-cal or horizontal reactors the focus of most literature reports waslayed on stirred tank reactors with much better mass transferproperties. Almost no information about methanogenesis in boxfermenters is available. Box fermenters for DAD are consideredinexpensive and meet the requirements for the ‘‘technologybonus’’ (2 Euro cent per kWh electricity) offered by the GermanRenewable Energy Law. No process water is added to DAD duringreactor feeding, but in some systems process water or leachate issprayed on or mixed into the digesting material to improve biogas

anaer-

http://dx.doi.org/10.1016/j.biortech.2014.02.118

mailto:[email protected]



mailto:Claudia.gallert@hs-emden-leer. de

mailto:Claudia.gallert@hs-emden-leer. de



http://www.sciencedirect.com/science/journal/09608524

http://www.elsevier.com/locate/biortech


2 C. Li et al. / Bioresource Technology xxx (2014) xxx–xxx

production and digestion efficiency. Anaerobic microbial consortiafor biogas production from organic matter require an aequousenvironment with a water activity of >0.91 (e.g., Rockland and Beu-chal, 1987) for high-rate hydrolysis of polymers, acidogenesis ofmonomers, acetogenesis of fatty acids and methanogenesis of ace-tate and of CO2/H2. At the high dry matter (DM) content of non-moistened municipal biowaste (P30%) there may not be enoughbioavailable water (aW 6 0.91) for an optimal, non water limitedmultistep DAD. As waste treatment by DAD began only about20 years ago, not many data on the behavior of DAD during start-up and during long-term fermentation are available. Abbassi-Guendouz et al. (2012) reported a slightly decreasing methane pro-duction from card boards for increasing DM content from 10% to25%. At 30% DM content methanogenic activity was no longer sta-ble and at 35% DM content methanogenesis failed completely. Theauthors concluded that 30% DM content was the threshold concen-tration for the solids content. Simulation with the anaerobic diges-tion model No.1 revealed mass transfer limitations at increasingDM content and in particular a limited hydrolysis rate at high sol-ids content. In another report mesophilic and thermophilic DAD ofthe organic fraction of municipal solid waste (OFMSW with 20%DM) was compared by modeling organic matter conversion andbiogas production (Fernàndez-Rodriguez et al., 2013). Specificgrowth rates were 27–60% higher during thermophilic than duringmesophilic methanogenesis, which could have been due to an in-creased water activity. More water of the moisture was apparentlybioavailable at 55 �C than at 37 �C. As a consequence thermophilicreactor operation would require a shorter retention time and pre-sumably less investment costs for the digester.

The start-up of reactors for wet anaerobic digestion (WAD) orDAD depends on the activity of the inoculum, which ideally shouldcome from digestion of the same or of a similar substrate. A majorproblem during the start-up phase may be the accumulation of vol-atile fatty acids, especially of propionate by the fast-growing het-erotrophs (Gallert and Winter, 2008; Felchner-Zwirello et al.,2012, 2013), which lead to acidification of the reactor contentand, if no counteractions are taken, to failure. Monitoring of fattyacids for flexible biowaste addition may shorten the start-up timeand is considered helpful for a successful start-up of bioreactors,e.g., after revision (Gallert et al., 2003; Gallert and Winter, 2008).High-rate anaerobic digestion by WAD or DAD depends on syn-trophic interaction of fatty acid degrading acetogens with acetateand H2/CO2 utilizing methanogens to avoid volatile fatty acid accu-mulation (Gallert and Winter, 2005). If fatty acids have beenformed due to process imbalances, propionic acid is the most crit-ical organic acid, since its degradation may depend on the estab-lished degradation pathway (Felchner-Zwirello et al., 2012), thehydrogen partial pressure and on acetate levels. High degradationrates require close interspecies distances between propionatedegraders, hydrogenolytic and aceticlastic methanogens (Felch-ner-Zwirello et al., 2013) that prevail during DAD, but also a non-limiting water activity as in WAD.

Little is known about the community structure in DAD reactors.Within the methanogens a dominance of Methanosarcinales, eitherof Methanosaeta spec. (Chu et al., 2010; Montero et al., 2009) orMethanosarcina spec. (Cho et al., 2013) was reported, whereas pro-pionate degraders, with one exception (Zahedi et al., 2013), wereonly investigated in WAD systems (e.g., Ariesyady et al., 2007;Felchner-Zwirello et al., 2012; Narihiro et al., 2012; Chu et al.,2010).

In this contribution we address three aspects of DAD: the opti-mal water content, the influence of a temperature change fromambient (20 �C) to mesophilic (37 �C) and thermophilic (55 �C)temperatures as well as identification and enumeration of domi-nant methanogens and propionic acid degraders with respectivegene probes.

Please cite this article in press as: Li, C., et al. Effect of moisture of municipal bioobic digestion. Bioresour. Technol. (2014), http://dx.doi.org/10.1016/j.biortech

2. Methods

2.1. Substrates: source of fresh biowaste and digester residues forinoculation

Source-sorted biowaste was collected with rotating drumtrucks by City authorities of Karlsruhe, Germany for large-scalewet anaerobic digestion (WAD) (Gallert et al., 2003; Nayonoet al., 2009). For lab-scale dry anaerobic digestion (DAD) experi-ments woody material, ornamental plant soils as well as paper,plastic foils, broken glass and metals were manually sorted outfrom the collected biowaste fraction before shredding in a cutter(ZG Raiffeisen, Karlsruhe) to 1 cm length. The dry matter (DM) con-tent of the sorted biowaste (triplicate analyses) was 30.9 ± 0.6%(first batch for start of experiments) and 30.3 ± 0.6% (second batchfor the re-feeding experiments). In both batches the organic drymatter content (ODM, triplicate analyses) varied only little be-tween 65% and 67% of the DM content (calculated by ODM/DM�100, Table 1). As a source of microorganisms solid residues of di-gested biowaste suspensions were taken from the extrusion pipeof the sludge centrifuge at the WAD plant of the City of Karlsruhe.This inoculum contained 33.7 ± 0.6% DM of which 62% were organ-ic material (bacteria and undigested/undigestible biowaste parti-cles). Portions of 10 kg of shredded fresh biowaste and of 10 kgsolid residues of digested biowaste suspension were mixed thor-oughly. Little water was added to obtain a calculated DM contentof 30%, which was controlled in each fermenter by respectiveanalyses. To obtain biowaste fractions with 25% or 20% DM content(Table 1), the above mixture was accordingly diluted with tapwater. Percent amounts were calculated from the mean of tripli-cate analyses (variation ±0.6%). After 300 days all DAD reactorswere re-fed (Table 2).

2.2. Digester set-up, feeding and incubation conditions

Parallel DAD experiments with 2 kg of the above preparedbiowaste fractions that contained 30%, 25% or 20% DM were startedin 3 L glass reactors. One reactor was only fed with 2 kg digesterresidues that contained 25% DM and was incubated as a control.Reactors were initially flushed with nitrogen, closed with a rubberstopper and incubated at room temperature (20 ± 1 �C). Incubationtime, changes of the incubation temperature, e.g., after re-feeding,pH corrections with 5 M NaOH are mentioned at the respectiveexperiments. Biogas from the 3 L reactors was measured with aRitter model MGC-1 V30 mini gas counter, analyzed with a Bluesense model BACCom 12 CB methane/CO2 gas detector and regis-tered by a computer (System Blue Sense Gas GmbH, D-45099Herten, Germany). Since no gas was produced after 3 months ofincubation in the control reactor, it was stopped. Little leachatewater that accumulated at the bottom of the reactors after3–4 days was regularly remixed into the solid fraction by shakingthe reactors. For measuring the pH and for analysis of volatile fattyacids 1 ml of leachate was withdrawn through a bottom valve.Initial incubation of all reactors was at room temperature(20 ± 1 �C). The pH was adjusted after 5, 10 and 30 days to 8 (asgood as this is possible at the high DM content) and then stabilizeditself at around 8 (Figs. 1b, 2b, 3b and c). Later on the incubationtemperature was raised to 37 ± 0.5 or 55 ± 0.5 �C as indicated inFigs. 1–3. Re-fed reactors were incubated at 37 ± 0.5 or 55 ± 0.5 �C.

2.3. Analyses

To determine the DM content of biowaste three 1-kg portionswere dried to constant weight at 105 �C. The organic DM (ODM)content was obtained from triplicate 20 g-portions of the united

waste on start-up and efficiency of mesophilic and thermophilic dry anaer-.2014.02.118


Table 1Mass data of reactors for dry anaerobic digestion of biowaste with 30, 25, 20% dry matter content at start and after 300 days of digestion.

Time t0 (start) tend (after 300 days)

Biowaste DMtotal (kg) DM (%) ODM (%) DMtotal (kg) DM (%) ODM (%)

DM 30% R1 5.1 30.9 20.1 5.0 22.7 11.7DM 30% R2 5.04 30.9 20.1 4.9 22.9 12.1DM 25% R1 5.54 25.2 16.3 5.3 18.4 9.0DM 25% R2 5.72 25.2 16.3 5.5 19.3 9.8DM 20% R1 6.14 21.2 13.8 5.9 14.2 7.1DM 20% R2 6.02 21.2 13.8 5.8 14.7 7.2

DM = dry matter; ODM = organic dry matter; R1, R2 = reactor 1 and reactor 2, initially at the same and later on at a different temperature regime as depicted in Figs. 1–3.

Table 2Re-feeding of dry anaerobic reactors for mesophilic and thermophilic methanogenesis.

Reactor designation after re-feeding Content Incubation Temperature (�C) Water addition DMa (%)

DM 30%,R1⁄ 1 kg residue DM 30% R1 + 1 kg fresh biowaste 37 n.a. 28.6DM 30%, R2⁄ 1 kg residue DM30% R2 + 1 kg fresh biowaste 55 n.a. 28.6DM 25%, R1⁄ 1 kg residue DM 25% R1 + 1 kg fresh biowaste 37 n.m. 24.9DM 25%,R2⁄ 1 kg residue DM 25% R2 + 1 kg fresh biowaste 55 n.m. 24.8DM 20%, R1⁄ 1 kg residue DM 20% R1 + 1 kg fresh biowaste 37 250 ml 20.3DM 20%, R2⁄ 1 kg residue DM 20% R2 + 1 kg fresh biowaste 55 250 ml 20.0

aDM = actual dry matter content of each reactor at start; ⁄ re-fed reactors; n.a. = no addition; n.m. = not measured.

C. Li et al. / Bioresource Technology xxx (2014) xxx–xxx 3

and powdered dried material by heating the dried samples to550 �C for 2 h and subtracting the ash residues (mineral content)from the 20 g dried biowaste initially weighed in for analysis(APHA, AWWA, WEF, 2005). Ammonia was quantified with a testkit of Dr. Lange (Berlin, Germany). Acetate, propionate and n-buy-trate in Figs. 1–4 (i-butyrate, i- and n-valerate were not detected)were determined by gaschromatography with FID detection.Hydrogen, methane and carbon dioxide were analyzed every thirdsampling using a gas chromatograph with thermoconductivitydetector (Gallert and Winter, 2008). All values are the mean of atleast duplicate analyses. Gas amount was analyzed with Ritter minigas counters (BlueSens Gas Sensor GmbH Herten, Germany).

2.4. Characterization of the biowaste population by fluorescence in situhybridization (FISH)

Biowaste samples were taken from the reactors that digestedbiowaste with 20%, 25% and 30% DM and processed according toFelchner-Zwirello et al. (2013). Portions of 0.1 g of each samplewere mixed with 0.3 ml of 4% para-formaldehyde solution (Amannet al., 1990). The mixture was incubated at 4 �C for 3 h and thencentrifuged at 15,000 rpm for 5 min in a Microfuge (Eppendorf,Hamburg, Germany). The pellet was washed in phosphate bufferedsaline solution (PBS). Samples were frozen at �20 �C in 1 ml 50%ethanol-PBS-solution before further analysis. For FISH (Amannet al., 1990) 5 ll of sample were transferred on a Teflon coatedslide (8 mm diameter), air dried and completely dehydrated byascending ethanol concentrations of 50%, 80% and 99% (exposureto each concentration for 1 min.). For FISH analyses 10 ll hybrid-ization buffer (Amann et al., 1990) and 2 ll of the respective genprobes (1:20 diluted with distilled water, Table 3) were mixedand incubated 1.5 h at 46 �C, then washed with washing buffer(Amann et al., 1990) and incubated for 200 at 48 �C. All sampleswere counter stained with 0.1 lM 40,6-diamidino-2-phenylindol(DAPI). CitiFluor™ was used as embedding agent. A Zeiss AxioskopA50 equipped with a mercury HBO 50 UV lamp and an Axiocamcamera served for microscopy and photography, respectively. Fromeach sample that was specifically labeled with respective fluoresc-ing gene probes for domain, genus or species detection and coun-terstained with DAPI 10 randomly chosen microscopic view fieldswere photographed under the phase contrast microscope with and

Please cite this article in press as: Li, C., et al. Effect of moisture of municipal bioobic digestion. Bioresour. Technol. (2014), http://dx.doi.org/10.1016/j.biortech.

without filters specific for DAPI staining and the fluorescence dyesof the respective gene probes. Images were analyzed with Axiovi-sion 3.1 or DAIME software (Daims et al., 2006) and visually cor-rected for fluorescent particles other than the bacteria. Imagecorrections were made manually by taking into account criteriasuch as particle size and form, color and intensity of fluorescence,and by comparing DAPI, phase contrast and FISH images of thesame view field. The lowest detection limit was 1.58 � 106 cells/ml. This number was calculated taken the case of 1 FISH positivecell in 10 view fields. Taxa, which were not found in 10 microscopicview fields, are not at all present or only present at lower numbersthan 1.58 � 106 cells/ml.

3. Results and discussion

3.1. Influence of moisture content of biowaste on start-up and finalefficiency of biogas production

Assays for dry anaerobic digestion (DAD) of source-sorted mu-nicipal biowaste at its original dry matter (DM) content of 30%(w/v) and at 25% and 20% DM content were incubated at roomtemperature 20 ± 1 �C, 37 ± 0.5 �C and 55 ± 0.5 �C. Biogas produc-tion, fatty acids levels and pH were monitored for almost 1 year(Figs. 1–3).

In the DAD reactors that were moistened to a DM content of 20%methanogenesis at room temperature started after a lag phase of10–20 days (Fig. 1a). The bulk amount of biogas was generated inthe first 150 days and only little more biogas was produced uponfurther incubation at 37 �C (reactor 1) or 55 �C (reactor 2). Initiallythe pH of all reactors decreased below 6.7 and was adjusted to 8with sodium hydroxide after 5, 10 and 25 days (Fig. 1b). Later onno pH correction was necessary, even though volatile fatty acids(VFA) such as acetate, propionate and n-butyrate were still increas-ing. Whereas the n-butyrate concentration reached about 10 g L�1

and n-butyrate was completely degraded after 70 days, degrada-tion of up to 20 g L�1 acetate to the low final steady state levelrequired 150 days (Fig. 1b). Propionate concentrations in the reac-tors increased to 10–18 g L�1 during n-butyrate and acetate degra-dation and reached their low steady state level of 0.5 ± 0.25 g L�1

only after 180 days. These VFA concentrations were in the samerange as reported by Zahedi et al. (2013) for thermophilic DAD in

waste on start-up and efficiency of mesophilic and thermophilic dry anaer-2014.02.118


0

0.1

0.2

0.3

0.4

0.5

0 50 100 150 200 250 300

Met

hane

(m3 *

kg-1

OD

M)

Time (days)

DM 20%, R1 DM 20%, R2

RT 37°C

RT 55°C

(a)

0

1

2

3

4

5

6

7

8

9

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300

pH

VFA

(g*L

-1)

Time (days)

DM 20%, R1

Acetate Propionate n-Butyrate total VFA pH

(b)

Fig. 1. Biogas production in reactor R1 an R2 (a) at room temperature (RT), pH and volatile fatty acid (VFA) concentrations for R1 ((b) Profiles for R2 were similar) duringdigestion of biowaste with 20% DM content. Raising the temperature to 37 �C or 55 �C after 220 h (a) did not cause significant more biogas generation or VFA production.


a stirred tank reactor. When the gas production had ceased after210 days an increase of the reactor temperature to 37 ± 0.5 �C(R1) or 55 ± 0.5 �C (R2, Fig. 1a) did not lead to a significant furtherdegradation and only little more biogas was produced in both reac-tors. Methane production in both reactors differed by 6% (Fig. 1a),which was acceptable for parallel incubations of complex biowasteand the solid residues of WAD as a source of microorganisms.

In the DAD reactors that were moistened to a DM content of25% methanogenesis at 20 ± 1 �C started only after 140 days andproceeded for about 100 days. The total methane amount reachedonly about 50% of the methane amount that was obtained in reac-tors with biowaste that contained 20% DM or biowaste with 25%DM content after raising the temperature to 37 �C (Fig. 2a). At37 �C methane was produced much faster than at 20 ± 1 �C. Whenmethane production ended in the reactor that was incubated at37 �C the temperature was further increased to 55 �C. About 15%more methane were produced at the higher incubation tempera-ture (Fig. 2a). As in the reactors with 20% DM content VFA wereaccumulating initially and the pH was adjusted to 8 three timesafter 5, 10 and 25 days (Fig. 2b). VFA levels in total or distinguishedas acetate, propionate and n-butyrate were similar in both reac-tors. Acetate, propionate and n-butyrate were accumulating in


the first 60–70 days and then were slowly degraded. n-Butyrateand acetate degradation apparently caused an increase of the pro-pionate concentration, either by inhibition of propionate degrada-tion or by propionate formation during acetate or n-butyratedegradation (Fig. 2b).

Methanogenesis in the DAD reactors with biowaste that con-tained 30% DM did not start within 210 days of incubation at20 ± 1 �C. Even when the temperature in one of the reactors wasraised to 37 �C at day 90 (R2 in Fig. 3a) methanogenesis did not startwithin the next 40 days. Only when the temperature was raisedfrom 20 ± 1 �C to 55 �C (R1, Fig. 3a) or from 37 �C to 55 �C (R2,Fig. 3a) in both reactors biogas production began. However, onlyabout half of the methane amount (0.18–0.22 m3 kg�1 ODM) was fi-nally obtained as compared to the biowaste reactors with 20% DMcontent (0.35–0.38 m3 kg�1 ODM; Figs. 1a, 3a), although moredigestible substrate (30% DM instead of 20% DM) was available.The maximum methane production rates in the biowaste reactorswith 30% DM content (Fig. 3a) were similar, no matter whether55 �C were approached from 20 ± 1 �C (R1) in one step or via 40 daysat 37 �C (R2). VFA levels were high in the reactor that was incubatedat 20 ± 1 �C or at 20 ± 1 �C followed by 37 ± 0.5 �C and only decreasedafter biogas production began at 55 ± 0.5 �C (Fig. 3b and c).



0

0.1

0.2

0.3

0.4

0.5

0 50 100 150 200 250 300

Met

hane

(m3 *

kg-1

OD

M)

Time (days)

DM 25%, R1 DM 25%, R2

RT

RT 37°C 55°C

(a)

0

1

2

3

4

5

6

7

8

9

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300pH

VFA

(g*L

-1)

Time (days)

DM 25%, R1

Acetate Propionate n-Butyrate total VFA pH

(b)

Fig. 2. Biogas production in reactor R1 (300 d at room temperature) and R2 (room temperature ? 37 �C ? 55 �C, (a)), pH and volatile fatty acid (VFA) concentrations in R1((b) Profiles for R2 were similar) during digestion of biowaste with 25% DM content.


3.2. Re-feeding of the reactors

After biogas production ceased in the parallel biowaste reactorswith 20%, 25% and 30% DM content, 1 kg digestion residue of eachreactor was mixed with 1 kg fresh biowaste. The moisture contentwas re-adjusted to 20%, 25% and 30%. Then one of the 2 biowastereactors with 20%, 25% and 30% DM-content was incubated at37 �C and the other at 55 �C, respectively. The pH was adjustedtwice after 3 and 12 days, when VFAs accumulated and the pHhad dropped far below 7 (Fig. 4b–g). The DAD reactors with undi-luted biowaste (30% DM content) produced only about 0.03 m3

methane per kg ODMadded at 37 �C and 0.075 m3 methane per kgODMadded at 55 �C within 5–30 days of incubation, respectively(Fig. 4a). No more methane was produced after day 30 in both reac-tors. After 60 days propionate dominated the reactor incubated at37 �C (Fig. 4f) and acetate the reactor incubated at 55 �C (Fig. 4g).In the DAD reactors that contained biowaste with 25% DM signifi-cantly less methane (ca. 60%) was produced at 37 �C than at 55 �Cand more propionate remained un-degraded (Fig. 4d and e). Inboth, mesophilic and thermophilic DAD reactors with biowastethat contained 20% DM and in the thermophilic DAD reactor withbiowaste that contained 25% DM 0.35 m3 methane/kg ODMadded


were released and volatile fatty acids almost completely degradedafter 60 days (Fig. 4a,b and e). Whereas biogas production duringthe start-up phase at 20 ± 1 �C in the assays with 20% DM contain-ing biowaste started only after 20 days and continued until day150 (Fig. 1), gas production after re-feeding and incubation ateither 37 �C or 55 �C started almost immediately and ended afteronly 30–40 days. In both re-feeding assays with 20% DM (Fig. 4band c) and in the thermophilic assay with 25% DM (Fig. 4e) VFAswere almost completely degraded after 60 days, whereas in bothassays with biowaste, that contained 30% DM and in the meso-philic assay with 25% DM content, 10–20 g/L of either acetate(Fig. 4g) or propionate (Fig. 4d and f) accumulated and both acidswere not degraded.

3.3. Moisture content, volatile fatty acids and methane productionrates

The moisture content of biowaste for DAD and the incubationtemperature are important factors for anaerobic digestion to pro-ceed at all and for the final efficiency of digestion. Maximal volatilefatty acid (VFA) levels in all DAD biowaste reactors were obtainedin the first 50–100 days at 20%, 25% and 30% DM content (Figs. 1b,



0

0.1

0.2

0.3

0.4

0.5

0 50 100 150 200 250 300

Met

hane

(m3 *

kg-1

OD

M)

Time (days)

DM 30%, R1 DM 30%, R2

RT

RT 37°C

55°C

55°C

(a)

0

1

2

3

4

5

6

7

8

9

0

10

20

30

40

50

60

70

80

0 100 200 300

pH

VFA

(g*L

-1)

Time (days)

DM 30%, R1

Acetate Propionate n-Butyrate

total VFA pH

(b)

0

1

2

3

4

5

6

7

8

9

0

10

20

30

40

50

60

70

80

0 100 200 300

pH

VFA

(g*L

-1)

Time (days)

DM 30%, R2

Acetate Propionate n-Butyrate

total VFA pH

(c)

Fig. 3. Biogas production in reactor R1 (room temperature ? 55 �C) and R2 (room temperature ? 37 �C ? 55 �C, (a)), pH and volatile fatty acid (VFA) concentrations of R1 (b)and R2 (c) during digestion of biowaste with 30% dry matter (DM) content.


2b, 3b and 4b–g). In biowaste DAD reactors with 20% DM contentthere was apparently enough bioavailable water for non water lim-ited biogas formation by the established microflora at 20, 37 and55 �C. In biowaste that contained 25% DM content the bioavailablewater at 20 �C was apparently still enough to allow rapid hydroly-sis and acidification (Fig. 2b), but the methane production by syn-trophic interaction of acetogens and methanogens wassignificantly delayed and did not proceed to completion (Fig. 2a).Since aW is temperature dependent (Starzak and Mathlouthi,2006) a temperature shift from 20 �C to 37 �C may have increasedthe amount of bioavailable water so that methanogenesis in thebiowaste reactor with 25% DM content could proceed to comple-tion (Fig. 2a). The water activity in biowaste with 30% DM contentapparently still allowed acidification but no longer biogas produc-tion. Even the increased water activities at 37 or 55 �C seemed tobe not high enough for non water limited methanogenesis as inthe 20% DM assays. The dependence of biogas production on bio-availability of water was more clearly apparent from the re-feedingexperiment at incubation temperatures of 37 and 55 �C. Whereasat a DM content of the biowaste of 30% only very little methane


was generated at 37 and 55 �C, in the assays with 25% DM contentat 37 �C incubation temperature by far not as much methane wasproduced as in the parallel assay at 55 �C.

The increase of the water activity by increasing the incubationtemperature might be counteracted by a decrease of the metabolicactivity of the bacteria due to the unfavorable high temperaturesfor the prevalent acetogens and methanogens in the DAD reactor.However it turned out that the inoculum from full-scale WAD, pre-grown at 33 �C and digesting biowaste from the same sourceapparently contained phylogenetically diverse hydrolytic, acido-genic, acetogenic and methanogenic bacteria for growth tempera-tures ranging from 20 �C to 55 �C. Mesophilic and moderatelythermophilic bacteria apparently stayed alive during the long incu-bation period at 20 �C, where those bacteria were enriched thatcould grow best at this temperature. Their metabolism could bere-activated at higher water activity by e.g., raising the tempera-ture to 37 or 55 �C.

Methane production rates of 0.9–3 L kg�1 d�1 from biowastewith 20–30% DM (13–19.5% ODM) were calculated for the initialbatch DAD assays (chapter 3.1) at 20, 37 and 55 �C (Table 4,



0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0 10 20 30 40 50 60

Met

hane

(m3 *

kg-1

OD

M)

Time (days)

DM20%,37°C

DM20%,55°C

DM25%,37°C

DM25%,55°C

DM30%,37°C

DM30%,55°C

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

DM 20%, 37°C (b)

(a)

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

DM 20%, 55°C (c)

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

DM 25%, 37°C (d)

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

DM 25%, 55°C (e)

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

Time (days)

DM 30%, 37°C

Acetate Propionate n-Butyratetotal VFA pH

(f)

0

2

4

6

8

10

0

20

40

60

80

0 20 40 60

pH

VFA

(g*L

-1)

Time (days)

DM 30%, 55°C

Acetate Propionate n-Butyratetotal VFA pH

(g)

Fig. 4. Biogas production in biowaste reactors with 20%, 25% and 30% DM content (a), pH and volatile fatty acid (VFA) concentrations after re-feeding the reactors atmesophilic (37 �C; b,d and f) or thermophilic (55 �C; c,e and g) temperatures.


lines 1–3). After re-feeding methane production rates were muchhigher, 5.8 L kg�1 d�1 at 37 �C and 55 �C in the DAD reactors withbiowaste that contained 20% DM and 5.8 L kg�1 d�1 at 55 �C or4.3 L kg�1 d�1 at 37 �C in the reactors with biowaste that con-tained 25% DM content. At 37 �C the methane production ratein the DAD reactor with 25% DM content was lower (4.3 insteadof 5.8 L kg�1 d�1), presumably due to a too low aW value. Verylittle methane was produced in any DAD reactor with 30% DMcontent, although the water activity at 55 �C should be higher


than at 20 or 37 �C. At this high DM content most of the mois-ture apparently was tightly bound to particles and increasing thetemperature could not increase bioavailability far enough foracetogenic and methanogenic bacteria. The temperature shiftapparently had a more severe effect on the activity of acetogenicand methanogenic bacteria than on acidogenic activity. Thereason for this may be a broader range of still growth allowingtemperatures of the biowaste hydrolyzing and VFA-producingbacteria.



Table 3Oligonucleotide probes with fluorescent marker (50-FAM or 50Cy3).

Probe Target Formamide (%) Sequence 50–30 References

Eub388 Most bacteria 30 GCT GCC TCC CGT AGG AGT Amann et al. (1990)Arc915 Archaea 30 GTG CTC CCC CGC CAA TTC CT Stahl and Amann (1991)Mg1200 Methanomicrobiales 30 CGG ATA ATT CGG GGC ATG CTG Raskin et al. (1994)Mb310 Methanobacteriales 30 CTT GTC TCA GGT TCC ATC TCC G Raskin et al. (1994)MsMx860 Methanosarcinales 30 GGC TCG CTT CAC GGC TTC CCT Raskin et al. (1994)Mx825 Genus Methanosaeta 30 TCG CAC CGT GGC CGA CAC CTA GC Raskin et al. (1994)Glh821m Genus Pelotomaculum 10 ACCTCCTACACCTAGCACCC Narihiro et al. (2012)Synbac824 Genus Syntrophobacter 10 GTA CCC GCT ACA CCT AGT Ariesyady et al. (2007)SmiSR354 Syntrophus group incl. Smithella propionica 10 CGC AAT ATT CCT CAC TGC Ariesyady et al. (2007)SmiLR150 Smithella sp. long rod (LR) 10 CCT TTC GGC ACG TTA TTC Ariesyady et al. (2007)

Table 4Methane production rates during dry anaerobic digestion of biowaste at 20, 37 and 55 �C.

20 ± 1 �C 37 ± 0.5 �C 55 ± 0.5 �C

DM% CH4 L kg�1 ODM d�1 DM% CH4 L kg�1 ODM d�1 DM% CH4 L kg�1 ODM d�1

First feeding21.2 1.7 21.2 n.d. 21.2 n.d.25.2 0.9 25.2 3.0 25.2 n.d.30.9 no gas 30.9 no gas 30.9 1.7

Re-feeding20.2 n.d. 20.2 5.8 20.2 5.824.9 n.d. 24.9 4.3 24.9 5.828.6 n.d. 28.6 neg. 28.6 neg.

DM = dry matter, ODM = organic dry matter, n.d. = not determined, neg. = negligible. Rates were estimated from Figs. 1a, 2a, 3a and 4a for logarithmic/linear CH4 productionphases.


Methane production rates and, similarly important, total biogasyields are the main criteria for either WAD or DAD of organicwastes (de Baere, 2000). A comparison of the maximal biogas pro-ductivity of the biowaste fraction of the City of Karlsruhe duringWAD and DAD revealed that during WAD of biowaste with 5–6%DM content the same amount of biogas per gram (0.59 m3 kg�1 VS;Nayono et al., 2009) at a hydraulic retention time (HRT) of 7 d wasgenerated than during batch DAD of biowaste with 20–25% DMcontent during an almost ten times longer time span (60 d; 0.53–0.59 m3 kg�1 ODM, this paper). This shows that the final biodegra-dation efficiency of municipal biowaste with 20% or maximally 25%DM content in box fermenters for DAD may be as good as in com-pletely mixed reactors for WAD with 5–6% DM content. The aver-age methane content in the biogas from WAD was 62–70% (Gallertet al., 2003; Nayono et al., 2009) as compared to DAD, where it was70–75%, due to a higher pH. The space loading for stable WAD inlaboratory and in full-scale was 15 kg m�3 d�1 for a HRT of 6 days(Gallert et al., 2003) and thus was in the same order as in all thereferences for DAD mentioned by Zahedi et al. (2013). Even in theirown work total volatile solids (=ODM) accumulation began at aHRT of 6.6 days, equivalent to a space loading of 13 kg m�3 d�1,although methane productivity apparently was still stable.

3.4. Microbial population in the dry anaerobic digesters

In parallel mesophilic and thermophilic DAD reactors the totalpopulations (DAPI-stained) and the sub-populations of Eubacteria(Eub388-labeled) and Archaea (Arc915-labeled) were in the samerange for biowaste of the same DM content. No unidirectionalchanges towards higher or lower cell numbers were observed insingle reactors within 52 days. Mean values of total bacterialcounts (DAPI-stained), eubacterial counts (Eub388-labeled) andarchaeal counts (Arc915-labeled) in the DAD reactors containingbiowaste with 20%, 25% and 30% DM at 37 �C were 4.1 � 109,1.4 � 109 and 0.5 � 109 cells/ml at 37 �C and at 55 �C 3.9 � 109,1.2 � 109 and 0.6 � 109 cells/ml (each ± 0.2), respectively. Fromthe test with the Arc915 gene probe for Archaea it can clearly be


seen that the population of Archaea was about twice as high inthe mesophilic and thermophilic DAD reactors with biowaste thatcontained 20% and 25% DM as compared to the DAD reactors thatcontained 30% DM (Data not shown). This corresponded well withthe data on biogas production (e.g., Fig. 4). Comparison of theEub388 cell counts in the DAD reactors with those of other studieswas difficult, due to different digester regimes. In publications onmicrobial community analyses by FISH in biowaste digesters, sub-strates were fed semi-continuously into continuously stirred tankreactors, whereas we used batch ‘‘box-type fermenters’’ withoutwash-out of cells. The numbers for the Eub388 and Arc915 cellcounts in thermophilic DAD reactors, as reported by Zahedi et al.(2013), were ranging from 5.1 to 9.9 � 109 and 1–2 � 109 cells/ml, respectively, for different organic space loading rates and wereon average 3.6- to 7-fold (Eub388) or 1.4- to 2.8-fold, respectively,higher than in our batch DAD reactor with 20% DM at 55 �C. Sinceour DAD reactors were not permanently stirred reduced masstransfer may have been this reason for reduced cell growth. Thisis the ‘‘reality’’ in all DAD reactors without process water recycling.

The used probes covered the archaeal population (Arc915 cellcounts) in the DAD biowaste reactors which was further differen-tiated by probes for all known groups of methanogens except forthe Methanococcales (Raskin et al., 1994). Species of Methanosarci-nales were the dominating group in all reactors, representing up to96% of all tested methanogens at 37 or 55 �C (Fig. 5). No organismsreacting with the Mx825 gene probe, specific for the genus Meth-anosaeta, were found at a detection limit of 1.58 � 106 cells ml�1

of the test system. Up to 10% Methanomicrobiales (gene probeMg1200/Arc915) were found in biowaste samples of the DAD reac-tors with 20% or 25% DM content, but almost 20% in biowaste sam-ples of the reactors with 30% DM at 37 or 55 �C (Fig. 5), wheremuch less biogas was produced. Methanobacteriales (Mb310 posi-tive cells) only seemed to be present in the DAD biowaste reactorswith 30% DM content at both temperatures, 37 or 55 �C.

Except for Methanosarcinales, which were detected by probeMsMx860 (Fig. 5), this probe covers various genera of methanebacteria, belonging to the Methanococcoides, Methanolobus,



0.0%

20.0%

40.0%

60.0%

80.0%

100.0%

120.0%

140.0%

160.0%

DM30% t DM30% m DM25% t DM25% m DM20% t DM20% m

Arc

haea

(Arc

915)

=10

0%

Methanomicrobiales Methanobacteriales Methanosarcinales

Fig. 5. Proportion of major methanogenic taxa (% Methanosarcinales, Methanobacteriales and Methanomicrobiales) in DAD reactors with biowaste that contained 30%, 25%, and20% DM at mesophilic (m, 37 �C) and thermophilic (t, 55 �C) temperature after 21 days.


Methanohalophilus as well (Raskin et al., 1994). As we did not get apositive reaction with probe Mx825, specific for Methanosaetaspec., we concluded that Methanosaeta spec. do not play a signifi-cant role in the biowaste reactors. This is corroborated by high ace-tate levels at the sampling time in conjunction with reports thatMethanosarcina spec. are the dominant acetate degrading metha-nogens in systems with high acetate levels (Hori et al., 2006).The absence of detectable numbers of Methanosaeta spec. may bethe reason for the high acetate levels in biowaste DAD reactors.In recent reports on DAD of food waste, where a dominance ofMethanosaeta spec. was found, acetate concentrations were muchlower (Chu et al., 2010; Montero et al., 2009). Chu et al. (2010)for instance compared mesophilic and thermophilic digestion offood waste and found that 72% of the mesophilic methanogensbelonged to Methanosaeta concilii and 98% of the thermophilicmethanogens belonged to Methanosaeta thermophila. Monteroet al. (2009) also observed high percentages of thermophilicMethanosaeta spec. at high OLRs. For mesophilic DAD of food wasteCho et al. (2013) observed a decrease of the phylogenetic diversityof acetate utilizing methanogens to finally 96.4–99.1% ofM. termophila. In one recent publication a dominance ofMethanosarcina spec., identified by q-PCR, at low acetate levels inDAD reactors was reported (Abbassi-Guendouz et al., 2013). High

0.0%

1.0%

2.0%

3.0%

4.0%

5.0%

6.0%

7.0%

8.0%

9.0%

Euba

cter

ia (E

ub38

8)=1

00%

DM30% DM25%

Fig. 6. Percentage of POB Taxa that were detected with gene probes GIh821m (Genus Pelowith 30%, 25% and 20% DM during incubation (% POB in relation to the total population


acetate levels above 8 g L�1 in WAD may exert a strong inhibitoryeffect on both, Methanosarcina spec. and Methanosaeta spec.(McMahon et al., 2004). Although acetate levels above 8 g L�1 werereached in our DAD reactors after only 21 d and should haveprevented methanogenesis, inhomogeneous spaces with lowerconcentrations of the inhibiting acetic acid and a higher pH mighthave been responsible for the slowly increasing methanogenicactivity, as argued similarly by Abbassi-Guendouz et al. (2013).Hydrogenotrophic methanogens usually were dominant after startof DAD at high VFA levels (Montero et al., 2009). A dominance ofMethanobacteriales was reported in reactors with both, a highVFA content and a low pH (Blume et al., 2010), whereas in reactorswith lower VFA levels Methanomicrobiales apparently dominated(Garrity and Holt, 2001). This was in agreement with our results.

Among the propionate oxidizing bacteria (POB) in the re-feededmesophilic assays members of the genus Syntrophobacter (geneprobe Synbac824) and Pelotomaculum (gene probe Glh821m)played the major role, whereas members of the Smithella group,including the genus Smithella propionica (Gene probes SmiSR354and SmiLR150) could not be found (Fig. 6). POP are essentiallyrequired members of the anaerobic food chain for syntrophicdegradation of fatty acids with a carbon chain longer than C2(e.g., Gallert and Winter, 2005; Felchner-Zwirello et al., 2013). In

DM20%

tomaculum) and Synbac824 (Genus Syntrophobacter) in the mesophilic DAD reactors).




the reactor with 30% DM containing biowaste less than 0.8%(exception Syntrophobacter at day 21) of the Eubacteria were propi-onate degraders. In the reactor containing biowaste with 25% DMthe percentage of Pelotomaculum spec. was decreasing with timewhereas the percentage of Syntrophobacter spec. increased as longas propionate was available, and then decreased. Only in the reac-tor containing biowaste with 20% DM a slightly increasing popula-tion of Syntrophobacter spec. and a significantly increasingpopulation of Pelotomaculum spec. with time was seen (Fig. 6).

Generally little is known about anaerobic propionate oxidizingbacteria (POB) in DAD reactors, although propionate is a majorintermediate in anaerobic digestion and can accumulate easily inunbalanced fermenters, e.g., during start up (Gallert and Winter,2008). In a recent study Zahedi et al. (2013) found 15% and 6%POB at an increasing OLR in samples from thermophilic DAD, byapplying FISH and the Synbac824 probe, respectively. No thermo-philic species of POB, identified with gene probe Synbac824 weredescribed as yet (Li et al., 2012), but may exist (Zahedi et al.,2013) and would represent new species. Although in our approachfor POB identification all available gene probes for known POBwere used, the overall proportion of POBs in the reactors wassmall. This may have been the reason why the propionate concen-trations in the DAD reactors were higher than 0.06–1.3 g L�1 as re-ported by Zahedi et al. (2013). Propionate concentrations alsocorrelated well with the absolute numbers of POB in a negative lin-ear relationship (data not shown), indicating that the higher thenumber of POBs the lower the propionate concentration was. ThusPOB are essential to prevent acidification by high VFA contents.

4. Conclusions

Dry anaerobic digestion at 20–55 �C was possible with 20% DM-containing biowaste. With 25% DM-containing biowaste biogasproduction in the digestion assay at 37 �C was restricted andincomplete, whereas it proceeded to completion in the 55 �C assay.The water activity was apparently too low at 37 �C in biowastewith 25% DM content. No functioning DAD of biowaste with 30%DM content was obtained.

Methanosarcinales were the dominant acetate-degrading, Met-hanomicrobiales the dominant H2/CO2 converting methanogens,Pelotomaculum and Syntrophobacter species the dominant propio-nate oxidizing bacteria. No members of the Smithella group weredetected.

Acknowledgement

We thank the City Authorities of Karlsruhe, Amt fürAbfallwirtschaft for providing separately collected biowaste andinocula from the full-scale digester. This work was financiallysupported by a Grant of Deutsche Forschungsgemeinschaft (DFG),Grant No. Ga-546/4-2.

References

Abbassi-Guendouz, A., Brockmann, D., Trably, E., Dumas, C., Delegenés, J.-P., Steyer,J.-P., Escudié, R., 2012. Total solids content drives high solid anaerobic digestionvia mass transfer limitation. Bioresour. Technol. 111, 55–61.

Abbassi-Guendouz, A., Trably, E., Hamelin, J., Dumas, C., Steyer, J., Delegenés, J.,Escudié, R., 2013. Microbial community signature of high-solid contentmethanogenic ecosystems. Bioresour. Technol. 133, 256–262.

Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., Stahl, D.A., 1990.Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometryfor analyzing mixed microbial populations. Appl. Environ. Microbiol. 56 (3),1919–1925.

APHA, AWWA, WEF, 2005. Standard Methods for the Examination of Water andWastewater, 21st ed. Washington, DC, New York, USA.

Ariesyady, H., Ito, T., Yoshiguchi, K., Okabe, S., 2007. Phylogenetic and functionaldiversity of propionate-oxidizing bacteria in an anaerobic digester sludge. Appl.Microbiol. Biotechnol. 75, 673–683.


Blume, F., Bergmann, I., Nettmann, E., Schelle, H., Rehde, G., Mundt, K., Klocke, M.,2010. Methanogenic population dynamics during semi-continuous biogasfermentation and acidification by overloading. J. Appl. Microbiol. 109, 441–450.

Bolzonella, D., Pavan, P., Mace, S., Cecchi, F., 2006. Dry anaerobic digestion ofdifferently sorted organic municipal waste: full-scale experience. Water Sci.Technol. 53 (8), 23–33.

Cecchi, F., Pavan, P., Mata-Alvarez, J., Bassetti, A., Cozzolino, C., 1991. Anaerobicdigestion of municipal solid waste: thermophilic vs mesophilic performance athigh solids. Waste Management Res. 9, 305–315.

Cho, S., Im, W., Kim, D., Kim, M., Shin, H., Oh, S., 2013. Dry anaerobic digestion offood waste under mesophilic conditions: performance and methanogeniccommunity analysis. Bioresour. Technol. 131, 210–217.

Chu, C., Ebie, Y., Xu, K., Li, Y., Inamori, Y., 2010. Characterization of microbialcommunity in the two-stage process for hydrogen and methane productionfrom food waste. Int. J. Hydrogen Energy 35, 8253–8261.

Daims, H., Lücker, S., Wagner, M., 2006. Daime, a novel image analysis programe formicrobial ecology and biofilm research. Environ. Microbiol. 8, 200–213.

De Baere, L., 2000. Anaerobic digestion of solid waste: state of the art. Water Sci.Technol. 41 (3), 283–290.

Felchner-Zwirello, M., Winter, J., Gallert, C., 2012. Mass spectrometric identificationof 13C-labeled metabolites during anaerobic propionic acid oxidation. Chem.Biodivers. 9 (2), 376–384.

Felchner-Zwirello, M., Winter, J., Gallert, C., 2013. Interspecies distances betweenpropionic acid degraders and methanogens in syntrophic consortia for optimalhydrogen transfer. Appl. Microbiol. Biotechnol. 97, 9193–9205.

Fernandez-Güelfo, L.A., Álvarez-Gallego, C., Sales, D., Romero, L.I., 2011. The use ofthermochemical and biological pretreatments to enhance organic matterhydrolysis and solubilization from organic fraction of municipal solid waste(OFMSW). Chem. Eng. J 168, 249–254.

Fernàndez-Rodriguez, J., Pérez, M., Romero, L.I., 2013. Comparison of mesophilicand thermophilic dry anaerobic digestion of OFMSW: kinetic analysis. Chem.Eng. J. 232, 59–64.

Gallert, C., Winter, J., 2005. Bacterial metabolism in wastewater treatment systems.In: Jördening, H.J., Winter, J. (Eds.), Environmental Biotechnology – Conceptsand Application. Wiley-VCH Weinheim, pp. 1–48.

Gallert, C., Winter, J., 2008. Propionic acid accumulation and degradation duringstart-up of anaerobic biowaste digestion. Bioresour. Technol. 99, 170–178.

Gallert, C., Henning, A., Winter, J., 2003. Scale-up of anaerobic digestion of theorganic fraction from domestic wastes. Water Res. 37 (1433–1441), 2003.

Garrity, G.M., Holt, J.G., 2001. Euryarchaeota. In: Boone, D.R., Castenholz, R.W. (Eds.),Bergeys Manual of Systematic Bacteriology, vol. 1. Springer, New York, pp. 211–354.

Hori, T., Haruta, S., Ueno, Y., Ishii, M., Igarashi, Y., 2006. Dynamic transition of amethanogenic population in response to the concentration of volatile fatty acidsin a thermophilic anaerobic digester. Appl. Environ. Microbiol. 72, 1623–1630.

Li, J., Ban, Q., Zhang, L., Jha, A., 2012. Syntrophic propionate degradation in anaerobicdigestion: a review. Int. J. Agric. Biol. 14, 843–850.

Lissens, G., Vandervivere, P., De Baere, L., Bley, E.M., Verstraete, W., 2001. Solidwaste digestors: process performance and practice for municipal solid wastedigestion. Water Sci. Technol. 44 (8), 91–102.

Luning, L., van Zundert, E.H.M., Brinkann, A.J.F., 2003. Comparison of dry and wetdigestion for solid waste. Water Sci. Technol. 48 (4), 15–20.

Mata-Alvarez, J., Cecchi, F., Pavan, P., Bassetti, A., 1993. Semi-dry thermophilicanaerobic digestion of fresh and pre-composted organic fraction of municipalsolid wastes: digester performance. Water Sci. Technol. 27, 87–96.

McMahon, K., Theng, D., Stams, A., Mackie, R., Raskin, L., 2004. Microbial populationdynamics during start up and overload conditions of anaerobic digesterstreating municipal solid waste and sewage sludge. Biotechnol. Bioeng. 87, 823–834.

Montero, B., García-Morales, J., Sales, D., Solera, R., 2009. Analysis of methanogenicactivity in a thermophilic-dry anaerobic reactor: use of fluorescent in situhybridization. Waste Manage. 29, 1144–1151.

Narihiro, T., Terada, T., Ohashi, A., Kamagata, Y., Nakamura, K., Sekiguchi, Y., 2012.Quantitative detection of previously characterized syntrophic bacteria inanaerobic wastewater treatment systems by sequence-specific rRNA cleavagemethod. Water Res. 46, 2167–2175.

Nayono, S.E., Gallert, C., Winter, J., 2009. Foodwaste as a co-substrate in a fed-batchanaerobic biowaste digester for constant biogas supply. Water Sci. Tech. 59 (6),1169–1178.

Pavan, P., Battistoni, P., Mata-Alvarez, J., Cecchi, F., 2000. Performance ofthermophilic semi-dry anaerobic digestion process changing the feedbiodegradability. Water Sci. Technol. 41, 75–82.

Raskin, L., Stromley, J., Rittmann, B., Stahl, D., 1994. Group-specific 16S rRNAhybridization probes to describe natural communities of methanogens. Appl.Environ. Microbiol. 601, 232–240.

Rockland, L.B., Beuchal, L.R., 1987. Water Activity: Theory and Applications to Food,2nd ed. Marcell Dekker, New York.

Stahl, D., Amann, R., 1991. Development and application of nucleic acid probes. In:Stackebrandt, E., Goodfellow, M. (Eds.), Nucleic Acid Techniques in BacterialSystematics. John Wiley & Sons Inc, NewYork, N.Y., pp. 205–248.

Starzak, M., Mathlouthi, M., 2006. Temperature dependence of water activity inaqueous solutions of sucrose. Food Chem. 9 (3), 346–370.

Zahedi, S., Sales, D., Romero, L., Solera, R., 2013. Optimization of single-phasedry-thermophilic anaerobic digestion under high organic loading rates ofindustrial municipal solid waste: population dynamics. Bioresour. Technol.146, 109–117.


http://refhub.elsevier.com/S0960-8524(14)00289-2/h0005




































































































effect of moisture of municipal biowaste on start-up and efficiency of mesophilic and thermophilic...

Documents