1

Earliest Mexican turkeys (Meleagris gallopavo) in the Maya region: implications for pre-1

Hispanic animal trade and the timing of turkey domestication 2

3

Erin Kennedy Thorntona1, Kitty F. Emeryb, David Steadmanb, Camilla Spellerc,e, 4

Ray Mathenyd, and Dongya Yangc 5

6

a Trent University Archaeological Research Centre, DNA C205, 2140 East Bank Drive, 7

Peterborough, ON K9J 7B8, Canada. 8

9

b Florida Museum of Natural History, University of Florida, Gainesville, FL 32611–7800, USA 10

11

c Ancient DNA Laboratory, Department of Archaeology, Simon Fraser University, Burnaby, BC 12

V5A 1S6, Canada 13

14

d Department of Anthropology, Brigham Young University, Provo, Utah 84042 15

16

e Department of Archaeology, University of Calgary, Calgary, AB T2N 1N4, Canada 17

18

19

1To whom correspondence should be addressed. E-mail: erinthornton@trentu.ca 20

21

2

Abstract: 22

Late Preclassic (300 BC–AD 100) turkey remains identified at the archaeological site of El 23

Mirador (Petén, Guatemala) represent the earliest evidence of the Mexican turkey (Meleagris 24

gallopavo) in the ancient Maya world. Archaeological, zooarchaeological, and ancient DNA 25

evidence combine to confirm the identification and context. The natural pre-Hispanic range of 26

the Mexican turkey does not extend south of central Mexico, making the species non-local to the 27

Maya area. Prior to this discovery, the earliest evidence of M. gallopavo in the Maya area dated 28

to approximately one thousand years later. The El Mirador specimens therefore represent 29

previously unrecorded Preclassic exchange of animals from northern Mesoamerica to the Maya 30

cultural region. As the earliest evidence of M. gallopavo found outside its natural geographic 31

range, the El Mirador turkeys also represent the earliest indirect evidence for Mesoamerican 32

turkey rearing or domestication. Although wild and domestic forms of M. gallopavo are 33

morphologically similar, the presence of male, female and sub-adult turkeys, and reduced flight 34

morphologyfurther suggests that the El Mirador turkeys were raised in captivity. This confirms 35

that the origins of turkey husbandry or at least captive rearing date to the Preclassic. 36

37

Keywords: Meleagris gallopavo, turkey, Maya, Mesoamerica, El Mirador, trade 38

39

3

The turkey was a significant animal for the ancient Maya, whose realm stretched from 40

northern Honduras to southern Mexico. Turkeys were not only a source of food, but were also 41

important sacrificial offerings, and their feathers, bones, and other byproducts were used to 42

produce medicines, fans, tools, musical instruments and personal adornments. Until this study, 43

however, the Maya were assumed to have used only the native, wild ocellated turkey (Meleagris 44

ocellata) throughout the Preclassic to Classic period of cultural florescence (ending in AD 1000). 45

The Mexican turkey (Meleagris gallopavo gallopavo), domesticated in central/northern Mexico 46

[1], was presumed not to have been introduced until the Postclassic (AD 1000–1500), the final 47

period of pre-Contact Maya occupation. Our recent identification of M. gallopavo in Late 48

Preclassic (ca. 300 BC–AD 100) deposits from the Maya archaeological site of El Mirador 49

overturns these assumptions. In this collaborative study, we identified the El Mirador turkey 50

specimens through morphology, osteometrics, and ancient DNA (aDNA) analysis. The context 51

and dates were confirmed through archaeology and AMS radiocarbon dating. The results lead us 52

to reconsider the timing of turkey domestication and diffusion throughout Mesoamerica, as well 53

as the nature and extent of Preclassic Mesoamerican trade connections. 54

Today, the domesticated form of M. gallopavo is distributed worldwide, but its wild 55

progenitor was limited to the eastern and southwestern United States and central/northern 56

Mexico north of the Isthmus of Tehuantepec, and thus outside the Maya cultural region [1–3] 57

(Fig.1). The absence of wild populations of M. gallopavo in the Maya area after the end of the 58

Pleistocene is supported by both the paleontological and archaeological records [4–6]. In 59

contrast, the ocellated turkey ranges throughout the northern half of the Maya cultural area 60

including Mexico’s Yucatan Peninsula and northern Belize and Guatemala where it remains 61

4

locally common [3,7]. Although some ocellated turkeys may have been raised in captivity during 62

pre-Hispanic times, there is no evidence that this species was ever domesticated [2,8]. 63

The exact timing and location of New World turkey domestication are still unknown: 64

recent evidence points to at least two separate domestication events in Mexico and the North 65

American Southwest [9]. In central Mexico, archaeological M. gallopavo bones have been 66

identified at sites dating to 800–100 BC [10,11]. It is unclear whether these early specimens 67

represent wild or domestic individuals, but domestic turkeys were likely established in central 68

Mexico by the first half of the Classic Period (ca. AD 200–1000) [12]. Until this study, M. 69

gallopavo had not been identified in any Maya archaeological deposits predating the Postclassic 70

[6,8,13]. The Postclassic Maya specimens are all presumed to represent domesticated individuals 71

[8,13] either imported directly from central/northern Mexico or bred and raised in the Maya 72

world following their initial introduction. 73

The M. gallopavo specimens reported here were recovered from the major archaeological 74

site of El Mirador, located in north-central Petén, Guatemala (SI Text) (Fig. 1). Settlement at the 75

site dates back to at least 600 BC, but population and architectural extent peaked at the site 76

during the Late Preclassic (300 BC–AD 100) when one of the largest assemblages of Maya 77

public architecture was constructed at the site, including but not limited to the Tigre and Danta 78

Pyramids. El Mirador’s Late Preclassic florescence coincided with a time of increasing social, 79

political, and economic complexity in the Maya region when many of the hallmarks of Classic 80

Maya civilization (e.g., institution of kingship, monumental stone architecture, extensive trade 81

networks, and elaborate iconography) were established. At the end of the Late Preclassic, the site 82

was largely abandoned although there was a small presence in the Early Classic and somewhat 83

5

more substantial settlement during the Late Classic. No monumental constructions like those 84

from the Late Preclassic occurred during these later occupations. 85

Zooarchaeological turkey specimens (n=7) from El Mirador were recovered along with 86

other animal remains (n=1116) from the Tigre complex, a large public architectural group on the 87

site’s western edge (Fig. 2). Most of the turkey bones were associated with the Jaguar Paw 88

Temple (Op. 26), a nine meter high platform topped by triadic architecture and decorated with 89

sculptured stucco masks. An additional turkey specimen was recovered from an eight meter high 90

building (Op. 35) located on the east side of the Tigre Plaza. The turkey bones were associated 91

with Late Preclassic ceramics in well-sealed, undisturbed contexts [14, SI Text]. AMS 92

radiocarbon ages from animal bones found in close association with the turkey remains confirm 93

that the deposits are Preclassic (cal 327 BC–AD 54) (Table S2). 94

95

Results 96

The turkey specimens were identified during zooarchaeological analysis of El Mirador 97

animal remains conducted by the Environmental Archaeology Program of the Florida Museum 98

of Natural History (FLMNH-EAP), University of Florida. Comparison with modern FLMNH-99

EAP and FLMNH-Ornithology collections confirmed that six of the seven specimens are M. 100

gallopavo (Table 1). The remaining specimen (a fragmentary femur) could not be identified to 101

the species level because of poor preservation. Morphological characteristics identifying the 102

specimens as M. gallopavo include element size, shape/curvature and robustness as well as 103

spacing of the quill tubercles (also called cubital tubercles or papillae remigiales) on two ulnae 104

(Fig. 3). The quill tubercles, which form where tendons connect the secondary flight feathers to 105

the ulna are also underdeveloped suggesting that the animals were raised in captivity. Age and 106

6

sex characteristics (e.g., skeletal element size, tarsometatarsus spur morphology) further indicate 107

that a minimum of three Mexican turkeys are represented in the assemblage—two males and a 108

female. One of the males is a subadult (<2 years old). 109

The morphological evaluations were supported by osteometric analysis. Five of the seven 110

skeletal elements were complete enough to allow for shaft width and depth measurements. When 111

compared to published M. gallopavo and M. ocellata osteometrics [6], three specimens fall 112

within the range of male domestic Mexican turkeys (Fig. 4). 113

Ancient DNA analysis of four of the turkey bones, conducted in the Simon Fraser 114

Ancient DNA Laboratory, further verified the morphological and osteometric identifications 115

(Table 1). Poor preservation of tropical faunal assemblages is often problematic for aDNA 116

analysis. Nonetheless, numerous PCR amplifications successfully amplified short fragments (93–117

120bp) of Meleagris DNA using a combination of different primer sets (Table S3). A total of 80 118

PCR amplifications were conducted on the ancient bone samples, eight of which yielded PCR 119

amplifications and sequences of expected length (Table S4). While three of the bones produced 120

at least one short Meleagris DNA sequence, only one bone yielded replicable DNA sequences 121

using multiple primer sets. Two different fragments of control region mitochondrial DNA 122

(mtDNA) (121bp and 106bp respectively) were successfully amplified and replicated from both 123

the initial and repeat extraction. All obtained mtDNA sequences matched most closely or 124

identically with M. gallopavo sequences, and were considerably different from those of M. 125

ocellata (Table S5), confirming the species identity as M. gallopavo. 126

127

Discussion 128

Mesoamerican Preclassic Trade Connections 129

7

The combined morphological, osteometric and aDNA evidence confirm the early 130

presence of M. gallopavo at El Mirador in the Maya lowlands. The presence of male, female and 131

subadult turkeys, some with reduced flight capabilities, suggests that the introduced birds were 132

captive reared and/or domesticated. Although we do not yet know the immediate source of the 133

turkey bones, the most reasonable explanation is that a few Mexican turkeys entered the site as 134

exchange goods directly from central/northern Mexico suggesting a close Late Preclassic 135

association between El Mirador and contemporary northern Mesoamerican cultures at sites such 136

as Teotihuacan. Most of the evidence for the exchange of goods and ideas between central 137

Mexico and the Maya region dates to the Classic period several centuries later (ca. AD 250–900) 138

[15]. The El Mirador turkeys therefore add to a relatively sparse record of Preclassic cultural and 139

material exchange between the Maya lowlands and northern Mesoamerica [16–18]. Prior 140

information on Preclassic exchange comes primarily from non-perishable goods such as obsidian 141

and ceramics so the non-local turkeys at El Mirador expand our understanding of the types of 142

goods that were exchanged long distances during this early period of Maya history. Although 143

The El Mirador turkey specimens could represent the transport of dried meat or partial carcasses, 144

the presence of associated upper and lower limb bones suggests that the animals were imported 145

whole and possibly live. The imported turkeys further emphasize that El Mirador’s vast Late 146

Preclassic trade connections extended some 1000 kilometers north into central Mexico, in 147

addition to the site’s better known connections with the Atlantic and Pacific coasts and the Maya 148

highlands [14,19,20]. El Mirador’s participation in interregional trade and cultural interaction 149

was likely pivotal to the site’s accumulation of political and economic power during the Late 150

Preclassic [20,21]. 151

152

8

Timing of Mesoamerican Turkey Domestication and Diffusion 153

The Late Preclassic presence of M. gallopavo in the Maya region has important 154

implications for documenting the timing of Mesoamerican turkey domestication and diffusion. 155

To date, morphological and genetic studies have been unable to distinguish between wild and 156

early domestic forms of M. gallopavo. In the absence of morphological and genetic markers, 157

archaeologists have relied on indirect evidence of domestication such as the presence of pen 158

structures, egg shells and neonates or appearance of the species outside its presumed natural 159

geographic range. Previous to our study, all indirect evidence for Mesoamerican turkey 160

husbandry dated to the Classic period or later [8,22,23]. Since the Preclassic El Mirador turkeys 161

represent movement of M. gallopavo outside its natural geographic range, the specimens 162

represent the earliest indirect evidence of captive turkey rearing or domestication in 163

Mesoamerica. A Preclassic origin for Mexican turkey domestication has been suggested 164

previously [11,24], but archaeological evidence has been lacking. The El Mirador turkey 165

specimens confirm that turkey domestication, or at least captive rearing, dates to the Preclassic. 166

Determining when Mesoamerican cultures started experimenting with turkey rearing and 167

domestication is vital to the larger question of whether the origins of New World turkey 168

husbandry should be attributed to cultures of the American Southwest or Mesoamerica. It was 169

originally believed that the turkey was first domesticated in Mesoamerica and then introduced in 170

domestic form to the American Southwest [1]. More recent archaeological and genetic evidence 171

has overturned this scenario demonstrating that turkeys were independently domesticated in 172

these two regions although the timing of domestication remains unclear [9,25,26]. It is possible 173

that the idea for turkey rearing or husbandry prior to domestication also arose independently in 174

the American Southwest and Mesoamerica. However, the wealth of documented cultural and 175

9

material exchange between the regions supports a model of diffusion for the concept of turkey 176

husbandry as part of early exchange networks. The Late Preclassic El Mirador M. gallopavo 177

specimens provide evidence for the antiquity of Mesoamerican turkey rearing, and support the 178

probable role of interregional turkey exchange in the diffusion of ideas about animal 179

management in the New World. 180

The presence of Late Preclassic Mexican turkeys at El Mirador also confirms that this 181

non-local species was introduced to the Maya region over one thousand years earlier than 182

previously thought. If the El Mirador turkeys are isolated examples of imported captive-183

raised/domestic Mexican turkeys, it raises the question of why the Maya did not broadly adopt 184

the idea of turkey rearing or domestication until the Postclassic. One possibility is that turkey 185

domestication was not widespread or common in any part of Mesoamerica until the later half of 186

the Classic period despite its potentially earlier origins. This suggestion is supported by the 187

relative rarity of M. gallopavo specimens in Preclassic/Formative central Mexican faunal 188

assemblages, and their increasing frequency in Classic and Postclassic deposits [11,22]. An 189

alternative explanation is related to the nature of the Postclassic Maya economy. During the 190

Postclassic, long-distance trade between central Mexico and the Maya area increased with the 191

expansion of maritime trade routes around the Yucatan Peninsula between the Gulf of Mexico 192

and Central America’s Caribbean coast [27,28]. Increased Postclassic exchange throughout 193

Mesoamerica could have facilitated the dispersal of domesticated turkeys to the Maya area 194

through repeated introductions of breeding pairs and transmission of rearing information. In 195

contrast, the rare earlier introduction of the bird might not have been sufficient to fully 196

incorporate the species into the Maya economy. 197

10

Although the El Mirador turkeys may represent isolated imports, it is also possible that 198

M. gallopavo has been under-identified in Preclassic and Classic Maya zooarchaeological 199

assemblages since M. gallopavo and M. ocellata can be difficult to differentiate morphologically 200

when preservation is poor. Researchers also may not have considered the possible presence of M. 201

gallopavo in earlier assemblages due to the longstanding belief that they were not introduced to 202

the Maya region until the Postclassic. It is essential to determine whether the Mexican turkey 203

appeared in the Maya region earlier than previously understood because an earlier introduction 204

would have provided a second domestic vertebrate during the Late Preclassic to Classic period of 205

Maya population expansion and increasing social complexity. During the Preclassic, the Maya 206

relied extensively on the domestic dog (Canis lupus familiaris), which they used for both dietary 207

and ritual purposes [29], although perhaps primarily for ceremonies related to elite display and 208

power negotiations [29,30]. The turkey was another important food and ritual animal among the 209

Maya [31]. Prior models suggest that only local, wild ocellated turkeys were used through the 210

Classic period, but an early demand for domesticated or captive-reared turkey (i.e., M. 211

gallopavo) could have been related to increased elite ceremonial and status-displaying activities 212

as well as the need for meat to feed growing populations during the Late Preclassic to Classic 213

period of population growth and cultural florescence. 214

215

Conclusions 216

Combined zooarchaeological and aDNA analyses identified the earliest non-local 217

Mexican turkey remains in the Maya cultural region at the site of El Mirador. Prior to this 218

discovery, the earliest evidence of M. gallopavo in the Maya area dated to approximately one 219

thousand years later. The El Mirador turkeys may represent rare, or isolated imports from 220

11

central/northern Mexico, but it is also possible that captive/domestic Mexican turkey husbandry 221

was practiced by the ancient Maya much earlier than previously thought. The Maya may 222

therefore have had access to another domestic vertebrate, besides the dog, during the Late 223

Preclassic to Classic period of population expansion and increasing social complexity. 224

Significantly, the El Mirador turkeys also provide the earliest indirect evidence of M. gallopavo 225

captive rearing or domestication in Mesoamerica. Previously, all other indirect evidence of 226

husbandry (e.g., pen structures, egg shells and neonates, or the appearance of the species outside 227

its natural geographic range) dated to the Classic period or later [8,22,23]. 228

The early presence of M. gallopavo at Late Preclassic El Mirador demonstrates a need to 229

reassess the timing of turkey domestication and diffusion in Mesoamerica. Understanding when 230

the Mexican turkey was domesticated and when it was introduced to and fully adopted by the 231

ancient Maya has important consequences for understanding Mesoamerica subsistence systems 232

and long-distance trade connections. The topic also has broader ramifications with respect to the 233

process and timing of New World animal domestication, and the culture-specific motivations for 234

incorporating or not incorporating potential domesticates or managed species into ancient social 235

and economic systems. 236

237

Materials and Methods 238

Zooarchaeology and Osteometrics 239

The archaeological turkey bones were identified within a larger zooarchaeological 240

assemblage from the site (number of identified specimens = 3470). The sample also contained 241

other bird bones that we could only identify to the level of taxonomic subclass (Aves) because 242

they were undiagnostic elements or poorly preserved. Nearly all of the unidentified bird remains 243

12

come from large-bodied species, and some of these may represent additional M. gallopavo 244

elements. 245

Zooarchaeological specimens were identified through comparison with modern skeletons 246

housed in the Florida Museum of Natural History Environmental Archaeology and Ornithology 247

collections (www.flmnh.ufl.edu/museum/collections.htm). Turkey age and sex determinations 248

were based on skeletal element size, osteometrics [6,32], and tarsometatarsus spur morphology. 249

Archaeological bones were measured using standard osteometric measurements and were 250

compared to published metric data available for M. gallopavo and M. ocellata [6: Tables 10, 11, 251

14, 15, 20, 21]. 252

253

Ancient DNA Analysis 254

The four archaeological bird bones were processed in the Ancient DNA Laboratory 255

located in the Department of Archaeology at Simon Fraser University. The ancient DNA 256

laboratory is specifically designed for and dedicated to ancient DNA work - no modern DNA 257

samples have ever been processed in the lab. The lab is equipped with a UV filtered ventilation 258

and positive airflow, with dedicated equipment and bench UV lights. Strict contamination 259

control protocols are followed in the lab, including: 1) the use of protective clothing including 260

Tyvex™ suits, gloves, masks, etc.; 2) the separation of the pre- and post-PCR work (located in 261

two buildings with separate ventilation systems); and 3) the inclusion of multiple blank DNA 262

extractions and negative PCR controls. 263

Two separate DNA extractions were conducted for each bone, with the repeat extractions 264

occurring several months after the initial extractions. For both extractions, the analyzed bone 265

samples weighed approximately 0.5g. Bone samples were subjected to rigorous chemical 266

13

decontamination in order to remove possible surface contamination [33]. The samples were 267

immersed in a 6% sodium hypochlorite solution for 7 minutes, followed by immersion in 1 N 268

HCl solution for 30–60 seconds, then immersion in 1N NaOH for 30–60 seconds, before being 269

rinsed twice in ultra-pure water and UV irradiated in a crosslinker for 30 minutes on two sides. 270

The samples were crushed into powder using a liquid nitrogen grinding mill (6750 SPEX 271

CertiPrep Freezer/Mill). Three additional ancient turkey bones were included in analysis to act as 272

positive controls for both the initial and repeat extractions, as well as the subsequent PCR 273

reaction sets. These three bones were recovered from archaeological sites in Arizona (ca. AD 274

1100–1300) [9] and were processed separately from the El Mirador samples. DNA extraction 275

was performed using a modified silica-spin column technique [9,34], and approximately 100 µl 276

of DNA solution was collected for each sample. 277

PCR amplifications were conducted in a Mastercycler Personal (Eppendorf, Hamburg, 278

Germany) in a 30–50 µL reaction volume containing 50 mM KCl, 10 mM Tris-HCl, 2.5 mM 279

MgCl2, 0.2 mM dNTP, 1.0 mg/ml BSA, 0.3 µM each primer, 3.0–5.0 µl DNA sample and 2.5–280

3.5 U AmpliTaq Gold™ LD (Applied Biosystems). Primers were designed to target fragments of 281

Meleagris mitochondrial DNA of various lengths. Several different primer sets were tested 282

(Table S3). PCR began with an initial 12 minute denaturing period at 95°C, followed by 60 283

cycles at 94°C for 30 seconds (denaturing), 52°C for 30 seconds (annealing), and 72°C extension 284

for 40 seconds. Blank extracts and negative controls were included in each of the PCR reaction 285

sets. Ancient positive controls (Arizona archaeological turkey bone extracts) were also tested to 286

ensure the efficacy of the primer sets and PCR conditions. 287

Five µL of PCR product were visualized via electrophoresis on a 2% agarose gel using 288

SYBR Green™ staining, Successfully amplified PCR products of expected length were purified 289

14

using MinElute™ purification kits (Qiagen, Valencia, CA). Purified products were sequenced 290

using both forward and reverse primers at the Central Facility of the Institute for Molecular 291

Biology and Biotechnology Laboratory at McMaster University (using an ABI 3100) and at 292

Macrogen, Seoul, Korea (ABI 3730XL). The obtained electropherograms were edited, aligned 293

and compiled using ChromasPro software (www.technelysium.com.au). Consensus sequences 294

were developed based on multiple PCR amplifications and sequencing. 295

Once the DNA analysis of the ancient samples was completed, DNA was extracted from 296

a modern M. ocellata phalanx collected from Guatemala (FLMNH catalog number Z11050, 297

Table S4). The M. ocellata samples were processed in the SFU Center for Forensic Research in a 298

lab dedicated to DNA analysis of modern or forensic bone samples. Two 0.5g bone samples 299

were extracted using methods similar to those listed above. The DNA extracts were PCR 300

amplified using primers TK-F2/TK-R405 and TK-F252/TK-R567 (Table S3) and produced 301

amplicons of 254bp and 338bp in length, respectively. The PCR products were sequenced from 302

both directions and consensus sequences matched identically with the GenBank M. ocellata 303

reference sequence AF487120. 304

305

Ancient DNA Extraction Results and Authenticity 306

Sequences were obtained for three (631.0209, 631.0173, 631.0206) of the four bone 307

samples. Only one bone yielded replicable sequences (631.0206) using different primer sets and 308

using both the initial and repeated DNA extracts (Table S4). The obtained ancient DNA 309

sequences were BLAST-compared through GenBank to determine if they would match 310

Meleagris sequences and to ensure that they did not match with any other unexpected species or 311

sequences. Multiple alignments of the sample sequences and published Meleagris mtDNA 312

15

reference sequences were conducted using ClustalW [35] in order to confirm the species 313

identifications. 314

Two replicable DNA fragments were obtained for sample 631.0206 totaling 71bp and 315

55bp respectively once the primer sequences were removed. The two fragments correspond to 316

positions 15731–15800, and 15858–15913 on the M. gallopavo mitochondrial genome (reference 317

NC010195). Despite their short lengths, the sequences clearly match most closely with M. 318

gallopavo rather than M. ocellata, as demonstrated by the multiple alignment (Table S5). 319

Due to the antiquity of the samples and the tropical climate from which they were 320

recovered, a low success rate for DNA extraction and amplification is expected, and provides 321

support for the authenticity of the recovered sequences. The successfully reproduced sample, the 322

carpometacarpus fragment, was the largest of the four bone samples and the best preserved 323

morphologically [36]. PCR targeted fragments of mtDNA varying in length from <100 to 400bp. 324

Only short fragments of DNA could be amplified despite repeat amplifications with longer 325

primer sets designed to detect contamination from modern sources [37]. Multiple blank 326

extractions and negative PCR controls were included in the study, none of which yielded DNA 327

fragments of expected length. Successful amplification of three positive controls (ancient turkey 328

bones from Arizona) demonstrated the efficacy of both the extraction method and PCR primers 329

[9]. 330

The retrieved sequences matched very closely or identically with modern turkey 331

reference sequences in GenBank, and therefore cannot be used to definitively rule out the 332

possibility of contamination from modern sources. However, considering the short length of the 333

retrieved sequences significant differences between the ancient and modern turkeys were not 334

expected. Moreover, the primer sets were designed to target areas maximizing differences 335

16

between M. gallopavo and M. ocellata, rather than polymorphic sites within the M. gallopavo 336

control region. The retrieved sequences themselves, including those unreplicated sequences, 337

demonstrate significant post-mortem damage characterized by C→T transitions (Figure S1). 338

These DNA transitions were likely caused by hydrolytic damage and are anticipated to occur in 339

ancient sequences [37,38]. Finally, the DNA identification of M. gallopavo supports the 340

morphological and osteometric identification of the bones 341

Acknowledgments 342

FLMNH provided laboratory space and access to modern comparative specimens. Ashley Sharpe 343

and Deanne Matheny assisted with manuscript preparation. 344

345

References 346

1. Leopold AS (1959) Wildlife of Mexico: the game birds and mammals. Berkeley: University of 347

California Press. 581 p. 348

349

2. Schorger AW (1966) The wild turkey: its history and domestication. Norman: University of 350

Oklahoma Press. 625 p. 351

352

3. Howell SNG, Webb S (1995) A guide to the birds of Mexico and northern Central America. 353

New York: Oxford University Press. 1010 p. 354

355

4. Camacho-Escobar MA, Jiménez-Hidalgo E, Arroyo-Ledezma J, Sánchez-Bernal EI, Pérez-356

Lara E (2011) Natural history, domestication and distribution of the turkey (Meleagris 357

gallopavo) in Mexico. Revista Universidad y Ciencia, 27: 351–360. 358

17

359

5. Corona-M E (2002) The Pleistocene bird record of México. Acta Zoologica Cracoviensia 360

45(special issue): 293–306. 361

362

6. Steadman DW (1980) A review of the osteology and paleontology of turkeys (Aves: 363

Meleagridae). Contribution of the Science and Natural History Museum of Los Angeles County 364

California 330: 131–207. 365

366

7. Steadman DW, Stull JA, Eaton SW (1979) Natural history of the ocellated turkey. World 367

Pheasant Assoc. J. 4: 15–37. 368

369

8. Hamblin NL (1984) Animal use by the Cozumel Maya. Tuscon: University of Arizona Press. 370

206 p. 371

372

9. Speller CF, Kemp BM, Wyatt SD, Monroe C, Lipe WD, et al. (2010) Ancient mitochondrial 373

DNA analysis reveals complexity of indigenous North American turkey domestication. Proc. 374

Natl. Acad. Sci. U.S.A. 107: 2807–2812. 375

376

10. Álvarez T, Ocaña A (1999) Sinopsis de restos arqueo-zoológicos de vertebrados terrestres - 377

basada en informes del laboratorio de paleozoología del INAH. Mexico City: INAH Colección 378

Científica. 108 p. 379

380

18

11. Flannery KV (1967) Vertebrate fauna and hunting patterns. In Byers DS, editor. The 381

prehistory of the Tehuacan Valley, volume 1. Austin: University of Texas Press. pp. 132–177. 382

383

12. Middleton WD, Feinman GM, Nicholas LM (2002) Domestic faunal assemblages from the 384

Classic period Valley of Oaxaca, Mexico: a perspective on the subsistence and craft economies. 385

J. Archaeol. Sci. 29: 233–249. 386

387

13. Götz CM (2008) Coastal and inland patterns of faunal exploitation in the prehispanic 388

northern Maya lowlands. Quat. Int. 191: 154–169. 389

390

14. Hansen RD (1990) Excavations in the Tigre Complex El Mirador, Peten, Guatemala. Provo, 391

UT: New World Archaeological Foundation. 308 p. 392

393

15. Braswell GE, editor (2003) The Maya and Teotihuacan: reinterpreting Early Classic 394

interaction. Austin: University of Texas Press. 441 p. 395

396

16. Moholy-Nagy H, Nelson FW (1990) New data on sources of obsidian from Tikal, 397

Guatemala. Ancient Mesoam. 1: 71–80. 398

399

17. Pendergast DM (1971) Evidence of early Teotihucan-lowland Maya contact at Altun Ha. 400

Am. Antiq. 36: 455–460. 401

402

19

18. Clayton SC (2005) Interregional relationships in Mesoamerica: interpreting Maya ceramics at 403

Teotihuacan. Lat. Am. Antiq. 16: 427–448. 404

405

19. Neff H, Bishop RL, Arnold DE (1990) A reexamination of the compositional affiliations of 406

Formative period whiteware from highland Guatemala. Ancient Mesoam. 1: 171–180. 407

408

20. Matheny RT, Matheny DG (2011) Introduction to Investigations at El Mirador, Peten, 409

Guatemala. El Mirador Series, Part 1. Provo, UT: New World Archaeological Foundation, 410

Brigham Young University. 240 p. 411

412

21. Reese-Taylor K, Walker DS (2002) The passage of the Late Preclassic into the Early Classic. 413

In Masson M, Freidel DA, editors. Ancient Maya political economies. New York: AltaMira 414

Press. pp. 87-122. 415

416

22. Lapham HA, Feinman GM, Nicholas LM (in press) Animal economies in prehispanic 417

southern Mexico. In Götz C, Emery KF, editors. Archaeology of Ancient Mesoamerican 418

Animals. Oxford: Oxbow Press, David Brown Book Company. 419

23. Storey R (1992) Life and death in the ancient city of Teotihuacan: a modern 420

paleodemographic synthesis. Tuscaloosa: University of Alabama Press. 328 p. 421

422

24. Valadez AR (2003) Domesticación y zootecnia en el México antiguo. Imagen Veterinaria 3: 423

32-45. 424

20

425

25. Breitburg E (1993) The evolution of turkey domestication in the greater Southwest and 426

Mesoamerica. In Woosley AI, Revesloot JC, editors. Culture and contact: Charles C. Di Peso’s 427

gran chichimeca. Albuquerque: University of New Mexico Press. pp. 153-172. 428

429

26. McKusick CR (2001) Southwest birds of sacrifice. Tucson: Arizona Archaeological Society. 430

208 p. 431

432

27. Guderjan TH, Garber JF (1995) Maya maritime trade, settlement, and populations on 433

Ambergris Caye, Belize. San Antonio, TX: Maya Research Program and Labyrinthos. 201 p. 434

435

28. McKillop H, Healy PF, editors (1989) Coastal Maya trade. Peterborough, ON: Trent 436

University Occasional Papers in Anthropology, No. 8. 189 p. 437

438

29. Emery KF (2004) In search of the "Maya" diet: is regional comparison possible in the Maya 439

area? Archaeofauna 13: 37–56. 440

441

30. Teeter WG (2004) Animal utilization in a growing city, vertebrate exploitation at Caracol, 442

Belize. In Emery KF, editor. Maya zooarchaeology: new directions in method and theory. Los 443

Angeles: Institute of Archaeology, UCLA Press. pp 177–191. 444

445

21

31. Pohl MD, Feldman LH (1982) The traditional role of women and animals in lowland Maya 446

economy. In Flannery KV, editor. Maya subsistence: studies in memory of Dennis E. Puleston. 447

New York: Academic Press. pp 295–311. 448

449

32. von den Driesch A (1976) A guide to the measurement of animal bones from archaeological 450

sites. Cambridge, MA: Peabody Museum of Archaeology and Ethnology, Harvard University. 451

137 p. 452

453

33. Yang DY, Cannon A, Saunders SR (2004) DNA species identification of archaeological 454

salmon bone from the Pacific Northwest Coast of North America. J. Archaeol. Sci. 31: 619–631. 455

456

34. Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR (1998) Improved DNA extraction from 457

ancient bones using silica-based spin columns. Am. J. Phys. Anthro. 105: 539–543. 458

459

35. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of 460

progressive multiples sequence alignments through sequence weighting, position-specific gap 461

penalties and weight matrix choice. Nucl. Acids Res. 22: 4673–4680. 462

463

36. Haynes S, Searle JB, Bretman A, Dobney KM (2002) Bone preservation and ancient DNA: 464

the application of screening methods for predicting DNA survival. J. Archaeol. Sci. 29: 585–592. 465

466

37. Paabo S (1989) Ancient DNA: extraction, characterization, molecular-cloning, and 467

enzymatic amplification. Proc. Natl. Acad. Sci. U.S.A. 86: 1939–1943. 468

22

469

38. Gilbert MT, Binladen J, Miller W, Wiuf C, Willersley E, et al. (2007) Recharacterization of 470

ancient DNA miscoding lesions: insights in the era of sequencing-by-synthesis. Nucl. Acids Res. 471

35: 1–10. 472

473

23

Figure Legends 474

475

Figure 1: Pre-Hispanic range of M. ocellata and M. gallopavo [2,6] in Mesoamerica, and 476

location of discussed archaeological sites. 477

478

Figure 2: El Tigre Complex showing structures containing turkey bones (circled). Redrawn from 479

original by B. Dahlin. 480

481

Figure 3: Archaeological turkey specimens compared with modern M. gallopavo and M. 482

ocellata: A) right ulnae, and B) left tarsometatarsi. 483

484

Figure 4: Archaeological turkey () osteometrics compared with mean (±2 standard deviations) 485

M. gallopavo (male , female ); and M. ocellata (male , female ) [6]. 486

487

24

Table 1: Provenience dates and zooarchaeological, aDNA, and osteometric identifications of the El Mirador turkey specimens.

Catalog no. Provenience AMS date (calibrated)a

Zooarchaeological identification

aDNA identification

Osteometric identification

Element Sex/Age

631.0209A 26O-25/27 200 BC–AD 3 M. gallopavo M. gallopavo M. gallopavo ulna male

631.0173 26J-4 - M. gallopavo M. gallopavo M. gallopavo tarsometatarsus male (subadult)

631.0152 26J-14 186 BC–AD 54 M. gallopavo no amplification M. gallopavo ulna male

631.0206 35B-5 327–204 BC M. cf. gallopavo M. gallopavob inconclusive carpometacarpus -

631.0210 26O-25/27 200 BC–AD 3 M. cf. gallopavo not tested inconclusive carpometacarpus -

631.0209B 26O-25/27 200 BC–AD 3 M. gallopavo not tested - tarsometatarsus female

631.0341 26K-4 - Meleagris. sp. not tested - femur - a AMS dates from zooarchaeological specimens found in association with the turkey bones (Table S2) b aDNA identification was confirmed through repeat extractions and amplification

 

 

   

 

   

 

   

 

 

1

Supporting Information (SI) 1

El Mirador: excavation history, provenience descriptions, and dating 2

El Mirador, an ancient Maya city located deep in the tropical forest of the northern area 3

of the Department of Peten, Guatemala is famous for its Preclassic cultural remains (Table S1). 4

In 1932 the 16th Carnegie Institution Central American Expedition briefly visited the site. Years 5

later many of the largest architectural features of the site were mapped by Ian Graham and some 6

areas briefly tested by Joyce Marcus; a larger program of excavation and mapping was carried 7

out by Bruce Dahlin and Ray Matheny from 1978–1983, and included the Harvard El Mirador 8

Project in 1982. Excavations were resumed in 2003 by Richard Hansen and are ongoing as part 9

of what is known as the Mirador Basin investigations. The archaeological turkey specimens 10

reported here along with other archaeological animal remains were recovered from excavations 11

between 1980 and 1982 (Fig. 2). These materials were housed by the Brigham Young University 12

Museum of Peoples and Cultures prior to zooarchaeological analysis of the El Mirador animal 13

remains at FLMNH-EAP, which began in 2003. 14

All of the turkey bones recovered in the 1980s came from investigations in the Late 15

Preclassic Tigre Complex, whose major focus is the 56 m tall Tigre Pyramid. Operation 26J, 16

conducted by Hansen [14] under supervision by Matheny, was a tunnel placed under an ancient 17

plaster floor exposed at the base of the east side of the Jaguar Paw Temple. This floor was of 18

interest because it appeared to run under the building platform. Hansen probed under the floor 19

with a 3.7 m tunnel under a second continuous floor (below the first) that sealed a midden layer 20

containing bones, pieces of charcoal, ceramics, and other cultural materials; turkey bones were 21

found in Lots 04 and 14, and radiocarbon sample Beta 241842 was recovered from Lot 14 (Fig. 22

S2). Hansen [14: Table 4] classified all ceramics from the lots below the lower floor as 23

2

Preclassic. The midden layer may have been in place prior to floor construction or brought in 24

from elsewhere as floor preparation. Below the midden layer excavation continued through a 25

substantial layer of sterile sascab (deteriorated limestone) lying on bedrock. 26

Operation 26O was an exploratory 33 m tunnel into the heart of the Jaguar Paw Temple 27

[14: 70–73]. The turkey bones, and the mammal bone used for radiocarbon sample Beta 241844, 28

were found in contiguous Lots 25/27. The specimens were found about 24 meters into the 29

structure, almost directly under the center of the temple above (Fig. S3). The context of the 30

bones was sealed in antiquity by Late Preclassic construction of the temple that also covered 31

Middle Preclassic architectural remains. 32

Operations 35 A and B were in Structure 4D2-1, a prominent 8 m high building located 33

on the east side of the Tigre Plaza, directly east of the main Tigre Pyramid stairway (Fig. 1). This 34

building is the central construction of a triadic group. Operation 35A included the excavation of 35

two large chambers on the summit of the building, including the central room [14, Fig. S4]. 36

Excavations continued below what may have been the latest floor in the room. In Operation 35B, 37

which was a continuation of Operation 35A to a deeper level in the southern portion of the 38

central room, plaster floors were found at -3.18 m and at -4.7 m below datum. The excavations 39

continued beneath the lower plaster floor to -9.05 m in Lot 05 where radiocarbon sample Beta 40

241843 and turkey bones were found. Of an estimated 400 potsherds from Operation 35B, 41

Hansen [14] reported that all were from the early Late Preclassic period in a sealed context. 42

43

3

Figure Legends (Supporting Information) 44

Figure S1: Multiple alignments of obtained sequences demonstrating DNA damage induced 45

transitions. 46

47

Figure S2: Operation 26J baulk profile. Redrawn after [14: Fig. 29]. 48

49

Figure S3: Operation 26O baulk and tunnel profile. Redrawn after [14: Fig. 44]. 50

51

Figure S4: Operations 35A and 35B wall and baulk profile. Redrawn after [14: Fig. 56].52

4

Table S1: Generalized chronology used in the text 53

Mesoamerican cultural period Approximate dates

Early Preclassic/Formative 2000–1000 BC

Middle Preclassic/Formative 1000–300 BC

Late Preclassic/Formative 300 BC–AD 100

Terminal Preclassic/Protoclassic AD 100–250

Early Classic AD 250–600

Late Classic AD 600–800

Terminal Classic AD 800–1000

Postclassic AD 1000–1500

54 55

5

Table S2: AMS Radiocarbon ages from zooarchaeological remains found in association with the 56

archaeological turkey bones. 57

Taxa (scientific name)

Beta Analytic lab no.

Provenience (Op. no.)

Uncalibrated ages (years BP)

2 Sigma calibrated radiocarbon ages (INTCAL09 calendar years)

Odocoileus virginianus Beta-241842 26J-14 2050 +/- 50 186 BC–AD 54 Mammalia Beta-241843 35B-5 2250 +/- 40 330 BC–204 BC Mammalia Beta-241844 26O-25/27 2080 +/- 40 200 BC–AD 3

58

6

Table S3: Meleagris primers for PCR amplification 59

Primer name Direction Coordinates§ Sequence (5' to 3')

TK-F2* Forward 15482–15505 AATTTATTCCCGCTTGGATAAGCC TK-F143* Forward 15624–15650 GCATAATCGTGCATACATTTATATACC TK-F205 Forward 15685-15712 CGTACTAAACCCATTATATGTARACGGA TK-F224* Forward 15704–15729 GTAGACGGACATAACAACCTTTACCCC TK-F247 Forward 15729–15754 CCCATTYCTCCCTAATGACTACTCC TK-F252 Forward 15731-15755 CCATTTCTCCCACAATGACTACTCC TK-F315* Forward 15759–15782 ACATGCCAATGACATTAACTCCTTC TK-F411* Forward 15829–15854 TGGTTACAGGACATACCTCTAAATCT TK-R261* Reverse 15718–15741 AGGGAGRAATGGGGTAAAGGTTGT TK-R405* Reverse 15801–15824 TGTATATGGTCTCTTGRGGGTTGG TK-R519 Reverse 15914–15935 GGGTTGGTGATCTCTCGTGAGG TK-R567* Reverse 15962–15981 GGGAAAGAATGGGCCTGAAG * Previously published results [9] 60 § Coordinates numbered according to GenBank reference sequence accession EF153719. 61 62

7

Table S4: Results of PCR amplification and sequence analysis 63

Catlogue No.

Extraction TK-F2/

TK-R405 (342bp)

TK-F252/ TK-R567 (250bp)

TK-F143/ TK-R405 (200bp)

TK-F315/ TK-R519 (176bp)

TK-F205/ TK-R405 (139bp)

TK-F224/ TK-R405 (120bp)

TK-F143/ TK-R261 (117bp)

TK-F411/ TK-R519 (106bp)

TK-F247/ TK-R405

(95bp)

TK-F252/ TK-R405

(93bp)

TOTAL PCRs

Species Identity

631.0152 1st 0/1 0/1 0/1 0/1 0/2 0/1 0/2 0/2 0/2 0/13

N/A 2nd 0/1 0/1 0/1 0/1 0/1 0/1 0/1 0/7

0631.0209A 1st 0/1 0/1 0/1 0/1 0/2 0/1 0/2 0/2 0/2 0/13

M. gallopavo 2nd 0/1 0/1 0/1 0/1 0/1 1/1 0/1 1/7

631.0173 1st 0/1 0/1 0/1 0/1 0/2 0/1 0/2 1/2 0/2 1/13

M. gallopavo 2nd 0/1 0/1 0/1 0/1 0/1 0/1 0/1 0/7

631.0206 1st 0/1 0/1 0/1 0/1 1/2 0/1 1/2 1/2 1/2 4/13

M. gallopavo 2nd 0/1 0/1 0/1 0/1 1/1 0/1 1/1 2/7

Z11050 1st 2/2 2/2 4/4

M. ocellata 2nd 1/2 1/2 2/4

Note: Table lists the ratio of successfully PCR amplifications compared to total number of PCR attempts for all samples. 64 65

8

Table S5: Multiple alignment of M. gallopavo and M. ocellata control-region reference 66

sequences, with the retrieved ancient sequence 67

1574

0

1574

1

1574

1.1

1576

0

1576

1

1576

2

1576

2.1

1576

3

1577

6

1577

7

1577

8

1578

8

1578

9

1579

0

1579

1

1579

4

1579

5

1579

6

1579

9

1586

0

1586

3

1588

5

1589

6

NC010195 M. gallopavo C T - C A T - C C T C - C C C A T C T T C A G

AF532414 M. gallopavo A - - . . . G . . . . - . . . . . . . . . . .

AJ297180 M. gallopavo . . - . . . - . . . . - . . . . . . . . . . A

AF486875 M.g.silvestris . . - . . . - . . . . - . . . . . . . . . . .

GQ303165 M.g.gallopavo . . - . . . - . . . . - . . . . . . . . . . .

AF487121 M.ocellata . A C T G C - T T C T C A T A C C T G C G - .

AF487120 M.ocellata . A C T G C - T T C T C A T A C C T G C G - .

M. ocellata (cat #Z11050) . A C T G C - T T C T C A T A C C T G C G - .

Specimen 631.0206 . . - . . . - . . . . - . . . . . . . . . . .

68 69

9

70 71

10

72 73

11

74 75

12

76