downloaded from on march 21, 2020 by guest › ... › 2018 › 09 › 10 ›...

Filling the void: Introducing aromatic interactions into solvent tunnels towards 1

lipase stability in methanol 2

3

Shalev Gihaz1, Margarita Kanteev1, Yael Pazy2 and Ayelet Fishman1# 4

5

1Department of Biotechnology and Food Engineering, Technion-Israel Institute of 6

Technology, Haifa, 3200003, Israel 7

2Technion Center for Structural Biology, Lorry I. Lokey Center for Life Sciences and 8

Engineering, Technion-Israel Institute of Technology, Haifa, 3200003, Israel 9

10

Running head: Tunnel engineering for lipase methanol stability 11

12

#Address correspondence to Ayelet Fishman: Department of Biotechnology and Food 13

Engineering, Technion-Israel Institute of Technology, Haifa, 3200003, Israel; 14

[email protected]; Tel (972) 48295898. 15

16

Keywords: Lipase, protein engineering, stability, solvent tunnel, organic solvents, 17

biodiesel. 18

AEM Accepted Manuscript Posted Online 14 September 2018Appl. Environ. Microbiol. doi:10.1128/AEM.02143-18Copyright © 2018 American Society for Microbiology. All Rights Reserved.

on July 8, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

ABSTRACT 19

Enhanced stability in organic solvents is a desirable feature for enzymes implemented 20

under industrial conditions. Lipases potential as biocatalysts is mainly limited by 21

denaturation in polar alcohols. In this study we focused on selected solvent tunnels in lipase 22

from Geobacillus stearothermophilus T6 to improve its stability in methanol during 23

biodiesel synthesis. Using rational mutagenesis, bulky aromatic residues were incorporated 24

in order to occupy solvent channels and induce aromatic interactions leading to a better 25

inner core packing. Each solvent tunnel was systematically analyzed with respect to its 26

chemical and structural characteristics. Selected residues were replaced with Phe, Tyr or 27

Trp. Overall, 16 mutants were generated and screened in 60% methanol, from which 3 28

variants showed elevated stability up to 81-fold compared with wild-type. All stabilizing 29

mutations were found in the longest tunnel detected in the “closed-lid” x-ray structure. 30

Combining the Phe substitutions created double mutant A187F/L360F with an increase in 31

Tm of +7°C in methanol and a 3-fold increase in biodiesel synthesis yield from waste 32

chicken oil. Kinetic analysis with p-nitrophenyl laurate revealed that all mutants displayed 33

lower hydrolysis rates (kcat), though mostly their stability properties determined the 34

transesterification capability. Seven crystal structures of different variants were solved 35

disclosing new π-π or CH/π intramolecular interactions emphasizing the significance of 36

aromatic interactions to improved solvent stability. This rational approach could be 37

implemented in other enzymes for stabilization in organic solvents. 38

IMPORTANCE 39

Enzymatic synthesis in organic solvents holds increasing industrial opportunities in many 40

fields, however, one major obstacle is the limited stability of biocatalysts in such a 41


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

denaturing environment. Aromatic interactions play a major role in protein folding and 42

stability and we were inspired by this to re-design enzyme voids. Rational protein 43

engineering of solvent tunnels of lipase from Geobacillus stearothermophilus is presented 44

here, offering a promising approach to introduce new aromatic interactions within the 45

enzyme core. We discovered that longer tunnels leading from the surface to the enzyme 46

active site were more beneficial targets for mutagenesis for improving lipase stability in 47

methanol during biodiesel biosynthesis. Structural analysis of the variants confirmed the 48

generation of new interactions involving aromatic residues. This work provides insights 49

into stability-driven enzyme design by targeting solvent channels void. 50

INTRODUCTION 51

Utilization of enzymes in non-aqueous media has been an ongoing aspiration in 52

synthetic chemistry as such biotransformations exhibit several advantages over 53

conventional aqueous media. Some of the benefits include increased solubility of 54

hydrophobic substrates, elimination of microbial contamination and suppression of water-55

dependent catabolic side reactions (1-4). These advantages become more imperative when 56

combining biological catalysts together with chemo-catalysts to improve yields and 57

efficiency of processes (5). 58

Despite the great interest in biocatalysis in organic solvents, the non-trivial 59

combination of water-based enzymes within non-aqueous media presents many challenges, 60

most importantly, the relatively low stability of enzymes compared to their natural habitat 61

conditions (2, 6, 7). Conformational changes in the enzyme's structure are the main reason 62

for deactivation by organic solvents due to impairment of the hydrophilic-hydrophobic 63

interactions balance. Moreover, polar (hydrophilic) solvents can penetrate the enzyme's 64


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

hydrophilic core affecting secondary and tertiary conformational changes in parallel with 65

stripping off structured water molecules from the protein hydration shell (2, 8-15). 66

With the growing understanding on enzymes inactivation mechanisms using both 67

structural and computational tools, came the development of enzyme stabilization 68

techniques in organic solvents such as protein engineering and immobilization (2, 13, 16, 69

17). Protein engineering methods include: (a) random mutagenesis, (b) rational design, and 70

(c) semi-rational design (2, 8, 18-20). It was previously shown that these approaches can 71

be applied separately or in combination to tailor enzymes for enhanced stability in organic 72

solvents (1, 9, 12, 18, 21, 22). 73

Protein engineering by rational design requires structural information, and precise 74

regions for mutagenesis are identified usually by computational tools or prior knowledge 75

(17, 22-24). One recently developed concept for enzyme stabilization in organic solvents 76

is modification of residues buried in tunnels within the protein structure. Globular enzymes 77

are comprised of clefts, pockets, channels and cavities, which offer a unique 78

microenvironment for biological functions, such as ligand binding or enzymatic catalysis. 79

The tunnel properties (diameter, length, hydrophobicity, etc.) may alter substrate 80

specificity or improve organic solvent resistance (2, 25-28). The identification of these 81

networks requires computational engines for detecting cavities and tunnels such as CAVER 82

or MOLE generator along with a known structure or model for the target protein (29-31). 83

The profound work of Damborsky and co-workers on stabilizing haloalkane dehalogenase 84

(DhaA) has demonstrated the potential of saturation mutagenesis of residues found in 85

solvent channels. The random substitutions established in these works revealed the effect 86

of small vs. bulky residues on both the activity and stability of DhaA (32, 33). 87


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

Lipases have a long history of utilization in organic solvents (34, 35). They are 88

ubiquitous hydrolytic enzymes mostly possessing two unique features; (i) 'interfacial 89

activation' phenomenon with enhanced activity generated at an oil-water interphase, and 90

(ii) a helix 'lid' gating the substrate accessibility which exposes the active site towards 91

catalysis (“open/close” conformations) via a conformational change (36). In a micro-92

aqueous environment, lipases carry out synthesis reactions such as transesterification of a 93

wide range of natural and unnatural substrates (36-38) while one common reaction is the 94

synthesis of fatty acid methyl esters (FAMEs) also known as biodiesel (39-41). Biodiesel 95

is a sustainable and renewable alternative for petroleum-based fossils, which can be 96

produced from a wide range of feedstocks (edible and non-edible animal fats and plant 97

oils). In most cases, methanol serves as a second substrate in FAME production (42, 43). 98

Compared with traditional chemical pathways to synthesize FAMEs, enzymatic routes are 99

preferred regarding energy consumption and downstream operations. Lipase efficiency in 100

converting oil feedstocks into biodiesel is mainly restrained by alcohol-induced 101

inactivation, thus, methanol-stable enzymes are desired (10, 44-46). 102

The thermophilic bacterial lipase from Geobacillus stearothermophilus T6 (LipT6), 103

was previously used for biodiesel synthesis and the wild-type recombinant enzyme 104

(LipT6WT) was stabilized towards methanol by protein engineering (47, 48). LipT6WT 105

crystal structure (PDB 4X6U) revealed tight side-chain packing and a relatively rigid 106

structure while structures of the methanol-stable variants affirmed the enhancement of a 107

surface hydrogen bond network (47, 48). Furthermore, the helix-lid was identified (α9, 108

residues F177-A192) (48), and is expected to have a significant interphase-triggered 109

conformational change as was reported by Carrasco-Lopez et al. for a similar lipase from 110


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

Geobacillus thermocatenulatus analyzed in an “open” lid conformation (95% sequence 111

identity) (49). Further stabilization of the methanol-stable variant H86Y/A269T/R374W 112

was obtained through immobilization in sol-gel (50). 113

To date, solvent tunnel engineering of lipases was not applied for improving 114

stability in methanol. Most works aimed to alter enzyme selectivity and substrate 115

specificity (26, 31, 51-54). While the previous report on stabilizing DhaA employed 116

saturation mutagenesis of tunnel residues (33), herein a more systematic rational approach 117

was practiced, incorporating bulky aromatic amino acids for introducing new interactions 118

within the LipT6 inner hydrophobic core. Tighter packing of a protein lipophilic core was 119

previously shown to result in higher stability with correlation to thermophilic nature (55). 120

In particular, aromatic interactions have a major contributing role in protein folding 121

nucleation, membrane anchoring and thermodynamic stability (56-60). Solvent tunnels 122

were selected as target regions for mutagenesis due to their void volume and accessibility 123

to the enzyme centroid. Each solvent tunnel was carefully and logically examined and Phe, 124

Tyr or Trp substitutions were incorporated. Single variants were purified and evaluated for 125

stability features, kinetic parameters and biodiesel synthesis, as well as their double and 126

triple combinations. X-ray structures of 7 mutants revealed the changes induced by the 127

inclusion of bulky residues. Interestingly, we discovered non-trivial correlations among 128

three neighboring stabilizing Phe mutations. 129

130


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

RESULTS 131

Tunnels analysis and selection of mutations. Analysis of the LipT6WT structure (PDB 132

4X6U) with MOLE 2.0 generator yielded 9 tunnels, and several nearby residues to these 133

channels (4-5 Å) were identified and selected for mutagenesis (Fig. 1). Overall, 10 134

positions were selected for rational design and 16 single mutants were generated as 135

presented in Table 1. The general considerations were: (i) obstructing solvent tunnels with 136

bulky side chains, (ii) maintaining the native hydrogen bond networks, and (iii) avoiding 137

changes to catalytic and metal binding residues. The geometrical and biochemical 138

properties of each residue dictated the choice of the specific amino acid used for site-139

directed mutagenesis (Phe, Tyr or Trp). The different primers used for mutagenesis are 140

listed in Table 2. 141

Screening for enhanced stability in 60% methanol. The mutants were expressed in E. 142

coli and the soluble cell extract was used for stability evaluation in 60% methanol as 143

previously described (47, 48). Relative hydrolysis activity values of the designed mutants 144

compared with LipT6WT are presented in Table 3. A threshold of 4-fold increase in stability 145

was used to determine which mutations were further combined to investigate a potential 146

additive effect. Of the 16 variants evaluated, only L184F, A187F and L360F had significant 147

improvement of 81.2, 5.3 and 4.5-fold compared with WT, respectively. All three 148

mutations were found in the vicinity of the longest solvent tunnel (tunnel 1) which is 2.9 Å 149

away from catalytic Ser114 as presented in Fig. 2. L184 and A187 are located on the LipT6 150

helix lid while L360 is part of a flexible internal loop. The three mutations were combined 151

in all possible rearrangements to explore their additive effect on LipT6 stability (Table 3). 152

Only two double mutants, L184F/A187F and A187F/L360F, were found to be more stable 153


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

than LipT6WT but inferior to L360F, while the triple mutant was a very poor catalyst, 154

suggesting a complex association between these three residues. 155

Stability measurements of purified enzymes in 70% methanol. In order to validate the 156

screening results, single variants and their double mutant combinations were purified and 157

used for stability measurement in 70% methanol during a total incubation time of 6 h (47). 158

The relative activity values (compared with stress-free conditions in buffer) are presented 159

in Fig. 3. An expected decrease in activity occurred in all variants after 1 h, while LipT6WT 160

lost more than 70% of its activity after 6 h of incubation. Single variants L184F, A187F 161

and L360F maintained 37, 47 and 73% of their hydrolytic activity after 6 h, respectively, 162

as was also inferred by the screening results (Table 3). In addition, double mutants 163

L184F/A187F and A187F/L360F showed increase in stability compared to LipT6WT, 164

preserving more than 48 and 58% of their initial activity, respectively. Nevertheless, double 165

mutant L184F/L360F presented lower stability after losing more than 80% of its initial 166

activity after 6 h. As found in the screening stage, only 5 out of 6 mutants were more stable 167

than LipT6WT. 168

Unfolding temperature of LipT6 mutants. The stable mutants (in their purified form) 169

were characterized by their unfolding temperature (Tm) in buffer (native environment) and 170

in organic solvents (denaturing environment). The assay was conducted using differential 171

scanning fluorimetry (50) with 60% methanol solutions resembling biodiesel synthesis 172

reaction conditions (Table 4). Furthermore, Tm values were also measured in 50-70% (v/v) 173

solutions of methanol, ethanol, acetonitrile and DMSO (Table S1). 174

The results in Table 4 clearly indicate that all single mutants were more stable than 175

LipT6WT in both buffer and 60% methanol, while similar results were obtained for 176


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

additional organic solvents (Table S1). Among the single mutants, L360F presented the 177

highest thermal stability improvement in buffer and in 60% methanol of more than +3°C 178

and +6°C, respectively. Moreover, it displayed higher thermal stability in all other solvents 179

tested. The addition of A187F to form variant A187F/L360F, resulted in a further 180

improvement of overall +5°C and +7°C in buffer and 60% methanol, respectively. 181

Surprisingly, L184F/L360F exhibited a lower Tm compared with LipT6WT, despite the 182

stabilizing effect observed by L184F and L360F, separately (the same trend was observed 183

in the other organic solvents studied). However, L184F/A187F had minor enhancement in 184

buffer (+1°C) but substantial stability of +7°C in 60% methanol. 185

Kinetic analysis. To investigate the mutation effects on enzyme kinetics, pNPL hydrolysis 186

was selected, based on its wide usage in lipase studies (61-64) including LipT6 (47, 48). 187

The kinetic constants (Table 5) were calculated based on activity in native conditions 188

without methanol. In general, all variants displayed a decrease in kcat values compared with 189

LipT6WT, with L184F/L360F displaying a 70% decline. Single mutants A187L and L360F, 190

and double mutants L184F/A187L and A187F/L360F all had similar lower Km constants, 191

while L184F displayed a similar value as LipT6WT. L184F/L360F had the lowest Km value 192

compared with LipT6WT but also the lowest activity rate. Moreover, the enzyme efficiency 193

parameter kcat/Km of most variants was lower than LipT6WT, except L184F/L360F which 194

displayed a 2-fold increase. Generally, the L360F mutation had the largest negative impact 195

on kcat in the hydrolysis reaction. 196

Biodiesel production from waste chicken oil. Purified single and double variants were 197

used as soluble biocatalysts for biodiesel synthesis from waste chicken oil with 5:1 molar 198

ratio of methanol:oil. Results presented in Fig. 4 emphasize the superior stability and yield 199


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

of double mutant A187F/L360F which converted 88% of waste chicken oil into FAME (3-200

fold improvement over LipT6WT yield after 24 h) under conditions tested. Single mutant 201

L360F achieved the second-highest FAME yield of 59% under conditions tested (2-fold 202

improvement). The synthesis yields highly correlated with the increase in Tm, (Table 4) 203

the initial screening results of the soluble cell extracts (Table 2), and the pure enzyme-204

based stability assay in 70% methanol (Fig. 3). Furthermore, L184F and L184F/L360F 205

provided lower FAME conversions compared with LipT6WT as predicted by their Tm values 206

in 60% methanol. Unexpectedly, A187F and L184F/A187F variants displayed a similar 207

increase in transesterification activity contrary to their different Tm. An additive effect in 208

terms of stability was well observed mainly in combining A187F and L360F mutations. 209

On the other hand, L184F mutation had a negative effect in combination with L360F and 210

negligible influence when merged with A187F. 211

Crystal structure determination. In an attempt to gain a deeper understanding of the 212

correlation between structure and stability, the crystal structures of all single and double 213

mutants were solved at resolutions of 1.2 - 2.7 Å (Fig. 5 A-F in comparison with LipT6WT). 214

Crystal parameters and data statistics are summarized in Table S2. Each solved structure 215

was analyzed with two web servers: (a) MOLE 2.0 to re-assess the variants’ new solvent 216

tunnel distribution (30) and (b) Arpeggio for calculating and visualizing unique interatomic 217

interactions in LipT6 mutants compared with LipT6WT. Arpeggio server uses PDB files to 218

calculate all possible intramolecular interactions based on the residues geometrical and 219

biochemical features (65). It was selected due to its versatility in identifying a wide range 220

of interactions and its straightforward user interphase in comparison with other traditional 221

tools. 222


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

First, superposition of all mutant structures with LipT6WT ensured there was no 223

significant structural change in the catalytic triad (Ser114, His359, Asp 318), calcium-224

binding site (Glu361, Gly287, Pro367, Asp366), zinc binding site (Asp62, His88, Asp239, 225

His82), and oxyanion hole stabilizing backbone residues (Phe17 and Glu115) (48). Thus, 226

all changes in the variants properties are associated directly to the induced mutations. The 227

electron density around the mutated residues in all variants discussed are presented in Fig. 228

S1. 229

Inspection of solvent tunnels in the new structures using the MOLE server, 230

confirmed the elimination of tunnel 1 which extends from the outer protein surface towards 231

the hydrophobic pocket (Fig. S2). As expected, the phenyl rings obstructed the channel by 232

occupying its volume. Moreover, no other newly-formed tunnels were identified close to 233

the active site region or other locations in variants crystal structures. 234

In all single mutants structures (Fig. 5, A-C), the phenyl side chains orientation is 235

directed towards the former occupied region of tunnel 1. Compared with LipT6WT, the three 236

single mutations did not cause any structural changes in the near environment and overall 237

fold. Analysis of new contacts in the mutants using Arpeggio revealed a new π-π interaction 238

with Phe291 in L184F and A187F (Fig. 5A, 4B). Phe291 is a neighboring residue to the 239

mutated residues, located on a solvent accessible loop (a13) and mainly stabilized by CH/π 240

interactions (Fig. S3). Moreover, Phe184 interacts with Phe17 and several CH/π 241

interactions were formed following mutagenesis. In L360F, a new π-π interaction with 242

catalytic His359 was generated. This residue is stabilized by several other interactions in 243

LipT6WT (Fig. S3). 244


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

Examining double mutant structures, of which two were more stable than LipT6WT, 245

showed different bond networks depending on the mutation combinations (Fig. 5, D-F). 246

Stable mutants L184F/A187F and A187F/L360F had a similar residue pose as in the 247

respective single variants. L184F/A187F (Fig. 5D) displayed the same interactions as were 248

found in L184F and A187F separately, creating two new π-π interactions with Phe291. In 249

addition, Phe184 and Phe187 participate in a new aromatic continuum with Phe 291, as 250

was shown in L184F. Likewise, similar to the two single mutants, stable variant 251

A187F/L360F (Fig. 5F) exhibited new π-π interactions with His359 and Phe291 by Phe360 252

and Phe187, respectively. 253

In contrast, methanol-sensitive variant L184F/L360F exhibited a different 254

conformation of Phe184, due to steric hindrance by Phe360 (Fig. 5E). Movement of 255

Phe184 also induced a conformational change of Phe291 now facing “out” into a more 256

solvent accessible orientation (Fig. S4). This movement caused the exclusion of π-π or 257

amide-π interactions formerly stabilizing Phe291. In addition, in its "new" orientation, 258

Phe184 was discarded from any π-π interactions, now stabilized by only hydrophobic 259

interactions. The poor methanol-stability of L184F/L360F is therefore linked to the 260

aromatic rearrangement in the vicinity of the active site, despite the stabilizing effect of 261

L360F alone due to tunnel 1 obstruction. To further strengthen this hypothesis, the crystal 262

structure of triple mutant L184F/A187F/L360F was solved (Fig. S5). The structure 263

displayed the same “flipped” conformation of Phe184 and Phe291 occurring in 264

L184F/L360F. Despite this, Phe187 managed to interact with Phe291 and Phe360 by π-π 265

interactions, but with no effect on the variants’ stability. 266

267


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

DISCUSSION 268

Enzyme engineering is one of the major approaches for designing stable 269

biocatalysts for an organic solvent environment (2, 10, 18, 22). Manipulating tunnels for 270

obtaining stability in organic solvents was first introduced on haloalkane dehalogenase 271

DhaA by Koudelakova et al. increasing its stability in DMSO by primarily randomized 272

design (33). Most works on tunnel re-design focus on altering substrate selectivity by 273

influencing substrate access to the active site (26, 31, 52, 53, 66-69). 274

The present work aimed to stabilize LipT6 in methanol by incorporating aromatic 275

residues into solvent channels to induce improved hydrophobic packing via π-involving 276

interactions. Some works suggested that such modifications can potentially restrict 277

unnecessary penetration of polar alcohols into the enzyme core (32). Site-directed 278

mutagenesis at selected positions was performed based on geometric and biochemical 279

properties of the residues. This approach was indeed successful in obtaining new solvent-280

stable mutants of LipT6, with improved Tm and biodiesel synthesis yields. As a rational 281

concept, introducing π-interactions within lipophilic areas in the enzyme inner tunnels can 282

reduce screening efforts, compared with other reported directed evolution approaches. Dror 283

et al. obtained a 2-fold improvement in FAME synthesis yield with LipT6 double mutant 284

H86Y/A269T, when combining mutations selected from random mutagenesis and 285

structure-guided consensus libraries. Isolating these mutations required the screening of 286

over 2200 colonies (47). Greater improvement of 30-fold higher stability in 70% methanol 287

was achieved by Korman et al. who constructed Dieselzyme4 (Proteus mirabilis lipase 288

variant with 13 mutations including one introduced disulfide bond), though their overall 289

screening efforts were estimated in 20,000 colonies (70). On the other hand, a rational 290


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

approach by Park et al. yielded 7 variants of Candida antarctica lipase B (CaLB) with 291

potentially enriched hydrogen bonds network while only one mutant possessed 1.5-fold 292

higher stability in 80% methanol (71). Koudelakova et al. discovered stabilizing mutations 293

located in the DhaA access tunnel after screening 5326 colonies from random mutagenesis 294

libraries, towards stability in 42% DMSO. The random positive mutations were added to a 295

previously-known stable DhaA variant and saturation mutagenesis of position Ala171 in 296

the access tunnel was performed. This combined approach resulted in few stable variants 297

possessing superior 2-fold increased stability in 40% DMSO (33). Regarding our screening 298

efforts (16 single variants) and the additive effect accomplished (3-fold improvement in 299

FAME biosynthesis), one can conclude that introduction of aromatic interactions within 300

solvent tunnels is a promising concept in the quest for solvent-stable enzymes. Moreover, 301

focusing on long and deep tunnels could have even reduced labor and cost efforts. 302

Generally, initial screening results emphasized the dependence on tunnel location 303

and length. Stabilizing mutations (3 of 6; 50%) were found exclusively in the longest 304

solvent pathway (tunnel 1) leading from the surface to the active site. The overall structure 305

of LipT6 is rigid and compact similar to other thermophilic homologs in the I.5 family (49, 306

72, 73). Thus, the peripheral tunnels are situated mostly near the hydrophilic surface (Fig. 307

1) and are less prone to stabilization through core hydrophobic interactions. In addition, 308

tunnel 1 is near the active site thus re-designing such surroundings was expected to have 309

some significant outcomes as was presented by Biedermannova et al. for haloalkane 310

dehalogenase LinB (51). Furthermore, Phe and Tyr mutations had significantly diverse 311

stabilization features when occupying the same position (Table 3). For example, L360F 312

was 81.2-fold more stable than wild-type while L360Y was less stable (0.19-fold). These 313


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

contradicting outcomes highlight the importance and unique nature of this tunnel, nearby 314

the helix-lid which is expected to have a significant structural rearrangement in the 315

presence of hydrophobic substrates. 316

Three positions within tunnel 1 were selected for further investigation after their 317

Phe mutations resulted in increased stability in 60% methanol. L184 and A187 are located 318

on LipT6 helix-lid (α9) while L360 is found close to the active site. Re-analysis of the 319

variants crystal structures with MOLE 2.0 indicated that the introduced phenyl side chains 320

managed to crowd tunnel 1 (no longer found in mutants, Fig. S2), as intended, and as 321

described beforehand (32, 33). Conversely, Liskovaet et al. have shown that replacing Phe 322

with Gly in DhaA80 caused a decline in stability due to disruption of intramolecular 323

hydrophobic packing (32). These findings correlated with our positive results of replacing 324

Leu or Ala with Phe residues rationally. Stability measurements of purified enzymes in 325

70% methanol validated our screening results as L360F exhibited the highest residual 326

activity after 6 h followed by stable mutants A187F and L184F, respectively. Melting 327

temperature measurements agreed well with initial stability screening results when L360F 328

and A187F mutants presented better thermal stability in both buffer and methanol (along 329

with other organic solvents as presented in Table S1). A similar correlation between Tm 330

and stability in organic solvents was previously obtained for other LipT6 stable variants 331

(47, 48). 332

The superior stability of L360F was greatly related to its unexpected π-π stacking 333

interaction with catalytic His359 (Fig. 5C). Kannan and Vishveshwara previously reported 334

the existence of one aromatic cluster next to the active site in thermophilic enzymes which 335

was lacking in their mesophilic equivalents (55). LipT6 homologous sequence alignment 336


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

performed by Dror et al. showed that Leu360 is not an evolutionary conserved position, 337

however the formation of a new aromatic cluster explains the stabilization exhibited by this 338

mutant (47, 55). 339

Both L184F and A187F interacted separately with Phe291 by new aromatic π-π 340

interactions, while A187F had both improved transesterification activity and 341

thermostability. Since L184F exhibited the relatively lowest improvement in Tm and 342

methanol-stability, it can be implied that a minimum stability enhancement threshold is 343

required for improved biodiesel synthesis in comparison with LipT6WT. As previously 344

described by Dror et al., some mutations in LipT6WT induced methanol stability but at the 345

same time led to decreased FAME synthesis. One example is the neighboring position 346

Gln185, which was mutated into Leu and was found to induce alcohol-stability yet a lower 347

transesterification yield of soybean oil (47). This phenomena was attributed to tighter 348

orientation of LipT6 helix-lid limiting the triglycerides accessibility during biodiesel 349

synthesis. It can be assumed that the L184F mutation had a similar affect as was reported 350

for Q185L. In addition, several studies indicated that mutations of the lid can alter 351

thermostability along with selectivity (74, 75). Khan et al. recently reviewed the influence 352

of mutagenesis of the lid on thermostability and activity highlighting the importance of this 353

domain in lipases (76). Some studies indicated a simultaneous change in stability and 354

substrate preferences caused by altering residues on the lid (77, 78). Likewise, decline in 355

activity accompanied with elevated stability was also apparent after introducing bulky 356

residues in the DhaA access tunnel (32, 33). 357

Kinetic analysis revealed a general increase in substrate affinity (lower Km) and 358

decrease in maximum hydrolytic velocity (lower kcat) by most variants. As expected, 359


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

mutations in the vicinity to the active site tend to affect enzyme kinetics, selectivity or even 360

mechanism (51, 68, 69). Among single mutants, L360F displayed the lowest kcat with 361

similar Km values, emphasizing the significant interaction with catalytic His359. Lid 362

mutations L184F and A187F also affected LipT6 kinetics as was described previously by 363

Tang et al. on lid mutations of Penicillium expansum lipase (77). Despite the lower activity 364

rates of the mutants in the hydrolysis reaction, most of them performed better in an organic 365

solvent environment, leading to higher biodiesel yields (Fig. 4). 366

Merging stable mutations in all possible double-mutant combinations revealed 367

interesting complex correlations regarding stability in methanol, Tm values and FAME 368

synthesis. The highest stabilizing affect was accomplished by A187F/L360F, displaying 369

the best FAME yield (88% after 24 h) and Tm improvement (+5°C and +7°C compared 370

with LipT6WT in buffer and 60% methanol, respectively). These finding were also 371

confirmed in the purified enzyme stability assay (Fig. 3) and melting temperatures in other 372

polar solvents (Table S1). Relatedly, Stepankove et al. previously showed that different 373

organic solvents can confer different destabilizing effects on enzymes (79). Structural 374

analysis suggests that new aromatic interactions with both catalytic His359 (by Phe360) 375

and Phe291 (by Phe187) are responsible for the improved performance in the non-aqueous 376

environment. Aromatic interactions were previously found to stabilize xylanase, 377

ribonuclease and many other protein structures by improving hydrophobic packing and 378

introducing new π-interactions (80-83). In addition, these two mutations did not dismiss 379

interactions found in LipT6WT, yet enriched the existing network along with occupying 380

tunnel 1. Prior work on LipT6 stabilization highlighted the importance of enhancing the 381

hydrogen bond network among surface residues as well as interactions with water 382


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

molecules (47, 48). Here, we have discovered the significance of π-π stacking interactions 383

and CH/π interactions within the LipT6 hydrophobic core to methanol stability. The kinetic 384

properties of A187F/L360F revealed a lower hydrolysis reaction rate and higher affinity 385

towards pNPL (C12). Despite this, triglycerides methanolysis rate and yield was 3-fold 386

higher than wild type. Based on these observations, we conclude that the major factor 387

influencing FAME synthesis in our system is the enzyme stability. This was also shown in 388

other cases (47, 48). Dror et al. showed that LipT6 double mutant H86Y/A269T had similar 389

hydrolysis performance to LipT6WT though its FAME yield from soybean oil was 2-fold 390

higher (47). 391

L184F/A187F variant displayed similar thermostability to A187F/L360F, but its 392

transesterification performance was similar to A187F. Adding L184F did not reduce the 393

already improved transesterification activity of A187F. Only L184F/A187F possess two 394

neighboring lid mutations which may explain this non-correlative relationship between 395

alcohol stability and FAME synthesis, as was shown before (76, 77). Both L184F and 396

L184F/A187F structures revealed a π-π stacking interaction network involving 16 aromatic 397

side chains (Fig. S6). Apparently, thermostability improved due to this branched aromatic 398

continuum, but no significant transesterification improvement occurred compared with 399

A187F variant (55). 400

Interestingly, double mutant L184F/L360F, comprising of two single stabilizing 401

mutations, showed decreased methanol stability, lower Tm (in all solvents tested), lowest 402

kcat, Km and biodiesel yield. Unlike the effect of L184F on A187F (L184F/A187F variant), 403

in combination with L360F a dramatic decrease in stability occurred. Inspecting the crystal 404

structure L184F/L360F showed an aromatic cluster rearrangement involving Phe184, 405


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

Phe291 and Phe360 (Fig. 5, S3). Steric collision between static Phe360 (found in the same 406

orientation in all mutants) and Phe184, caused the latter a conformational change leading 407

to movement of Phe291 as well. Subsequently less intramolecular interactions were 408

possible. It was previously shown that helix-stabilizing residues (as Phe291) had an impact 409

on protein stability when comparing thermophilic and mesophilic homologs (84). In 410

addition, analysis of triple mutant L184F/A187F/L360F affirmed that A187F could not 411

restore L184F/L360F stability or favored ring conformation. The fact that stabilizing 412

mutation L360F did not improve the stability of L184F or L184F/A187F, demonstrated the 413

significant impact of Phe291 conformation on LipT6 stability and organic synthesis 414

capability. 415

Overall, this new systematic approach of rational tunnel engineering by 416

incorporating aromatic residues to facilitate π-involving interactions could be considered 417

when stabilizing other enzymes in organic solvents, focusing on deep and long solvent 418

channels. 419

420


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

MATERIALS AND METHODS 421

Chemicals. Methanol, glycerol, NaCl and Triton X-100 were purchased from Bio-Labs 422

(Jerusalem, Israel). 2-Propanol , ethanol and sodium citrate were purchased from J.T. Baker 423

(Deventer, The Netherlands). Sodium formate, dimethyl sulfoxide (DMSO) and sodium 424

acetate were purchased from Merck (Darmstadt, Germany). Ethyl acetate was purchased 425

from Gadot (Haifa, Israel) while acetonitrile and CaCl2 from Spectrum Chemical MFG 426

(Gardena, CA, USA). Trizma-base, 4-nitrophenyl laurate (pNPL), polyethylene glycol 427

(PEG) 400, PEG 3350, heptadecanoic acid methyl ester and kanamycin were purchased 428

from Sigma–Aldrich (Rehovot, Israel). Waste chicken oil was kindly donated by Miloubar 429

(Miloubar Mixture Institute ACS, Miluot, Israel). All materials used were of the highest 430

purity available. 431

Bacterial strains, plasmids and enzymes. Recombinant Geobacillus stearothermophilus 432

T6 lipase (EMBL, AF429311.1) fused to a His-tag was expressed in Escherichia coli BL21 433

cells (DE3; Novagen, Darmstadt, Germany) as previously described (47, 48, 50). 434

Solvent tunnels analysis using MOLE 2.0. The crystal structure of LipT6WT (PDB 4X6U) 435

was analyzed for tunnels detection with MOLE 2.0 online generator 436

[http://old.mole.upol.cz/] using default parameters (30). The analysis resulted in 9 tunnels 437

and superposition display (enzyme structure and tunnels' coordinates) was utilized to define 438

the closest residues to these channels (4-5 Å direct distance) using Pymol (85). After 439

eliminating essential residues (catalytic, metal-binding and multiple hydrogen bond donor) 440

and inspecting MOLE 2.0 job review, 10 positions were selected for site-directed 441

mutagenesis (Table 1) alternated into at least one bulky residue (F, Y or W). Mutants were 442


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

generated, and subsequently evaluated for activity, stability, and structural 443

characterization. 444

Site-directed mutagenesis of LipT6. Rational mutagenesis of pET9a-LipT6WT plasmid 445

was performed using the QuickChangeTM Protocol for Site Directed Mutagenesis. Reaction 446

mixture is composed of 5µl Taq polymerase buffer, 2µl DNA template (50 ng/µl), 1.5µl of 447

each primer solution (1µg/µl), 2µl dNTP’s (20 mM A:T:C:G 1:1:1:1), 0.5µl Taq 448

polymerase (EurX; Gdańsk, Poland) and 37.5µl bH2O. The different primers are listed in 449

Table 2. Followed by its addition, Taq polymerase was incubated in a thermocycler 450

(Labcycler; SensoQuest, Göttingen, Germany). The PCR program had an initial 451

denaturation step for 1 min at 95 °C, then 20 cycles of 30 s at 95 °C, 45 s at 65 °C and 6 452

min at 68 °C, followed by a final elongation step for 7 min at 68 °C. PCR product was run 453

on agarose gel (1 % w/w) to validate single-band product and the template plasmid was 454

digested for 18 h at 37 °C with a Dpn1 treatment (NEB, Massachusetts, USA). The 455

resulting plasmid was used for transformation and selection on LB agar plates containing 456

25 μg/ml kanamycin. Plasmids from positive colonies were extracted using a plasmid 457

miniprep kit (Qiagen, Hilden, Germany), and sequenced for verification (HyLabs, 458

Rehovot, Israel). 459

Soluble lipase activity assay. The soluble lipase hydrolytic activity on pNPL was 460

determined using a colorimetric assay as described previously (47, 48). This method was 461

also used to determine the specific activity of purified enzyme samples in buffer and in 462

solvent solutions. 463

Stability screen in 60% methanol. Screening for methanol-stable mutants was performed 464

as described previously with few modification (47). TB medium inoculation volume was 465


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

35 ml while after centrifugation the cells were resuspended in 9 ml buffer to increase the 466

method’s sensitivity. 467

Purification of LipT6 variants. Purification of LipT6 variants was conducted according 468

to previously described procedures (47, 48), with AKTA Prime Plus (GE Healthcare Bio-469

Sciences AB, Sweden). 470

Unfolding temperature (Tm) determination of purified LipT6 variants. Denaturation 471

temperature determination by using nanoDSF device was conducted according to a 472

previously described procedure (50). 473

Determining kinetic parameters. Km and kcat values for LipT6 purified variants were 474

determined using the pNPL hydrolysis colorimetric assay in 96-well plates as was 475

previously described (47, 48). Results were analyzed using SigmaPlot software. 476

Stability validation of LipT6 variants in 70% methanol. The stability of purified LipT6 477

variants in 70% methanol was determined by measuring the residual hydrolytic activity 478

after incubation for several hours as described previously (47, 48). 479

Enzymatic transesterification of waste chicken oil by soluble lipase. The 480

transesterification reactions were carried out according to the work of Dror et al. (48), in 481

triplicate with few modifications. Roughly, 14 ml closed glass vials were filled with 2 g 482

waste chicken oil while methanol was added in 5:1 alcohol to oil molar ratio followed by 483

the addition of 400 µl of lipase buffer (2 mg/mL enzyme solution, 0.04% enzyme and 20% 484

water content based on oil weight). 485

Gas chromatography analysis of FAME. GC analysis of FAME formation was carried 486

out according to the work of Dror et al. (48). 487


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

LipT6 variants crystallization, data collection and structure determination. 488

Crystallization of LipT6 variant was performed as described before with few modification 489

(48). The hanging drop contained 2 μl protein solution (0.5-2 mg/ml) and 2 μl 490

crystallization condition (0.2 M sodium citrate 25 % PEG 3350 or 0.2 M sodium formate 491

20 % PEG 3350). Cryoprotectant solution was crystallization condition enriched with 25% 492

PEG 400. X-ray diffraction data of LipT6 variants were collected at the European 493

Synchrotron Radiation Facility (ESRF), Grenoble, France, at beamlines described in Table 494

S2. Diffraction data was indexed, integrated, and reduced with either Moslfm (86), Scala 495

(87), autoPROC (88) or by EDNA (89). All structures were solved by molecular 496

replacement using Phaser (90) and the coordinates of LipT6WT structure (PDB 4X6U). 497

Refinement was performed using PHENIX (91). Manual model building, real-space 498

refinement, and structure validations were performed using Coot (92). Crystal parameters, 499

ESRF used beamlines and data statistics are summarized in Table S2 in the supplementary 500

material. 501

Calculation and visualization of LipT6 variants interatomic interactions. 502

Determination of interaction repertoire in LipT6WT and other variants was performed by 503

using Arpeggio web served using each mutants PDB file (65). Default setting were used to 504

calculate and analyze each structure including graphical presentation using Pymol (85) as 505

shown in Fig. 5. 506

507

ACKNOWLEDGMENTS 508

We acknowledge the Russell-Berrie Nanotechnology Institute (RBNI) at the Technion for 509

supporting this research. We also thank the staff of the European Synchrotron Radiation 510


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

Facility (beamlines ID 29, ID 30a-3) for provision of synchrotron radiation facilities and 511

kind assistance. 512

513


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

514

REFERENCES 515

1. Doukyu N, Ogino H. 2010. Organic solvent-tolerant enzymes. Biochem Eng J 48:270-282. 516 2. Stepankova V, Bidmanova S, Koudelakova T, Prokop Z, Chaloupkova R, Damborsky J. 2013. 517

Strategies for stabilization of enzymes in organic solvents. ACS Catal 3:2823-2836. 518 3. Carrea G, Riva S. 2000. Properties and synthetic applications of enzymes in organic solvents. 519

Angew Chem Int Edit 39:2226-2254. 520 4. Choi J-M, Han S-S, Kim H-S. 2015. Industrial applications of enzyme biocatalysis: current 521

status and future aspects. Biotechnol Adv 33:1443-1454. 522 5. Rudroff F, Mihovilovic MD, Gröger H, Snajdrova R, Iding H, Bornscheuer UT. 2018. 523

Opportunities and challenges for combining chemo-and biocatalysis. Nat Catal 1:12–22. 524 6. Lotti M, Pleiss J, Valero F, Ferrer P. 2015. Effects of methanol on lipases: Molecular, kinetic 525

and process issues in the production of biodiesel. Biotechnol J 10:22-30. 526 7. Wang S, Meng X, Zhou H, Liu Y, Secundo F, Liu Y. 2016. Enzyme stability and activity in 527

non-aqueous reaction systems: a mini review. Catalysts 6:32. 528 8. Klibanov AM. 2001. Improving enzymes by using them in organic solvents. Nature 409:241-529

246. 530 9. Ogino H, Ishikawa H. 2001. Enzymes which are stable in the presence of organic solvents. J 531

Biosci Bioeng 91:109-116. 532 10. Lotti M, Pleiss J, Valero F, Ferrer P. 2018. Enzymatic production of biodiesel: strategies to 533

overcome methanol inactivation. Biotechnol J:DOI: 10.1002/biot.201700155. 534 11. Herbst D, Peper S, Niemeyer B. 2012. Enzyme catalysis in organic solvents: influence of water 535

content, solvent composition and temperature on Candida rugosa lipase catalyzed 536 transesterification. J Biotechnol 162:398-403. 537

12. Frauenkron-Machedjou VJ, Fulton A, Zhao J, Weber L, Jaeger K-E, Schwaneberg U, Zhu L. 538 2018. Exploring the full natural diversity of single amino acid exchange reveals that 40–60% 539 of BSLA positions improve organic solvents resistance. Bioresour Bioprocess 5:2. 540

13. Markel U, Zhu L, Frauenkron-Machedjou VJ, Zhao J, Bocola M, Davari MD, Jaeger K-E, 541 Schwaneberg U. 2017. Are directed evolution approaches efficient in exploring nature’s 542 potential to stabilize a lipase in organic cosolvents? Catalysts 7:142. 543

14. Kumar A, Dhar K, Kanwar SS, Arora PK. 2016. Lipase catalysis in organic solvents: 544 advantages and applications. Biol Proced Online 18:2. 545

15. Khabiri M, Minofar B, Brezovský J, Damborský J, Ettrich R. 2013. Interaction of organic 546 solvents with protein structures at protein-solvent interface. J Mol Model 19:4701-4711. 547

16. Woodley JM. 2008. New opportunities for biocatalysis: making pharmaceutical processes 548 greener. Trends Biothecnol 26:321-327. 549

17. Ebert MC, Pelletier JN. 2017. Computational tools for enzyme improvement: why everyone 550 can–and should–use them. Curr Opin Chem Biol 37:89-96. 551

18. Woodley JM. 2013. Protein engineering of enzymes for process applications. Curr Opin Chem 552 Biol 17:310-316. 553

19. Wehrmann M, Klebensberger J. 2018. Engineering thermal stability and solvent tolerance of 554 the soluble quinoprotein PedE from Pseudomonas putida KT2440 with a heterologous whole‐555 cell screening approach. Microb Biotechnol 11:399-408. 556

20. Mate DM, Alcalde M. 2015. Laccase engineering: from rational design to directed evolution. 557 Biotechnol Adv 33:25-40. 558

21. Yu X-W, Tan N-J, Xiao R, Xu Y. 2012. Engineering a disulfide bond in the lid hinge region 559 of Rhizopus chinensis lipase: increased thermostability and altered acyl chain length 560 specificity. Plos One 7:e46388. 561


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

22. Rosenfeld L, Heyne M, Shifman JM, Papo N. 2016. Protein engineering by combined 562 computational and in vitro evolution approaches. Trends Biochem Sci 41:421-433. 563

23. Otten LG, Hollmann F, Arends IW. 2010. Enzyme engineering for enantioselectivity: from 564 trial-and-error to rational design? Trends Biothecnol 28:46-54. 565

24. Widersten M. 2014. Protein engineering for development of new hydrolytic biocatalysts. Curr 566 Opin Chem Biol 21:42-47. 567

25. Brezovsky J, Chovancova E, Gora A, Pavelka A, Biedermannova L, Damborsky J. 2013. 568 Software tools for identification, visualization and analysis of protein tunnels and channels. 569 Biotechnol Adv 31:38-49. 570

26. Kingsley LJ, Lill MA. 2015. Substrate tunnels in enzymes: structure–function relationships 571 and computational methodology. Proteins 83:599-611. 572

27. Gora A, Brezovsky J, Damborsky J. 2013. Gates of enzymes. Chem Rev 113:5871-5923. 573 28. Damborsky J, Brezovsky J. 2014. Computational tools for designing and engineering 574

enzymes. Curr Opin Chem Biol 19:8-16. 575 29. Chovancova E, Pavelka A, Benes P, Strnad O, Brezovsky J, Kozlikova B, Gora A, Sustr V, 576

Klvana M, Medek P. 2012. CAVER 3.0: a tool for the analysis of transport pathways in 577 dynamic protein structures. Plos Comput Biol 8:e1002708. 578

30. Sehnal D, Vareková RS, Berka K, Pravda L, Navrátilová V, Banás P, Ionescu C-M, Otyepka 579 M, Koca J. 2013. MOLE 2.0: advanced approach for analysis of biomacromolecular channels. 580 J Cheminf 5:39. 581

31. Kaushik S, Marques SM, Khirsariya P, Paruch K, Libichova L, Brezovsky J, Prokop Z, 582 Chaloupkova R, Damborsky J. 2018. Impact of the access tunnel engineering on catalysis is 583 strictly ligand‐specific. FEBS J 285:1456–1476. 584

32. Liskova V, Bednar D, Prudnikova T, Rezacova P, Koudelakova T, Sebestova E, Smatanova 585 IK, Brezovsky J, Chaloupkova R, Damborsky J. 2015. Balancing the stability–activity trade‐586 off by fine‐tuning dehalogenase access tunnels. ChemCatChem 7:648-659. 587

33. Koudelakova T, Chaloupkova R, Brezovsky J, Prokop Z, Sebestova E, Hesseler M, Khabiri 588 M, Plevaka M, Kulik D, Kuta Smatanova I, Rezacova P, Ettrich R, Bornscheuer UT, 589 Damborsky J. 2013. Engineering enzyme stability and resistance to an organic cosolvent by 590 modification of residues in the access tunnel. Angew Chem Int Edit 52:1959-1963. 591

34. Angajala G, Pavan P, Subashini R. 2016. Lipases: An overview of its current challenges and 592 prospectives in the revolution of biocatalysis. Biocatal Agric Biotechnol 7:257-270. 593

35. Anobom CD, Pinheiro AS, De-Andrade RA, Aguieiras EC, Andrade GC, Moura MV, Almeida 594 RV, Freire DM. 2014. From structure to catalysis: recent developments in the biotechnological 595 applications of lipases. BioMed Res Int 2014:ID684506. 596

36. Jaeger K, Dijkstra B, Reetz M. 1999. Bacterial biocatalysts: molecular biology, three-597 dimensional structures, and biotechnological applications of lipases. Annu Rev Microbiol 598 53:315-351. 599

37. Muralidhar R, Chirumamilla R, Marchant R, Ramachandran V, Ward O, Nigam P. 2002. 600 Understanding lipase stereoselectivity. World J Microb Biot 18:81-97. 601

38. Gupta R, Gupta N, Rathi P. 2004. Bacterial lipases: an overview of production, purification 602 and biochemical properties. Appl Microbiol Biotechnol 64:763-781. 603

39. Fukuda H, Kondo A, Noda H. 2001. Biodiesel fuel production by transesterification of oils. J 604 Biosci Bioeng 92:405-416. 605

40. Al-Zuhair S. 2007. Production of biodiesel: possibilities and challenges. Biofuel Bioprod Bior 606 1:57-66. 607

41. Hama S, Noda H, Kondo A. 2018. How lipase technology contributes to evolution of biodiesel 608 production using multiple feedstocks. Curr Opin Biotech 50:57-64. 609

42. Cesarini S, Pastor F, Nielsen PM, Diaz P. 2015. Moving towards a competitive fully enzymatic 610 biodiesel process. Sustainability 7:7884-7903. 611


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

43. Guldhe A, Singh B, Mutanda T, Permaul K, Bux F. 2015. Advances in synthesis of biodiesel 612 via enzyme catalysis: Novel and sustainable approaches. Renew Sust Energ Rev 41:1447-613 1464. 614

44. Bajaj A, Lohan P, Jha PN, Mehrotra R. 2010. Biodiesel production through lipase catalyzed 615 transesterification: an overview. J Mol Catal B: Enzym 62:9-14. 616

45. Gog A, Roman M, Toşa M, Paizs C, Irimie FD. 2012. Biodiesel production using enzymatic 617 transesterification–current state and perspectives. Renew Energ 39:10-16. 618

46. Christopher LP, Kumar H, Zambare VP. 2014. Enzymatic biodiesel: challenges and 619 opportunities. Appl Energ 119:497-520. 620

47. Dror A, Shemesh E, Dayan N, Fishman A. 2014. Protein engineering by random mutagenesis 621 and structure-guided consensus of Geobacillus stearothermophilus Lipase T6 for enhanced 622 stability in methanol. Appl Environ Microb 80:1515-1527. 623

48. Dror A, Kanteev M, Kagan I, Gihaz S, Shahar A, Fishman A. 2015. Structural insights into 624 methanol-stable variants of lipase T6 from Geobacillus stearothermophilus. Appl Microbiol 625 Biotechnol 99:9449-9461. 626

49. Carrasco-López C, Godoy C, de las Rivas B, Fernández-Lorente G, Palomo JM, Guisán JM, 627 Fernández-Lafuente R, Martínez-Ripoll M, Hermoso JA. 2009. Activation of bacterial 628 thermoalkalophilic lipases is spurred by dramatic structural rearrangements. J Biol Chem 629 284:4365-4372. 630

50. Gihaz S, Weiser D, Dror A, Sátorhelyi P, Jerabek‐Willemsen M, Poppe L, Fishman A. 2016. 631 Creating an efficient methanol‐stable biocatalyst by protein and immobilization engineering 632 steps towards efficient biosynthesis of biodiesel. ChemSusChem 9:3161-3170. 633

51. Biedermannová L, Prokop Z, Gora A, Chovancová E, Kovács M, Damborský J, Wade RC. 634 2012. A single mutation in a tunnel to the active site changes the mechanism and kinetics of 635 product release in haloalkane dehalogenase LinB. J Biol Chem 287:29062-29074. 636

52. Pavlova M, Klvana M, Prokop Z, Chaloupkova R, Banas P, Otyepka M, Wade RC, Tsuda M, 637 Nagata Y, Damborsky J. 2009. Redesigning dehalogenase access tunnels as a strategy for 638 degrading an anthropogenic substrate. Nat Chem Biol 5:727-733. 639

53. Prokop Z, Gora A, Brezovsky J, Chaloupkova R, Stepankova V, Damborsky J. 2012. 640 Engineering of protein tunnels: keyhole-lock-key model for catalysis by the enzymes with 641 buried active sites, p 421-464, Protein Engineering Handbook, vol 3. 642

54. Schmitt J, Brocca S, Schmid RD, Pleiss J. 2002. Blocking the tunnel: engineering of Candida 643 rugosa lipase mutants with short chain length specificity. Protein Eng 15:595-601. 644

55. Kannan N, Vishveshwara S. 2000. Aromatic clusters: a determinant of thermal stability of 645 thermophilic proteins. Protein Eng 13:753-761. 646

56. Hong H, Park S, Flores Jiménez RH, Rinehart D, Tamm LK. 2007. Role of aromatic side 647 chains in the folding and thermodynamic stability of integral membrane proteins. J Am Chem 648 Soc 129:8320-8327. 649

57. Hunter CA, Lawson KR, Perkins J, Urch CJ. 2001. Aromatic interactions. J Chem Soc Perk T 650 2:651-669. 651

58. Lanzarotti E, Biekofsky RR, Estrin DA, Marti MA, Turjanski AG. 2011. Aromatic–aromatic 652 interactions in proteins: beyond the dimer. J Chem Inf Model 51:1623-1633. 653

59. Maves SA, Sligar SG. 2001. Understanding thermostability in cytochrome P450 by 654 combinatorial mutagenesis. Protein Sci 10:161-168. 655

60. Yano JK, Poulos TL. 2003. New understandings of thermostable and peizostable enzymes. 656 Curr Opin Biotech 14:360-365. 657

61. Mohammadi M, Sepehrizadeh Z, Ebrahim-Habibi A, Shahverdi AR, Faramarzi MA, Setayesh 658 N. 2016. Enhancing activity and thermostability of lipase A from Serratia marcescens by site-659 directed mutagenesis. Enzyme Microb Tech 93:18-28. 660

62. Rathi PC, Fulton A, Jaeger K-E, Gohlke H. 2016. Application of rigidity theory to the 661 thermostabilization of lipase A from Bacillus subtilis. Plos Comput Biol 12:e1004754. 662


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

63. Li G, Fang X, Su F, Chen Y, Xu L, Yan Y. 2017. Enhancing the thermostability of Rhizomucor 663 miehei lipase with a limited screening library by rational design point mutations and disulfide 664 bonds. Appl Environ Microb 84:e02129-17. 665

64. Shokri MM, Ahmadian S, Akbari N, Khajeh K. 2014. Hydrophobic substitution of surface 666 residues affects lipase stability in organic solvents. Mol Biotechnol 56:360-368. 667

65. Jubb HC, Higueruelo AP, Ochoa-Montaño B, Pitt WR, Ascher DB, Blundell TL. 2017. 668 Arpeggio: a web server for calculating and visualising interatomic interactions in protein 669 structures. J Mol Biol 429:365-371. 670

66. Marques SM, Daniel L, Buryska T, Prokop Z, Brezovsky J, Damborsky J. 2017. Enzyme 671 Tunnels and Gates As Relevant Targets in Drug Design. Med Res Rev 37:1095-1139. 672

67. Fink MJ, Syrén P-O. 2017. Redesign of water networks for efficient biocatalysis. Curr Opin 673 Chem Biol 37:107-114. 674

68. Marton Z, Léonard-Nevers V, Syrén P-O, Bauer C, Lamare S, Hult K, Tranc V, Graber M. 675 2010. Mutations in the stereospecificity pocket and at the entrance of the active site of Candida 676 antarctica lipase B enhancing enzyme enantioselectivity. J Mol Catal B: Enzym 65:11-17. 677

69. Brouk M, Derry N-L, Shainsky J, Zelas ZB-B, Boyko Y, Dabush K, Fishman A. 2010. The 678 influence of key residues in the tunnel entrance and the active site on activity and selectivity 679 of toluene-4-monooxygenase. J Mol Catal B: Enzym 66:72-80. 680

70. Korman TP, Sahachartsiri B, Charbonneau DM, Huang GL, Beauregard M, Bowie JU. 2013. 681 Dieselzymes: development of a stable and methanol tolerant lipase for biodiesel production 682 by directed evolution. Biotechnol Biofuel 6:1. 683

71. Park HJ, Joo JC, Park K, Yoo YJ. 2012. Stabilization of Candida antarctica lipase B in 684 hydrophilic organic solvent by rational design of hydrogen bond. Biotechnol Bioproc E 685 17:722-728. 686

72. Tyndall JD, Sinchaikul S, Fothergill-Gilmore LA, Taylor P, Walkinshaw MD. 2002. Crystal 687 structure of a thermostable lipase from Bacillus stearothermophilus P1. J Mol Biol 323:859-688 869. 689

73. Arpigny JL, Jaeger K-E. 1999. Bacterial lipolytic enzymes: classification and properties. 690 Biochem J 343:177–183. 691

74. Shiraga S, Ueda M, Takahashi S, Tanaka A. 2002. Construction of the combinatorial library 692 of Rhizopus oryzae lipase mutated in the lid domain by displaying on yeast cell surface. J Mol 693 Catal B: Enzym 17:167-173. 694

75. Santarossa G, Lafranconi PG, Alquati C, DeGioia L, Alberghina L, Fantucci P, Lotti M. 2005. 695 Mutations in the “lid” region affect chain length specificity and thermostability of a 696 Pseudomonas fragi lipase. FEBS Lett 579:2383-2386. 697

76. Khan FI, Lan D, Durrani R, Huan W, Zhao Z, Wang Y. 2017. The lid domain in lipases: 698 Structural and functional determinant of enzymatic properties. Front Bioeng Biotechnol 5:16. 699

77. Tang L, Su M, Zhu L, Chi L, Zhang J, Zhou Q. 2013. Substitution of Val72 residue alters the 700 enantioselectivity and activity of Penicillium expansum lipase. World J Microb Biot 29:145-701 151. 702

78. Shih T-W, Pan T-M. 2011. Substitution of Asp189 residue alters the activity and 703 thermostability of Geobacillus sp. NTU 03 lipase. Biotechnol Lett 33:1841. 704

79. Stepankova V, Damborsky J, Chaloupkova R. 2013. Organic co‐solvents affect activity, 705 stability and enantioselectivity of haloalkane dehalogenases. Biotechnol J 8:719-729. 706

80. Burley S, Petsko GA. 1985. Aromatic-aromatic interaction: a mechanism of protein structure 707 stabilization. Science 229:23-28. 708

81. Georis J, Esteves FDL, Lamotte-Brasseur J, Bougnet V, Devreese B, Giannotta F, Granier B, 709 Frère J-M. 2000. An additional aromatic interaction improves the thermostability and 710 thermophilicity of a mesophilic family 11 xylanase: structural basis and molecular study. 711 Protein Sci 9:466-475. 712


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

82. Meurisse R, Brasseur R, Thomas A. 2003. Aromatic side-chain interactions in proteins. Near-713 and far-sequence his–X pairs. BBA Proteins Proteom 1649:85-96. 714

83. Serrano L, Bycroft M, Fersht AR. 1991. Aromatic-aromatic interactions and protein stability: 715 investigation by double-mutant cycles. J Mol Biol 218:465-475. 716

84. Facchiano AM, Colonna G, Ragone R. 1998. Helix stabilizing factors and stabilization of 717 thermophilic proteins: an X-ray based study. Protein Eng 11:753-760. 718

85. DeLano WL. 2002. The PyMOL molecular graphics system:Version 1.3, DeLano Scientific 719 LLC, San Carlos, CA. 720

86. Battye TGG, Kontogiannis L, Johnson O, Powell HR, Leslie AG. 2011. iMOSFLM: a new 721 graphical interface for diffraction-image processing with MOSFLM. Acta Crystallorg D 722 67:271-281. 723

87. Leslie A. 1992. Joint CCP4 and ESF-EACMB. Newsletter on Protein Crystallography 724 26:Daresbury Laboratory, Warrington, United Kingdom, 30. 725

88. Vonrhein C, Flensburg C, Keller P, Sharff A, Smart O, Paciorek W, Womack T, Bricogne G. 726 2011. Data processing and analysis with the autoPROC toolbox. Acta Crystallorg D 67:293-727 302. 728

89. Incardona M-F, Bourenkov GP, Levik K, Pieritz RA, Popov AN, Svensson O. 2009. EDNA: 729 a framework for plugin-based applications applied to X-ray experiment online data analysis. J 730 Synchrotron Radiat 16:872-879. 731

90. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. 2007. Phaser 732 crystallographic software. J Appl Crystallorg 40:658-674. 733

91. Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung L-W, 734 Kapral GJ, Grosse-Kunstleve RW. 2010. PHENIX: a comprehensive Python-based system for 735 macromolecular structure solution. Acta Crystallorg D 66:213-221. 736

92. Emsley P, Cowtan K. 2004. Coot: model-building tools for molecular graphics. Acta 737 Crystallorg D 60:2126-2132. 738

739


.asm.org/

Dow

nloaded from

http://aem.asm.org/

30

TABLES 740

Table 1. Residues selected for mutagenesis based on LipT6WT tunnels analysis 741

Tunnel number a,b Tunnel length c (Å) Residue Generated

mutation

1 21

L184 F, Y

A187 F, Y

L360 F, Y

2 and 3 (Y-shape) 13.5 and 13.9 R215 F, Y

4 11.5 H154 Y, W

5 7.8 I11 W

7 8.5 F226 Y

K330 Y, W

8 8.8 L380 F

F268 Y

a according to MOLE 2.0 automatic numbering.

b tunnels 6 and 9 were unchanged to maintain their rich hydrogen bond network.

c according to MOLE 2.0 job report.

742

743


.asm.org/

Dow

nloaded from

http://aem.asm.org/

31

Table 2. Primers for site directed mutagenesis of pET9a-LipT6WT plasmid 744

Position Original

aa

Substitution Nucleotide sequence 5’→3’ (Fw) a

11 I W GCTAACGATGCGCCATGGGTACTTCTCCACGGG

154 H Y TTTGAAGGCGGACATTATTTTGTGTTGAGCGTG

W TTTGAAGGCGGACATTGGTTTGTGTTGAGCGTG

184 L F GATCGCTTTTTTGACTTCCAGAAGGCGGTGTTG

Y CGATCGGTTTTTTGACTATCAGAAGGCGGTGTTG

187 A F GACTTGCAAAAATTCGTGTTGAAAGCAGCGGC

Y GACTTGCAAAAATACGTGTTGAAAGCAGCGGC

215 R F GACCAATGGGGACTGTTTCGCCAGCCAGGTGAA

Y GACCAATGGGGACTGTATCGCCAGCCAGGTGAA

226 F Y GAATCATTCGACCAATATTATGAACGGCTCAAACGG

268 F Y CGAATACGTATTATTTGAGCTATGCCACAGAACGGACG

330 K W ATGAACGGACCATGGCGAGGATCGACAGAT

Y ATGAACGGACCATATCGAGGATCGACAGATCGG

360 L F ACAATGTAGATCATTTCGAAGTCATCGGCGTTG

Y CGTACAACGTAGATCATTATGAAGTCATCGGCGT

380 L F GCCTTTTATTTGCGATTTGCAGAGCAGTTGGCG

L184F/A187F b L F CGCTTCTTCGACTTCCAAAAATTCGTGTTG

a Positions of alternation in mutagenesis primers are indicated in bold.

b Used for the combination of L184F/A187F while A187F (underlined) was used as template.

745


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32

Table 3. Relative activity of LipT6 variants in 60% methanol 746

Variant a Relative activity b

Sin

gle

mu

tan

ts

L360F 81.2±8.51

A187F 5.3±0.72

L184F 4.5±0.99

F268Y 3.46±0.22

R215F 2.40±0.35

H154Y 1.89±0.25

L184Y 1.51±0.19

R215Y 1.31±0.29

A187Y 1.22±0.43

F226Y 1.08±0.45

H154W 0.94±0.04

K330Y 0.49±0.15

K330W 0.30±0.08

I11W 0.21±0.03

L360Y 0.19±0.09

L380F 0.10±0.05

Dou

ble

mu

tan

ts

A187F/L360F 26.5±7.48

L184F/A187F 19.9±0.89

L184F/L360F 0.46±0.05

Tri

ple

mu

tan

t

L184F/A187F/L360F 0.29±0.06

a Each variant was expressed in E.coli and the soluble cell extract (CE)

was used for the screen. SDS-PAGE analysis ensured an appropriate

expression level and hydrolysis activity in buffer assured no drastic

activity loss. b The relative hydrolysis activity of pNPL was calculated as

(E/E0)/(E/E0)WT by comparing the activity of each variant CE before (E0)

and after (E) 30 min incubation in 60% methanol, divided by the same

value of LipT6WT (E/E0)WT. The results represent an average of

duplicates.

747

748


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33

Table 4. Unfolding temperature of LipT6 variants in methanol 749

750

751

752

753

754

755

756

757

758

759

760

LipT6 variant Tm

in buffer [°C]

Tm

in 60% methanol [°C]

WT (*) 66.6 ± 0.1 38.9 ± 0.3

L184F 67.5 ± 0.1 41.0 ± 0.2

A187F 70.0 ± 0.2 43.0 ± 0.6

L360F 69.9 ± 0.2 45.6 ± 0.2

L184F/A187F 67.6 ± 0.1 46.1 ± 0.2

L184F/L360F 65.5 ± 0.1 38.1 ± 0.1

A187F/L360F 72.2 ± 0.1 46.2 ± 0.1

*obtained from Gihaz et al. 2016.


.asm.org/

Dow

nloaded from

http://aem.asm.org/

34

Table 5. Kinetic parameters of LipT6 variants in pNPL hydrolysis 761

762

763

764

765

LipT6 variant Km

(10-2 mM)a

kcat

(103 s-1)

kcat/Km

(103 s-1 mM-1)

WT (b) 7.9±0.6 4.7 59

L184F 8.4±0.9 3.0 36

A187F 5.4±0.6 3.0 55

L360F 5.1±0.5 2.1 41

L184F/A187F 5.1±0.4 2.1 41

L184F/L360F 1.1±0.1 1.3 116

A187F/L360F 5.6±0.7 1.6 30

a values are means ± standard errors of the means. b obtained from Dror et al. 2014.


.asm.org/

Dow

nloaded from

http://aem.asm.org/

35

766

767

768

769

770

771

772 773 774 775 776 777 778 779 780 781 Figure 1. Visualization of the LipT6

WT solvent tunnels as generated by the computational 782

algorithm MOLE 2.0. The α-helix lid (α9) is marked in red. Calcium and zinc metal ions are 783

shown as green and gray spheres, respectively. Solvent tunnels are shown in blue and target 784

residues intended for mutagenesis are shown as magenta sticks. Catalytic Ser114 is presented in 785

cyan. Numbers in black indicate the tunnel numbering according to MOLE job report. 786

787


.asm.org/

Dow

nloaded from

http://aem.asm.org/

36

788

789

790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 Figure 2. Residues found to influence stability in methanol by tunnel engineering. (A) Close-807

up view of tunnel 1, (B) Surface visualization. The α-helix lid (α9) is marked in red. Solvent tunnel 808

is shown in blue and target residues are shown as magenta sticks. Catalytic serine is presented in 809

cyan. 810

811

Leu360

Leu184

Ala187

Ser114

A B


.asm.org/

Dow

nloaded from

http://aem.asm.org/

37

812

813

Figure 3. Relative residual activity of LipT6 variants after incubation in 70% methanol. 814

Purified LipT6 mutants were incubated in 70% methanol for various time durations and their 815

remaining activity was measured and compared with native conditions (marked as 100% in cyan 816

bars). Samples for pNPL hydrolysis assay were collected after 1, 4 and 6 h of incubation. 817

818

0

10

20

30

40

50

60

70

80

90

100

Rel

ati

ve

acti

vit

y a

fter

in

cub

ati

on

in 7

0%

meth

an

ol

[%

]

0h 1h 4h 6h


.asm.org/

Dow

nloaded from

http://aem.asm.org/

38

819

Figure 4. FAME biosynthesis from waste chicken oil using soluble LipT6 variants. Reaction 820

conditions: oil (2 g), water (20%), methanol to oil molar ratio 5:1 (60% MeOH) and soluble lipase 821

(0.04% based on the oil weight), 1350 rpm, 45°C. The results represent triplicates (n=3). 822

823

824

825

0

10

20

30

40

50

60

70

80

90

0 5 10 15 20 25

FA

ME

conv

ersi

on [

%]

Time [h]

WT

L184F

A187F

L360F

L184F/A187F

L184F/L360F

A187F/L360F


.asm.org/

Dow

nloaded from

http://aem.asm.org/

39

826 827 828 829 830 831 832 833 834 835

836

837

838

839

840

841

842

843

844

845

846

847

848

849

850

851

852

853

S114

F17

F291

V188

L184F

A

S114

F291

A187F

L184

B

S114

L360F

H359

I320

D318

H113

F17 C

S114

F291 A187F

L184F

F17

I320

V188

D

S114 L184F

L360F

H359

A187

F291

S114

A187F

F291 L360F

H359

F E


.asm.org/

Dow

nloaded from

http://aem.asm.org/

40

Figure 5. X-ray structures of LipT6 designed mutants superimposed with LipT6WT

(in gold). 854

(A) L184F in green, (B) A187F in pink (C) L360F in blue, (D) L184F/A187F in cyan, (E) 855

L184F/L360F in brown and (F) A187F/L360F in purple. The α-helix lid in all structures is 856

marked in red and catalytic S114 is presented in all figures. New interactions induced in the 857

mutants compared with LipT6WT (according to Arpeggio server analysis) are marked in dashed 858

lines as followed: π-π in yellow, CH/π in green and amide-π in blue. 859


.asm.org/

Dow

nloaded from

http://aem.asm.org/

downloaded from on march 21, 2020 by guest › ... › 2018 › 09 › 10 ›...

Documents