Research Collection
Doctoral Thesis
The interplay of IgE and its high affinity receptor FcεRI
Author(s): Pochanke, Veronika
Publication Date: 2005
Permanent Link: https://doi.org/10.3929/ethz-a-005062847
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
Diss. ETHNo. 16149
The Interplay of IgE and its High Affinity Receptor FceRI
A dissertation submitted to the
SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH
for the degree of
Doctor of Natural Sciences
presented by
VERONIKA POCHANKE
Dipl. Biol., Université de Lausanne
born 07.09.1975
citizen of Wil (SG), Switzerland
accepted on the recommendation of
Prof. Dr. Hans Hengartner, examiner
Prof. Dr. Rolf M. Zinkernagel, co-examiner
Dr. Kathy D. McCoy, co-examiner
2005
Table of Contents 1
Table of Contents
Summary 3
Zusammenfassung 5
Abbreviations 7
1 Introduction 11
1.1 Immunoglobulin E (IgE) 11
1.2 The high affinity IgE receptor, FcsRI 19
1.3 Allergy 24
1.4 Central Question 30
2 Results Part 1 31
Induction of IgE and allergic-type responses in fur mite-infested mice 31
2.1 Abstract 31
2.2 Introduction 32
2.3 Materials and Methods 34
2.4 Results 36
2.5 Discussion 46
3 Results Part II 51
Generation and characterization of hmFcsRIocß Tg mice 51
3.1 Abstract 51
3.2 Introduction 52
3.3 Materials and Methods 54
3.4 Results 60
3.5 Discussion 76
4 Results Part III 79
Generation of a muFcsRIa-huIgGiFc fusion protein 79
4.1 Abstract 79
4.2 Introduction 80
4.3 Materials and Methods 82
4.4 Results 86
2 Table of Contents
4.5 Discussion 97
5 Discussion 101
5.1 The functions of IgE 101
5.2 The epidemic of allergy 102
5.3 Mechanisms of IgE-mediated immune responses 103
5.4 Remaining questions to be answered 103
5.5 Questions addressed in this thesis 106
5.6 Concluding remarks 108
6 References 109
Acknowledgements 127
Curriculum Vitae 129
Summary 3
Summary
Allergic diseases, such as eczema, rhinitis, asthma, and food allergies, have greatly
increased in the past two decades, mainly in developed countries. Immunoglobulin E (IgE)
is known to play a crucial role in the development of allergies, however, the physiological
function of IgE has most likely evolved to provide host defense mechanisms against
parasite infections. IgE-mediated immune responses involve similar mechanisms during
both allergic reactions and parasite clearance. Exposure to antigens leads to crosslinking of
antigen-specific IgE molecules bound to high affinity IgE receptors, FcsRI, expressed
predominantly on mast cells and basophils. Activation of FcsRI mediates the release of
allergic mediators, which are responsible for symptoms of allergy. Understanding the
mechanisms regulating IgE-dependent responses is therefore essential to provide effective
therapy against allergic disease and to alleviate damage caused by parasite infections.
The goal of the present thesis was to investigate the initial requirements for IgE production
and to elucidate the role of FcsRI expression on different cell subsets. Animal models that
closely resemble the pathology of human allergic conditions and allow measurement of
physiologic parameters are required to efficiently address these questions. We therefore
established and characterized a novel allergy model based on infestation of mice with fur
mites. The advantage of this model lies in the usage of natural murine ectoparasites
allowing physiological exposure to antigens, which strongly resembles the human atopic
sensitization. Fur mites were found to induce high levels of serum IgE in a T cell- and In¬
dependent manner. Moreover, our results strongly suggest that mite antigen entry occurs
via the skin of infested mice leading to T cell activation and B cell isotype switch to IgE in
skin-draining lymph nodes. Furthermore, mite-induced mast cell degranulation in the skin
was detected implying that some of the IgE produced in response to mite infestation was
antigen-specific.
In the second part of this thesis we investigated the functions of FcsRI. An intriguing
difference in the structure and cellular distribution of the human and murine high affinity
IgE receptor was previously found. While murine FcsRI has an obligatory tetrameric
structure and is only expressed on mast cells and basophils, the human receptor can be
additionally expressed as a trimer found on eosinophils, dendritic cells, Langerhans' cells,
monocytes, macrophages, and platelets. To investigate the role of FcsRI expression on
4 Summary
these effector and antigen presenting cells, we generated a murine transgenic system
(hmFcsRIaß Tg mice) that mirrors the human distribution pattern of FcsRI. Although
mRNA expression of the high affinity IgE receptor was successfully demonstrated in the
targeted cells of the hmFcsRIaß Tg mice, FcsRI protein expression could not be found.
Further investigation of the model is therefore required to determine the reason for the
absence of detectable FcsRI protein expression and to evaluate how it may be overcome.
Lastly, to provide an additional tool for the investigation of FcsRI we made an attempt to
generate a specific antibody against the a chain of the murine receptor. Such an antibody is
crucial for specific and efficient analysis of the expression of the murine FcsRI, which was
important for the study of FcsRI transgenic mice. To achieve the production of an anti-
muFcsRIa antibody, a fusion protein composed of the extracellular domain of the murine
FcsRIa and the human IgGi Fc portion was generated and used to immunize FcsRIa-
deficient mice. However, as the first series of immunizations did not result in the synthesis
of anti-muFcsRIa antibodies and because a commercial anti-mouse FcsRIa antibody
became available during the completion of this project, the investigation was interrupted.
Nevertheless, the successfully generated and purified muFcsRIa-huIgGiFc fusion protein
is available in large amounts and can be used in future if required.
In conclusion, the regulation of IgE production and the effector functions induced by IgE
interactions with FcsRI expressed on different cell types are still not fully understood.
Analysis of novel animal models, such as those presented in this thesis, may provide
answers to some of the still open questions and eventually lead to successful therapy of
allergy and parasite-induced disease.
Zusammenfassung 5
Zusammenfassung
Allergische Reaktionen, wie z.B. Ekzem, Heuschnupfen, Asthma und
Nahrungsmittelallergien, sind in den letzten 20 Jahren vor allem in entwickelten Ländern
drastisch gestiegen. Die Entstehung von Allergien ist zum grossen Teil vom
Immunoglobulin E (IgE) abhängig, die physiologische Funktion von IgE dient jedoch zum
Schutz gegen parasitäre Infektionen. Die Immunantwort, die durch IgE ausgelöst wird,
umfasst ähnliche Mechanismen bei allergischen Reaktionen wie auch bei der Abwehr
gegen Parasiten. Kontakt mit Antigenen führt zu einer Kreuzvernetzung von
antigenspezifisehen IgE Molekülen, die an Hochaffinitätsrezeptoren für IgE, FcsRI,
gebunden sind. FcsRI ist vorwiegend auf Mastzellen und Basophilen exprimiert und seine
Aktivierung führt zur Freisetzung von pro-inflammatorischen Substanzen, z.B. Histamin,
welche die klassischen Merkmale von Allergie hervorrufen. Mechanismen der von IgE
ausgelösten Immunantworten zu verstehen, ist daher essentiell um wirksame Mittel gegen
Allergien und parasitäre Krankheiten zu finden.
Das Ziel der vorliegenden Dissertation war es, die Voraussetzungen für die IgE Produktion
zu untersuchen, und die Rolle von FcsRI Expression auf diversen Zelltypen aufzuklären.
Tiermodelle, welche die Pathologie von menschlichen allergischen Erkrankungen
nachahmen und die es ermöglichen, physiologische Parameter zu messen, sind erforderlich
um diese Fragen effizient anzugehen. Wir haben ein neues Allergiemodel etabliert und
charakterisiert, das auf dem Befall von Mäusen durch Fellmilben basiert. Der Vorteil dieses
Models liegt darin, dass natürliche Mausektoparasiten den Kontakt mit Antigenen in
physiologischer Art und Weise ermöglichen, was wiederum der atopischen Sensibilisierung
bei Menschen ähnlich ist. Wir haben gezeigt, dass Milbenantigene durch die Haut von
befallenen Mäusen aufgenommen und über die Lymphe in die dränierenden Lymphknoten
transportiert werden. Dort führt das Antigen zur Aktivierung von T Zellen, die zur
Produktion von IL-4 stimuliert werden. Diese Th2 Antwort führt zum IgE-Klassenwechsel
in B Zellen und schliesslich zu stark erhöhten IgE Serumwerten. Zudem haben wir
milbenabhängige Mastzelldegranulation in der Haut beobachtet, was darauf hindeutet, dass
ein Teil an IgE, das als Antwort auf den Milbenbefall produziert wurde, Antigen-spezifisch
sein muss.
6 Zusammenfassung
Im zweiten Teil dieser Arbeit haben wir die Funktionen des FcsRI Rezeptors untersucht.
Ein überraschender Unterschied in der Struktur und in der zellulären Verteilung zwischen
dem IgE Rezeptor von Mensch und Maus wurde bereits vor einigen Jahren erkannt.
Während FcsRI in der Maus eine ausschliesslich tetramerische Struktur aufweist und nur
auf Mastzellen und Basophilen exprimiert wird, kann FcsRI im Menschen eine trimerische
Form annehmen, die auch auf eosinophilen Granulozyten, dendritischen Zellen,
Langerhans-Zellen, Monozyten, Makrophagen und Thrombozyten exprimiert werden kann.
Um die Funktion von FcsRI Expression auf diesen Zellen zu untersuchen, haben wir ein
transgenes System (hmFcsRIaß Tg Maus) hergestellt, das die menschliche FcsRI
Expression widerspiegelt. Obwohl die mRNA Expression des IgE Rezeptors in den Zellen
der hmFcsRIaß transgenen Mäuse erfolgreich gezeigt wurde, konnten wir keine FcsRI
Protein Expression nachweisen. Das Modell erfordert deshalb weiterer Analyse, um den
Grund für die fehlende FcsRI Protein Expression zu identifizieren, und zu beurteilen wie
diese zu überwinden sei.
Darüber hinaus haben wir versucht, einen spezifischen Antikörper gegen die a Kette des
FcsRI der Maus herzustellen. Ein solcher Antikörper ist erforderlich für eine spezifische
und effiziente Untersuchung der FcsRI Expression, was für die Studie der FcsRI
transgenen Mäuse ausschlaggebend war. Um die Produktion von anti-muFcsRIa
Antikörpern zu erzielen, haben wir ein Fusionsprotein hergestellt, das aus der
extrazellulären Domäne der a Kette von FcsRI und dem Fc-Teil des menschlichen IgGi
Antikörpers bestand. Dieses Fusionsprotein wurde anschliessend zur Immunisierung von
FcsRIa""
Mäusen verwendet. Da aber die ersten Immunisierungsserien nicht zur Synthese
des erwünschten Antikörpers geführt hatten, und weil ein kommerzieller anti-muFcsRIa
Antikörper während der Durchführung dieses Projektes erhältlich wurde, haben wir die
Versuche eingestellt. Dennoch steht das erfolgreich generierte und isolierte Fusionsprotein
für allfällige weitere Studien zur Verfügung.
Schlussfolgernd ist festzuhalten, dass die Regulation der IgE Produktion und die Folgen der
Interaktionen zwischen IgE und FcsRI noch nicht gänzlich geklärt sind. Analyse neuer
Tiermodelle, wie z.B. solcher die in dieser Dissertation präsentiert wurden, könnten
Antworten auf einige der offenen Fragen liefern und schliesslich zur erfolgreichen Therapie
gegen Allergie und parasitäre Infektionen führen.
Abbreviations 7
Abbreviations
Ab Antibody
AD Atopic dermatitis
Ag Antigen
AID Activation-induced cytidine deaminase
Amp Ampicillin
APC Antigen presenting cell
BAL Bronchoalveolar lavage
BMMC Bone marrow-derived mast cell
bp Base pair
BSA Bovine serum albumin
BSS Balanced salt solution
CD Cluster of differentiation
CD40L CD40 ligand
cDNA Complementary DNA
CDR Complementarity-determining region
Cs IgE heavy chain constant region
CFA Complete Freund's adjuvant
CSR Class-switch recombination
DC Dendritic cell
DNA Deoxyribonucleic acid
DNase Deoxyribonuclease
ELISA Enzyme-linked immunosorbent assay
Eos Eosinophil
ER Endoplasmic reticulum
Fab Antigen-binding fragment
FACS Fluorescence activated cell sorting
Fe Crystallizable fragment
FCS Fetal calf serum
FcsRI High affinity IgE receptor
FcsRIa Alpha chain of the high affinity IgE receptor
8 Abbreviations
FcsRIß Beta chain of the high affinity IgE receptor
FcsRIy Gamma chain of the high affinity IgE receptor
FR Framework
GFP Green fluorescent protein
GLT Germline transcript
HBSS Hanks balanced salt solution
HEK Human embryonic kidney cells
Hyg Hygromycin
i.p. Intraperitoneal
i.v. Intravenous
ICAM Intercellular adhesion molecule
IFA Incomplete Freund's adjuvant
IFN Interferon
Ig Immunoglobulin
IL Interleukin
FMDM Iscove's modified Dulbecco's media
ITAM Immunoreceptor tyrosine-based activation motif
Ka Association constant
Kana Kanamycin
kb Kilobase
kDa Kilodalton
k0ff Dissociation rate
LC Langerhans' cell
LFA Lymphocyte function-associated antigen
LN Lymph node
mAb Monoclonal antibody
MACS Magnetic-assisted cell sorting
MAUD Mite-associated ulcerative dermatitis
MC Mast cell
MHC Major histocompatibility complex
MIP Macrophage inflammatory protein
mRNA Messenger RNA
Abbreviations 9
MO Macrophage
iV. brasiliensis Nippostrongylus brasiliensis
NF-kB Nuclear factor-KB
OD Optical density
OVA Ovalbumin
PBMC Peripheral blood mononucleocytes
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PLC Phospholipase C
PMA Phorbol myristate acetate
PTK Protein tyrosine kinase
RNA Ribonucleic acid
rRNA Ribosomal RNA
RT Room temperature
RT-PCR Reverse transcription-PCR
S. mansoni Schistosoma mansoni
s.c. Subcutaneous
s.d. Standard deviation
SCF Stem cell factor
SEM Standard error of the mean
Spl Spleen
STAT Signal transducer and activator oft
T. spiralis Trichinella spiralis
TCR T cell receptor
Tg Transgenic
TGF Transforming growth factor
Th Helper T cell
TLR Toll-like receptor
TNF Tumor necrosis factor
WT Wild type
10 Abbreviations
Introduction 11
1 Introduction
1.1 Immunoglobulin E (IgE)
Physiological properties and structure of IgE
The first demonstration to show that a serum factor (originally named "reagin") was
responsible for the development of allergic reactions was performed in 1921 by Carl
Prausnitz and Heinz Küstner (Prausnitz, 1921). They injected serum from a fish-allergic
individual (Küstner himself) into the skin of a non-allergic person (Prausnitz) and observed
a typical weal and erythema reaction at the site of serum transfer after local administration
of fish extract. Only decades later, in 1967, was reagin recognized as a new
immunoglobulin class and was designated IgE due to the observed erythema reaction
(Ishizaka and Ishizaka, 1967). The physiological characteristics of IgE differ from the other
four known immunoglobulins, IgM, IgG, IgD, and IgA. First, IgE is the least abundant
antibody class in serum, with concentrations of about 100 ng/ml in healthy individuals,
compared with 10 mg/ml for IgG (Sutton and Gould, 1993). However, in atopic or
parasitized individuals IgE concentrations can increase by up to 1000-fold (Barbera et al.,
1977; Durmaz et al., 1998). Second, with a serum half-life of only about 2 days, IgE has the
shortest biological half-life of all the immunoglobulins. However, if IgE is cell surface-
bound, this half-life can be extended to 1-2 weeks (Tada et al., 1975). Similar to other
immunoglobulins, IgE consists of heavy (H) and light (L) chains with variable (V) and
constant (C) regions but it differs in that it is composed of s H-chains, which contain four C
domains (Csl-Cs4). Such distribution of C regions is also found in IgM while the H-chains
of IgG, IgD, and IgA are all composed of only three C domains (Gould et al., 2003) (Figure
1). The additional IgE domain (Cs2) replaces the hinge region found in the other antibody
classes and is a critical determinant of the physical properties of IgE (See paragraph "IgE-
FcsRI interactions"). Recently, the crystal structure of the IgE-Fc fragment has been solved
providing new insight into the conformation of IgE and the binding properties of IgE to its
high affinity receptor, FcsRI (Wan et al., 2002).
12 Introduction
B
s-s
B
H
m
a
m
O
u
H chains: a, 7, 8, e, |i
L chains: k. A,
Figure 1. Structures of immunoglobulins. Immunoglobulins are composed of two heavy (H) and
two light (L) chains. There are five types (isotypes) of H chains (a, y, S, e, and ]i) and two types of L
chains (k and X). The amino-terminal (NH3+) regions of each chain contain variable (V) domains
responsible for antigen binding, while the carboxy-terminal (COO) regions contain constant (C)
domains responsible for the biological activity of the antibodies. The a, y, and 5 H chains contain
three C domains (CH1-CH3) and a proline-rich hinge region (A), while the e and ]i H chains, which
lack the hinge region, contain four C domains (CH1-CH4) (B). Immunoglobulins can also be
subdivided into antigen-binding (Fab) and "crystallizable" fragments (Fc) by enzymatic digestion
above the disulfide bonds (S-S) that link the H chains.
Regulation of IgE
The very low levels of serum IgE of healthy individuals suggest that IgE synthesis may be
tightly regulated. This is thought to be important to prevent the potentially lethal
consequences of IgE-dependent immune responses. Thus, multiple factors are involved in
the induction of IgE synthesis.
One of the first steps leading to IgE production is specific binding of antigen to membrane-
bound B cell receptors, which subsequently ensures the specificity of the IgE produced. B
cells have the capacity to internalize, process and present antigenic peptides on MHC class
II molecules (Vercelli et al., 1989). Peptide-MHC class II complexes are recognized by
specific T cell receptors (TCRs) on CD4+ T cells. CD4+ T cells, also known as T helper
cells, are crucial for regulation of both cellular and humoral immune responses by secreting
cytokines and providing signals required for antibody production. Two subtypes of T helper
Introduction 13
cells (Thl and Th2) have been described based on their functional properties and the profile
of cytokines they produce (Abbas et al., 1996). Thl cells represent a major source of
interleukin (IL)-2, interferon (IFN)-y, tumor necrosis factor (TNF)-a, and other cytokines
important for cell-mediated immune responses. Thl responses antagonize IgE effector
functions, as IL-12 and IFN-y suppress IgE synthesis through direct effects on B cells
(Coffman and Carty, 1986). On the other hand, Th2 cells secrete IL-4, IL-5, IL-6, IL-10,
and IL-13, which are required for antibody responses, including IgE production (Aebischer
and Stadler, 1996). After antigen-specific interaction of TCRs with peptide-MHC class II
complexes, Th2 cells provide B cells with signals crucial for IgE synthesis. Such signals
involve cytokines secreted by Th2 cells as well as cell-to-cell interactions between Th2
cells and B cells (Figure 2). The most important cytokines for induction of IgE are IL-4 and
IL-13 (Finkelman et al., 1988; Minty et al., 1993; Punnonen et al., 1993). Binding of IL-4
and IL-13 to their receptors expressed on the surface of B cells leads to activation of the
transcription factor signal transducer and activator of transcription 6 (STAT6), which
provides the first signal for isotype switching to IgE (de Vries et al., 1993). Ligation of
CD40 (expressed on B cells) to its ligand CD40L (expressed on Th2 cells) activates the
transcription factor nuclear factor-KB (NF-kB), which induces the second signal leading to
IgE synthesis. NF-kB acts in synergy with IL-4-induced STAT6. On one hand, STAT6
together with NF-kB induce production of Cs germline transcripts (GLTs) by binding to
the Is promoter located upstream of the Cs genes (Iciek et al., 1997). Although Cs GLTs
lack the VDJ region and are "sterile", meaning that they are not translated into protein
because of stop codons in all reading frames, Cs GLT expression is a necessary step for the
subsequent class-switch recombination (CSR) to IgE (Geha et al., 2003). On the other hand,
synergy between STAT6 and NF-kB results in expression of activation-induced cytidine
deaminase (AID) (Chaudhuri et al., 2003). AID has been shown to play a crucial role in
CSR (Muramatsu et al., 2000) by a yet unresolved mechanism involving cytidine
deamination of either RNA (Muramatsu et al., 1999) or single-stranded DNA (Chaudhuri et
al., 2003). Thus, signals through both IL-4 and CD40 are required to induce Cs GLT
expression and to reach a threshold level of AID expression necessary for switching to IgE
(Messner et al., 1997). However, it has been reported that under some circumstances IgE
can be produced independently of T cells (Jabara et al., 1990), IL-4 (Grunewald et al.,
14 Introduction
2001; Morawetz et al., 1996), or CD40 (Litinskiy et al., 2002) implying that regulation of
IgE synthesis is a complex process involving additional molecules and signaling pathways.
Tceli
Antigen (~)
B cell
IL-13
Figure 2. Major T cell - B cell interactions regulating induction of IgE. Specific binding of
antigen by B cells via surface IgM (a) leads to processing and presentation of antigens by MHC
class II molecules and allows antigen-specific interactions with T cells via TCRs (b). Activated CD4+
Th2 cells express high levels of CD40L and produce the cytokines IL-4 and IL-13. Interaction of
CD40L with CD40 expressed by B cells (c) activates NF-kB (d), while binding of IL-4 and IL-13 to
their receptors (e) recruits STAT6 (f). Synergy between NF-kB and STAT6 leads to transcription of
Ce GLT and AID (g), both required for subsequent IgE synthesis (h).
Introduction 15
Effector functions of IgE
Type I immediate hypersensitivity
The immune system attempts to protect individuals from pathogens by inducing localized
inflammation. However, an inflammatory response can also have deleterious effects.
Inappropriate immune responses resulting in host damage can derive either from a reaction
against self-antigens (autoimmunity) or from an overreaction against environmental
antigens (hypersensitivity). Such an "overraction" was first described by Paul Portier and
Charles Richet in 1902 (Cohen and Zelaya-Quesada, 2002; Haas, 2001). These two French
scientists discovered that a second injection of fluids isolated from jellyfish induced a
violent reaction in dogs that showed no symptoms to an earlier injection. They called this
phenomenon "anaphylaxis" to mean the opposite of prophylaxis. Anaphylactic reactions
are cunently refened to as immediate or type I hypersensitivity. Hypersensitivity reactions
have been classified into four types by Gell and Coombs (Coombs RRA, 1963): type I, IgE-
mediated hypersensitivity; type II, IgG-mediated cytotoxic hypersensitivity; type III,
immune complex-mediated hypersensitivity; and type IV, cell-mediated hypersensitivity.
Type I hypersensitivity is induced by antigens that elicit secretion of specific IgE. High
affinity IgE receptors, FcsRI, highly expressed on mast cells and basophils, capture
secreted IgE (Wedemeyer et al., 2000). Such sensitized cells can be activated within
minutes following re-exposure to the same antigen (Figure 3). Signaling pathways induced
by antigen-dependent crosslinking of IgE bound to FcsRI trigger degranulation of the cell
and result in the release of preformed inflammatory mediators including histamine, neutral
proteases, and proteoglycans (Boyce, 2004). Additionally, activated mast cells and
basophils secrete newly synthesized lipid mediators such as prostaglandin D2, leukotriene
C4, and platelet-activating factor as well as numerous proinflammatory cytokines,
chemokines and growth factors, including TNF-a, IL-4, IL-13, and eotaxin (Prussin and
Metcalfe, 2003).
Clinical manifestations related to mediators released during IgE-induced degranulation
include enhanced local vascular permeability, increased cutaneous blood flow, erythema,
and other effects such as itching (Kay, 2001). Pathology induced by type I hypersensitivity
can range from moderate allergic reactions including hay fever and eczema, to life-
threatening conditions, such as systemic anaphylaxis and asthma.
16 Introduction
Figure 3. Activation and degranulation of mast cells. Soluble IgE binds to FceRI expressed on
mast cells. Crosslinking of receptor-bound IgE by specific antigen triggers the release of preformed
mediators (e.g. histamine) from the granules and induces synthesis of additional inflammatory
factors (e.g. lipids and cytokines).
Regulation ofmast cell survival andFcsRI expression
Recent reports have suggested that binding of monomeric IgE to FcsRI, i.e. in the absence
of antigen, can have immuno-regulatory functions. It has been demonstrated that
monomeric IgE can promote mouse mast cell proliferation induced by IL-3 or SCF in vitro
(Asai et al., 2001; Kalesnikoff et al., 2001; Kitaura et al., 2003). The mechanism of
monomeric IgE-mediated mast cell survival has been shown to involve anti-apoptotic
effects, however, its biological relevance remains to be determined. In addition, it has been
reported that IgE binding to FcsRI in the absence of specific antigen induces upregulation
of FcsRI surface expression on mast cells and basophils (Lantz et al., 1997; Yamaguchi et
al., 1997). The enhanced expression of FcsRI by IgE has been shown to be achieved by
receptor stabilization at the membrane as well as recruitment of a preformed pool of
receptors in the presence of continual basal protein synthesis (Borkowski et al., 2001). IgE
binding to FcsRI might also make the receptor resistant to degradation via conformational
changes induced in the a chain (Kubo et al., 2001). The biological relevance of FcsRI
upregulation induced by newly produced IgE may be an enhanced sensitivity to pathogens
due to reactivity to an increased number of antigens. This also implies that prevention of
Introduction 17
IgE-mediated FcsRI upregulation may be a useful target to diminish the impact of allergic
disorders.
Protection againstparasites
The first observation that parasites, particularly helminthes, induce strong primary and
secondary IgE responses was described by Ogilvie in 1964 (Ogilvie, 1964). Numerous
reports have since accumulated suggesting that the biological role of IgE-associated
immune responses is to provide host defense against parasites (Hagan, 1993; Janett and
Miller, 1982; Levy, 2004). However, different degrees of importance of IgE in parasite
clearance have been shown and the requirement of IgE for protective host immunity to
parasites has remained controversial. Investigation of Schistosoma mansoni (S. mansoni)
infection in humans revealed host defense mechanisms involving IgE-dependent killing of
larval schistosomes by platelets and macrophages (Capron et al., 1987). Moreover,
resistance to reinfection with S. mansoni was associated with high anti-schistosomular IgE
levels (Rihet et al., 1991). Convincing evidence that protection against reinfection is
associated with high levels of parasite-specific IgE was also provided by studies of
Schistosoma haematobium infection (Hagan et al., 1991). Additionally, a positive
conelation of parasite-specific IgE levels and protection in rodents was found for
Trichinella spiralis (T spiralis) (Ahmad et al., 1991; Bell, 1998; Dessein et al., 1981).
Interestingly, a powerful IgE response, with over 60% parasite-specific IgE, was found
within the intestinal lumen of T spiralis infected mice, while only 10% of serum IgE was
found to be specific (Negrao-Correa, 2001; Negrao-Conea et al., 1996). A recent study of
IgE-deficient mice infected with T spiralis revealed that IgE was required for both the
elimination of adult worms from the intestine and the killing of larvae present in the
skeletal muscle through mechanisms involving mast cell homeostasis and secretion of mast
cell protease-1 (Gurish et al., 2004).
However, other reports have speculated that IgE production in response to helminth
infection is merely the consequence of a strong Th2 response induced by the parasites but
plays no crucial role in parasite expulsion. In some cases this may indeed be true. For
example, it has been shown that mice lacking functional IgE receptors expel Trichuris
muris with normal kinetics (Betts and Else, 1999).
18 Introduction
Intriguingly, the presence of disproportionately high levels of total (non-parasite specific)
IgE has been observed in response to many parasitic helminthes (Dessaint et al., 1975;
Turner et al., 1979). The generation of such polyvalent IgE has been explained in two ways
(Pritchard, 1993). First, the presence of non-specific IgE might imply the existence of a
protective strategy used by the parasite whereby competition with specific IgE is induced.
Second, high amounts of unrelated IgE could possibly reduce the risk of anaphylaxis,
thereby protecting the host from potentially lethal consequences of hyperreactivity to
parasite antigens.
Taken together, IgE participation in the protective mechanisms involved in parasite
infections may strongly depend on the parasite species. Complex life cycles involving
different tissue localizations of helminthes, such as lung, stomach, or intestine, may induce
various mechanisms leading to protective immunity of the host. For example, it has been
proposed that mucosal penetration by the nematode may be required for induction of an IgE
response that could participate locally in worm elimination. Thus, parasite infections result
in multifactoral and redundant immune responses depending on the parasite species and
infection site. While a Th2-associated immune response is known to be a common feature
in immunity to most parasites, the exact effector elements, their regulation and modes of
action that are important for protection against each individual parasite, remain to be
determined.
Introduction 19
1.2 The high affinity IgE receptor, FcsRI
Structure and expression of FceRI
FcsRI is a multimeric cell surface receptor that exists in two isoforms. It can be expressed
either as a heterotetramer composed of one a, one ß, and two y chains (aßy2), or as a
heterotrimer lacking the ß chain (ay2) (Kinet, 1999) (Figure 4). The aßy2 form of FcsRI is
abundantly expressed on IgE-associated effector cells, mast cells and basophils, reaching
3xl05 molecules/cell (Liu et al., 2001). In humans, the trimeric form of FcsRI has been
demonstrated to be expressed on Langerhans' cells (Bieber et al., 1992; Wang et al., 1992),
monocytes (Maurer et al., 1994), eosinophils (Gounni et al., 1994), peripheral blood
dendritic cells (Maurer et al., 1996), and platelets (Joseph et al., 1997). Interestingly
however, mice lack expression of the ay2 form of FcsRI and therefore do not express the
receptor on cells other than mast cells and basophils. The a chain of the receptor (FcsRIa)
is a type I integral membrane protein with two Ig-like domains (Dl and D2) in the
extracellular (N-terminal) region, a single transmembrane domain, and a short cytoplasmic
tail (Garman et al., 1998). FcsRIa is heavily glycosylated due to seven N-linked
glycosylation sites involved in interactions between the a chain and the folding machinery
of the endoplasmic reticulum (Letourneur et al., 1995b). Crystal structure analysis of IgE-
Fc bound to FcsRIa revealed that the Cs3 domains of IgE-Fc bind two distinct sites located
in the D2 domain of FcsRIa (Garman et al., 2000). The ß subunit (FcsRIß) has four
transmembrane domains separating amino and carboxy terminal cytoplasmic tails
containing an immunoreceptor tyrosine-based activation motif (ITAM) near the carboxy
terminus (Kinet et al., 1988). Two major functions of FcsRIß are known. First, FcsRIß has
been shown to amplify signals produced by the y chain of the receptor, even though ß does
not appear to possess any signaling capacity through its own ITAM (Jouvin et al., 1994;
Lin et al., 1996). Second, it has been demonstrated that FcsRIß facilitates surface
expression of the receptor by promoting the processing and export of the a chain to the cell
surface and by enhancing the stability of the receptor complexes (Donnadieu et al., 2000).
The y chains (FcsRIy) form a disulfide-linked homodimer with short extracellular portions
and long cytoplasmic tails containing an ITAM on each subunit (Küster et al., 1990).
Several other receptors, including FcyRI, FcyRIIIA, FcaR, and the CD3 complex of the T
20 Introduction
cell receptor (TCR), share the ubiquitously expressed y subunit, which is crucial for
induction of signaling cascades through phosphorylation of the ITAMs (Daeron, 1997).
HUMAN+MOUSE; HUMAN:
mast cells Langerhans' cells
basophils monocytes
eosinophilsdendritic cells
platelets
Figure 4. Structure and cellular distribution of the high affinity IgE receptor, FcsRI. FceRI is
expressed either as a aßy2-tetramer (A) or a a^-trimer (B). The aßy2 form of FceRI is expressed on
mast cells and basophils of both humans and mice, while the 0,72 structure is found only in humans
on Langerhans' cells, monocytes, eosinophils, peripheral blood dendritic cells, and platelets. The
extracellular region of the a chain contains two lg-like domains (D1 and D2) responsible for binding
of IgE. The ß subunit has four transmembrane domains and an ITAM in the cytoplasmic tail. The y
chains form a disulfide-linked (S-S) homodimer with long cytoplasmic tails containing an ITAM on
each subunit.
IgE-FcsRI interactions
The unique binding kinetic of IgE to FcsRI is the most characteristic feature of this high
affinity receptor. FcsRI binds monomeric IgE with an association constant Ka of 1010 M"1
(Kulczycki and Metzger, 1974) which is considerably higher than binding of IgG to
FcyRIII, the closest homologue of FcsRI, characterized by a Ka of 105 M"1 (Maenaka et al.,
2001). This exceptionally high affinity of IgE binding to FcsRI reflects a very slow
dissociation rate, k0ff ~10"5 s"1 for FcsRI, compared with k0ff ~1 s"1 for FcyRIII (Ishizaka et
al., 1986). The most important implication for the biological function of IgE resulting from
such a slow dissociation rate is the long half-life of receptor-bound IgE, reaching 1-2 weeks
Introduction 21
(Tada et al., 1975). This results in persistent sensitization of cells expressing FcsRI, such as
mast cells and basophils, and is responsible for their capacity to react very fast to antigen
challenge, a feature characteristic of allergic responses. Recent investigation of crystal
structures of IgE and its high affinity receptor provided explanations for their unusual
binding kinetics (Wan et al., 2002). Binding of the Cs3 domain of IgE-Fc to the
extracellular domain of FcsRIa results in a profound conformational change of the adjacent
Cs2 domain. This conformational change is believed to greatly stabilize the IgE-FcsRI
complex and therefore lead to the slow dissociation rate (Novak and Bieber, 2002).
Biological functions of FcsRI
The best-known role of FcsRI is the induction of mast cell and basophil degranulation
when multivalent antigens crosslink the receptor by interacting with specific receptor-
bound IgE. The resulting processes, involving rapid release of granule-stored mediators as
well as synthesis and secretion of cytokines and chemokines, have been widely described
and shown to initiate allergic disorders and mediate immune responses against parasites
(Kawakami and Galli, 2002). The requirement for FcsRI in induction of IgE-dependent
allergic reactions has been shown in mice that lack either the a or ß chain gene of the
receptor as these mice do not exhibit cutaneous or systemic anaphylaxis (Dombrowicz et
al., 1993; Dombrowicz et al., 1998). In addition, FcsRI-deficient mice have an impaired
immunity to S. mansoni (Jankovic et al., 1997). In the S. mansoni model IgE-FcsRI
interactions are not directly involved in development of the Th2 response or resistance to
primary infection, but have been proposed to play a role in down-regulation of host
pathology by controlling hepatic fibrosis and egg granuloma formation. Moreover,
investigation of FcsRI on human eosinophils has revealed that during S. mansoni infection
FcsRI participates in eosinophil-mediated cytotoxicity against the parasite by promoting
eosinophil degranulation (Gounni et al., 1994).
Demonstration of FcsRI expression on human antigen presenting cells (APCs) has infened
a novel function of FcsRI in IgE-mediated antigen presentation pathways. Important
differences between FcsRI present on the classical IgE-associated effector cells (mast cells
and basophils) and professional APCs have to be pointed out. APCs express the trimeric
form of the receptor (ay2), which shows substantially lower expression density and
mediates weaker signals (Novak et al., 2003a). This suggests a distinct function for the high
22 Introduction
affinity IgE receptor on APCs. The importance of FcsRI in IgE-dependent antigen
presentation to T cells has been demonstrated on monocytes and circulating dendritic cells
(Maurer et al., 1995; Maurer et al., 1998). Studies of FcsRI-positive monocytes revealed
that high affinity IgE receptor-mediated endocytosis is more efficient than pinocytotic
allergen uptake. Thus, allergen presentation to T cells is highly enhanced when allergen-
IgE complexes are targeted to FcsRI-bearing APCs compared to T cell activation in
absence of IgE. This mechanism may therefore critically lower the atopic individual's
threshold to mount allergen-specific T cell responses. Interestingly, APCs of patients with
atopic diseases have been shown to express increased levels of FcsRI correlating with high
serum IgE concentrations (Kraft et al., 1998). Thus, FcsRI-mediated antigen presentation
has been proposed to mediate delayed-type hypersensitivity reactions (in contrast to
immediate-type hypersensitivity mediated by mast cells and basophils) involved in
diseases, such as atopic dermatitis (AD) and atopic eczema/dermatitis syndrome (AEDS),
in which aeroallergens penetrating the skin banier can be directly taken up by FcsRI-
bearing Langerhans' cells (LCs) leading to T cell activation and inflammation (Figure 5).
Moreover, a surprising functional difference in LCs from normal individuals and
individuals with AD has been observed: calcium mobilization upon crosslinking of FcsRI
can only be detected in LCs freshly isolated from patients with AD, but not in those from
skin of healthy individuals, despite the presence of significant amounts of the receptor
(Jürgens et al., 1995). The differential regulation of FcsRI expressed on LCs from atopic
patients has been reported to involve upregulated expression and activity of protein tyrosine
kinases (PTK) leading to activation of phospholipase C-y (PLCy) induced after IgE and
antigen ligation to FcsRI (Kraft et al., 2002b). Furthermore, signals through FcsRI in LCs
of atopic patients have been shown to induce expression of NF-kB resulting in activation of
proinflammatory cytokines, such as TNF-a and monocyte chemoattractant protein-1
(MCP-1) (Kraft et al., 2002a). These findings support the view that FcsRI-expressing APCs
may contribute to the inflammatory reactions found in atopic disease.
Taken together, recent investigations into the role of FcsRI on APCs have shed new light
on mechanisms controlling allergic and inflammatory hypersensitivity reactions. Additional
studies need to be undertaken to elucidate the detailed function of the high affinity IgE
Introduction 23
receptor expressed on different cell types in order to determine whether intervention with
FcsRI-mediated signaling cascades might be used for therapeutic strategies.
Stein
Allergen -.
NFLAMMATION
Lymph node
Figure 5. Contribution of FcsRI* LCs in development of AD. Allergen taken up through the skin
(a) binds to specific IgE present in high amounts in atopic patients. FceRI expressed on LCs
facilitates the uptake of allergens via IgE bound to the receptor leading to a more efficient
presentation of antigens and activation of LCs (b). In the regional lymph node LCs present the
antigen to naïve T cells resulting in activation of the T cells (c). Effector T cells migrate to the skin
where they trigger allergic inflammatory reactions, e.g. mediated by type-2 cytokines, which may
lead to dermatitis (d).
24 Introduction
1.3 Allergy
Definition of allergy
The term "allergy" was introduced by von Priquet in 1906 and it originally refened to all
forms of altered reactivity to antigenic stimulation, which may result in a protective
response (immunity) or an adverse clinical reaction (hypersensitivity) (Priquet, 1963).
However, the cunent usage of the term allergy describes potentially harmful immune
responses to environmental antigens, known as allergens. The pathology of allergic
diseases reflects activation of allergen-specific T cells, especially Th2 cells, and generation
of allergen-specific antibodies, mostly IgE. The term "atopy" (from Greek atopos, meaning
out of place) is used to describe IgE-mediated diseases. Patients with atopy produce IgE
antibodies against common environmental allergens and suffer from atopic diseases, such
as rhinitis, asthma, and eczema. Importantly, some allergic diseases, such as contact
dermatitis and hypersensitivity pneumonitis, develop through IgE-independent mechanisms
and can be therefore considered as nonatopic allergic conditions (Kay, 2001). Allergic
disease can usually be divided into three types of responses induced by allergen challenge:
(i) acute allergic responses, which can be elicited within minutes after exposure to allergen
reflecting the actions of mediators released from mast cells; (ii) late-phase reactions, which
develop several hours after allergen challenge and result in the recruitment of circulating
leukocytes; and (iii) chronic allergic inflammation, which occurs in response to repeated
allergen challenge and is characterized by long-lasting changes in the tissue and enhanced
propensity for Th2 cell-driven immune responses.
Allergens
An important question in the field of allergic disorders was asked by Aas in 1978: "What
makes an allergen an allergen?" (Aas, 1978). Although the first investigation of allergens
took place as early as the 1870s when Charles Blackley identified grass pollens as the cause
of his own disease, it is still not clear whether allergens are a specific subset of antigens or
whether any antigen can potentially become an allergen (Mohapatra and Lockey, 2001).
Molecular cloning and characterization of a large number of allergens has allowed the
identification of certain general characteristics of allergens. Allergens typically are proteins,
of which many show enzymatic activity (Cromwell, 1997). This led to the hypothesis that
Th2-type responses to enzymes evolved because of selection pressure that favored the
Introduction 25
development of immune responses to parasites that often require enzymes for successful
invasion of host tissues (Stewart et al., 1993). Other allergens are glycoproteins and it has
been proposed that oligosaccharide side chains may favor the binding to lectin receptors on
APCs and promote allergen uptake (Cromwell, 1997). The clinical classification of
allergens is based on their origin or patterns of distribution within the environment. Thus,
aeroallergens, further subdivided into indoor and outdoor aeroallergens, constitute airborne
particles, such as pollen grains, dust mite feces, and animal dander. Food allergens refer to
allergens ingested with food and the most prominent derive from peanuts, fish, cow's milk,
and cereal grains. Insect venoms represent an important group of allergens, because of their
high risk of causing anaphylaxis (Valentine, 1992). Although about 70 major allergens,
meaning allergens that induce immediate skin test responses in >90% of allergic
individuals, have been identified, it has not yet been revealed why these substances induce
Th2 cell-driven, IgE-associated responses. Thus, given such a wide range of allergens,
further research is required to understand the complexity of allergic disorders.
Factors involved in the development of allergy
Atopic diseases such as asthma, hives, eczema, atopic dermatitis, allergic rhinitis, and food
allergy have increased remarkably over the last two decades, and are now a major source of
disability worldwide, affecting mainly industrialized countries (1998; Holgate, 1999;
Sunyer et al., 1999). Due to the large number of people affected and the high annual costs
of treating allergic disorders, a large body of literature has accumulated discussing factors
that promote development of allergy.
Genetics
Investigation of asthma and eczema within families has revealed that allergy has a genetic
basis. Twin studies have shown that the heritability of asthma may be as high as 75%
(Duffy et al., 1990) and the presence of eczema-specific genes has been suggested from the
observation that parental eczema confers a higher risk of eczema in offspring than parental
asthma or rhinitis (Dold et al., 1992). Techniques used to identify genes that are relevant to
allergy and asthma include the candidate-gene approach, which depends on the
identification of polymorphisms in a known gene, and positional cloning, which links the
inheritance of a specific chromosomal region with the inheritance of a disease (Cookson,
1999). Studies using the candidate-gene method have revealed an association between an
26 Introduction
allele of the human leukocyte antigen (HLA)-DR locus and reactivity to the ragweed
allergen Ra 5 (Marsh et al., 1982), and the linkage of atopy to a polymorphism of FcsRIß
(Hill and Cookson, 1996) and to the IL-4 family of cytokine genes on chromosome 5
(Marsh et al., 1994). Positional cloning has shown that chromosomes 2q, 5q, 6q, 12q, and
13q contain loci linked both to asthma and atopy (Cookson, 1999). However, the clinical
relevance of these findings remains to be determined.
Feto-maternal events
It is widely recognized that most atopic disorders originate in childhood and therefore
research on the early development of the immune system is important to understand the
chronology of events leading to allergic reactions. Experimental data has suggested that
infants can develop an immune response to common environmental antigens whilst in utero
(Warner et al., 2000). Specific allergen-induced responses have been shown to occur as
early as 22 weeks of pregnancy and maternal exposure to birch pollen from this point
onwards results in increased infant allergen-specific responses at birth, suggesting that
antigen passage can occur across the placenta (Jones et al., 1996). Furthermore, peripheral
blood mononucleocytes (PBMCs) from babies with a family history of allergy have been
demonstrated to lack production of the Thl cytokine IFN-y (Holt et al., 1992; Tang et al.,
1994). Interestingly, several reports have proposed that during pregnancy the immune
response at the materno-fetal level is biased towards a Th2 response (Prescott et al., 1998).
This implies that fetal IFN-y production may be required to counterbalance the Th2
environment of the placenta in order to prevent an allergic Th2 phenotype in infants.
However, if the mother is atopic and exposed to allergens that trigger her own allergy
during pregnancy, Th2-type cytokines could potentially cross the placenta and hamper the
fetal IFN-y response. Early exposure of the infant to the same allergens may additionally
influence the immune response, resulting in atopic disease, as shown by the observation
that the level of house dust mite exposure during the first year of life correlates with the
subsequent risk of childhood asthma (Sporik et al., 1990).
Lifestyle
Results of international epidemiological studies have provided ample evidence that the
increase in the prevalence of allergic disease correlates with western lifestyle. Substantial
regional differences in importance of atopy have been shown over the past 20 years (1998)
Introduction 27
including studies of West and East Germany (von Mutius et al., 1998) as well as West and
East Europe (Bjorksten et al., 1998). Furthermore, rural lifestyle has been shown to have
protective effects on the development of allergies (Braun-Fahrlander et al., 1999). Large
families or animal pets have also been listed amongst the factors protecting against atopy
leading to the hypothesis that an excessively clean environment may result in inappropriate
immune responses (Rook and Stanford, 1998). It has been proposed that microbial
stimulation in the gastrointestinal tract could possibly explain the association of atopic
disease with clean western lifestyle as microbial antigens stimulate Thl cell activation. An
example of a link between bacteria colonizing the gastrointestinal tract and atopic
sensitizations has been described in a study of Swedish and Estonian children (Bjorksten et
al., 1999; Sepp et al., 1997). While lactobacilli and eubacteria were predominant in non-
atopic individuals, coliforms and Staphylococcus auerus dominated in allergic children.
The findings that atopic sensitization might be influenced by the bacterial species
colonizing the gut may explain why living in a rural community, which increases the
likelihood of exposure to bacteria found in barns, might protect from allergic disease.
The hygiene hypothesis versus the counter-regulatory model
The argument that bacterial and viral infections during early life direct the maturing
immune system toward Thl responses, which counterbalance allergy-associated responses
of Th2 cells, has led to the so-called hygiene hypothesis, first postulated in 1989 by David
Strachan (Strachan, 1989). The hygiene hypothesis argues that the increased prevalence of
allergic disease results from a reduced exposure to microbes that are more common on
farms and in less developed countries. This view has been supported by findings suggesting
that childhood infections show a negative association with atopy. In particular, exposure to
food and orofecal pathogens, such as hepatitis A, Toxoplasma gondii, and Helibacter
pylori, has been shown to reduce the risk of allergic disease by >60% (Matricardi et al.,
2000). However, studies reporting that the prevalence of Thl-dependent autoimmune
diseases is also increasing and that Th2-associated parasite infections do not increase the
risk of allergy, contradict the hygiene hypothesis and imply that the Thl/Th2 balance model
should be re-evaluated (Allen and Maizels, 1997; Gor et al., 2003). Thus, recent reviews
have favored a novel, so called "counter-regulatory" model, which offers a unifying
explanation for the increasing incidence of both allergy and autoimmunity in the absence of
persistent immune challenge characteristic for a westernized lifestyle (Wills-Karp et al.,
28 Introduction
2001; Yazdanbakhsh et al., 2002). Anti-inflammatory cytokines, such as IL-10 and
transforming growth factor (TGF)-ß, have been suggested to be the key players in the
counter-regulatory model. As most pathogenic infections have been shown to upregulate
IL-10 production, consequently suppressing allergic and autoimmune disease, decreased
infectious pressure found in developed countries might result in decreased levels of anti¬
inflammatory cytokines required for prevention of deleterious immune responses (Moore et
al., 2001; van den Biggelaar et al., 2000). This is supported by a previous finding of
decreased IL-10 production in asthmatic patients (Borish et al., 1996).
In summary, the interrelation between pathogenic infections and development of atopic
disorders seems to involve complex regulatory mechanisms that remain to be
experimentally proven. Factors required for counter-regulation, such as cell types and
anatomical locations involved, should be addressed in animal models to increase our
understanding of the mechanisms regulating the development of allergic disease.
Animal models used in the study of allergy
Various animal models, including mice (Levine and Vaz, 1970), rats (Byars and Fenaresi,
1976), guinea pigs (Tanaka et al., 1988), monkeys (Turner et al., 1996), and dogs (Ermel et
al., 1997), have been established in an attempt to provide insights into the immunology and
pathophysiology of human atopic disorders. The murine system has been widely used in
immunologic research because of the availability of a multitude of genetically engineered
mice as well as detailed knowledge of the murine genome and immune system.
Additionally, various techniques and reagents have been developed to assess
immunological responses in mice. Models to investigate allergic-type diseases require close
resemblance to the pathology of the disease in humans and should allow measurement of
physiologic parameters. Numerous sensitization protocols with food- and aero-allergens
have been used to induce an atopic phenotype in mice (Lloyd et al., 2001). Generation of
recombinant allergens has been shown to be advantageous to obtain reliable and
reproducible experimental data (Herz et al., 2004). Sensitization to ovalbumin (OVA) and
challenge with aerosolized OVA represents the most widly used protocol used in mice to
study human bronchial asthma (Neuhaus-Steinmetz et al., 2000). Nevertheless, methods
based on immunization with high amounts of protein antigen do not reflect the natural
pathway of atopic sensitization leading to allergic reactions in humans. Thus, natural
Introduction 29
murine infections inducing a Th2-type immune response including high levels of IgE, such
as helminth infections, have also been used to investigate mechanisms involved in
development of allergy (Finkelman et al., 1997). Although helminth infections have
provided important insight into the regulation of Th2 responses, they are often cleared by
the mouse and therefore do not induce a persistent IgE response that would mimic chronic
allergic diseases in humans. In consequence, novel improved murine models that would
resemble more closely the features of human allergy are required to allow investigation of
all aspects of the disease.
30 Introduction
1.4 Central Question
The main objective of this thesis was to investigate mechanisms involved in the regulation
of IgE production and to analyze the role of IgE interactions with its high affinity receptor,
FcsRI. To reach this aim, a new model of a murine infection resulting in allergy-like
symptoms was established and characterized (Results Part I). In particular, natural murine
ectoparasites, the fur mites Myocoptes musculinus and Myobia musculi, were used and their
value as a model for atopic disorders evaluated. Furthermore, a transgenic mouse model
mimicking the expression pattern of the human FcsRI was generated in order to provide a
tool to study the role of FcsRI expression on the same cell types as found in humans
(Results Part II). Lastly, an attempt to generate a monoclonal antibody against the a chain
of the murine FcsRI was made to allow specific analysis of the receptor expression (Results
Part III).
Results Part I 31
2 Results Part I
Induction of IgE and allergic-type responses in fur
mite-infested mice
2.1 Abstract
High serum IgE levels are characteristic of allergic diseases and immune responses to most
parasites. A murine allergy model based on infestation with the fur mites Myocoptes
musculinus and Myobia musculi was investigated. Analysis of mite infestation in various
knockout mice revealed that IgE production in response to these ectoparasites was
dependent on T cells, IL-4, and CD40L interaction. Secretion of IL-4 by CD4+ T cells
obtained from peripheral lymph nodes draining mite-infested skin sites was increased with
progressing mite infestation and correlated with the serum IgE induction. A time course
analysis of the mRNA expression of s germline, switched IgE, and AID transcripts
suggested that switching to IgE in response to fur mites occuned initially in skin-draining
lymph nodes. In addition, mite infestation induced mast cell degranulation in the skin as
well as mast cell infiltrations into skin-draining lymph nodes. Analysis of the immune
response generated in mite-infested mice should provide information useful for better
understanding of mechanisms involved in IgE induction and regulation. Due to the
physiological way of allergen-exposure resembling the atopic sensitization in humans, mite
infestation might offer a highly valuable model for the investigation of allergic disorders.
32 Results Part I
2.2 Introduction
IgE is the main antibody isotype involved in allergic disease and immune responses against
parasites. The direct effects of IgE during an immediate-type hypersensitivity reaction are
well characterized (Corry and Kheradmand, 1999; Kay, 2001; Kinet, 1999). However,
many of the specific factors involved in the initiation and induction of IgE are yet to be
determined. Many components influencing development of atopy have been proposed, such
as lifestyle, diet, and genetic background (Cookson, 1999). Nevertheless, it is still unclear
why some individuals develop allergy while others remain allergy-free. Investigation of
factors regulating the induction of IgE is therefore of crucial importance to elucidate the
etiology of allergic diseases.
Nematode infection models have been widely used to study IgE-related immune responses
(Finkelman et al., 1997; Shea-Donohue and Urban, 2004). However, in contrast to allergic
diseases, which are chronic, frequently used parasites, such as Trichinella spiralis and
Nippostrongylus brasiliensis, induce Th2-type responses leading to protection. Other
frequently employed methods to study allergic disorders have been based on immunization
with high amounts of purified protein antigens in adjuvants, which induce some of the
symptoms of allergy or asthma (Herz et al., 2004). While this can provide information on
the effects of IgE after induction, it is important to investigate additional in vivo models,
which could yield physiologically relevant information on the factors regulating the
initiation of allergic responses.
Murine fur mite infestation was previously suggested to closely mimic the development of
allergic type responses (Jungmann et al., 1996a; Laltoo et al., 1979; Weisbroth et al., 1976),
however, little research has been done on the immune response to ascariasis. Most common
mouse fur mite species are Myocoptes musculinus and Myobia musculi (Gambles, 1952).
These mites are natural parasites of mice and live their entire life cycle on the same host
(Friedman and Weisbroth, 1977). Interestingly, despite the fact that these mites are
classified as ectoparasites and do not penetrate the deeper layers of the skin, infested mice
develop greatly increased total serum IgE levels (Jungmann et al., 1996b; Laltoo et al.,
1979). Following prolonged periods of infestation, mice develop skin lesions known as
mite-associated ulcerative dermatitis (MAUD) of which severity is influenced by the
Results Part I 33
genetic background of the infested mice (Dawson et al., 1986; Friedman and Weisbroth,
1975).
In the present study we characterized the initial requirements of IgE induction in mite-
infested mice. We show that fur mite infestation represents a good animal model for
investigation of allergic-type immune responses involving activation of Th2 cells and
secretion of IL-4. T cell activation and B cell isotype switching to IgE appear to occur
within skin-draining LN. Furthermore, mast cell degranulation was greatly increased in the
skin and increased mast cell infiltration in skin-draining LN was observed. These data
suggest that mite antigens enter through the skin of infested animals leading to induction of
a Th2-type response and B cell switch to IgE in skin-draining LN. Murine mite infestation
is therefore a promising physiological animal model in which to study induction of allergic
responses.
34 Results Part I
2.3 Materials and Methods
Mice and mite infestation
C57BL/6, CD40L"A (Renshaw et al., 1994), IL4"A (Kopf et al., 1993), IL5"A (Kopf et al.,
1996), and TCRßo"" (Mombaerts et al., 1993) mice were bred and maintained at the
Institute of Laboratory Animal Science of the University of Zurich. BALB/c mice were
purchased from Harlan (Netherlands).
For mite infestation female mice at 6-8 weeks of age were put into a cage with a previously
infested mouse carrying a mixed population of Myocoptes musculinus and Myobia musculi.
Hereafter infestation occurred by direct contact. Transgenic mice were housed in the same
cage with respective control mice in order to avoid cage-cage variation.
Serum IgE and IgGi measurement
Blood was collected weekly and total serum IgE and IgGi concentrations were determined
by enzyme-linked immunosorbent assays (ELISA). ELISA plates were coated with 5 ug/ml
rat anti-mouse IgE (clone 6HD5) or with 1 ug/ml goat anti-mouse IgGi (Southern
Biotechnologies) in 0.1 M NaHCÛ3 (pH 9.6) and blocked with 5% (w/v) bovine serum
albumin (BSA). Serially diluted serum or standards, IgE (clone TIB-141) and IgGi
(Zymed), were added and incubated for 2 hours. Bound IgE was detected with biotinylated
anti-mouse IgE (clone RIE-4) at 2.5 ug/ml followed by horseradish peroxidase-conjugated
streptdavidin (Jackson ImmunoResearch Laboratories) at 1 ug/ml. Bound IgGi was
detected by horseradish peroxidase-conjugated anti-mouse IgG (Sigma). ABTS peroxidase
solution (2,2'-azino-bis-[3-ethylbenzthiazidine-6-sulfonic acid] 0.1 mg/ml, 0.05% H202,
and 0.1 M NaH2P04 pH 4.0) was used for the peroxidase-catalyzed color reaction. Color
reaction was read at 405 nm in a Bio-Rad microplate reader and standard curves and
antibody concentrations analyzed with Microplate Manger III software (Bio-Rad).
Flow cytometry
To obtain single cell suspensions, lymph nodes and spleens were smashed though nylon or
metal grids whereas lungs were digested for 1 hour at 37°C in DNase I (50 ug/ml, Fluka
Chemie) and Collagenase (500 ug/ml, Invitrogen). Cells were restimulated for 6 hours with
PMA (50 ng/ml) and ionomycin (500 ng/ml) in the presence of Brefeldin A (5 ug/ml).
Results Part I 35
Collected cells were surface-stained with anti-CD4-FITC (5 ug/ml, BD Biosciences), fixed
with 2% paraformaldehyde and permeabilized in 0.1% saponin. Intracellular staining was
performed with anti-IL-4-APC (2 ug/ml, BD Biosciences), anti-IL-5-PE (2 ug/ml, BD
Biosciences), or anti-IFN-y-APC (1 ug/ml, BD Biosciences).
Histochemistry
Freshly removed organs were immersed in Carnoy's fixative (60% Ethanol, 20%
Chloroform, 20% Acetic acid). Sections of 5 urn thickness were cut in paraffin, and stained
with toluidine blue using standard procedures.
RT-PCR and sequencing
B cells were purified to > 95% from spleen and lymph nodes by magnetic-assisted cell
sorting (MACS) (Miltenyi Biotec) using anti-B220 microbeads. Total RNA was isolated
using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer's
instructions. First-strand cDNA synthesis of 1 ug total RNA was performed with random
hexamers and SuperScript II reverse transcriptase (Invitrogen Life Technologies). 1 ul of
the resulting cDNA was amplified by PCR. Primer sequences and PCR conditions were as
follows: mature IgE switched transcripts (962 bp): 5'-CCTGCCCTCGGTTCTGA-3' and
5'-CTAGGCGACTGAAGATGAAG-3' (94°5'; [94°1'; 58°1'; 72°l']x35; 72°10'; 10°), s
germline transcripts (300 bp): 5'-GCAGAAGATGGCTTCGAATAAGAACAGT-3' and
5'-TCGTTGAATGATGGAGGATGTGTCACGT-3' (94°5'; [94°1'; 60°1'; 72°l']x35;
72°10'; 10°), u germline transcripts (325 bp): 5'-CTCTGGCCCTGCTTATTGTTG-3' and
5'-ATGGTGCTGGGCAGGAAGTC-3' (94°5'; [94°1'; 60°1'; 72°l']x35; 72°10'; 10°),
AID (300 bp): 5'-GGCTGAGGTTAGGGTTCCATCTCAG-3' and 5'-
GAGGGAGTCAAGAAAGTCACGCTAGA-3' (94°5'; [94°1'; 60°1'; 72°l']x35; 72°10';
10°).
For sequence analysis cDNA was synthesized from B cells purified from spleens of day 80
mite-infested mice. V(D)JH-Cs transcripts were amplified by PCR using a degenerative
primer mix (Krebber et al., 1997) specific for the Vh region and a reverse primer that
anneals within exon 1 of the Cs gene (IgEc, 5'-TCTGAATACCAGGTCACAGTC-3').
PCR products were purified using the agarose gel extraction kit (Qiagen) and subcloned
directly into the pGEM-T vector (Promega) for automated sequencing.
36 Results Part I
2.4 Results
Mite infestation induces IgE
To investigate the antibody response induced by ascariasis, total serum IgE levels were
analyzed in C57BL/6 and BALB/c mice infested with two common species of mouse fur
mites, Myobia musculi and Myocoptes musculinus. Blood was collected at weekly intervals
following infestation to determine the kinetics of IgE induction. Upregulation of total
serum IgE was first observed 15 days after mite infestation (Figure 6A) followed by a
gradual increase for about ten weeks. Around 90 days post infestation IgE levels reached a
1000-fold increase from about 3 ng/ml to 2000 ng/ml in C57BL/6 mice and 60 ng/ml to
lO'OOO ng/ml in BALB/c mice. These high serum IgE levels then remained stable up to two
years after first contact with the ectoparasite (data not shown). In addition, total serum IgGi
levels were also determined (Figure 6B). The kinetics for IgGi induction showed a similar
course as observed for IgE, however the increase (10-fold in C57BL/6 and 20-fold in
BALB/c) was less prominent. Thus, fur mite infestation parallels an allergic situation where
high serum IgE levels are chronically induced in response to the constant presence of
naturally occurring allergens.
B104 k__ A- -A
A= 104
enc
UJ
5> 103_^r*rL-*rhr*
h-T-
2 k~
o
O
2 102
io2 ^x'a^t r""
**
10 /
1 £ 10 "
A C57BL/6
A BALB/c
0.1 1
0 15 30 45 60 75 90 105 0 15 30 45 60 75 90 105
Days post mite infestation Days post mite infestation
Figure 6. Mite infestation induces IgE and IgGi. C57BL/6 mice (closed symbols) or BALB/c mice
(open symbols) were infested with fur mites at day 0. Blood was collected at weekly intervals and
total serum IgE (A) and lgG1 (B) was determined by ELISA. The data points represent the mean +
standard deviation (s.d.) of 11 C57BL/6 and 8 BALB/c mice. Results are representative of five
separate experiments. The dotted line in A indicates the lower limit sensitivity (0.7 ng/ml) of the IgE
ELISA.
Results Part I 37
Induction of IgE in response to mite infestation requires T cells, CD40L, and IL-4
To investigate which factors are required for the immune response induced against mites,
several different knockout mice were infested. At various time points thereafter, blood was
collected and total serum IgE and IgGi concentrations were analyzed. A requirement for T
cells for mite-induced IgE was confirmed by investigating TCRßo""
mice (Mombaerts et
al., 1993), as IgE levels remained below detection limit throughout the time of mite
infestation (Figure 7, upper panel). T cells induce isotype switch to IgE by providing
cytokines and through direct cognate interaction with B cells. To investigate if both forms
of T cell help were required, mice deficient in CD40L, IL-4 or IL-5 were infested with
mites and serum IgE levels monitored. As expected, no increase in serum IgE levels was
observed in either IL-4 (Köpfet al., 1993) or CD40L (Renshaw et al., 1994) deficient mice,
however, the absence of IL-5 (Köpfet al., 1996) did not alter IgE production in response to
mites (Figure 7, upper panel). IgGi measurements led to comparable observations (Figure
7, lower panel).
These data suggest that mite infestation induces B cells to switch to IgE or IgGi under the
influence of signals through CD40 and the Th2-type cytokine IL-4. Thus, the immune
response to fur mites requires T cells and IL-4, as observed for IgE induction during
allergic reactions. Therefore, mite infestation may serve as a suitable model for
investigation of allergic responses causing high serum IgE levels.
38 Results Part I
104
TCRßS-/- CD40L-/- IL-4-/- IL-5-/-
--
--
Jc
m
103^--- A-*- * *"* ,*^^
102/
--
/ -,if
/ *
;/2 10 J
¥*'
/
,o 1 '-
AH
*—^c> o -o- o ' \^ ( o<^^^-^^^-^^S*
0.1
105
' 1
j ,
1 >
¥"ra3.
104 ----*—*- - '„# - -p-
"W
"r 103 - -
o
2 102 -
x:^>- --o- -O^'^"~v—v \
\-
~-<^- -o
"5 ?r-*---<>
':y °
,o 10 i"
t
"
KOh- WT
1 1
r
'
0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100
Days post mite infestation
Figure 7. Absence of IgE or IgGi induction in response to mite infestation in mice deficient in
T cells, CD40L or IL-4. Knock-out (open symbols) and WT control mice (closed symbols) were
infested with mites by direct contact and housed together in the same cage. Total serum IgE (upper
panel) and lgG1 (lower panel) of TCRßS"'", CD40L"'", IL-4_/", and IL-5_/" mice were determined by
ELISA at different time points after infestation with mites. The data points represent the mean + s.d.
of 4-5 mice per group. Results are representative of two separate experiments. The dotted line in
the upper panel indicates the lower limit sensitivity (0.7 ng/ml) of the IgE ELISA.
Results Part I 39
Mite infestation induces IL-4 secretion in skin-draining LN
To further characterize the immune response mounted against fur mites, we investigated the
site of T cell activation, which could provide insight into the site of antigen entry. For this
purpose, we determined the cytokine profile of T cells in spleen, lung, and LN draining the
skin (brachial and cervical LN), the gut (mesenteric LN), and the lung (mediastinal LN).
Cells were isolated at several time points after mite infestation and re-stimulated in vitro
with PMA and lonomycin. Percentages of IL-4-, IL-5-, and IFNy-producing cells were
determined by intracellular staining. Representative dot plots of IL-4+ CD4+ T cells from
three different time points post mite infestation are shown in Figure 8A. IL-4 secretion in
response to mite infestation was observed in CD4+ T cells from skin-draining LN,
mediastinal LN, and lung, but not spleen or mesenteric LN (Figure 8B). Importantly, while
significant increase in IL-4 production in mediastinal LN and lung occurred only late after
mite infestation (>150 days), the increase in IL-4 levels in skin-draining LN was observed
already 30 days post infestation, conesponding to the time of IgE upregulation. These data
suggest that the IL-4 responsible for B cell switch to IgE in mite-infested mice was
produced in skin-draining LN. In contrast, CD4+ T cell secretion of IL-5 was slightly
increased above background levels only at very late time points (>150 days, data not
shown). This correlates well with the very low levels of peripheral blood eosinophilia
observed in infested mice. In our animal facility the percentage of eosinophils in peripheral
blood of naïve C57BL/6 mice averages 0.6% (±0.1% SEM, n=38) and was increased to
2.5%) (±0.2%) SEM, n=38) on day 60 post infestation. After this time eosinophil levels
remained stable or even declined. T cell secretion of IFNy remained stable at background
levels except late time points after mite infestation (data not shown).
Taken together, these results show that T cell activation in response to contact with fur
mites was induced in skin-draining LN, suggesting that mite antigens enter initially via the
skin and not through other possible routes, such as the lung or the gut. Moreover, skin-
draining LN were increased in size following mite infestation while the size of other LN
remained stable (data not shown). This provides additional evidence that after uptake of
mite antigen T cells are activated in skin-draining LN.
40 Results Part I
day 0 day 60
0.17% 1.99%
day 320
4.52%
B
CD4
brachial+cervical LNs mediastinal LNs mesenteric LNs
+
o
ü
+
0 15 30 45 60 165 320 0 15 30 45 60 165 320 0 15 30 45 60 165 320
spleen lung
CZ3 PMA/lonomycmUnstimulated
1kzz:ez n
i i3 X rL
}\
jJ J
0 15 30 45 60 165 320 0 15 30 45 60 165 320
Days post mite infestation
Figure 8. CD4+ T cells in skin-draining LN produce IL-4 in response to mite infestation. A)
Representative dot plots of brachial and cervical LN isolated on day 0, 60, and 320 post mite
infestation after PMA/lonomycin restimulation. The percentage of IL-4+ CD4+ cells is indicated. B)
Cells isolated from LN, spleen, and lung on indicated time points after mite infestation and
stimulated with PMA/lonomycin (light bars) or with medium alone as controls (dark bars). Gates
were set on live CD4+ cells and IL-4 expression was analyzed. Results represent the mean + s.d. of
5 mice per group. Results are representative of two separate experiments.
Switching to IgE is induced in skin-draining lymph nodes
In order to determine at which sites B cell switching to IgE was occuning, B cells were
purified from the spleen and LN draining the skin, lung, and gut of naive and mite-infested
mice RT-PCR was then performed to detect s germline transcripts (GLT), uGLT, mature
switched IgE, and activation-induced cytidine deaminase (ADD) The presence of sGLT
provides evidence for the initial steps leading to IgE class-switch recombination (CSR)
The "sterile" sGLT, which lacks the VDJ region, is an essential prerequisite for CSR AID
Results Part I 41
has been shown to play a crucial role in CSR (Muramatsu et al., 2000) and its expression
indicates initiation of CSR. Mature IgE transcripts, resulting from DNA excision and
ligation of the VDJ sequences to the constant s locus, indicate the presence of IgE switched
B cells. uGLT expression was also analyzed and used as an internal control as uGLT result
from heavy chain VDJ rearrangement during B cell development and characterize
functional B cells. Our results show an upregulation of sGLT and mature IgE transcripts
induced in B cells isolated from skin-draining LN, while in B cells from spleen and
mesenteric LN the expression of all transcripts remained comparable over the time of
infestation (Figure 9). AID expression was also upregulated in skin-draining LN but to a
lesser extent. Importantly, the levels of uGLT remained constant, indicating that B cell
isolation and cDNA synthesis were comparable in all samples (Figure 9).
Thus, these data suggest that initial B cell switching to IgE in response to mite infestation
occurs in skin-draining LN, corresponding to the site of initial IL-4 production.
eGLT IgE AID uGLT
day 15 ^^J^^^^^J ^^^^^^^^5 pBlBfijj^^^s ^^^^^^^^3
day 23 ^SS^^^^S ^^^EiHiiS ^H^^^^^S
ci 8.y 35 ^^B^^^M^^j ^^^^^^^^^^3 ''"I ^^^^^^^^^^3
_j-~~ _L~~ + — + —
Hl^p||^mi|||||||^^B ||^^^^BiiSiii"iiiBi JiiiiiiiiiiiiiiiiiiiiiiiiiiillimHHHHHHHHHm^^M tfjJiiiittMMIIMEflflflSfll
Pill k^ riHInco k^ EÜ^B^nD hn HIHwhn
Figure 9. Messenger RNA expression of eGLT and mature switched IgE transcripts is
upregulated in skin-draining LN upon mite infestation. B cells were isolated from spleen (Spl),
brachial and cervical LN (sLN), and mesenteric LN (mLN) of naïve or fur mite-infested C57BL/6
mice at 15, 23, and 35 days post infestation. Positive controls (+) derive from RNA isolated from B
cells stimulated in vitro with IL-4 and anti-CD40 for 40 hours. Negative controls (-) are H20. Results
are representative of two independent experiments.
42 Results Part I
IgE induced by mite infestation is polyclonal
Parasite infections are known to induce an increase in total IgE although the levels of
parasite-specific IgE are usually low (Hagan, 1993; Pritchard, 1993; Turner et al., 1979).
This implies that parasites may induce a polyclonal non-specific response. In order to
investigate the diversity of the IgE repertoire induced by mite infestation, we determined
the usage of the V, D, and J segments of IgE heavy chains present in B cells of mite-
infested mice. For this purpose, B cells were isolated from spleens of infested mice and
V(D)J Cs transcripts were amplified by RT-PCR and sequenced. Sequences containing an
open reading frame and the correct Cs sequence were then aligned to the closest germ-line
sequence using the DNAplot database (www.dnaplot.de) to determine the Vh, Dh, and Jh
gene usage and the number of mutations within the framework (FR) and the
complementarity-determining regions (CDR). Analysis of twelve sequences obtained from
three C57BL/6 mice is shown in Table 1 and 2. The majority (11/12) of analyzed clones
were found to align to different germline sequences suggesting that the antibody response
to fur mites is not directed against a single antigen. Furthermore, the sequences of Vs
transcripts of mite-infested mice were not highly mutated suggesting that they may not
have undergone somatic hypermutation. This reveals the possibility that the IgE produced
in response to mite infestation might not result from a germinal center reaction. However,
many more sequences need to be analyzed to allow for representative conclusions.
Table 1. V(D)J Ce rearrangements in mite-infested C57BL/6 mice.
Clone VH family3 DH family JH family -
No. of mutations'3
FR CDR FR
R/Sc
CDR
B6#1-VDJ-1.6 v„i DFL16.2 J„3 21 3 0.8 2 .0
B6#l-VDJ-1.12a v„i DFL16.1 J„l 2 0 1.0 NA
B6#1-VDJ-1.18 v„i - J„3 15 5 1.1 0.6
B6#1-VDJ-1.23 v„i DFL16.1 J„4 2 1 NA NA
B6#l-VDJ-2.3 v„i DFL16.1 J„2 19 6 2 .8 5.0
B6#l-VDJ-2.47 v„i - J„3 12 3 1.4 NA
B6#2-VDJ-1.46 V„5 DSP2.9-C J„2 2 3 1.0 NA
B6#3-VDJ-1.52 V„3 DSP2.X J„3 15 10 1.1 4 .0
B6#3-VDJ-1.53 v„i DFL16.1 J.4 16 4 1.0 1.0
B6#3-VDJ-1.65 v„i DFL16.1 J.2 11 7 2 .7 2 .5
B6#3-VDJ-1.70 v„i DQ52-C J„2 11 6 1.8 NA
aClosest germline VH families of clones isolated from three mite-infested C57BL/6 mice (B6#1-3) were
assigned using the DNAplot database (www dnaplot de) bNumbers of mutations in the framework (FR) and the
complementarity-determining region (CDR) were determined for each sequence cRatio of replacement to
silent mutations (R/S) was calculated unless not applicable (NA) dSequence was isolated in two clones after
PCR reaction
Results Part I 43
Table 2. V(D)J Ce sequences in mite-infested C57BL/6 mice.
Clone VH (P)Na DH (P)Na JH
B6#1-VDJ-1.6 TGTGCAAGA GAGACCTCG ATTACTACG ATAC CCTGGTTTG
B6#l -VDJ-1.12 TGTGCAAGA GAGA ATTACTACGGTAGTAGCTAC CC CTACTGGTA
B6#1-VDJ-1.18 TGTGCAAG GGGG - - GCTTACTGG
B6#1-VDJ-1.2 3 TGTGCAAG GAATGGACCCTT CTACGGTAGTAÇCTAC GAGGT TGCTATGGA
B6#l-VDJ-2.3 TGTACAAGA GGGA ATTTCTACGGTAGTAGCAAC CCA TACTTTGAC
B6#l-VDJ-2.47 TGTGCAAGA G - - GCTTACTGG
B6#2-VDJ-1.46 TGTGCAAGACTA CCCT ATAGTAACCTT - TACTTTGAC
B6 #3-VDJ-1.52 TGTGCAAAA AA TAACTAC GGGA GGTTTACTT
B6#3-VDJ-1.53 TGTGCAA TGCAATTCCCCC TTATTACTTC TT TGGACTACT
B6 #3-VDJ-1.6 5 TGTGCAAGA TCCC TÇTATTTCTTCGGTAGTAGTT - TTTGACTAC
B6#3-VDJ-1.7 0 TGTGCAAGA - TCCCÇGÇG GGCTAACTGGG ACTACTTTG
Nucleotides inserted between the Vh, Dh, and Jh sequences Differences to the closest germline sequence
are underlined
Mite infestation induces mast cell degranulation in skin and mast cell recruitment to
skin-draining LN
To investigate the effects of the high IgE concentrations induced upon mite infestation, we
performed histochemistry analysis of mast cells by staining sections of several organs with
toluidine blue. Total mast cell numbers as well as numbers of degranulated mast cells were
determined. While total mast cell numbers in skin sections did not change throughout the
time of mite infestation (Figure 10A), the numbers of degranulated mast cells increased
greatly upon exposure to mites (Figure 10B). The dramatic increase in degranulation is
clearly visible in figures 10C-F, while no such increase was observed in mice deficient in T
cells (Figure 10G) or CD40L (Figure 10H) even late after mite infestation. Induction of
mast cell degranulation suggests the presence of mite-specific IgE, which would be
crosslinked by mite antigens. It also demonstrates that scratching alone resulting from mite
presence on the fur cannot be responsible for mast cell degranulation as scratching was also
observed in TCRßo"" and CD40L"" mice. Thus, our results strongly suggest that the
immune response resulting from mite infestation is directed against specific antigens.
Moreover, we observed an accumulation of mast cells in skin-draining LN (Figure 10I-L)
but not in gut-draining LN (Figure 10M-N). No mast cell infiltration was found in any
other organs such as spleen, lung, jejunum, ileum or colon (data not shown). Mast cells
infiltrating skin-draining LN upon mite infestation may interact with lymphocytes and
influence mite-induced immune responses. However, the relevance of such interactions
remains to be determined.
44 Results Part I
B
0 15 30 45 60 165 320
Days post mite infestation
_ D
^i'
.J • ^
E"
ff;'*:•«. F..%»- •
w'/(* „ ,#
Hm f.
f
*. 'I; '-•#•. 'V- '*''.'"» % m- V ,% »
' • • fer'"
-
« tt ' 'V*
«s
ü
S 60
I| 40
c
E
g» 20
•a
5?.
0 15 30 45 60 165 320
Days post mite infestation
m
Figure 10. Mast cell degranulation occurs in skin of mite-infested mice. Total numbers + s.d. of
mast cells per 10 high power fields (HPF) of a 20x magnification (A) and the percentage + s.d. of
degranulated mast cells (B) were determined in skin sections of WT C57BL/6 mice at different time
points after mite infestation. Tissue sections stained with Toluidine blue are depicted as follows:
skin of naïve (C) or mite-infested WT C57BL/6 mice on day 45 (D), 165 (E), and 320 (F) post mite
infestation; skin of TCRßS-deficient (G) and CD40L-deficient (H) mice on day 200 post mite
infestation; cervical LN of naïve (I) or mite-infested WT C57BL/6 mice on day 45 (J), 165 (K), and
320 (L) post mite infestation; mesenteric LN of naïve (M) or mite-infested WT C57BL/6 mice on day
320 (N) post mite infestation. The arrows indicate examples of degranulated mast cells. Results are
representative of three mice per group and two independent experiments.
Results Part I 45
Additionally, we investigated whether mucus production was induced in the lung of mite-
infested mice by staining lung sections with periodic acid Schiff (PAS). Accumulation of
mucus was never observed in the lungs of mice at various time points post mite infestation
(data not shown), indicating absence of lung inflammation in this model.
Induction of mast cell degranulation in the skin as well as infiltration of mast cells in skin-
draining LN, in agreement with the observations of IL-4 production and B cell switch to
IgE, provide strong evidence that after mite infestation antigen uptake takes place in the
skin and an immune response is induced in skin-draining LN.
46 Results Part I
2.5 Discussion
In the present study we showed that murine ectoparasite infestation can serve as a valuable
model to investigate allergic disorders. We characterized the immune response against
Myocoptes musculinus and Myobia musculi, two fur mite species naturally occurring in
mice. Our results demonstrate that mite infestation induces a strong Th2-type response
resulting in persistent high serum IgE levels. The fact that mites cause a chronic IgE-
associated response is of particular interest because of its resemblance with chronically
induced atopic reactions in humans that cannot be easily reproduced by common allergy
models based on peptide immunizations.
In this report we provide evidence that induction of the immune response against fur mites,
involving IL-4 secretion by CD4+ T cell and B cell switching to IgE, takes place in LN
draining mite-infested skin. Our results thus suggest that mite antigen is taken up via the
skin. Although other antigen entry sites, such as ingestion through the gut or inhalation
through the lung, may also be possible, the absence of marked signs of inflammation in
these organs indicates that priming of the allergic responses occurs in other tissues.
Upregulation of the expression of sGLT and switched IgE transcripts during the course of
mite infestation was explicitly shown in B cells isolated from skin-draining LN. Some
increase of sGLT and switched IgE transcription was also observed in the mesenteric LN,
however, this increase was only detected on day 15 after mite infestation, while in skin-
draining LN the upregulation of sGLT and IgE expression was maintained until at least day
35. The induction of high serum IgE levels observed between 15 and 60 days post mite
infestation correlates therefore with the class switch recombination to IgE in skin-draining
LN. This provides additional evidence for antigen entry to occur via the skin.
As no mite antigen has been identified thus far, we could not directly prove that any of the
IgE produced in response to mite infestation was antigen-specific. However, highly
increased mast cell degranulation in skin of infested mice strongly suggests that at least part
of the total IgE induced was mite antigen specific. This view is supported by a previous
report in which passive and active cutaneous anaphylaxis as well as mast cell degranulation
in the skin have been demonstrated in response to mite extract (Laltoo et al., 1979).
Nevertheless, a large component of the mite-mediated IgE might be antigen non-specific as
sequence analysis of the mature IgE transcripts suggested a polyclonal response to fur mite
Results Part I 47
infestation. Interestingly, the analyzed IgE was not highly mutated from germline
sequences, suggesting that the mite-induced IgE (whether specific or non-specific) had not
undergone somatic hypermution. Analysis of additional sequences should provide detailed
insight into the nature of the IgE repertoire induced by mites.
In recent years, fur mites have been investigated in the context of atopic dermatitis in
Nishiki Cinnamon (NC) mice. The Japanese NC mice were initially believed to
spontaneously develop dermatitis-like syndromes accompanied by high serum IgE levels
and were therefore suggested as a good model to study human atopic dermatitis (AD)
(Matsuda et al., 1997). Later however, the fur mites Myocoptes musculinus and Myobia
musculi were reported to be the cause of skin lesions and increased IgE production in NC
mice (Iijima et al., 2000; Morita et al., 1999). Mite antigen-specific IgE was demonstrated
in the sera of mite-infested NC mice by histamine release from bone marrow-derived mast
cells stimulated with mite extract (Morita et al., 1999). Additionally, histochemical
examination of mite-induced skin lesions has revealed significantly increased numbers of
mast cells, eosinophils, and T cells as well as the presence of IL-4 (Matsuda et al., 1997).
This suggests that IL-4 released from skin CD4+ T cells and mast cells may be involved in
the pathogenesis of the AD-like lesions occurring in mite-infested NC mice. However, the
mechanism regulating the development of mite-dependent dermatitis has not yet been
clarified. Genetic background has been previously accounted for different susceptibilities to
mite-associated ulcerative dermatitis (MAUD) (Dawson et al., 1986; Friedman and
Weisbroth, 1975). The NC strain appears to be particularly susceptible showing rapid
development of severe skin lesions (at -12 weeks of age) (Matsuda et al., 1997). In the
present study, we investigated mite infestation mainly on C57BL/6 mice. MAUD
symptoms were observed in about 5% of these mice when mite infestation was maintained
for at least one year, which is comparable to previously published data (Dawson et al.,
1986). The choice of an adequate mouse strain seems therefore to be of major importance
depending on the questions investigated with the mite infestation model. NC mice, prone to
readily develop skin lesions, may be most appropriate to study atopic dermatitis. In the
present report however, C57BL/6 mice were chosen as a suitable strain to investigate the
mechanisms required for the induction and regulation of mite-dependent IgE.
The physiological environment of fur mite infestation makes this model highly suitable for
the investigation of initial events inducing IgE production and IgE-mediated
48 Results Part I
pathophysiology leading to allergic disease. The way of antigen exposure resulting from
mite infestation resembles natural allergen sensitization responsible for atopy in humans.
Noteworthy, the importance of house dust mites in the development of human atopic
dermatitis has been suggested by several studies (Cameron, 1997; Tan et al., 1996). House
dust mites are known to trigger airway responses which led to the hypothesis that the
respiratory route may be relevant for the induction and exacerbation of dermatitis after
house dust mite inhalation in patients with high IgE levels and a history of asthma. In the
fur mite model antigens appear to enter the host through the skin and may directly trigger
dermatitis-like responses.
Histochemical analysis of organ sections isolated from mite-infested mice revealed both
mite-dependent mast cell degranulation in the skin and accumulation of large numbers of
mast cells in skin-draining LN. Mast cell degranulation in the skin is likely due to mite
antigen-induced crosslinking of IgE bound to the high affinity IgE receptor (FcsRI). The
effects of inflammatory mediators released by mast cell degranulation are known to induce
symptoms of allergy and may eventually contribute to the dermatitis-like lesions occurring
in mite-infested mice. However, the role of mast cell accumulation in skin-draining LN has
remained controversial. Mite-induced mast cell infiltrations have been previously reported
by Jungmann et al. who speculated that mast cells might recirculate into the lymphatics and
contribute to antigen transport and presentation in draining LN (Jungmann et al., 1996b).
Several studies have shown that mast cells can enhance the development of T cell-
associated responses. For example, mast cells have been shown to be able to present
antigen in vitro through MHC class I- and class Il-dependent pathways (Fox et al., 1994;
Frandji et al., 1993; Malaviya et al., 1996). Moreover, mast cells have been demonstrated to
express a number of molecules that may allow them to interact with lymphocytes. These
molecules include the costimulatory molecules CD40L (Gauchat et al., 1993) and
CD80/CD86 (Frandji et al., 1996) and the accessory molecules intercellular adhesion
molecule (ICAM)-l (Valent et al., 1991), ICAM-3 (Babina et al., 1999), and lymphocyte
function-associated antigen (LFA)-l (Toru et al., 1997). Thus, mast cells may contribute to
B cell switching to IgE by inducing IL-4- and CD40L-mediated pathways. Interestingly,
mast cell migration to LN has also been demonstrated during dinitrofluorobenzene
(DNFB)-induced contact hypersensitivity in mice (Wang et al., 1998). Wang et al. have
suggested that mast cells may contribute to the induction of primary immune responses by
Results Part I 49
migration from the site of antigen encounter to draining lymph nodes, where they may
promote T cell recruitment by secretion of the chemokine macrophage inflammatory
protein (MlP)-lß. In fur mite-infested mice mast cell infiltration was observed exclusively
in skin-draining LN. The absence of mast cell accumulation in any other organs suggests
the involvement of mite antigens taken up through the skin leading to activation of immune
responses in the skin-draining LN. Further investigation is required to evaluate the
significance of mast cell accumulation in the skin-draining LN and its possible involvement
in mite-induced responses.
Great increase in the prevalence in allergic diseases has been observed over the past two
decades and has been recognized to positively correlate with westernized lifestyle (1998).
Ample epidemiologic data has suggested that allergy may to some extent result from
diminished infectious burden in childhood (Cookson, 1999). The mechanism behind this
hypothesis has recently been proposed to involve anti-inflammatory cytokines, such as IL¬
IO or TGF-ß, induced by exposure to pathogens and responsible for suppression of allergic
and autoimmune diseases (Wills-Karp et al., 2001). The fur mite infestation model
presented in this report could serve to evaluate the regulatory theory of protection against
atopic reactions. Mite infestation could be investigated following exposure to viral or
bacterial pathogens to study their effect in naturally occurring IgE-mediated immune
responses. Thus, the mite allergy model could provide insights into factors regulating the
development of atopic disease.
50 Results Part I
Results Part II 51
3 Results Part II
Generation and characterization of hmFcsRIaß Tg
mice
3.1 Abstract
Major differences in the expression pattern of the high affinity IgE receptor, FcsRI, exist
between humans and rodents. While the tetrameric form of the receptor (aßy2) is expressed
on mast cells and basophils of both mice and humans, the trimeric complex (0,72) has only
been found to be expressed in humans and is present on eosinophils, dendritic cells,
Langerhans' cells, monocytes, macrophages, and platelets. To elucidate the role of FcsRI
expression on these multiple potential effector and antigen presenting cells, we generated
two transgenic (Tg) mouse models that mimic the human situation. The hmFcsRIa Tg
mouse expresses the murine a chain of the receptor under control of the human FcsRIa
promoter, while the hmFcsRIß Tg mouse expresses the murine ß chain under control of the
human FcsRIa promoter. hmFcsRIaß double Tg mice were generated by crossing the two
Tg lines together. mRNA expression of the transgenes was successfully demonstrated by
RT-PCR and Northern blot, which revealed the intended distribution of all three chains of
the high affinity IgE receptor on same cells as found in humans. Nevertheless, FcsRI
protein expression, investigated by flow cytometry, Western blot, and
immunohistochemistry, could not be found in the targeted cells of the hmFcsRIaß Tg mice.
Thus, the generated mouse model requires further investigation to determine the reason of
the absence of FcsRI protein expression and to evaluate whether this drawback can be
corrected.
52 Results Part II
3.2 Introduction
The high affinity receptor for IgE, FcsRI, is an essential component of IgE-mediated
diseases, such as allergy and asthma. After specific receptor crosslinking via IgE/antigen
interactions, FcsRI signal transduction leads to cell degranulation and release of pro¬
inflammatory mediators. In both humans and mice FcsRI is expressed on mast cells and
basophils as a tetramer composed of one a, one ß, and two y chains (aßy2) (Perez-Montfort
et al., 1983). The extracellular domain of the a chain, containing two Ig-like domains, is
responsible for binding to IgE (Blank et al., 1991). Although both the ß and y chains
contain immunoreceptor tyrosine-based activation motifs (ITAMs), ß is believed to act
merely as an amplifier of signals generated by y (Jouvin et al., 1994; Lin et al., 1996).
Additionally, the ß chain has been demonstrated to have a second amplifier function by
stabilizing the receptor complex on the cell surface and facilitating maturation of the a
chain (Donnadieu et al., 2000). In rodents, the ß chain has been reported to be
indispensable for efficient surface expression of the receptor (Blank et al., 1989; Ra et al.,
1989). In contrast, the human FcsRI can also be found in a trimeric structure, composed
only of one a and two y chains (ay2), expressed on Langerhans' cells (Bieber et al., 1992;
Wang et al., 1992), monocytes (Maurer et al., 1994), eosinophils (Gounni et al., 1994),
peripheral blood dendritic cells (Maurer et al., 1996), and platelets (Joseph et al., 1997).
The discovery of FcsRI expression on cells other than mast cells and basophils raised many
questions regarding the role of the high affinity IgE receptor, in particular concerning its
function in antigen presentation (Novak et al., 2003a; von Bubnoff et al., 2001). However,
the lack of FcsRI expression on antigen presenting cells in mice makes it difficult to use
murine models for investigation of the biological relevance of FcsRI-mediated antigen
presentation. Thus, a "FcsRI-humanized" mouse model was generated with the aim of
assessing the functions of FcsRI on antigen presenting cells in a situation more resembling
humans (Dombrowicz et al., 1996; Dombrowicz et al., 1998). In these human FcsRIa
transgenic mice (hFcsRIa Tg) the endogenous gene encoding the a chain of the FcsRI was
replaced with its human homologue. The human FcsRIa promoter used in hFcsRIa Tg
mice controlled expression of the transgene such that it retained the cell specificity and
structure as found in humans. However, the presence of the human FcsRIa protein in these
Results Part II 53
mice complicates assessment of the physiological role of the trimeric FcsRI because
binding of mouse IgE to the human a chain is characterized by lower affinity than that of
human IgE (Pruzansky and Patterson, 1986). Thus, our aim was to generate a different
FcsRI Tg mouse model, where the murine FcsRIa was expressed under control of the
human FcsRIa promoter, such that in the resulting hmFcsRIa Tg mice the murine high
affinity IgE receptor should be expressed with the same cell distribution as observed for the
human FcsRI. Such a transgenic animal model should allow investigation of the role of
FcsRI expression in host defense or development of allergic diseases using in vivo murine
assays.
54 Results Part II
3.3 Materials and Methods
Mice
C57BL/6 mice were bred and maintained at the Institute of Laboratory Animal Science of
the University of Zurich. FcsRIa"" mice (Dombrowicz et al., 1993) were kindly provided
by Jean-Pierre Kinet (Boston, USA). BALB/c mice were purchased from Harlan
(Netherlands).
Generation of the transgenic mice
hmFcsRIa Tg mice:
The pGL2 expression vector containing the 2.9 kb sequence of the human FcsRIa
promoter, subcloned into Sma I and Xho I restriction digestion sites, was kindly provided
by Jean-Pierre Kinet (Boston, USA). The pGEM-7 expression vector containing the
palH6.8 sequence coding for all 5 exons of the murine FcsRIa genomic DNA, subcloned
into Hind III restriction digestion sites, was kindly provided by William E. Paul (Bethesda,
USA). A Xho I restriction site was inserted immediately upstream of the ATG codon of the
palH6.8 sequence to allow cloning of the murine FcsRIa genomic DNA into the pGL2
vector downstream of the 2.9 kb human FcsRIa promoter. The correct cloning of the
resulting pGL2 vector (14.8 kb) containing the 2.9 kb human FcsRIa promoter followed by
the 6.3 kb murine FcsRIa sequence was verified by sequencing. Thereafter, the vector was
digested with Sma I and Nar I resulting in excision of a 9.2 kb sequence coding for the
human FcsRIa promoter and the murine FcsRIa. This sequence was microinjected into
male pronuclei of fertilized C57BL/6 oocytes at the Institute of Laboratory Animal Science
of the University of Zurich.
hmFcsRIß Tg mice:
The complete cDNA sequence of the murine FcsRIß sequence was kindly provided by
Chisei Ra (Tokyo, Japan) and was subcloned into the pGL2-phFcsRIa-mFcsRIa vector
replacing the mFcsRIa sequence. Microinjection was performed as described above.
Results Part II 55
Bone marrow-derived mast cell (BMMC) culture
Femur and tibia bones were collected from C57BL/6 mice and bone marrow cells were
flushed out with BSS. Cells were washed and resuspended at an initial concentration of 106
cells/ml in FMDM containing 10% FCS, 50 uM 2-Mercaptoethanol, 20 ng/ml recombinant
mouse stem cell factor (SCF, R&D Systems), and 5% X63-IL-3 cell-conditioned medium
corresponding to about 5 ng/ml IL-3. Cells were maintained in tissue culture petri dishes at
20 ml/dish in a humidified incubator at 37°C with 5% CO2. Non-adherent cells were
initially transferred to new dishes every other day, later once a week and subsequently
expanded as necessary. Fresh SCF and IL-3 were provided weekly. 6 week cultures
contained >80% mast cells as confirmed by FACS analysis of CD117 expression.
Cell isolation
Macrophages
Peritoneal macrophages were induced by injection of 1 ml of 5% thioglycollate i.p.. The
peritoneal cavity was washed with 10 ml ice-cold BSS 72 hours post thioglycollate
injection. Macrophages were purified by MACS (Miltenyi Biotec) using anti-CD lib
microbeads.
Dendritic cells
To obtain single cell suspensions, spleens or lymph nodes were smashed on metal or nylon
grids, respectively. Dendritic cells were then purified by MACS (Miltenyi Biotec) using
anti-CD 1 lc microbeads.
Langerhans'
cells
Epidermal cells were isolated as previously described (Schüler and Steinman, 1985).
Briefly, ears were collected, split and digested with trypsin at 37°C (dorsal halves in 0.6%
trypsin for 20 min and ventral halves in 1% trypsin for 45 min). Epidermal sheets were
peeled from the underlying dermis and epidermal cells were collected into HBSS
containing 10% FCS. Langerhans' cells were purified from the epidermal cell suspension
by MACS (Miltenyi Biotec) using anti-MHC II microbeads.
56 Results Part II
Eosinophils
Bronchoalveolar lavage (BAL) was performed on Nippostrongylus brasiliensis-mfected
mice on day 14 post infection by inserting a blunted 18G plastic needle into the trachea and
flushing the lung three times with 1 ml ice-cold PBS. The recovered cells were analyzed
directly without any further purifying step because of low cell yields.
RT-PCR
Total RNA was isolated from about 5xl06 cells using TRIzol reagent (Invitrogen Life
Technologies) according to the manufacturer's instructions. First-strand cDNA synthesis
was performed with random hexamers and SuperScript II reverse transcriptase (Invitrogen
Life Technologies). Transcripts encoding mFcsRI were amplified using the following
primers and conditions: a chain (467 bp band) 5'-CGATGGTCACTGGAAGGTCTGC-3'
and 5'-ATAACTGTAGTTGAAAGCATGG-3' (94°5'; [94°1'; 54°30"; 72°l']x35; 72°10';
10°), ß chain (306 bp band) 5'-AACATTGTCAGTAGCATCGC-3' and 5'-
CCCTTTGTCTTCCAACTCAC-3' (94°5'; [94°1'; 58°30"; 72°l']x35; 72°10'; 10°), and y
chain (402 bp band) 5'-CAGCCGTGATCTTGTTCTTGC-3' and 5'-
TTAACGGAGATGGGGACCTGC-3' (94°5'; [94°1'; 58°30"; 72°l']x35; 72°10'; 10°).
Northern blot
Total RNA was isolated from 107 cells using TRIzol reagent (Invitrogen Life Technologies)
according to the manufacturer's instructions. Equal amounts of RNA (5 ug/lane) were
separated on a 1.5% agarose-formaldehyde gel. The RNA was transferred onto a Hybond-
N+ nucleic acid transfer membrane (Amersham Biosciences) using the Turbo Blotter
system (Schleicher&Schuell). The specific mRNA was detected by hybridization of the
membrane with a 32P-labeled RNA probe specific for the murine FcsRIa gene. The DNA
template for the riboprobe was generated by cloning a 630 bp FcsRIa RT-PCR product
(primers: FcsRIaNhe 5'-CTAGCTAGCATGGTCACTGGAAGGTCTG-3' and
FcsRIaXba 5'-GCTCTAGAAGTTGTAGCCAATAATACTTGC-3', conditions: 94°5';
[94°1'; 54°30"; 72°l']x35; 72°10'; 10°) into the pGEM-T vector (Promega) and
subsequently linearizing the vector by Nde I restriction digestion. The probe was
synthesized by incubating 1 ug of the DNA template for 3 h at 37°C in presence of 50 uCi
[a32P]UTP (800 Ci/mmol, Amersham Bioscience), 1 U T7 polymerase, and 10 uM
Results Part II 57
Ribonuclease Triphosphate set (rATP, rCTP, and rGTP) in a total volume of 25 ul of T7
buffer (Roche). The RNA-containing membrane was prehybridized for 1 h at 68°C in
presence of the ULTRAhyb hybridization buffer (Ambion). 5-15xl06 cpm of the probe was
then added and hybridized overnight at 68°C. The membrane was washed twice in 2xSSC
and twice in 0.2xSSC, both containing 0.2% SDS, for 15 min at 60°C and exposed
overnight to a BIOMAX MR film (Kodak).
Western blot
Cells were lysed at 5xl07 cells/ml in lysis buffer containing 1% digitonin, 150 mM NaCl,
50 mM Hepes, and complete protease inhibitor cocktail (one tablet per 50 ml lysis buffer,
Roche). 500 ul lysate was immunoprecipitated with biotinylated anti-FcsRIa antibody (10
ug/ml, eBioscience) for 2 h on a helicopter rotor at 4°C. Streptavidin-conjugated sepharose
(Amersham Biosciences) was added and incubated for an additional 2 h on a helicopter
rotor at 4°C. The sepharose beads were then washed 3x with PBS and samples denaturated
by incubating for 5 min at 95°C in SDS reducing loading buffer. After centrifugation (3
min, 13000 RPM) proteins were separated by running on a 12.5% SDS-polyacryamide Tris
gel (Bio-Rad Laboratories) and then electrotransferred to Protran nitrocellulose membranes
(Schleicher&Schuell) using a semi-dry transfer unit (SemiPhor Hoefer). Membranes were
blocked in 4% milk/PBS overnight at 4°C. Detection of FcsRIß was performed with mouse
anti-mouse FcsRIß antibody (Rivera et al., 1988) (1 ug/ml, clone JRK, kindly provided by
Juan Rivera, Bethesda, USA) followed by goat anti-mouse IgG antibody (1 ug/ml, EY
Laboratories). Detection of FcsRIy was performed with rabbit anti-mouse FcsRIy antibody
(1 ug/ml, Upstate Biotech) followed by goat anti-rabbit IgG (1 ug/ml, Sigma) antibody. All
antibodies were diluted in 1% milk/PBS and incubated with the membranes for 2 h. For
both ß and y chains HRPO-conjugated donkey anti-goat IgG (1 ug/ml, Abeam) was used as
tertiary antibody and incubated with the membranes for 1 h. Revelation was performed
using the SuperSignal West Pico Chemiluminescent Substrate (Pierce) according to the
manufacturer's instructions.
Flow cytometry
Purified cells were stained using standard procedures with the following antibodies: anti-
mouse CD117-APC (0.7 ug/ml, BD Pharmingen), anti-mouse CDllb-PE (0.4 ug/ml, BD
58 Results Part II
Pharmingen), anti-mouse CDllc-PE (0.7 ug/ml, BD Pharmingen), anti-mouse I-Ab-PE (0.7
ug/ml, BD Pharmingen), anti-mouse GR-l-PE (2 ug/ml, BD Pharmingen), anti-mouse
FcsRIa-FITC (15 ug/ml, eBiosciences), and FITC-labeled Golden Syrian Hamster isotype
control (15 ug/ml, eBiosciences). For intracellular staining cells were fixed with 2%
paraformaldehyde and permeabilized in 0.1% saponin. Cells were acquired in a FACS
Calibur (BD) and analyzed using FlowJo software.
Immunofluorescence
Cytospins of 105 cells were performed in a Shandon Southern centrifuge. Cells were fixed
in acetone, air-dried, and rehydrated in PBS immediately prior to staining. Anti-mouse
CD117-APC (2 ug/ml, BD Pharmingen) or anti-mouse FcsRIa-biotin (10 ug/ml,
eBiosciences) antibodies were applied onto the fixed cells and incubated for 45 min at room
temperature (RT). When staining for FcsRIa, streptavidin-Cy3 (1.3 ug/ml, Jackson
Immunoresearch) was applied for 30 min at RT. Nuclei were stained with DAPI (1 ug/ml,
Sigma) for 5 min at RT. After each staining step slides were washed 3x in PBS. Slide
covers were mounted using DakoCytomation fluorescent mounting medium. Fluorescence
was monitored on a Zeiss Axiophot microscope with a JVC KYF70 camera, using the
Analysis software (Soft Imaging System, Münster, Germany).
Nippostrongylus brasiliensis infection
Parasite maintenance and injection
N brasiliensis was maintained by serial passage through 6 week-old Lewis rats. To
establish rat infections, 5000 infective L3 stage larvae were resuspended in 0.5 ml H20 and
injected s.c. Rat fecal pellets were collected daily between day 7 and 11 post infection and
cultured with granular charcoal at 27°C for 14-28 days. Exsheathed L3 stage larvae were
harvested and resuspended in H20. Mice were injected s.c. with 550 L3 larvae in 200 ul
H20.
Determination ofparasite egg numbers
Infected mice were transferred to gridded cages lined with moist paper and fecal pellets
were collected daily between day 5 and 11 post iV. brasiliensis infection. Pellets were
resuspended in equal volumes of H20 and saturated NaCl solution, vortexed and a sample
Results Part II 59
quickly removed and transferred to a McMaster Worm Egg Counting Chamber (Weber
Scientific International Ltd.) for quantification. The number eggs per gram feces was
calculated knowing that the counting chamber holds 150 ul volume and that 25 mouse fecal
pellets correspond to 1 gram.
Determination ofperipheral blood eosinophilia
Blood smears were prepared from a drop of freshly collected blood, air-dried, and stained
with Diff-Quik (Dade Behring) for differential cell counts of lymphocytes, macrophages,
neutrophils, and eosinophils. A total of 200 cells were counted and the percentage of
eosinophils determined.
Determination oftotal serum IgE levels
Total serum IgE concentrations were determined by enzyme-linked immunosorbent assay
(ELISA). ELISA plates (Greiner Microion) were coated with 5 ug/ml rat anti-mouse IgE
(clone 6HD5) in 0.1 M NaHC03 (pH 9.6) and blocked with 5% (w/v) bovine serum
albumin (BSA). Serially diluted serum or standards (IgE clone TIB-141) were added and
incubated for 2 hours. Bound IgE was detected with biotinylated anti-mouse IgE (clone
RIE-4) at 2.5 ug/ml followed by horseradish peroxidase-conjugated streptdavidin (Jackson
ImmunoResearch Laboratories) at 1 ug/ml. ABTS peroxidase solution (2,2'-azino-bis-[3-
ethylbenzthiazidine-6-sulfonic acid] 0.1 mg/ml, 0.05% H202, and 0.1 M NaH2P04 pH 4.0)
was used for the peroxidase-catalyzed color reaction. Color reaction was read at 405 nm in
a Bio-Rad microplate reader and standard curves and IgE concentrations analyzed with
Microplate Manger III software (Bio-Rad).
60 Results Part II
3.4 Results
Generation of hmFcsRIaß Tg mice
The strategy used to generate mice with FcsRI expression patterns comparable to those
found in humans was based on the results obtained by Dombrowicz et al. (Dombrowicz et
al., 1996). Thus, to obtain the hmFcsRIa Tg mouse, the 2.9 kb promoter region of the
human FcsRIa encoding the information necessary for cell-specific expression was
subcloned into the pGL2 expression vector. The murine FcsRIa genomic DNA fragment of
6.3 kb was then subcloned downstream of the promoter into the Xho I and Hind III
restriction digestion sites (Figure IIA). For microinjection into C57BL/6 oocytes the
promoter and gene were excised from the vector by Sma I and Nar I restriction digestion.
Integration and germline transmission of the transgene were monitored by PCR and
Southern blot analysis (data not shown).
Expression of the human FcsRIa chain in the previously described hFcsRIa Tg mice
(Dombrowicz et al., 1996; Dombrowicz et al., 1998) was reported to be independent of the
presence of the ß chain and trimeric ay2 complexes were identified on peritoneal
macrophages isolated from hFcsRIa Tg mice. However, in the present approach we used
the murine FcsRIa chain, which has been demonstrated to require the presence of the ß
chain for correct surface expression of FcsRI (Blank et al., 1989; Ra et al., 1989). Thus, in
order to ensure proper expression, in addition to the hmFcsRIa Tg mouse we generated an
hmFcsRIß Tg mouse, which should express the ß chain of the murine FcsRI with the same
cellular distribution characteristics as found in humans. The transgene construct for the
hmFcsRIß Tg mouse was generated by replacing the mFcsRIa gene in the pGL2-
phFcsRIa-mFcsRIa with the mFcsRIß sequence (Figure 1 IB). Lastly, the two generated
Tg strains, hmFcsRIa and hmFcsRIß, were crossed to obtain double transgenic
hmFcsRIaß mice. The phenotype of the double transgenic mice was analyzed by RT-PCR,
Northern blot, Western blot, FACS analysis, and immunohistofluorescence as described
below. Additionally, the immune response of hmFcsRIaß mice to Nippostrongylus
brasiliensis infection was assessed.
Results Part II 61
A
PolfA Sifnit
Sma I (4)B
3OTR
intron f
Nar I (9229)
Hind 111 (9167)
hFct-RIa
promoter
Xho I (2902)
mFceRIa
/
PolfA Signal
3'yTR
Sma I (4)
PGL2-phFceRI»mFccRip
909? Tap
FceRIa
promoter
Xho I (2902)
tnFcvlRlR1111 %^c i %i ^.j
Nar I (9229)
Figure 11. Transgene constructs for hmFceRlot and hmFceRIß Tg mice. The 2.9 kb human
FceRIa promoter was subcloned into the Sma I and Xho I restriction sites of the pGL2 expression
vector. For the hmFcsRIa mouse, the 6.3 kb murine FceRIa genomic DNA was subcloned
downstream of the promoter into the Xho I and Hind III restriction sites (A). For the hmFceRIß
mouse, the 0.7 kb murine FceRIß cDNA was subcloned downstream of the promoter into the Xho I
and Nar I restriction sites (B). Both vectors were digested with Sma I and Nar I to excise the
transgene, which was then used for microinjections into male pronuclei of fertilized C57BL/6
oocytes to generate hmFceRIa and hmFceRIß Tg mice.
62 Results Part II
RT-PCR analysis of FcsRI expression in hmFcsRIaß Tg mice
In order to investigate mRNA expression of FcsRI in different cell types of hmFcsRIa and
hmFcsRIaß Tg mice, RT-PCR primers were generated for each of the chains of the
receptor. The primers were tested on the MC/9 mast cell line as well as on bone marrow-
derived mast cells (BMMC) of WT C57BL/6, hmFcsRIa Tg, and FcsRIa-deficient mice
(Figure 12A). All mast cell samples expressed all three chains of FcsRI (a, ß, and y) except
BMMC from FcsRIa""
mice (Dombrowicz et al., 1993) in which FcsRIa was not detected.
As expected, peritoneal macrophages of C57BL/6 mice, used as negative control, expressed
only the y chain of the FcsRI, which is known to be ubiquitously expressed.
Analysis of hmFcsRIa Tg mice revealed mRNA expression of the a chain of the high
affinity IgE receptor in macrophages, dendritic cells, eosinophils, and Langerhans' cells,
while no such expression could be detected in WT C57BL/6 mice (Figure 12B). The
quality of the cDNA was controlled by the presence of y chain transcripts in all samples.
mRNA expression of both FcsRIa and FcsRIß was confirmed in macrophages and
dendritic cells of the double transgenic hmFcsRIaß mice (Figure 12C). We have not yet
confirmed expression of FcsRIa or FcsRIß in Langerhans' cells and eosinophils due to the
large numbers of cells required for RNA isolation coupled with limited availability of the
double transgenic mice. Surprisingly, we also detected FcsRIa mRNA expression in
splenic B cells isolated from hmFcsRIa Tg mice after infection with N brasiliensis and in
splenic B cells of naive double transgenic mice but at very low levels (data not shown).
Further investigation is required to confirm expression of the transgenic high affinity IgE
receptor in B cells. As expected, investigation of T cells isolated from both hmFcsRIa and
hmFcsRIaß Tg mice did not reveal any FcsRIa mRNA expression (data not shown).
Taken together, these data indicate that mRNA expression of the high affinity receptor was
successfully achieved on the targeted cells of the hmFcsRIaß Tg mice.
Results Part II 63
BMMC
500—1
500—1
L MC/9 B6 aTg a-'- ft» »P
FceRIa
467 bp
FceRIß"*~
306 bp
500-1m
FceRIy407 bp
B
bp l
500-
M<î>
B6 aTg
SpIDC
B6 aTg
LNDC
B6 aTg
BAL eos
B6 aTg
LC
B6 aTg
BMMC
B6 aTg
Hfi
500-
FceRIa
"467bp
FceRIy407 bp
bp
500-
500 —
500-
B6 aß
SpIDC
B6 aß
LNDC
B6 aß
BMMC
B6 aß
Hfi
FceRIa
487 bp
FceRIß306 bp
FceRIy407 bp
Figure 12. mRNA expression of the individual chains of FceRI in hmFceRIa and hmFcsRIaß
Tg mice. RT-PCR for detection of the a, ß, and y chains of FceRI was performed on mast cells
(MC/9 line and BMMC), thioglycollate-induced peritoneal macrophages (MO), naïve splenic
dendritic cells (spl DC), DC from lymph nodes (LN DC), eosinophils (eos) from the BAL of N.
Jbras/7/'ens/'s-infected mice, and naïve Langerhans' cells (LC). Cells were isolated from WT C57BL/6
(B6), FceRIa"'" (a"/_), hmFceRIa Tg (aTg), or hmFceRlaß Tg (aß) mice. Controls (A) as well as
analysis of hmFceRIa (B) and hmFceRlaß (C) Tg mice are depicted. H20 was used as negative
control. The size of each PCR product is indicated. The 100 bp Ladder (L) was used for the size
marker and the 500 bp band is indicated. Results are representative of two to four separate
experiments.
64 Results Part II
Northern blot analysis of FcsRI expression in hmFcsRIaß Tg mice
To provide a quantitative method to investigate mRNA expression of the high affinity IgE
receptor, Northern blot analysis for FcsRIa expression was developed. Initially, Northern
blot analysis was used to quantify FcsRIa expression levels in different hmFcsRIa Tg lines
derived from founders 2, 3, and 14 (Figure 13A). The Tg line with the highest FcsRIa
expression was identified (founder 3) and this line was then crossed with hmFcsRIß Tg
mice to generate double transgenic mice.
Northern blot analysis was also performed in order to confirm the RT-PCR results showing
that the murine a chain gene was expressed in hmFcsRIa and hmFcsRIaß Tg mice in the
same cells as found in humans. mRNA of the a chain of the receptor was detected in
splenic dendritic cells from both hmFcsRIa and hmFcsRIaß Tg mice, as indicated by the
presence of a 1 kb band corresponding to the 1005 bp of the murine FcsRIa mRNA (Ra et
al., 1989) (Figure 13B). 18 S rRNA bands were also observed due to unspecific binding of
the probe and could be eliminated by more stringent washing (data not shown). However,
as they served as a convenient internal control for the amount of loaded RNA they were not
routinely washed away. Contrary to what was observed by RT-PCR no expression of
FcsRIa was observed in macrophages of either single or double Tg mice. The lack of
detection by Northern blot analysis is likely to be due to sensitivity of this assay. It is
possible that the levels of FcsRIa expression in macrophages may be lower than in
dendritic cells and therefore detectable only by RT-PCR and not by Northern blot. As
Northern blot analysis requires large cell numbers to obtain sufficient RNA, investigation
of other cell types, such as Langerhans' cells and eosinophils, could not be performed due
to limited availability of the transgenic mice.
Results Part II 65
SpIDC BMMC
2a 2b 14a 14b B6 B6
Kb
1.77«
1.28-
18 S rRNA
FceRIa
1005 bp
B
B6
M4>
aTg aßTg
SpIDC
B6 aTg aßTg
Kb
1.77«
1.28-
18 S rRNA
FceRIa
1005 bp
Figure 13. Northern blot analysis of FceRIa expression. FceRIa expression levels in splenic
dendritic cells (spl DC) purified from hmFceRIa Tg lines derived from founders 2, 3, and 14 were
investigated using a FceRla-specific radioactive probe (A). Thioglycollate-induced peritoneal
macrophages (MO) and naïve spl DC purified from WT C57BL/6 (B6), hmFceRIa Tg (aTg), or
hmFceRlaß Tg (aßTg) mice were equally analyzed (B). BMMC from WT C57BL/6 mice were used
as positive control. The 18 S rRNA bands reflect the amount of loaded RNA. The 0.16-1.77 Kb RNA
Ladder was used as marker and the positions of the 1.77 Kb and 1.28 Kb bands are indicated.
Results are representative of two (A) or four (B) separate experiments.
66 Results Part II
Western blot analysis of FcsRI expression in hmFcsRIaß Tg mice
The results presented thus far confirmed mRNA expression of FcsRI in hmFcsRIaß Tg
mice. We next investigated whether the mRNA was also transcribed into protein in the
different cell types of the transgenic mice. For this purpose a method for Western blot
analysis of the murine high affinity IgE receptor was developed and tested on mast cells. To
assess cytosolic proteins, cells were lysed and lysates were immunoprecipitated with a
monoclonal anti-mouse FcsRIa antibody to subsequently identify proteins that were bound
to and therefore co-immunoprecipitated with FcsRIa. Precipitated proteins were then
analyzed for the presence of FcsRIß and FcsRIy by probing with specific antibodies against
the ß and y chains of FcsRI. This method allowed demonstration of the presence of the ß
and y chains and their association with the a chain. As expected, both the ß (Figure 14A)
and y (Figure 14B) chains were found to be associated with the a chain in the mast cell line
MC/9 as well as in BMMC of WT mice. Importantly, anti-a chain antibody-mediated
immunoprecipitation of BMMC lysates derived from FcsRIa-deficient mice did not reveal
the presence of neither ß nor y chains, indicating the specificity of the co-precipitation of
the ß and y chains. Thus far we did not succeed in detecting the presence of the a chain in
cell lysates by probing membranes containing fractionated proteins with a specific anti-
FcsRIa antibody. This may be due to conformational changes induced in FcsRIa while
running the samples on a reducing SDS-gel or transferring them to nitrocellulose
membranes. Such conformational changes may mask or destroy binding sites of the anti-
FcsRIa antibody and therefore inhibit its binding to the a chain.
Analysis of peritoneal macrophages and splenic dendritic cells derived from either
hmFcsRIa or hmFcsRIaß Tg mice did not reveal co-precipitation of the ß nor the y chain
with the a chain of FcsRI (Figure 14C). Weak detection of a protein corresponding to the
size of the y chain in the macrophage samples was present, as shown by the weak bands in
the lower panel of Figure 14C. However, this protein was also detected in macrophages
isolated from FcsRIa-deficient mice, suggesting that the detected band did not result from
co-immunoprecipitation with the a chain. It is possible that this band reflects non-specific
binding of the anti-y antibody to a protein present in macrophages. Alternatively, this band
may indicate the ability of the y chain from macrophages to non-specifically "stick" to the
sepharose beads used in the immunoprecipitation. Thus, although we could detect mRNA
Results Part II 67
expression of the subunits composing the high affinity IgE receptor in macrophages and
dendritic cells of the generated transgenic mice, we were not able to show their association
at the protein level. Importantly, this method was based on immunoprecipitation with
FcsRIa leaving it open whether the absence of FcsRI protein detection in the Tg mice was
due to lack of a chain protein expression in the peritoneal macrophages and dendritic cells
of the Tg mice or to the lack of receptor complex formation in these cells. Alternative
approaches may be envisaged to answer this question and possibly demonstrate the
presence of FcsRI complexes in the cells of hmFcsRIa and hmFcsRIaß Tg mice.
Therefore, we are currently developing methods for Western blot analysis where cell
lysates are immunoprecipitated with either the ß or the y chain of FcsRI and fractionated
proteins are subsequently probed with specific antibodies against the a, ß, and y chains of
the receptor.
Taken together, further investigation is required to determine whether translation of the
FcsRI chains from mRNA into protein or their association into receptor complexes was
inhibited in the targeted cells of hmFcsRIa and hmFcsRIaß Tg mice. Furthermore, it is
possible that the expression level of FcsRI in the transgenic mice is below the detection
limit of the Western blot, implying that additional assays are required to confirm the data.
68 Results Part II
B
BMMC
kDa
50 —
37 —
25 —
20 —
15 —
10 —
MC/9
FceRIß"32kD
BMMC
kDa B6 a-'-
50 ¥
37 -- *
#1ï
25 ,
20—f},
-
15 /;""
* J" ''
i
10— A"
MC/9
Vm. 1
FceRIy'9 kDa
MO spl DC
kDa MC/§ B6 a aß or'- B6 a aß a-/_
37
»-• FceRIß", 32 kDa
20"
-
15
il,10—
-%§ iii?-
1 '•,
*, _
1'
37-
25-
20-
15-
10-
'r
- -
§*-itsitf
..* !FceRIy9 kDa
Figure 14. Immunoprecipitation and Western blot of FceRI. Digitonin-solubilized protein extracts
were prepared from the mast cell line MC/9, BMMC, thioglycollate-induced peritoneal macrophages
(MO) or naïve splenic dendritic cells (spl DC) isolated from WT C57BL/6 (B6), hmFceRIa Tg (a),
hmFceRlaß Tg (aß) or FceRla-deficient (a"/_) mice. Immunoprecipitation was carried out with anti-
mFceRIa Ab and co-precipitation of ß and y chain proteins was analyzed by Western blot using
antibodies specific for the mFceRIß and mFceRly. The molecular mass is indicated in Kilodaltons.
Results are representative of four (mast cells) or one (MO and DC) separate experiments.
Results Part II 69
FACS analysis of FcsRI expression in hmFcsRIaß Tg mice
To further investigate whether hmFcsRIaß Tg mice express FcsRI, flow cytometry
analysis was performed to detect both intra- and extracellular protein expression of FcsRIa.
In contrast to the Western blot analysis, which detects the association of the receptor
subunits, this approach provides direct information on the presence of translated FcsRIa.
Several different cell types were isolated from WT C57BL/6, hmFcsRIa Tg, and
hmFcsRIaß Tg mice and FcsRIa expression was assessed on each cell population. In
contrast to BMMC, which were found to express high amounts of the receptor (Figure 15,
top panel), FcsRIa protein expression was not detected in macrophages, Langerhans' cells
or dendritic cells isolated from naive hmFcsRIa or hmFcsRIaß Tg mice (Figure 15, middle
panel).
A positive correlation between FcsRI cell surface expression and serum IgE concentrations
has been shown previously (Yamaguchi et al., 1997). The mechanisms controlling
upregulation of FcsRI by IgE involve receptor stabilization at the membrane and continued
basal synthesis of receptors (Borkowski et al., 2001). It has also been reported that in
humans FcsRI expression on APCs is greatly upregulated in atopic individuals, which are
characterized by high levels of IgE (Maurer et al., 1994; Novak et al., 2003b). Therefore, it
was possible that the inability to detect expression of FcsRI in APCs isolated from
hmFcsRIa and hmFcsRIaß Tg mice may reflect the lack of significant levels of serum IgE.
Thus, in order to achieve maximal expression of FcsRI we attempted to induce high levels
of serum IgE in the transgenic mice prior to cell isolation. Mice were therefore infected
with the nematode Nippostrongylus brasiliensis, which is known to induce up to 1000-fold
increase in total serum IgE (Finkelman et al., 1988). Cells were then isolated 15 days
following iV. brasiliensis infection when IgE levels had reached a peak of 1769 ng/ml
(±166.7 SEM, n=50). Besides macrophages, dendritic cells, and Langerhans' cells, FcsRIa
expression was additionally investigated in eosinophils isolated from BAL of iV.
brasiliensis-'mfected mice. However, despite the presence of high levels of serum IgE,
FcsRIa expression could not be detected in any of the analyzed cells (Figure 15, lower
panel).
70 Results Part II
BMMC(CD117+)
i 'I
i p.
C57BL/6
FcsRIa-'-
,! I
Isotype control
: ,- \
Spl DC(CD11c+) LN DC (CD11 c+) LC (MHCII+)MO(CD11b+)
fi
f\ |1 C57BL/6
>
'reC
! i
I jil i
l" \
11,i i
? I » \
aTg
aßTg
J i^ 1 \\i \
eos(GR-1+)
c
.0)
'552-Q
i
il 11
\\i Ï
1M
fi
I!li
j
« tI s
S 11 ./ 1^
; \ j\
FcsRIa
Figure 15. Intracellular FACS analysis of FcsRIa expression. BMMC, thioglycollate-induced
peritoneal macrophages (MO), splenic dendritic cells (spl DC), DC from lymph nodes (LN DC),
Langerhans' cells (LC), and eosinophils (eos) from the BAL isolated from either naïve or N.
Jbras;'/;'ens;'s-infected WT C57BL/6 (black), hmFceRIa Tg (aTg, green), or hmFceRlaß Tg (aßTg, red)
mice were analyzed for FceRIa expression by intracellular flow cytometry. Cells were gated for the
specific cell type markers of each cell population as indicated in brackets. Control stains were
performed using BMMC from FceRIa"'" (blue) and with an isotype control antibody (grey). Results
are representative of three (naïve) or two (A/. Jbras;'/;'ens;'s-infected) separate experiments.
These data therefore suggest that although there is expression of the a chain of FcsRI at the
mRNA level, there does not appear to be expression of FcsRIa protein in the analyzed cells
from either hmFcsRIa or hmFcsRIaß Tg mice. Intracellular FACS analysis should allow
detection of both intracellular FcsRIa protein expression and FcsRIa expressed on the cell
surface as part of the receptor complex. Thus, these results could be explained by a
potential inhibition of the translation of FcsRIa in macrophages, dendritic cells,
Langerhans' cells, and eosinophils of the generated transgenic mice. The reason for such
inhibition remains to be determined. Alternatively, it is possible that the a chain is
translated into protein but then retained in the endoplasmic reticulum (ER) and rapidly
Results Part II 71
degraded, which would hinder its detection by FACS. The retention in the ER could be due
to incomplete interactions of the ß with the a chain, which in mice is required to release
FcsRIa from the ER (Ra et al., 1989). Possible mutations in the transgene could lead to
structural changes of the receptor chains inhibiting their interactions. Thus, sequence
analysis of the transgenic FcsRI may provide further insight into the factors responsible for
the absence of FcsRI protein expression in hmFcsRIaß Tg mice.
Immunofluorescence analysis of FcsRI expression in hmFcsRIaß Tg mice
Although the data from flowcytometry suggested that FcsRIa protein was not expressed in
the targeted cells of hmFcsRIa and hmFcsRIaß Tg mice, we decided to confirm these
results by an additional method. For this purpose cytospins of several cell types isolated
from WT C57BL/6, hmFcsRIa or hmFcsRIaß Tg mice were investigated for FcsRIa
protein expression by immunofluorescence. To begin with the method was tested on
BMMC from WT C57BL/6 and FcsRIa""
mice, which were used as positive and negative
controls, respectively. The results showed clear expression of the mast cell marker CD117
on both cell types, while FcsRIa expression was detected only on WT cells (Figure 16A).
However, no FcsRIa expression could be detected in macrophages, dendritic cells, or
Langerhans' cells isolated from either WT or transgenic mice as shown by fluorescence
comparable to background levels (Figure 16B). As not all cell surface maker antibodies
were available for immunofluorescence analysis, the purity and viability of each cell
sample was confirmed by FACS prior to preparation of the cytospins. Analysis of FcsRIa
expression in cells isolated from iV. brasiliensis-mfected mice equally revealed only
background levels of fluorescence (data not shown), implying that even in presence of high
serum IgE levels no detectable FcsRIa expression was induced.
Taken together, these results are consistent with the FACS data leading to the conclusion
that despite of significant FcsRIa mRNA expression in the targeted cells of hmFcsRIa and
hmFcsRIaß Tg mice no a chain protein could be detected.
72 Results Part II
A CD117 FceRIa DAPI Merge
B I» spl DC LNDC LC
aßTg
Figure 16. Immunofluorescence of cytospins. Cytospins of BMMC isolated from WT C57BL/6
(B6) and FceRIa"'" (a"'") mice were analyzed for CD117 and FceRIa expression using specific
fluorescent antibodies; nuclei were stained with DAPI (A). FceRIa expression was investigated in
thioglycollate-induced peritoneal macrophages (MO), splenic dendritic cells (spl DC), dendritic cells
from lymph lodes (LN DC), and Langerhans' cells (LC) isolated from WT C57BL/6 (B6), hmFceRIa
Tg (aTg) or hmFceRlaß Tg (aßTg) (B). Results are representative of two separate experiments.
Results Part II 73
Immune response of hmFcsRIaß Tg mice to Nippostrongylus brasiliensis infection
hmFcsRIa and hmFcsRIaß Tg mice were infected with the nematode parasite iV.
brasiliensis to induce high serum levels of IgE and to drive maximal FcsRI expression.
Additionally, the immune response of the transgenic mice to iV. brasiliensis was assessed.
This approach was based on the hypothesis that the presence of FcsRI on the surface of
APCs or eosinophils could provide mechanisms leading to a more efficient immune
response against the parasite. For example, FcsRI-mediated antigen uptake by APCs could
lead to enhanced antigen presentation and therefore increased T cell activation.
Furthermore, activation of eosinophils via FcsRI could improve killing of the parasitic
larvae during their passage through the lung. Thus, the level of protection against iV.
brasiliensis was assessed in hmFcsRIa and hmFcsRIaß Tg mice and compared to that in
WT C57BL/6 mice.
Within 10 days post iV. brasiliensis infection total serum IgE levels increased greatly and
remained high in both WT and transgenic mice (Figure 17A). There was no significant
difference in the kinetics nor magnitude of IgE induction between WT and transgenic mice.
Peripheral blood eosinophil levels were also investigated as N brasiliensis infection is
known to induce blood and tissue eosinophilia, which has been suggested to play a role in
host protection and expulsion of the parasite (Shin et al., 1997). The percentage of
eosinophils in the blood started to increase at day 7 post infection and reached a peak of
about 10% around day 15 (Figure 17B). Comparable results were observed for WT as well
as hmFcsRIa and hmFcsRIaß Tg mice. In WT mice the immune response induced by iV.
brasiliensis leads to expulsion of the worms within two weeks after infection. During that
period infecting larvae develop into the adult stage within the gut lumen and produce eggs
that are expelled via the fecal pellets. The numbers of eggs in the feces are inversely
proportional to the strength of the protective immune response. Fecal worm egg counts
were therefore monitored in iV. brasiliensis-'mfected WT as well as hmFcsRIa and
hmFcsRIaß Tg mice. Comparable worm egg numbers and comparable kinetics of worm
expulsion were found between WT and both Tg mouse strains (Figure 17C). The eggs
found in hmFcsRIaß Tg mice had a slightly delayed onset and were cleared one day
earlier, however, data of several experiments showed no significant difference between the
analyzed mouse strains indicating the they had a comparable degree of protection to iV.
74 Results Part II
brasiliensis. Although our results were variable, especially the range of eosinophilia and
egg counts was very wide, repeated iV. brasiliensis injections demonstrated that the overall
response did not differ between WT, hmFcsRIa, and hmFcsRIaß Tg mice.
A
B
C
5 6 7 8 9 10 11
Days post Nb infection
Figure 17. Nippostrongylus brasiliensis (Nb) infection of hmFceRlaß Tg mice. C57BL/6
(closed circles), hmFceRIa Tg (open triangles), and hmFceRlaß Tg (open squares) mice were
infected with 550 Nb L3 larvae on day 0. Blood was collected on several time points after infection
(as indicated) and total serum IgE levels (A) and blood eosinophilia (B) were determined. The data
points represent the mean + s.d. of 3-5 mice per group. The dotted line in A indicates the lower limit
sensitivity (0.7 ng/ml) of the IgE ELISA. Numbers of Nb eggs per gram feces were monitored for
each mouse strain (C). Results are representative of five separate experiments.
• C57BL/6
A hmFceRIa
D hmFceRlaß
30'000
ra 20'000
5»o>mœ
10'000
Results Part II 75
It is possible that FcsRI expressed on APCs may only play a role in secondary parasite
infections, where IgE produced during the primary response has already bound to the
receptor. To investigate this hypothesis we performed a booster infection of iV. brasiliensis
ten weeks after the primary infection. Analysis of IgE serum levels during the secondary
immune response did however not reveal any significant differences between WT,
hmFcsRIa, and hmFcsRIaß Tg mice (data not shown).
76 Results Part II
3.5 Discussion
FcsRI transgenic mice were generated to provide a novel tool for the investigation of
various aspects of the biology of the high affinity IgE receptor. Using the human FcsRIa
promoter we generated transgenic mice with the aim of expressing the murine FcsRI on the
same cell types as demonstrated for the human FcsRI. We first generated hmFcsRIa Tg
mice that express the murine a chain of the receptor under control of the human FcsRIa
promoter. Although previously reported transgenic mice generated with the same technique
but using the human a chain of the receptor have been shown to express the ay2-trimeric
receptor complex (Dombrowicz et al., 1998), in the present approach important species
differences between the murine and human FcsRIa chain had to be considered, such as the
different requirements for receptor surface expression. Transfection studies had previously
demonstrated that the murine a chain contains endoplasmic reticulum (ER) retention
signals located in the cytoplasmic tail (Letourneur et al., 1995a). The other chains of the
FcsRI complex appear to prevent retention and degradation of the a chain in the ER by
masking the ER retention signals and allowing export of the receptor to the Golgi apparatus
and subsequently to the plasma membrane. While the y chain has been shown to be
sufficient to mask the ER retention signals of the human a chain, the murine a chain
requires both the ß and y chains to allow receptor release from the ER (Ra et al., 1989).
Therefore, in order to achieve surface expression of FcsRI in hmFcsRIa Tg mice, we were
obliged to induce expression of the ß chain in the cell types that express the transgenic a
chain. For this purpose, hmFcsRIß Tg mice were generated. Nevertheless, even after
crossing the hmFcsRIa and hmFcsRIß strains together to obtain double transgenic mice,
detectable levels of receptor expression could not be found in antigen presenting cells. This
result was unexpected as FcsRI mRNA expression was observed in these cells. Several
reasons for the lack of detectable protein expression of the high affinity IgE receptor in the
generated transgenic mice can be considered. First, a considerable difference in the
expression density of FcsRI between the classical IgE effector cells (mast cells and
basophils) and other FcsRI-expressing cells has been reported (Donnadieu et al., 2000). It
was therefore possible that very low expression levels of the receptor in the targeted cells of
our transgenic models could have prevented us from detecting the receptor by commonly
Results Part II 77
used methods. However, this expression density difference has been accredited to the lack
of the ß chain on cells other than mast cells and basophils, which was overcome in our
approach by additional generation of hmFcsRIß Tg mice. Second, as Western blot analysis
did not show any association of the receptor chains, it can be speculated that regardless of
the addition of the ß chain to the system, the receptor complex might still be retained and
degraded in the ER. Additional analysis, such as confocal microscopy, would be required to
determine the exact location of the FcsRI chains in the cytosol. Moreover, to generate the
hmFcsRIß Tg strain rather than using the genomic sequence of FcsRIß for the transgene
construct, ß chain cDNA was employed. Thus, it cannot be excluded that the absence of
normally occurring mRNA maturation events, such as splicing, could modify the cell
processes and prevent the transgene from being translated. Lack of the ß chain would
consequently lead to degradation of the a chain in the ER. Lastly, it has to be envisaged
that mRNA of both the a and ß FcsRI chains detected by RT-PCR or Northern blot may
have not been translated into protein. This would explain the complete lack of FcsRIa
detection by both surface and intracellular FACS analysis. At the moment we do not have
an explanation for the absence of FcsRI translation. Many factors are involved in the
machinery of gene expression and translation and can account for absence of an expected
phenotype in transgenic mouse models. Mutations of the sequence could inhibit transgene
expression. Therefore, we are currently analyzing the mRNA sequences of the a and ß
chains in macrophages of hmFcsRIaß Tg mice.
iV. brasiliensis infection did not reveal any differences in protection against the parasite
between WT and hmFcsRIaß Tg mice. This may obviously be due to the lack of FcsRI
protein expression in the Tg mice. However, it is also important to evaluate whether iV.
brasiliensis infection was the appropriate model to investigate hmFcsRIaß Tg mice.
Clearance of iV. brasiliensis has been suggested to be IgE-independent (Watanabe et al.,
1988) and may therefore not involve FcsRI-mediated mechanisms. This would easily
explain the absence of differences in protection against iV. brasiliensis between WT and
hmFcsRIaß Tg mice. Thus, additional models should be investigated to analyze the
immune response in hmFcsRIaß Tg mice, such as parasite infections where IgE is required
for protection (e.g. T. spiralis (Gurish et al., 2004)).
78 Results Part II
Taken together, we generated two mouse models, the hmFcsRIa and the hmFcsRIß Tg
mice, which were crossed together to obtain double transgenic hmFcsRIaß mice. Although
presence of the transgenes was detected in the genomic DNA of all these models and their
mRNA expression was shown in the targeted cell types, no detectable protein expression
was observed. Additional investigation is required to determine the exact reason for lack of
protein expression in order to modify the transgenic mice and to enable them to be suitable
models for investigation of the role of FcsRI expression on APCs and eosinophils.
Results Part III 79
4 Results Part III
Generation of a muFcsRIa-huIgGiFc fusion protein
4.1 Abstract
Studies investigating the interaction of IgE and its high affinity receptor, FcsRI, have
revealed novel functions and expression patterns of FcsRI. Mouse models have been
widely used to study the downstream effects of IgE binding to FcsRI and their impact on
immune responses. However, the lack of a specific anti-mouse FcsRIa antibody hampers
investigations of the role of FcsRI in mice. Here we describe the successful generation of a
fusion protein composed of the extracellular domain of murine FcsRIa and the human IgGi
Fc domain. This fusion protein was used for immunization of FcsRIa"" mice in an attempt
to induce production of anti-mouse FcsRIa antibodies.
80 Results Part III
4.2 Introduction
Cell surface receptors for immunoglobulin (Ig) Fe regions, Fe receptors (FcRs), are
involved in a broad range of tasks within the immune system and are important regulators
of immune responses by inducing either activation or inhibition of cellular effector
functions. FcRs are widely expressed on various hematopoietic cells allowing interactions
of the Fc domain of antibodies with many specialized cells leading to a diverse range of
immune responses (Daeron, 1997). Thus, FcRs are able to provide a link between humoral
and cell-mediated immunity. The functions of FcRs can be divided into three groups
(Takai, 2002). First, the most important function of FcRs is the regulation of cellular
immune responses. Triggering of FcRs leads to biological events such as degranulation of
mast cells (Metzger et al., 1986), phagocytosis by macrophages (Anderson et al., 1990),
proliferation of B lymphocytes (Phillips and Parker, 1983), or induction of cytokine and
chemokine expression (Turner and Kinet, 1999). Although most FcRs induce activating
signals through immunoreceptor tyrosine-based activation motifs (ITAMs), there is one
inhibitory FcR, FcyRIIB, which contains in its cytoplasmic domain an inhibitory motif
(ITIM) allowing down-regulation of many of the above cited effector responses (Ravetch
and Bolland, 2001). Second, FcRs play an important role in internalization of immune
complexes leading to enhanced antigen presentation (Regnault et al., 1999). The third
major function of FcRs involves transcellular transfer of Igs, such as transplacental transfer
of maternal IgG (Simister and Mostov, 1989) or transfer of IgA to mucosal surfaces
(Phalipon and Corthesy, 2003).
Two Fc receptors for IgE have been identified, the high affinity IgE receptor, FcsRI, and
the low affinity IgE receptor, FcsRII (CD23). FcsRI is the major surface molecule involved
in induction of allergic diseases (Kinet, 1999). Initially it was believed that the sole role of
FcsRI was to induce immediate-type hypersensitivity reactions through allergen/IgE-
mediated crosslinkage on the surface of mast cells and basophils. However, in the last
decade evidence has accumulated that in humans FcsRI is expressed not only on mast cells
and basophils but also on Langerhans' cells (Bieber et al., 1992; Wang et al., 1992),
monocytes (Maurer et al., 1994), eosinophils (Gounni et al., 1994), peripheral blood
dendritic cells (Maurer et al., 1996), and platelets (Joseph et al., 1997). More recent
investigations have shown that even in the absence of specific antigen, binding of
Results Part III 81
monomeric IgE to FcsRI can induce signals leading to FcsRI upregulation (Yamaguchi et
al., 1997) and mast cell survival (Asai et al., 2001; Kalesnikoff et al., 2001). These novel
findings have shed new light on the functions of FcsRI and increased the interest in this
receptor.
In order to investigate surface expression of FcsRI in humans, several monoclonal
antibodies (mAbs) against the human a chain of the receptor have been generated (Rigby et
al., 2000; Riske et al., 1991; Wang et al., 1992). However, the lack of a mAb against the
murine FcsRIa makes it difficult to study specific FcsRIa expression in mouse models.
Binding of labeled IgE has traditionally been used to study expression of the muFcsRI, but
since IgE binds also to the low affinity receptor, CD23 (Delespesse et al., 1992), and an
additional receptor, Mac-2 (Cherayil et al., 1989; Frigeri and Liu, 1992), specific muFcsRI
binding cannot be observed. Therefore, the objective of the present study was to generate a
mAb against the murine a chain of the high affinity IgE receptor (muFcsRIa). As a first
step, we generated a fusion protein composed of the extracellular domain of muFcsRIa and
the human IgGi Fc domain (hulgGiFc). HulgGiFc allowed isolation of the fusion protein
via a protein A column. In this report we describe the successful production and isolation of
the muFcsRIa-huIgGiFc fusion protein as well as the results obtained from immunizations
of FcsRIa""
mice with the muFcsRIa-huIgGiFc fusion protein.
82 Results Part III
4.3 Materials and Methods
Bone marrow-derived mast cell (BMMC) culture
Femur and tibia bones were collected from C57BL/6 mice and bone marrow cells were
flushed out with BSS. Cells were washed and resuspended at an initial concentration of 106
cells/ml in FMDM containing 10% FCS, 50 uM 2-Mercaptoethanol, 20 ng/ml recombinant
mouse stem cell factor (SCF, R&D Systems), and 5% X63-IL-3 cell-conditioned medium
corresponding to about 5 ng/ml IL-3. Cells were maintained in tissue culture petri dishes at
20 ml/dish in a humidified incubator at 37°C with 5% C02. Non-adherent cells were
initially transferred to new dishes every other day, later once a week and subsequently
expanded as necessary. Fresh SCF and IL-3 were provided weekly. 6 week cultures
contained >80% mast cells confirmed by FACS analysis of CD117 expression.
Generation of muFcsRIa-huIgGiFc fusion protein
Total RNA was isolated from bone marrow-derived mast cells using TRIzol reagent
(Invitrogen Life Technologies). First-strand cDNA synthesis from 1 ug total RNA was
performed using random hexamers and SuperScript II reverse transcriptase (Invitrogen Life
Technologies). A 631 bp fragment encoding the extracellular domain of the muFcsRIa
gene was amplified using primers FcsRIaNhe 5'-
CTAGCTAGCATGGTCACTGGAAGGTCTG-3' and FcsRIaXba 5'-
GCTCTAGAAGTTGTAGCCAATAATACTTGC-3' (94°5'; [94°1'; 54°30"; 72°l']x35;
72° 10'; 10°). These primers introduce Nhe I and Xba I restriction sites respectively, both of
which were utilized for the cloning strategy. The PCR-product was purified from a 1%
agarose gel using the QIAquick gel extraction kit 250 (Qiagen). The isolated fragment was
subcloned into pGEM-T (Promega) and transformed into XL-1 blue competent bacteria.
Plasmid DNA was isolated from single colonies grown on agar-LB/ampicillin plates using
the QIAprep Spin Miniprep kit (Qiagen). Restriction digestion with Nhe I and Xba I
(Roche) was performed to select for clones containing the FcsRIa DNA insert. Positive
clones were sequenced and checked for mutations. Sequences were compared with the
mRNA sequence of the murine FcsRIa (NCBI: NM010184) (Ra et al., 1989). The FcsRIa
DNA with the correct sequence was then excised from plasmids by Nhe I and Xba I
restriction digestion and ligated into the pCMVKanaRFcB7H expression vector (kindly
Results Part III 83
provided by J. Weber, Zürich) containing the sequence coding for the Fc portion of the
human IgGi. Prior to ligation, the pCMVKanaRFcB7H vector was also digested with Nhe I
and Xba I in order to replace the B7H fragment with the FcsRIa gene. The resulting
pCMV-KanaR-muFcsRIa-huIgGiFc vector was then transformed into XL-1 blue competent
bacteria. Plasmid DNA was isolated from colonies grown on agar-LB/kanamycin plates and
restriction-digested with Nhe I and Xba I as described above. Positive colonies were
confirmed by sequencing. Three samples of pCMV-KanaR-muFcsRIa-huIgGiFc plasmid
DNA were selected for transfection. Unless stated otherwise, all procedures were
performed according to the manufacturer's instructions.
Transfection
HEK293T human embryonic kidney cells were cultured in DMEM containing 10% FCS
and 50 uM 2-Mercaptoethanol. For transfection, 3-4xl06 cells were incubated in 25 uM
Chloroquine (7-Chloro-4-[4-diethylamino-l-Methyl-butylamino] Quinoline) (Sigma) for 1
hour at 37°C. DNA (1 ug GFP/hygR and 10 ug pCMV-KanaR-muFcsRIa-huIgGiFc
expression vectors) was prepared in 1 ml 250 mM CaCb, added dropwise to 1 ml 2xBBS
(BES-buffered solution) and incubated 2-5 min. Cells were supplemented with 10 ml fresh
medium and mixed gently with the DNA solution. After 8 hours of incubation at 37°C
medium was exchanged to remove the CaCl2 DNA solution. For stable transfection, cells
were cultured in presence of 200 ug/ml Hygromycin B.
ELISA
ELISA plates were coated with 1.6 ug/ml goat anti-human IgG (Jackson ImmunoResearch
Laboratories) in 0.1 M NaHC03 (pH 9.6) overnight at 4°C and then blocked with 5% (w/v)
bovine serum albumin (BSA). For detection of the muFcsRIa-huIgGiFc fusion protein in
supernatant of transfected HEK293T cells, serially diluted supernatant was added and
incubated for 2 hours. Detection of bound muFcsRIa-huIgGiFc was performed by adding
horseradish peroxidase (HRPO)-conjugated goat anti-human IgG (Jackson
ImmunoResearch Laboratories) at 0.8 ug/ml for 1 hour. For detection of anti-muFcsRIa-
huIgGiFc antibodies in serum of immunized mice or in supernatant of hybridoma, the
muFcsRIa-huIgGiFc fusion protein or a control hulgGiFc fusion protein at 10 ug/ml was
added to plates coated with goat anti-human IgG and incubated for 1 hour. Thereafter,
84 Results Part III
serially diluted sera or hybridoma supernatants were incubated for 2 hours, followed by
incubation of HRPO-conjugated goat anti-mouse IgG (Sigma) at 1 ug/ml. ABTS
peroxidase solution (2,2'-azino-bis-[3-ethylbenzthiazidine-6-sulfonic acid] 0.1 mg/ml,
0.05%) H202, and 0.1 M NaH2P04 pH 4.0) was used for the peroxidase-catalyzed color
reaction. Color reaction was read at 405 nm in a Bio-Rad microplate reader.
Western blot
Transfected HEK293T cells were grown in serum-free InVitrus medium (R&D Laboratory)
for 3 days and supernatant from a confluent T25 flask was collected by centrifugation (15
min, 4000 RPM). 25 ul protein A sepharose CL-4B (Pharmacia Biotech) was added per 1
ml supernatant and incubated on a rotor at 4°C overnight. Sepharose beads were then
washed twice with PBS and samples denaturated by incubating for 5 min at 95°C in SDS
reducing loading buffer. After centrifugation (3 min, 13000 RPM) proteins were separated
on 10%) SDS-polyacryamide Tris gels (Bio-Rad Laboratories) and then electrotransferred to
Protran nitrocellulose membranes (Schleicher&Schuell) using a semi-dry transfer unit
(SemiPhor Hoefer). Membranes were blocked in 4% milk/PBS overnight at 4°C and probed
with HRPO-conjugated goat anti-human IgG antibody (Caltag Laboratories) at 0.7 ug/ml
for 2 hours. Revelation was performed using SuperSignal West Pico Chemiluminescent
Substrate (Pierce) according to the manufacturer's instructions.
Flow cytometry
To analyze the presence of anti-muFcsRIa antibodies in sera of immunized mice or
supernatants of generated hybridoma, BMMC were incubated with 1:2 diluted sera or
supernatants for 20 min on ice. Thereafter cells were surface-stained with anti-mouse IgG-
FITC (2.5 ug/ml, Caltag Laboratories) and anti-mouse CD117-PE (0.7 ug/ml, BD
Biosciences). To test for expression of FcsRIa on BMMC, cells were incubated with
mouse IgE (clone RIE4) at 50 ug/ml and stained thereafter with anti-mouse IgE-FITC (20
ug/ml, Southern Biotechnology). Cells were aquired in a FACS Calibur (BD) and analyzed
using FlowJo software.
Results Part III 85
Mice
C57BL/6 mice were bred and maintained at the Institute of Laboratory Animal Science of
the University of Zurich. FcsRIa"" mice (Dombrowicz et al., 1993) were kindly provided
by Jean-Pierre Kinet, Boston, USA.
Immunization
muFcsRIcc-huIgGiFcfusion protein injections:
FcsRIa"" mice were tolerized against human IgGi by an i.v. injection with 500 ug of
human IgGiK (Sigma). Two weeks later an initial immunization with 20 ug muFcsRIa-
huIgGiFc fusion protein in complete Freund's adjuvant (CFA) s.c. was administrated
followed by five booster immunizations at 2-week intervals: four with 20 ug muFcsRIa-
huIgGiFc fusion protein in incomplete Freund's adjuvant (IFA) s.c. and one with 50 ug
muFcsRIa-huIgGiFc fusion protein in IFA i.p.. A final immunization with 50 ug
muFcsRIa-huIgGiFc fusion protein in PBS i.p. was administrated 1 day after the last boost.
Mast cells injections:
FcsRIa"" mice were immunized five times with 106-107 BMMC in PBS i.p. at 2-week
intervals. A final immunization with 106 BMMC in PBS i.v. was administrated 1 day after
the last boost.
For both immunization protocols, splenocyte fusion to myeloma cells was performed 3
days after the final immunization.
Hybridoma production
Spleens of immunized animals were isolated and single cell suspensions prepared. 2xl07
splenocytes and 2xl07 cells of the mouse myeloma cell line X63AG8.653 were mixed.
Fusion was induced by adding 1% PEG 4000 (Polyethylenglycol, Merck) in BSS to the cell
pellet at 37°C. After fusion, cells were resuspended in pre-warmed HAT-IMDM medium
(Hypoxanthine-Aminopterine-Thymidine, Gibco) and distributed into 96-well plates
containing peritoneal macrophages isolated from C57BL/6 mice and plated one day before
fusion. Hybridoma colonies were detectable 7-10 days after fusion and screening of
supernatant was performed once medium had turned orange.
86 Results Part III
4.4 Results
Cloning of the fusion gene muFcsRIa-huIgGiFc
The initial objective of the present study was to generate a fusion protein composed of the
extracellular domain of the murine a chain of the high affinity IgE receptor (muFcsRIa)
and the Fc portion of the human IgGi (hulgGiFc). The hulgGiFc was added to the
muFcsRIa protein to enable isolation of the expressed protein via binding to a protein A
column. To achieve expression of the muFcsRIa-huIgGiFc fusion protein, the sequences
coding for both the muFcsRIa extracellular domain and the hulgGiFc fragment were
cloned together into an expression vector (pCMV-KanaR). To obtain the muFcsRIa
sequence, bone marrow-derived mast cells (BMMC) from C57BL/6 mice were prepared
and total RNA was isolated from the cultured cells, which had been tested for purity by
CD117 expression analysis and of which FcsRIa expression was confirmed by IgE binding
(Figure 18A). The extracellular domain of the murine a chain of the high affinity IgE
receptor was then amplified using specific primers, which also introduced restriction sites
for the enzymes Nhe I and Xba I. As shown in Figure 18B, the primers aligned in exon 1
and exon 5 of the muFcsRIa gene yielding a PCR-product of 631 bp. The PCR-product
was then subcloned into the pGEM-T vector and transformed into XL-1 blue competent
bacteria. Single clones containing the insert were identified by restriction digestion using
Xba I and Nhe I and then sequenced. Three samples (4c, 5b, 8a) with the correct sequence
of muFcsRIa were then cloned into the pCMV-KanaR-huIgGiFc expression vector
containing the hulgGiFc (Figure 18C).
Results Part III 87
-24.1 75.3 99.2 0.054
Q
O
m m
0.42 0.11 0.67
IgE + anti-lgE
0.027
anti-lgE control
B
Nhe I
EXTRACELLULAR TM CP
5
IB
100 bp BMMC cDNA H20Ladder
500-
Xbal
muFceRIa protein domains
^^m muFceRIa gene exons
muFceRIa'
631 bp
CMVNhe I
KanaR
muFctKI«
831 bp
Xbai
pCMV-muFceRIcx-huIgG-]Fc5274 bp ^huig^Fc
p "" 723 bp
SV40 ori
Figure 18. Amplification of the muFceRIa sequence and cloning of the pCMV-muFceRloc-
hulgG.|Fc expression vector. BMMC were analyzed for purity (CD117 expression) and expression
of FceRI (binding of IgE) (A). The percentage of the cells present in each quadrant is indicated. A
primer set aligning within exon 1 and exon 5 of the muFceRIa sequence and containing restriction
sites for Nhe I and Xba I was used in RT-PCR on total RNA isolated from BMMC (B). The upper line
indicates the protein domains of FceRIa (TM=transmembrane, CP=cytoplasmic). The resulting 631
bp PCR-product coding for the extracellular domain of muFceRIa was cloned into the pCMV-KanaR-
hulgG^c vector (C). Kanamycin resistance was used for amplification of the vector.
88 Results Part III
Transfection and screening for cells expressing the muFcsRIa-huIgGiFc fusion
protein
The human embryonic kidney cell line HEK293T was transfected with the pCMV-
muFcsRIa-huIgGiFc vector to achieve expression of the muFcsRIa-huIgGiFc fusion
protein. To allow selection of transfected cells, a vector expressing the green fluorescence
protein (GFP) and Hygromycin resistance (HygR) was co-transfected into HEK293T cells
together with the pCMV-muFcsRIa-huIgGiFc vector. Transfected cells were identified by
GFP expression, using a fluorescent microscope. All three transfections obtained from the
constructs 4c, 5b, and 8a showed positive cells based on the presence of green fluorescence
(Figure 19A). At different time points after transfection, presence of the muFcsRIa-
huIgGiFc fusion protein in the supernatant of transfected cells was determined by ELISA
(Figure 19B). Cells transfected with the construct 4c produced the highest concentration of
protein, however, cells transfected with constructs 5b and 8a also showed substantial fusion
protein expression. As all three transfected cell lines produced the fusion protein, all three
were subcloned in order to obtain clonal cell lines. All cell lines derived from single cells
were tested by ELISA to determine if fusion protein expression was maintained. Over 300
clones were tested (data not shown) of which 31 with highest protein expression were
chosen to be expanded and tested again by ELISA. Three clones, labeled 8a3B, 5b4B, and
4c 1 A, with the highest protein expression were selected for further investigation. Western
blot analysis revealed that clone 8a3B appeared to produce the highest amounts of the
muFcsRIa-huIgGiFc fusion protein (Figure 19C). This clone was therefore selected for
further expansion and subsequent isolation of the fusion protein.
Results Part III 89
Figure 19. Transfection of HEK293T cells with three constructs coding for the muFceRloc-
hulgG.|Fc fusion protein. pCMV-muFceRla-hulgG^c vectors were co-transfected into HEK293T
cells together with a vector coding for GFP and HygR. After transfection cells were grown in
presence of Hygromycin and tested for GFP expression. Cells transfected with three selected
constructs of pCMV-muFceRla-hulgG^c (4c, 5b, and 8a) are depicted 16 days after transfection
(A). ELISA analysis for presence of hulgG^c in supernatants of transfected cells 19 days post
transfection (B). A 3-fold serial dilution was performed on initially undiluted supernatants.
Background of the ELISA was 0.16. Western blot analysis for presence of hulgG^c in the
supernatants of three clonal transfected cell lines (8a3B, 5b4B, and 4c1A) (C). A control hulgG^c
fusion protein was used as reference for the results. ELISA and Western blot results are
representative of three separate experiments.
Isolation of the muFcsRIa-huIgGiFc fusion protein
In order to purify the muFcsRIa-huIgGiFc fusion protein, four liters of supernatant of the
clone 8a3B were concentrated down to 100 ml and the fusion protein was isolated by
binding to a protein A column. Bound protein was eluted from the column and collected in
4 ml fractions. As shown in Figure 20A, fractions 5 to 11 contained high amounts of
protein with the protein peak eluting in fraction 6. The presence of the muFcsRIa-
90 Results Part III
hulgGiFc fusion protein in fractions 5 through 11 was then tested by specific ELISA with
all fractions revealing the presence of high amounts of fusion protein (Figure 20B).
Fractions 5 to 11 were therefore pooled and the total amount of protein determined. The
final yield of the isolated muFcsRIa-huIgGiFc fusion protein was 6 grams at a
concentration of 0.1 mg/ml.
A
Ecoeo
£S
Q
o
B
Ecmo
Q
O
r
3 4 5
Dilution [log3]
Fraction 5
Fraction 6
-- Fraction
-•- Fracti
-o- Fracti
-A- Fraction
-v- Fraction
7
on 8
on 9
10
Figure 20. Elution and analysis of the muFceRloc-hulgGiFc fusion protein. Four liters of
supernatant was collected from transfected clone 8a3B and concentrated to 100 ml. Fusion protein
was purified by binding to a protein A column and bound protein eluted in 4 ml fractions. The OD
(280 nm) of the eluent was measured (A). Fractions with a high OD are depicted in yellow.
Presence of hulgG-iFc in each of the fractions 5-11 was measured by ELISA (B). Samples were
pre-diluted 1:10 and then a 3-fold serial dilution was performed. Background of the ELISA was 0.14.
Results Part III 91
Immunization of FcsRIa""
mice with the muFcsRIa-huIgGiFc fusion protein
After successful generation of the muFcsRIa-huIgGiFc fusion protein, the second aim of
this study was to generate monoclonal anti-muFcsRIa antibodies. To obtain such
antibodies, mice deficient in FcsRIa (Dombrowicz et al., 1993) were chosen for
immunization with the fusion protein as these mice should recognize FcsRIa as a foreign
protein and therefore produce anti-FcsRIa antibodies. Prior to immunization with the
fusion protein, FcsRIa"" mice were tolerized against human IgGi by injection of a high
amount of human IgGi. Tolerance against human IgGi was induced in an attempt to
prevent production of antibodies against the hulgGiFc portion of the fusion protein. To
generate an anti-FcsRIa antibody response, FcsRIa""
mice were then immunized with the
muFcsRIa-huIgGiFc fusion protein six times at two-week intervals. Blood was collected
prior to each immunization in order to investigate the presence of anti-muFcsRIa
antibodies in the serum. The immunization protocol was performed three times with 3-4
mice per group. Representative results obtained from one immunization regime are shown
in Figure 21 (FACS) and Figure 22 (ELISA).
The presence of anti-muFcsRIa antibodies in serum of immunized FcsRIa""
mice was
analyzed by FACS using BMMC. These BMMC were CD 117 positive and expressed high
amounts of FcsRIa as visualized by staining with IgE and anti-lgE (Figure 21 A). Thus, in
order to detect anti-muFcsRIa antibodies, serum was incubated with BMMC and anti-
muFcsRIa binding was subsequently detected using fluorochrome-labeled anti-mouse IgG
antibody, as illustrated in Figure 21B. None of the immunized FcsRIa"" mice had
detectable amounts of anti-muFcsRIa antibodies in their serum, although serum from
mouse #3 may have contained small amounts of antibody as a small increase in mast cell
binding was observed (Figure 21C).
92 Results Part III
A iL1°4
32 8 65 6
-m0
0 71 0 87
B
10 u i(r u 1G*
IgE + anti-lgE
mouse #1
0498 9 0 27
10 10 10 10J 104
anti-CD117 J» JLanti-mouse IgG
CD117^^*SerUmIPFceRIa
BMMC
mouse #2 mouse #3 mouse #4
98 5 0 52114
94 4 4 39"
981 0 25
#103-
102-
10 -
0 I «p
101
3° boost
0 95 0 05 0 88 0 280
1 41 0 25
10u 10 10' 10 104 10 10' 10 101 IQ"1 10u 10 10y 105 10*
98 2 0 54 98 3
1 12 017
10 10' 10 10^ 10"*
0 83
0 25
10'
94 7 41
^o'>-
m-io2-
10 -
0 88 0 33
98 6 0 047
4° boost
1 35 0 023
10 10 10y 10 104 10 10' 10 10J 104 10u 10 10' 101 10*
1V
97 6 0 92
n3-»
102-
fP»
10
1 18 0 28
97 7 1 39
o2
o1
.n0 81 0 14
it*
95 5 3 29
10*-
Iffio9-
10 -
0 87 0 32
98 6 0 27
5° boost
10 10' 10 101 10"* iou 10 ioy io5 iC 10 10 10 10J 104 10u 10 10' 10 104
serum + anti-mouse IgG
Figure 21. FACS analysis of sera of FcsRIa"'" mice immunized with the muFceRla-hulgGiFc
fusion protein. BMMC (CD117+) expressing high levels of FceRI (binding to IgE) were used for
FACS analysis (A). To detect anti-muFceRIa antibodies in blood of immunized mice, serum was
incubated with BMMC and binding to FceRIa was subsequently detected by fluorochrome-labeled
anti-mouse IgG antibodies (B). Analysis of serum of four FceRIa' mice collected before the third,
fourth and fifth boost with the muFceRla-hulgG^c fusion protein is shown (C). The percentage of
the cells present in each quadrant is indicated.
Serum samples were also analyzed by ELISA for the presence of antibodies binding to the
muFcsRIa-huIgGiFc fusion protein To confirm that antibodies present in the sera of
immunized mice were binding to the muFcsRIa portion of the fusion protein and not to the
hulgGiFc fragment, a control hulgGiFc fusion protein was included in the analysis, as
illustrated in Figure 22A Results of ELISA analysis using the muFcsRIa-huIgGiFc fusion
Results Part III 93
protein for antibody binding detection showed high levels of protein binding in sera
collected before the third, fourth, and fifth boost with the muFcsRIa-huIgGiFc fusion
protein (Figure 22B, orange symbols). However, sera collected prior to the fifth boost also
revealed high protein binding to a control hulgGiFc fusion protein (Figure 22B, green
squares). Moreover, analysis of serum collected prior to the first immunization with the
muFcsRIa-huIgGiFc fusion protein also revealed binding to the control hulgGiFc fusion
protein (Figure 22B, green circles). These data indicated the presence of anti-huIgGi
antibodies in the sera of immunized FcsRIa""
mice. Such antibodies were most likely
generated after injection of the human IgGi used for tolerization and could be detected in
the ELISA but not in the FACS analysis due to the different experimental setup.
A
}VtiHmouse IgG
BiuFccRlrif-huloGFc or controI-huIgGFc
jfanti-huIgG
Dilution [log3]
Figure 22. ELISA analysis of sera of FceRIa"'" mice immunized with the muFceRla-hulgGiFc
fusion protein. Plates were coated with anti-human IgG and incubated with the muFceRla-
hulgG^c fusion protein or a control hulgG^c fusion protein. Subsequently, plates were incubated
with sera of immunized mice and protein binding was detected with anti-mouse IgG (A). Results of
serum from mouse #3 collected prior to the first (•), third (A), fourth (T), and fifth () boost using
either the muFceRla-hulgG^c fusion protein (orange) or a control IgG^c fusion protein (green) for
detection are shown (B). Serum was pre-diluted 1:50 and then a 3-fold serial dilution was
performed. Background of the ELISA was 0.25.
Surprisingly, immunization of FcsRIa""
mice with the muFcsRIa-huIgGiFc fusion protein
caused development of skin lesions, which were not observed in control mice injected with
adjuvant alone. Due to the skin lesion development as well as the apparent absence of
specific anti-muFcsRIa antibodies, a different strategy of immunization was attempted
where FcsRIa""
mice were immunized with BMMC expressing high levels of FcsRI.
94 Results Part III
Immunization of FcsRIa""
mice with bone marrow-derived mast cells.
Immunization of FcsRIa""
mice with the muFcsRIa-huIgGiFc fusion protein revealed two
difficulties. First, rather than generating specific anti-muFcsRIa antibodies, immunized
mice produced antibodies against the human IgGi. Second, the immunization caused severe
skin lesions to a degree that some mice had to be removed from the experiment. This
prompted us to develop a new strategy for generation of anti-muFcsRIa antibodies. We
decided to immunize FcsRIa""
mice with BMMC, which express high levels of FcsRIa on
the cell surface. Blood was collected before each BMMC injection and serum was screened
for presence of anti-muFcsRIa antibodies using the same FACS and ELISA protocols as
described for immunization with the muFcsRIa-huIgGiFc fusion protein (Figures 2IB and
22A). The immunization regime was performed twice on 3-4 mice per group and
representative results of two mice are depicted in Figure 23. Interestingly, the presence of
mouse IgG antibodies binding to BMMC in serum of FcsRIa""
mice increased upon
immunization with BMMC, as monitored by FACS showing a shift of stained BMMC from
about 1% to 8% (Figure 23A). This suggested that increasing amounts of BMMC-binding
antibodies were induced upon BMMC immunization. ELISA analysis also revealed the
presence of antibodies binding to the muFcsRIa-huIgGiFc fusion protein in the sera of
FcsRIa""
mice immunized with BMMC (Figure 23B, closed symbols). No such binding
was observed in sera from naive FcsRIa""
mice (Figure 23B, open symbols). Importantly,
no antibody binding was detected using a control hulgGiFc fusion protein (data not shown)
indicating that antibodies present in serum of immunized mice bound specifically to the
muFcsRIa portion of the muFcsRIa-huIgGiFc fusion protein.
Thus, both the FACS and ELISA data confirmed induction of antibodies in FcsRIa""
mice
in response to immunization with BMMC. B cells from immunized mice were therefore
used to generate hybridoma cell lines producing anti-muFcsRIa antibodies. Splenocytes
were fused with myeloma cells and supernatants of successfully generated hybridoma
single cell clones were tested for the presence of anti-muFcsRIa antibodies by specific
FACS and ELISA. Over 100 hybridoma clones were generated, however, none of these
hybridoma were found to produce antibodies binding to either BMMC by FACS (Figure
24) or to the muFcsRIa-huIgGiFc fusion protein by ELISA (data not shown). Thus, the
hybridoma production did not lead to generation of a monoclonal anti-muFcsRIa antibody.
Results Part III 95
A BMMC control 2nd Ab control
93 8 0 38
JÉif
5.8 0.18,
IgE + anti-lgE anti-mouse IgG
mouse #2 mouse #6
87 2 2.33
i*l"
4 22 6 25
76 9 101
r
#
434 86
,93
<? ^
serum + anti-mouse IgG
1 23
1° boost
2° boost
3° boost
-A- mouse #2 naive
—O- mouse #6 naive
—A- mouse #2 5° boost
mouse #6 5° boost
Dilution [log3]
Figure 23. Detection of anti-FceRIa antibodies in FceRIa"'" mice immunized with BMMC. FACS
(A) and ELISA (B) were performed on sera of immunized mice as described in Figure 21B and 22A,
respectively. The top panels show control stains of BMMC with IgE to confirm high levels of FceRI
expression and with anti-mouse IgG used as secondary Ab in the subsequent stains.
Representative results of two mice (#2 and #6) are shown. The percentage of the cells present in
each quadrant is indicated. For ELISA analysis, serum was pre-diluted 1:10 and then a 3-fold serial
dilution was performed. Background of the ELISA was 0.1.
96 Results Part III
o
o
BMMC control
44 1 43 1
2nd Ab control
86 5 0 25
126
/
0 14 ,132, .
J 1t!JG 028
10° 101 10^ 10J 104 10 101 109 10* 10
IgE + anti-lgE anti-mouse IgG
Hybridoma 2B7t
Hybridoma 2D3
0 261°
389 5 0 16
10u 10' 10 10 10H
4Hybridoma 6F9
'89 5 0 14
103 0
10 101 Vf 10" 104
Hybridoma 11H10
186 8 0 098
4
131
104
10" 10' 10z 10 10
Hybridoma 9F9'
Î86 5 0 29
o'- '
10" 10' 10z Vf V
Hybridoma 12A2
86 1 0 46
£.
134
10u 10' 10 10 10H 10" 10' Wf 10 10
serum + anti-mouse IgG
Figure 24. Analysis of hybridoma generated from BMMC-immunized FcsRIa" mice.
Supernatant of generated hybridoma clones was tested by FACS using BMMC as described in
Figure 21B. Six representative clones of over 100 tested hybridoma are depicted. The percentage
of the cells present in each quadrant is indicated.
Results Part III 97
4.5 Discussion
The high affinity IgE receptor, FcsRI, regulates signals leading to immediate-type
hypersensitivity reactions by binding of IgE on mast cells or basophils. In the presence of
specific antigen, the receptor is crosslinked leading to degranulation of the cell and release
of allergic mediators (Kinet, 1999). Signaling through FcsRI can also be triggered by
monomeric IgE, in the absence of antigen, resulting in FcsRI upregulation and cell survival
(Asai et al., 2001; Kalesnikoff et al., 2001; Yamaguchi et al., 1997). In addition to its
classical funcions on mast cells and basophils, in humans, FcsRI has also been shown to be
expressed on Langerhans' cells (Bieber et al., 1992; Wang et al., 1992), monocytes (Maurer
et al., 1994), eosinophils (Gounni et al., 1994), peripheral blood dendritic cells (Maurer et
al., 1996), and platelets (Hasegawa et al., 1999).
To allow specific investigation of FcsRI expression and function in mouse models, we
undertook to generate a monoclonal anti-mouse FcsRIa antibody. The first aim was to
generate a fusion protein composed of the extracellular domain of the murine FcsRIa and
the human IgGi Fc fragment. For this purpose, sequences coding for muFcsRIa and
hulgGiFc were cloned into an expression vector and transfected into a mammalian cell line.
Expression of the fusion protein was confirmed by ELISA and Western blot analysis
detecting hulgGiFc in the supernatant of transfected cells. The muFcsRIa-huIgGiFc fusion
protein was isolated from the supernatant using binding properties of hulgGiFc to protein
A.
After successful generation and isolation of a considerable amount of purified fusion
protein, the second aim of this project was to use this muFcsRIa-huIgGiFc fusion protein
to immunize FcsRIa""
mice in an attempt to generate anti-muFcsRIa antibodies. FcsRIa""
mice are deficient in the a chain of the high affinity IgE receptor, thus immunization with
the fusion protein should induce production of antibodies against FcsRIa. However, as the
fusion protein was also composed of the hulgGiFc domain, we were obliged to tolerize the
mice with hulgGi in order to prevent generation of antibodies against the hulgGiFc portion
of the fusion protein. Nevertheless, our results suggest that rather than tolerization, FcsRIa-
deficient mice developed anti-huIgGi antibodies. One possible way to overcome such a
problem would be to remove the hulgGiFc portion of the fusion protein from the
muFcsRIa portion prior to immunization. A separation of the two portions would have
98 Results Part III
been possible by introducing a cleavage site, such as for Factor Xa, into the expression
vector between the sequences coding for muFcsRIa and hulgGiFc.
We encountered an additional difficulty with the muFcsRIa-huIgGiFc fusion protein when
attempting to investigate binding to IgE. Although we could detect binding of muFcsRIa-
huIgGiFc to anti-huIgG antibodies by both ELISA and Western blot, despite numerous
protocols used, we were not able to show binding of muFcsRIa-huIgGiFc to murine IgE.
This may indicate that the muFcsRIa portion of the fusion protein was not properly folded
such that the three-dimensional structure did not reveal the IgE-binding site. Alternatively,
the presence of the hulgGiFc portion may have prevented binding of IgE, possibly due to
steric hindrance. In either case, removal of the hulgGiFc portion by Factor Xa, as suggested
above, might have allowed successful binding of IgE to the muFcsRIa portion.
Surprisingly, FcsRIa"" mice immunized with the muFcsRIa-huIgGiFc fusion protein
responded with unexpected skin lesions. At present the mechanism behind induction of
these skin lesions is unclear, even if the response appeared to be specific for the fusion
protein, as adjuvant alone had no effect. Although the formation of these lesions may be
immunologicaly interesting, they nevertheless prevented us from pursuing the
immunization protocol using the muFcsRIa-huIgGiFc fusion protein. As an alternative we
developed a different immunization method based on injections of FcsRIa"" mice with
BMMC expressing high levels of FcsRI. Analysis of serum of FcsRIa""
mice immunized
with BMMC revealed the presence of antibodies binding to BMMC, however, generation
of hybridoma clones from splenocytes of these mice did not result in production of anti-
muFcsRIa antibodies. The reason for unsuccessful generation of hybridoma producing
anti-muFcsRIa antibodies is presently unclear. It is possible that generation of additional
hybridoma would eventually yield specific antibody production. However, during the
completion of this study a commercial anti-muFcsRIa antibody became available and the
project was therefore terminated.
In conclusion, a muFcsRIa-huIgGiFc fusion protein was successfully generated, expressed
in the HEK293T cell line, and substantial amounts of protein were purified. The fusion
protein was shown to bind specifically to anti-huIgG but not to IgE. Immunization of
FcsRIa""
mice with the muFcsRIa-huIgGiFc fusion protein or with BMMC did not result
Results Part III 99
in generation of anti-muFcsRIa antibodies, however, the fusion protein is available in large
amounts and can be used in future if needed.
100 Results Part III
Discussion 101
5 Discussion
5.1 The functions of IgE
IgE, formerly referred to as "reagin", was first recognized as a new immunoglobulin class
in 1967 (Ishizaka and Ishizaka, 1967; Johansson and Bennich, 1967). However, initial
description of reagin was performed much earlier, when Cooke and Vander-Veer published
a first report on the genetic predisposition to allergy in 1916 (Cooke, 1916). The role of
reagin in hypersensitivity was further confirmed by Prausnitz and Küstner who
demonstrated in 1921 that this serum factor was responsible for allergic reactions
(Prausnitz, 1921). Thus, the first identified function of IgE was related to its involvement in
the development of allergy. However, it seems rather astonishing that IgE would evolve to
induce harmful immune responses suggesting that there must also be a beneficial function
of IgE in immunity that has led to the evolution of this antibody. Indeed, in 1964 Bridget
Ogilvie proposed that IgE (at that time still called reaginic antibody) may play an important
role in immunity to parasitic helminth infections (Ogilvie, 1964). Since then, a large body
of literature has accumulated to demonstrate the host-protective function of IgE in parasite
infections, as reviewed by Hagan (Hagan, 1993). Although high IgE levels are associated
with most parasite infections and a protective role has been assigned to IgE against
parasites such as Schistosoma mansoni (Capron et al., 1987) and Trichinella spiralis
(Dessein et al., 1981), the involvement of IgE in host-defense mechanisms remains
controversial for many parasite species. This suggests that IgE participation in parasite
infections may strongly depend on the characteristics of individual parasites, including
different life cycles, host penetration routes, and tissue localizations. Thus, further
investigation is required to determine the mechanisms regulating effector elements involved
in protection against each individual parasite species.
Taken together, IgE is involved in two types of immune responses. On one hand, IgE is
produced in response to parasite infections and may be involved in anti-parasitic host-
defense. On the other hand, IgE mediates adverse immune responses resulting in allergic
disease. The most prevalent parasite infections (ascariasis, trichriasis, and hookworm
infections) are believed to affect nearly two billion people worldwide, mostly in East Asia
and Sub-Saharan Africa (de Silva et al., 2003). These numbers are far from declining and
102 Discussion
afflict considerable human suffering and economic hardship. Understanding the factors
mediating protection against parasites is therefore of high importance. Contrary to
nematode infections, allergy mostly affects western countries, which may explain why
significantly more research has been done on IgE in the context of allergic disease than on
immunity to parasites. Interestingly, both branches of IgE biology, parasite protection and
allergy, appear to rely on the same effector mechanisms. Thus, investigation of either of the
two "faces" of IgE may provide valuable means to diminish the harm of both allergy and
parasite infections.
5.2 The epidemic of allergy
The benefits of a contemporary westernized lifestyle, such as low infant mortality due to
improved sanitation and access to drinkable water, strongly correlate with an increased
prevalence of allergy. The incidence of allergic disorders has risen greatly in the past
decades reaching epidemiological dimensions, particularly in the developed world. Most
allergic reactions are not life threatening, however they cause distress for millions. Quality
of life is significantly decreased by allergic rhinitis, eczema, and asthma, which interfere
with sleep, intellectual functioning, and recreational activities. Food allergies cause
constant concern with eating habits and fear of unnoticed ingestion of the respective
allergen. More dramatic outcomes of allergy-related pathologies are illustrated with
anaphylaxis and severe asthma, which can cause death. Statistical studies of allergic
disorders report alarming results. In countries such as the UK, Australia, or New Zealand,
around 25% of children under the age of 14 are reported to be affected with asthma and/or
eczema (1998). A few years ago the cost of treating asthma in the United States was
estimated to be about 6 billion US dollars per year (Smith et al., 1997) and may now be
significantly higher. Allergic diseases are a feature of westernized societies and have
therefore been suggested to result from reductions in the nature and frequency of childhood
infections. To explain the correlation between reduced infectious stress and increased
prevalence of allergy, different models have been proposed, the two most prominent being
the hygiene hypothesis and the counter-regulatory model (Wills-Karp et al., 2001).
However, both of these models have been disputed and additional evidence is required to
clearly demonstrate the environmental factors and immunological regulators responsible for
the observed increase in allergic disorders.
Discussion 103
5.3 Mechanisms of IgE-mediated immune responses
Allergic conditions are believed to share a unique mechanism of disease induction, which
involves high levels of IgE production. Indeed, total serum IgE concentrations have been
shown to positively correlate with the severity of allergic reactions (Burrows et al., 1989;
Laske and Niggemann, 2004). Binding of IgE to its high affinity receptor, FcsRI, expressed
most importantly on mast cells, followed by antigen-mediated crosslinking of receptor-
bound IgE, induces the release of allergic mediators leading to symptoms of atopic disease
(Kay, 2001). The pathology of atopy includes weal and flare eruptions of the skin (hives
and urticaria), rhinitis, asthma, and anaphylaxis. Consequently, investigating the factors
that control IgE production is essential to understand the pathogenesis of allergy. The
regulation of IgE production is based on the activation of Th2 cells and secretion of Th2-
type cytokines, most importantly IL-4 and IL-13 (Geha et al., 2003). Understanding the
mechanisms regulating the induction of Th2-mediated immune responses is crucial to
provide effective means against allergic disease.
5.4 Remaining questions to be answered
Despite much progress in allergy research, many questions concerning the development of
the disease remain open and hinder the development of effective therapies. A great number
of factors have been shown to influence the outcome of allergic responses, including early
events during fetal life and childhood, genetic background, and lifestyle (Cookson, 1999).
This illustrates the complexity of the disease and explains the difficulty of successful
therapy and prevention.
One of the most basic questions regarding IgE production concerns the polarization of the T
helper response. Naive CD4+ T cells differentiate upon encounter of specific antigens into
two functionally distinct effector subtypes, Thl and Th2 (Abbas et al., 1996). Polarization
of T helper cells depends mainly on the cytokine milieu. Thus, induction of Thl cells
requires the presence of IL-12, which is produced by APCs after pathogen-dependent
activation of Toll-like receptors (Dabbagh and Lewis, 2003). On the other hand,
development of Th2 cells requires the cytokine IL-4, which is also crucial for the
production of IgE (Finkelman et al., 1988). However, the molecular basis for Th2
polarization is poorly understood. Recent findings have suggested that thymic stromal
lymphopoietin (TSLP) produced by epithelial cells at the site of antigen entry in skin and
104 Discussion
mucosa may interact with human dendritic cells. These interactions have been suggested to
induce production of Th2-attracting chemokines, such as CCL17 and CCL22, and Th2
differentiation characterized by secretion of IL-4, IL-5, and IL-13 (Soumelis et al., 2002).
However, in mice TSLP has no effect on dendritic cells (Leonard, 2002) implying that
other mechanisms must be involved in Th2 differentiation in the murine system. Ample
research has been performed to investigate the relevant source of IL-4, however, the
mechanisms involved in its induction remain unclear (Liew, 2002). Thus, as long as the
factors inducing a Th2-type response are not elucidated, the initiation of IgE-mediated
responses will remain unresolved. Several cell subsets have been shown to have the
capacity of producing IL-4. Mature CD4+ T cells have been reported to be a sufficient
source of IL-4 for initial induction of IgE synthesis (Schmitz et al., 1994). Mast cells (Plaut
et al., 1989) and basophils (Seder et al., 1991) are known to produce IL-4 upon
crosslinkage of high affinity Fes receptors. Interestingly, mast cells and eosinophils have
been shown to express IL-4 in bronchial mucosa of asthmatic patients (Ying et al., 1997)
and cultured basophils have been demonstrated to produce biologically active IL-4 and
express functional CD40L contributing to IgE production by B cells (Yanagihara et al.,
1998). Recent studies using IL-4 reporter mice have shown IL-4 synthesis by basophils and
eosinophils in response to infection with a Th2-inducing parasite (Min et al., 2004;
Voehringer et al., 2004). Furthermore, natural killer (NK) T cells have been suggested to
favor the development of Th2 cells by providing a source of IL-4 (Yoshimoto and Paul,
1994). Thus, initial induction of IL-4 might involve several still unresolved mechanisms,
which may depend on factors such as the tissue localization of pathogenic infection or the
nature of the antigen.
While the cytokine environment can clearly modulate the fate of a naive CD4+ T cell, other
factors have also been described to influence Th development, such as nature, dose, and
localization of antigen (Constant and Bottomly, 1997). These characteristics may explain
why some pathogens preferentially induce one of the Th subsets, such that intracellular
microorganisms induce Thl responses while extracellular forms of pathogens cause Th2
differentiation. The number of antigenic epitopes available to the precursor Th cell during
priming appears to play an important role. This suggests that efficiency of uptake and
processing by APCs, which has been shown to be influenced by the initial form of the
antigen (Constant et al., 1995), may indirectly influence the development of Th cells.
Discussion 105
Controversial data have been reported on the effect of antigen dose on Th cell polarization,
as reviewed by Constant and Bottomly (Constant and Bottomly, 1997). While several
studies have reported that high doses of immunogen induce Thl responses and low doses
favor Th2 responses (Bancroft et al., 1994), others have shown opposite results (Wang et
al., 1996). Thus, the experimental settings of each study need to be evaluated.
Another still intriguing part of IgE-related immunity relates to the function of its high
affinity receptor, FcsRI. Although the role of FcsRI in mediating allergic reactions is well
established, other physiological functions of FcsRI are less clear. Research from the past
decade has greatly improved our knowledge of the biology of FcsRI. The main progress is
due to the discovery of major differences between the composition and cellular distribution
of human and murine FcsRI. While in mice FcsRI is expressed only on mast cells and
basophils with an obligatory tetrameric structure described by the aßy2 chain composition,
the human FcsRI can be found both as a tetramer on mast cells and basophils and
additionally as a trimer (ay2) on Langerhans' cells, monocytes, eosinophils, peripheral
blood dendritic cells, and platelets (Kinet, 1999). These findings revealed an unexpected
participation of FcsRI in antigen presentation (Novak et al., 2003a). Furthermore,
investigation of the ß chain of the high affinity IgE receptor demonstrated that ß serves as
an amplifier of FcsRI functions by enhancing the signaling cascades transduced through the
receptor (Lin et al., 1996) and by increasing FcsRI cell surface expression (Donnadieu et
al., 2000). These important functions of FcsRIß imply distinct physiological roles for the
classical tetrameric receptor complex and the trimeric isoform lacking the ß chain.
Additionally, polymorphism within the FcsRIß gene has been associated with atopic
phenotypes (Hill and Cookson, 1996). Interesting findings have also been reported on the a
chain of the receptor. FcsRIa has been proposed to be target for specific anti-FcsRIa
autoantibodies able to release histamine from basophils and mast cells leading to
development of chronic urticatia (Fiebiger et al., 1995). In particular, an imbalance between
FcsRI occupancy and natural anti-FcsRIa antibodies has been suggested to play an
important role in the pathogenesis of autoimmune urticaria (Horn et al., 2001). Another
remarkable feature of the high affinity IgE receptor is that the surface expression of FcsRI
is regulated by its own ligand, IgE. Binding of IgE to FcsRI has been shown to upregulate
surface expression of the receptor in mast cells and basophils (Lantz et al., 1997;
106 Discussion
Yamaguchi et al., 1997) by receptor stabilization at the membrane (Borkowski et al., 2001).
This implies that increased IgE levels may enhance the sensitivity to pathogens or allergens
due to an increased number of receptors occupied by IgE with more antigen specificities.
Finally, a role in protection against parasites has also been assigned to FcsRI. Increased
liver pathology in response to S. mansoni has been demonstrated in FcsRIa-deficient mice
(Jankovic et al., 1997) and eosinophil-mediated cytotoxicity against S. mansoni has been
shown to involve FcsRI (Gounni et al., 1994). Thus, the high affinity IgE receptor has a
very broad range of functions, of which some are not yet completely understood and
require further investigation.
5.5 Questions addressed in this thesis
The aim of this thesis was to address some of the questions regarding the role of IgE in
allergic diseases, the mechanisms involved in the regulation of IgE induction, and the
interactions of IgE and FcsRI.
Results Part I
Animal models of Th2-type conditions should provide suitable tools for investigation of the
early steps of immune responses leading to IgE production and consequently to allergic
reactions. The fur mite infestation model, described in the first part of the results, was
characterized to determine its value as a tool to investigate mechanisms involved in the
induction of IgE and to determine its suitability as a model to study allergy. The immune
response induced by a mixed population of murine fur mites, Myocoptes musculinus and
Myobia musculi, was therefore characterized. The results showed that high levels of serum
IgE induced in mice in response to mite infestation involved the same mechanisms as those
known for allergy-inducing IgE in human disease, namely Th2 cell-dependent
CD40/CD40L interactions and secretion of IL-4. The kinetics and tissue localization of
isotype switching to IgE in B cells was investigated in detail and revealed that mite
antigens appear to enter via the skin from where they are transported to skin-draining
lymph nodes, the site of T cell activation and B cell switch to IgE.
Furthermore, the IgE repertoire induced in response to mite infestation was analyzed.
Preliminary results revealed little mutations in the Vh, Dh, and Jh segments of mite-induced
IgE. This suggests that the analyzed IgE had not undergone somatic hypermutation and
Discussion 107
therefore may not have gone through a germinal center reaction. It has been postulated that
in certain conditions, such as allergic rhinitis, B cells can undergo class switch
recombination to IgE at the site of inflammation, i.e. outside secondary lymphoid organs
(Takhar et al., 2005). Thus, further characterization of mite-induced IgE is required to
determine whether it may result from local B cell activation.
Importantly, antigen-exposure during mite infestation occurs in a fully physiological way.
Fur mites are natural murine parasites and mice are infested via direct contact with a
previously infested mouse. Thus, no artificial injections are required and mice are exposed
to physiological antigen loads. This implies an enormous advantage of the mite infestation
model compared with other models used in allergy research, such as immunization with
high amounts of purified protein antigens in adjuvants or infection with high doses of
nematode parasites. The close resemblance of the mite infestation model to allergen
sensitization in humans, both involving exposure to antigen loads corresponding to those
present in the natural environment, makes this model a valuable tool to study the
mechanisms regulating IgE induction and development of allergic conditions.
Results Part II
The high affinity IgE receptor, FcsRI, is an important player in IgE-mediated immune
responses. The functions of FcsRI, in particular the role of its expression on cells such as
APCs and eosinophils, are not fully understood. Therefore, the second part of the present
thesis was dedicated to provide better knowledge of the biological role of FcsRI by
generating a transgenic mouse model. The aim was to generate mice that would mirror the
human distribution pattern of FcsRI. If successful, such a model should provide important
insight into the role of FcsRI expression on multiple cells in humans on which the receptor
is lacking in the murine system, including Langerhans' cells, monocytes, eosinophils,
dendritic cells, and platelets. Comparison of immune responses in WT mice with those in
animals expressing FcsRI with a human distribution should provide information on the
importance of these cells in IgE-mediated reactions. For example, the presence of FcsRI-
positive Langerhans' cells and eosinophils in a murine model should allow a novel way for
investigation of atopic dermatitis and asthma and provide new insight into the role of IgE in
these diseases. Generation of hmFcsRIaß Tg mice was based on the usage of the human
FcsRIa promoter to drive expression of the a and ß chains of the murine FcsRI with the
108 Discussion
cellular distribution pattern found in humans. Although mRNA expression of the
transgenes was detected in the targeted cell types of the generated transgenic mice, no
FcsRI protein expression could be shown. The lack of detectable protein expression may be
due to retention and degradation of the receptor complex in the ER or to absence of
transcription of the transgenic mRNA. Further investigation of this transgenic model, such
as confocal microscopy and sequencing of the transgenic receptor chains, is therefore
required to enable its usage for investigation of the role of FcsRI expression.
Results Part III
Investigation of FcsRI requires tools allowing precise detection of its expression. Specific
monoclonal antibodies are commonly used to analyze the expression of cell surface
molecules. As no anti-mouse FcsRIa antibodies were available, we made an attempt to
generate a specific antibody against the a chain of the murine high affinity IgE receptor.
For this purpose a fusion protein composed of the murine FcsRIa and the human IgGi Fc
portion was generated and used to immunize FcsRIa-deficient mice. However, the applied
protocol of a chain protein injections into FcsRIa-deficient mice did not result in the
expected synthesis of anti-FcsRIa antibodies. Moreover, a commercial anti-mouse FcsRIa
antibody became available during the completion of this project prompting us to cease
further investigation. Nevertheless, the successfully generated and purified muFcsRIa-
huIgGiFc fusion protein is available in large amounts and can be used at further point if
needed.
5.6 Concluding remarks
Last but not least, applying the knowledge gained from experimental animal models to the
human condition requires much care. Differences between results obtained from rodent
systems and the pathology of human allergic disease have to be evaluated to avoid
misleading conclusions. The finding that IgE may be produced locally, in the nasal mucosa
of patients with allergic rhinitis (Smurthwaite et al., 2001) and the lung mucosa of
asthmatics (Wilson et al., 2002), implies that serum IgE or skin reactivity to common
allergens might underestimate a critical role of IgE in disease. Locally limited IgE, such as
IgE content of mucosal fluids, has to be additionally investigated to fully elucidate the role
of this intriguing antibody in allergy.
REFERENCES 109
6 References
(1998). Worldwide variation in prevalence of symptoms of asthma, allergicrhinoconjunctivitis, and atopic eczema: ISAAC. The International Study of Asthma and
Allergies in Childhood (ISAAC) Steering Committee. Lancet 351, 1225-1232.
Aas, K. (1978). What makes an allergen an allergen. Allergy 33, 3-14.
Abbas, A. K., Murphy, K. M., and Sher, A. (1996). Functional diversity of helper T
lymphocytes. Nature 383, 787-793.
Aebischer, I., and Stadler, B. M. (1996). TH1-TH2 cells in allergic responses: at the limits
of a concept. Adv Immunol 61, 341-403.
Ahmad, A., Wang, C. H., and Bell, R. G. (1991). A role for IgE in intestinal immunity.Expression of rapid expulsion of Trichinella spiralis in rats transfused with IgE and thoracic
duct lymphocytes. J Immunol 146, 3563-3570.
Allen, J. E., and Maizels, R. M. (1997). Thl-Th2: reliable paradigm or dangerous dogma?Immunol Today 18, 387-392.
Anderson, C. L., Shen, L., Eicher, D. M., Wewers, M. D., and Gill, J. K. (1990).
Phagocytosis mediated by three distinct Fc gamma receptor classes on human leukocytes. J
Exp Med 777, 1333-1345.
Asai, K., Kitaura, J., Kawakami, Y., Yamagata, N., Tsai, M., Carbone, D. P., Liu, F. T.,
Galli, S. J., and Kawakami, T. (2001). Regulation of mast cell survival by IgE. Immunity14, 791-800.
Babina, M., Mammeri, K., and Henz, B. M. (1999). ICAM-3 (CD50) is expressed byhuman mast cells: induction of homotypic mast cell aggregation via ICAM-3. Cell Adhes
Commun 7, 195-209.
Bancroft, A. J., Else, K. J., and Grencis, R. K. (1994). Low-level infection with Trichuris
muris significantly affects the polarization of the CD4 response. Eur J Immunol 24, 31 IS¬
SUS.
Barbera, G., Munoz-Lopez, F., Cruz-Hernandez, M., and Torralba, A. (1977). IgEconcentration in asthmatic children. Relation to other immunoglobulins, histamine-latex
reaction, eosinophilia and skin reactivity. Allergol Immunopathol (Madr) 5, 653-658.
Bell, R. G. (1998). The generation and expression of immunity to Trichinella spiralis in
laboratory rodents. AdvParasitol 41, 149-217.
Betts, C. J., and Else, K. J. (1999). Mast cells, eosinophils and antibody-mediated cellular
cytotoxicity are not critical in resistance to Trichuris muris. Parasite Immunol 21, 45-52.
110 REFERENCES
Bieber, T., de la Salle, H., Wollenberg, A., Hakimi, J., Chizzonite, R., Ring, J., Hanau, D.,and de la Salle, C. (1992). Human epidermal Langerhans cells express the high affinity
receptor for immunoglobulin E (Fc epsilon RI). J Exp Med 775, 1285-1290.
Bjorksten, B., Dumitrascu, D., Foucard, T., Khetsuriani, N., Khaitov, R., Leja, M., Lis, G.,
Pekkanen, J., Priftanji, A., and Riikjarv, M. A. (1998). Prevalence of childhood asthma,rhinitis and eczema in Scandinavia and Eastern Europe. Eur Respir J 12, 432-437.
Bjorksten, B., Naaber, P., Sepp, E., and Mikelsaar, M. (1999). The intestinal microflora in
allergic Estonian and Swedish 2-year-old children. Clin Exp Allergy 29, 342-346.
Blank, U., Ra, C, Miller, L., White, K., Metzger, H., and Kinet, J. P. (1989). Completestructure and expression in transfected cells of high affinity IgE receptor. Nature 337, 187-
189.
Blank, U., Ra, C. S., and Kinet, J. P. (1991). Characterization of truncated alpha chain
products from human, rat, and mouse high affinity receptor for immunoglobulin E. J Biol
Chem 266, 2639-2646.
Borish, L., Aarons, A., Rumbyrt, J., Cvietusa, P., Negri, J., and Wenzel, S. (1996).Interleukin-10 regulation in normal subjects and patients with asthma. J Allergy Clin
Immunol 97, 1288-1296.
Borkowski, T. A., Jouvin, M. H., Lin, S. Y., and Kinet, J. P. (2001). Minimal requirementsfor IgE-mediated regulation of surface Fc epsilon RI. J Immunol 167, 1290-1296.
Boyce, J. A. (2004). The biology of the mast cell. Allergy Asthma Proc 25, 27-30.
Braun-Fahrlander, C, Gassner, M., Grize, L., Neu, U., Sennhauser, F. H., Varonier, H. S.,
Vuille, J. C, and Wuthrich, B. (1999). Prevalence of hay fever and allergic sensitization in
farmer's children and their peers living in the same rural community. SCARPOL team.
Swiss Study on Childhood Allergy and Respiratory Symptoms with Respect to Air
Pollution. Clin Exp Allergy 29, 28-34.
Burrows, B., Martinez, F. D., Halonen, M., Barbee, R. A., and Cline, M. G. (1989).Association of asthma with serum IgE levels and skin-test reactivity to allergens. N Engl J
Med 320, 271-277.
Byars, N. E., and Ferraresi, R. W. (1976). Intestinal anaphylaxis in the rat as a model of
food allergy. Clin Exp Immunol 24, 352-356.
Cameron, M. M. (1997). Can house dust mite-triggered atopic dermatitis be alleviated
using acaricides? Br J Dermatol 737, 1-8.
Capron, A., Dessaint, J. P., Capron, M., Ouma, J. H., and Butterworth, A. E. (1987).
Immunity to schistosomes: progress toward vaccine. Science 238, 1065-1072.
Chaudhuri, J., Tian, M., Khuong, C, Chua, K., Pinaud, E., and Alt, F. W. (2003).
Transcription-targeted DNA deamination by the AID antibody diversification enzyme.
Nature 422, 726-730.
REFERENCES 111
Cherayil, B. J., Weiner, S. J., and Pillai, S. (1989). The Mac-2 antigen is a galactose-
specific lectin that binds IgE. J Exp Med 770, 1959-1972.
Coffman, R. L., and Carty, J. (1986). A T cell activity that enhances polyclonal IgE
production and its inhibition by interferon-gamma. J Immunol 136, 949-954.
Cohen, S. G., and Zelaya-Quesada, M. (2002). Portier, Richet, and the discovery of
anaphylaxis: a centennial. J Allergy Clin Immunol 770, 331-336.
Constant, S., SantAngelo, D., Pasqualini, T., Taylor, T., Levin, D., Flavell, R., and
Bottomly, K. (1995). Peptide and protein antigens require distinct antigen-presenting cell
subsets for the priming of CD4+ T cells. J Immunol 154, 4915-4923.
Constant, S. L., and Bottomly, K. (1997). Induction of Thl and Th2 CD4+ T cell
responses: the alternative approaches. Annu Rev Immunol 15, 297-322.
Cooke, V.-V. (1916). Human sensitization. J Immunol 7, 201-305.
Cookson, W. (1999). The alliance of genes and environment in asthma and allergy. Nature
402, B5-11.
Coombs RRA, G. P. (1963). The classification of allergic reactions underlying disease.
Clinical aspects of Immunology, 317-337.
Cony, D. B., and Kheradmand, F. (1999). Induction and regulation of the IgE response.
Nature 402, B18-23.
Cromwell, O. (1997). Biochemistry of allergens. In: Kay AB, ed. Allergy and allergicdiseases., 797-810.
Dabbagh, K., and Lewis, D. B. (2003). Toll-like receptors and T-helper-l/T-helper-2
responses. Curr Opin Infect Dis 16, 199-204.
Daeron, M. (1997). Fc receptor biology. Annu Rev Immunol 15, 203-234.
Dawson, D. V., Whitmore, S. P., and Bresnahan, J. F. (1986). Genetic control of
susceptibility to mite-associated ulcerative dermatitis. Lab Anim Sei 36, 262-267.
de Silva, N., Brooker, S., and Hotez, P. (2003). Soil-Transmitted Helminthic Infections:
Updating the Global Picture. Disease Control Priorities Project.
de Vries, J. E., Punnonen, J., Cocks, B. G., de Waal Malefyt, R., and Aversa, G. (1993).Regulation of the human IgE response by IL4 and IL13. Res Immunol 144, 597-601.
Delespesse, G, Sarfati, M., Wu, C. Y., Fournier, S., and Letellier, M. (1992). The low-
affinity receptor for IgE. Immunol Rev 125,11-91.
Dessaint, J. P., Bout, D., Wattre, P., and Capron, A. (1975). Quantitative determination of
specific IgE antibodies to Echinococcus granulosus and IgE levels in sera from patientswith hydatid disease. Immunology 29, 813-823.
112 REFERENCES
Dessein, A. J., Parker, W. L., James, S. L., and David, J. R. (1981). IgE antibody and
resistance to infection. I. Selective suppression of the IgE antibody response in rats
diminishes the resistance and the eosinophil response to Trichinella spiralis infection. J ExpMed 153, 423-436.
Dold, S., Wjst, M., von Mutius, E., Reitmeir, P., and Stiepel, E. (1992). Genetic risk for
asthma, allergic rhinitis, and atopic dermatitis. Arch Dis Child 67, 1018-1022.
Dombrowicz, D., Brini, A. T., Flamand, V., Hicks, E., Snouwaert, J. N., Kinet, J. P., and
Koller, B. H. (1996). Anaphylaxis mediated through a humanized high affinity IgE
receptor. J Immunol 757, 1645-1651.
Dombrowicz, D., Flamand, V., Brigman, K. K., Koller, B. H., and Kinet, J. P. (1993).Abolition of anaphylaxis by targeted disruption of the high affinity immunoglobulin E
receptor alpha chain gene. Cell 75, 969-976.
Dombrowicz, D., Lin, S., Flamand, V., Brini, A. T., Koller, B. H., and Kinet, J. P. (1998).
Allergy-associated FcRbeta is a molecular amplifier of IgE- and IgG-mediated in vivo
responses. Immunity 8, 517-529.
Donnadieu, E., Jouvin, M. H., and Kinet, J. P. (2000). A second amplifier function for the
allergy-associated Fc(epsilon)RI-beta subunit. Immunity 12, 515-523.
Duffy, D. L., Martin, N. G., Battistutta, D., Hopper, J. L., and Mathews, J. D. (1990).Genetics of asthma and hay fever in Australian twins. Am Rev Respir Dis 142, 1351-1358.
Durmaz, B., Yakinci, C, Koroglu, M., Rafiq, M., and Durmaz, R. (1998). Concentration of
total serum IgE in parasitized children and the effects of the antiparasitic therapy on IgElevels. J Trop Pediatr 44, 121.
Ermel, R. W., Kock, M., Griffey, S. M., Reinhart, G A., and Frick, O. L. (1997). The
atopic dog: a model for food allergy. Lab Anim Sei 47, 40-49.
Fiebiger, E., Maurer, D., Holub, H., Reininger, B., Hartmann, G., Woisetschlager, M.,
Kinet, J. P., and Stingl, G. (1995). Serum IgG autoantibodies directed against the alphachain of Fc epsilon RI: a selective marker and pathogenetic factor for a distinct subset of
chronic urticaria patients? J Clin Invest 96, 2606-2612.
Finkelman, F. D., Katona, I. M., Urban, J. F., Jr., Holmes, J., Ohara, J., Tung, A. S.,
Sample, J. V., and Paul, W. E. (1988). IL-4 is required to generate and sustain in vivo IgE
responses. J Immunol 141, 2335-2341.
Finkelman, F. D., Shea-Donohue, T., Goldhill, J., Sullivan, C. A., Morris, S. C, Madden,K. B., Gause, W. C, and Urban, J. F., Jr. (1997). Cytokine regulation of host defense
against parasitic gastrointestinal nematodes: lessons from studies with rodent models. Annu
Rev Immunol 75, 505-533.
Fox, C. C, Jewell, S. D., and Whitacre, C. C. (1994). Rat peritoneal mast cells present
antigen to a PPD-specific T cell line. Cell Immunol 755, 253-264.
REFERENCES 113
Frandji, P., Oskeritzian, C, Cacaraci, F., Lapeyre, J., Peronet, R., David, B., Guillet, J. G.,and Mecheri, S. (1993). Antigen-dependent stimulation by bone marrow-derived mast cells
ofMHC class II-restricted T cell hybridoma. J Immunol 757, 6318-6328.
Frandji, P., Tkaczyk, C, Oskeritzian, C, David, B., Desaymard, C, and Mecheri, S.
(1996). Exogenous and endogenous antigens are differentially presented by mast cells to
CD4+ T lymphocytes. Eur J Immunol 26, 2517-2528.
Friedman, S., and Weisbroth, S. H. (1975). The parasitic ecology of the rodent mite Myobiamusculi. II. Genetic factors. Lab Anim Sei 25, 440-445.
Friedman, S., and Weisbroth, S. H. (1977). The parasitic ecology of the rodent mite,
Myobia musculi. IV. Life cycle. Lab Anim Sei 27, 34-37.
Frigeri, L. G., and Liu, F. T. (1992). Surface expression of functional IgE binding protein,an endogenous lectin, on mast cells and macrophages. J Immunol 148, 861-867.
Gambles, R. (1952). Myocoptes musculinus (Koch) and Myobia musculi (Schrank), two
species of mite commonly parasitizing the laboratory mouse. Br Vet J 705, 194-203.
Garman, S. C, Kinet, J. P., and Jardetzky, T. S. (1998). Crystal structure of the human
high-affinity IgE receptor. Cell 95, 951-961.
Garman, S. C, Wurzburg, B. A., Tarchevskaya, S. S., Kinet, J. P., and Jardetzky, T. S.
(2000). Structure of the Fc fragment of human IgE bound to its high-affinity receptor Fc
epsilonRI alpha. Nature 406, 259-266.
Gauchat, J. F., Henchoz, S., Mazzei, G., Aubry, J. P., Brunner, T., Blasey, H., Life, P.,
Talabot, D., Flores-Romo, L., Thompson, J., and et al. (1993). Induction of human IgE
synthesis in B cells by mast cells and basophils. Nature 365, 340-343.
Geha, R. S., Jabara, H. H., and Brodeur, S. R. (2003). The regulation of immunoglobulin E
class-switch recombination. Nat Rev Immunol 3, 721-732.
Gor, D. O., Rose, N. R., and Greenspan, N. S. (2003). TH1-TH2: a procrustean paradigm.Nat Immunol 4, 503-505.
Gould, H. J., Sutton, B. J., Beavil, A. J., Beavil, R. L., McCloskey, N., Coker, H. A., Fear,
D., and Smurthwaite, L. (2003). The biology of IGE and the basis of allergic disease. Annu
Rev Immunol 21, 579-628.
Gounni, A. S., Lamkhioued, B., Ochiai, K., Tanaka, Y., Delaporte, E., Capron, A., Kinet, J.
P., and Capron, M. (1994). High-affinity IgE receptor on eosinophils is involved in defence
against parasites. Nature 367, 183-186.
Grunewald, S. M., Teufel, M., Erb, K., Neide, A., Mohrs, M., Brombacher, F., Brocker, E.
B., Sebald, W., and Duschl, A. (2001). Upon prolonged allergen exposure IL-4 and IL-
4Ralpha knockout mice produce specific IgE leading to anaphylaxis. Int Arch AllergyImmunol 725, 322-328.
114 REFERENCES
Gurish, M. F., Bryce, P. J., Tao, H., Kisselgof, A. B., Thornton, E. M., Miller, H. R.,
Friend, D. S., and Oettgen, H. C. (2004). IgE enhances parasite clearance and regulatesmast cell responses in mice infected with Trichinella spiralis. J Immunol 772, 1139-1145.
Haas, L. F. (2001). Charles Robert Richet (1850-1935). J Neurol Neurosurg Psychiatry 70,255.
Hagan, P. (1993). IgE and protective immunity to helminth infections. Parasite Immunol
75, 1-4.
Hagan, P., Blumenthal, U. J., Dunn, D., Simpson, A. J., and Wilkins, H. A. (1991). Human
IgE, IgG4 and resistance to reinfection with Schistosoma haematobium. Nature 349, 243-
245.
Hasegawa, S., Pawankar, R., Suzuki, K., Nakahata, T., Furukawa, S., Okumura, K., and Ra,C. (1999). Functional expression of the high affinity receptor for IgE (FcepsilonRI) in
human platelets and its' intracellular expression in human megakaryocytes. Blood 93, 2543-
2551.
Herz, U., Renz, H., and Wiedermann, U. (2004). Animal models of type I allergy usingrecombinant allergens. Methods 32, 271-280.
Hill, M. R., and Cookson, W. O. (1996). A new variant of the beta subunit of the high-
affinity receptor for immunoglobulin E (Fc epsilon RI-beta E237G): associations with
measures of atopy and bronchial hyper-responsiveness. Hum Mol Genet 5, 959-962.
Holgate, S. T. (1999). The epidemic of allergy and asthma. Nature 402, B2-4.
Holt, P. G, Clough, J. B., Holt, B. J., Baron-Hay, M. J., Rose, A. H., Robinson, B. W., and
Thomas, W. R. (1992). Genetic 'risk' for atopy is associated with delayed postnatalmaturation of T-cell competence. Clin Exp Allergy 22, 1093-1099.
Horn, M. P., Pachlopnik, J. M., Vogel, M., Dahinden, M., Wurm, F., Stadler, B. M., and
Miescher, S. M. (2001). Conditional autoimmunity mediated by human natural anti-
Fc(epsilon)RIalpha autoantibodies? Faseb J 75, 2268-2274.
Iciek, L. A., Delphin, S. A., and Stavnezer, J. (1997). CD40 cross-linking induces Ig
epsilon germline transcripts in B cells via activation of NF-kappaB: synergy with IL-4
induction. J Immunol 755, 4769-4779.
Iijima, O. T., Takeda, H., Komatsu, Y., Matsumiya, T., and Takahashi, H. (2000). Atopicdermatitis in NC/Jic mice associated with Myobia musculi infestation. Comp Med 50, 225-
228.
Ishizaka, K., and Ishizaka, T. (1967). Identification of gamma-E-antibodies as a carrier of
reaginic activity. J Immunol 99, 1187-1198.
Ishizaka, T., Helm, B., Hakimi, J., Niebyl, J., Ishizaka, K., and Gould, H. (1986).
Biological properties of a recombinant human immunoglobulin epsilon-chain fragment.Proc Natl Acad Sei U S A 83, 8323-8327.
REFERENCES 115
Jabara, H. H., Schneider, L. C, Shapira, S. K., Alfieri, C, Moody, C. T., Kieff, E., Geha,R. S., and Vercelli, D. (1990). Induction of germ-line and mature C epsilon transcripts in
human B cells stimulated with rIL-4 and EBV. J Immunol 145, 3468-3473.
Jankovic, D., Kullberg, M. C, Dombrowicz, D., Barbieri, S., Caspar, P., Wynn, T. A., Paul,W. E., Cheever, A. W., Kinet, J. P., and Sher, A. (1997). Fc epsilonRI-deficient mice
infected with Schistosoma mansoni mount normal Th2-type responses while displayingenhanced liver pathology. J Immunol 759, 1868-1875.
Jarrett, E. E., and Miller, H. R. (1982). Production and activities of IgE in helminth
infection. Prog Allergy 31, 178-233.
Johansson, S. G., andBennich, H. (1967). Immunological studies of an atypical (myeloma)immunoglobulin. Immunology 13, 381-394.
Jones, A. C, Miles, E. A., Warner, J. O., Colwell, B. M., Bryant, T. N., and Warner, J. A.
(1996). Fetal peripheral blood mononuclear cell proliferative responses to mitogenic and
allergenic stimuli during gestation. Pediatr Allergy Immunol 7, 109-116.
Joseph, M., Gounni, A. S., Kusnierz, J. P., Vorng, H., Sarfati, M., Kinet, J. P., Tonnel, A.
B., Capron, A., and Capron, M. (1997). Expression and functions of the high-affinity IgE
receptor on human platelets and megakaryocyte precursors. Eur J Immunol 27, 2212-2218.
Jouvin, M. H., Adamczewski, M., Numerof, R., Letourneur, O., Valle, A., and Kinet, J. P.
(1994). Differential control of the tyrosine kinases Lyn and Syk by the two signaling chains
of the high affinity immunoglobulin E receptor. J Biol Chem 269, 5918-5925.
Jungmann, P., Freitas, A., Bandeira, A., Nobrega, A., Coutinho, A., Marcos, M. A., and
Minoprio, P. (1996a). Murine acariasis. II. Immunological dysfunction and evidence for
chronic activation of Th-2 lymphocytes. Scand J Immunol 43, 604-612.
Jungmann, P., Guenet, J. L., Cazenave, P. A., Coutinho, A., and Huerre, M. (1996b).Murine acariasis: I. Pathological and clinical evidence suggesting cutaneous allergy and
wasting syndrome in BALB/c mouse. Res Immunol 147, 27-38.
Jürgens, M., Wollenberg, A., Hanau, D., de la Salle, H., and Bieber, T. (1995). Activation
of human epidermal Langerhans cells by engagement of the high affinity receptor for IgE,Fc epsilon RI. J Immunol 755, 5184-5189.
Kalesnikoff, J., Huber, M., Lam, V., Damen, J. E., Zhang, J., Siraganian, R. P., and Krystal,G. (2001). Monomeric IgE stimulates signaling pathways in mast cells that lead to cytokine
production and cell survival. Immunity 14, 801-811.
Kawakami, T., and Galli, S. J. (2002). Regulation of mast-cell and basophil function and
survival by IgE. Nat Rev Immunol 2, 773-786.
Kay, A. B. (2001). Allergy and allergic diseases. First of two parts. N Engl J Med 344, 30-
37.
116 REFERENCES
Kinet, J. P. (1999). The high-affinity IgE receptor (Fc epsilon RI): from physiology to
pathology. Annu Rev Immunol 77, 931-972.
Kinet, J. P., Blank, U., Ra, C, White, K., Metzger, H., and Kochan, J. (1988). Isolation and
characterization of cDNAs coding for the beta subunit of the high-affinity receptor for
immunoglobulin E. Proc Natl Acad Sei U S A 55, 6483-6487.
Kitaura, J., Song, J., Tsai, M., Asai, K., Maeda-Yamamoto, M., Mocsai, A., Kawakami, Y.,
Liu, F. T., Lowell, C. A., Barisas, B. G., etal. (2003). Evidence that IgE molecules mediate
a spectrum of effects on mast cell survival and activation via aggregation of the
FcepsilonRI. Proc Natl Acad Sei U S A 700, 12911-12916.
Kopf, M., Brombacher, F., Hodgkin, P. D., Ramsay, A. J., Milbourne, E. A., Dai, W. J.,
Ovington, K. S., Behm, C. A., Kohler, G., Young, I. G, and Matthaei, K. I. (1996). IL-5-
deficient mice have a developmental defect in CD5+ B-l cells and lack eosinophilia but
have normal antibody and cytotoxic T cell responses. Immunity 4, 15-24.
Kopf, M., Le Gros, G., Bachmann, M., Lamers, M. C, Bluethmann, H., and Köhler, G.
(1993). Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature 362,245-248.
Kraft, S., Novak, N., Katoh, N., Bieber, T., and Rupee, R. A. (2002a). Aggregation of the
high-affinity IgE receptor Fc(epsilon)RI on human monocytes and dendritic cells induces
NF-kappaB activation. J Invest Dermatol 775, 830-837.
Kraft, S., Wessendorf, J. H., Haberstok, J., Novak, N., Wollenberg, A., and Bieber, T.
(2002b). Enhanced expression and activity of protein-tyrosine kinases establishes a
functional signaling pathway only in FcepsilonRIhigh Langerhans cells from atopicindividuals. J Invest Dermatol 779, 804-811.
Kraft, S., Wessendorf, J. H., Hanau, D., and Bieber, T. (1998). Regulation of the highaffinity receptor for IgE on human epidermal Langerhans cells. J Immunol 161, 1000-1006.
Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., and
Pluckthun, A. (1997). Reliable cloning of functional antibody variable domains from
hybridomas and spleen cell repertoires employing a reengineered phage display system. J
Immunol Methods 207, 35-55.
Kubo, S., Matsuoka, K., Taya, C, Kitamura, F., Takai, T., Yonekawa, H., and Karasuyama,H. (2001). Drastic up-regulation of Fcepsilonri on mast cells is induced by IgE binding
through stabilization and accumulation of Fcepsilonri on the cell surface. J Immunol 167,3427-3434.
Kulczycki, A., Jr., and Metzger, H. (1974). The interaction of IgE with rat basophilicleukemia cells. II. Quantitative aspects of the binding reaction. J Exp Med 140, 1676-1695.
Küster, H., Thompson, H., and Kinet, J. P. (1990). Characterization and expression of the
gene for the human Fc receptor gamma subunit. Definition of a new gene family. J Biol
Chem 265, 6448-6452.
REFERENCES 117
Laltoo, H., Van Zoost, T., and Kind, L. S. (1979). IgE antibody response to mite antigens in
mite infested mice. Immunol Commun 5, 1-9.
Lantz, C. S., Yamaguchi, M., Oettgen, H. C, Katona, I. M., Miyajima, L, Kinet, J. P., and
Galli, S. J. (1997). IgE regulates mouse basophil Fc epsilon RI expression in vivo. J
Immunol 755,2517-2521.
Laske, N., and Niggemann, B. (2004). Does the severity of atopic dermatitis correlate with
serum IgE levels? Pediatr Allergy Immunol 75, 86-88.
Leonard, W. J. (2002). TSLP: finally in the limelight. Nat Immunol 3, 605-607.
Letourneur, F., Hennecke, S., Demolliere, C, and Cosson, P. (1995a). Steric masking of a
dilysine endoplasmic reticulum retention motif during assembly of the human high affinity
receptor for immunoglobulin E. J Cell Biol 729, 971-978.
Letourneur, O., Sechi, S., Willette-Brown, J., Robertson, M. W., and Kinet, J. P. (1995b).Glycosylation of human truncated Fc epsilon RI alpha chain is necessary for efficient
folding in the endoplasmic reticulum. J Biol Chem 270, 8249-8256.
Levine, B. B., and Vaz, N. M. (1970). Effect of combinations of inbred strain, antigen, and
antigen dose on immune responsiveness and reagin production in the mouse. A potentialmouse model for immune aspects of human atopic allergy. Int Arch Allergy Appl Immunol
39, 156-171.
Levy, D. A. (2004). Parasites and Allergy: From IgE to Thl/Th2 and Beyond. Clin Rev
Allergy Immunol 26, 1-4.
Liew, F. Y. (2002). T(H)1 and T(H)2 cells: a historical perspective. Nat Rev Immunol 2,55-60.
Lin, S., Cicala, C, Scharenberg, A. M., and Kinet, J. P. (1996). The Fc(epsilon)RIbetasubunit functions as an amplifier of Fc(epsilon)RIgamma-mediated cell activation signals.Cell 55, 985-995.
Litinskiy, M. B., Nardelli, B., Hubert, D. M., He, B., Schaffer, A., Casali, P., and Cerutti,A. (2002). DCs induce CD40-independent immunoglobulin class switching through BLySand APRIL. Nat Immunol 3, 822-829.
Liu, Z. J., Haleem-Smith, H., Chen, H., and Metzger, H. (2001). Unexpected signals in a
system subject to kinetic proofreading. Proc Natl Acad Sei U S A 95, 7289-7294.
Lloyd, C. M., Gonzalo, J. A., Coyle, A. J., and Gutierrez-Ramos, J. C. (2001). Mouse
models of allergic airway disease. Adv Immunol 77, 263-295.
Maenaka, K., van derMerwe, P. A., Stuart, D. I., Jones, E. Y., and Sondermann, P. (2001).The human low affinity Fcgamma receptors IIa, IIb, and III bind IgG with fast kinetics and
distinct thermodynamic properties. J Biol Chem 276, 44898-44904.
118 REFERENCES
Malaviya, R., Twesten, N. J., Ross, E. A., Abraham, S. N., and Pfeifer, J. D. (1996). Mast
cells process bacterial Ags through a phagocytic route for class IMHC presentation to T
cells. J Immunol 156, 1490-1496.
Marsh, D. G, Hsu, S. H., Roebber, M., Ehrlich-Kautzky, E., Freidhoff, L. R., Meyers, D.
A., Pollard, M. K., and Bias, W. B. (1982). HLA-Dw2: a genetic marker for human
immune response to short ragweed pollen allergen Ra5.1. Response resulting primarilyfrom natural antigenic exposure. J Exp Med 755, 1439-1451.
Marsh, D. G, Neely, J. D., Breazeale, D. R., Ghosh, B., Freidhoff, L. R., Ehrlich-Kautzky,E., Schou, C, Krishnaswamy, G., and Beaty, T. H. (1994). Linkage analysis of IL4 and
other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations.
Science 264, 1152-1156.
Matricardi, P. M., Rosmini, F., Riondino, S., Fortini, M., Ferrigno, L., Rapicetta, M., and
Bonini, S. (2000). Exposure to foodborne and orofecal microbes versus airborne viruses in
relation to atopy and allergic asthma: epidemiological study. Bmj 320, 412-417'.
Matsuda, H., Watanabe, N., Geba, G. P., Sperl, J., Tsudzuki, M., Hiroi, J., Matsumoto, M.,
Ushio, H., Saito, S., Askenase, P. W., and Ra, C. (1997). Development of atopic dermatitis¬
like skin lesion with IgE hyperproduction in NC/Nga mice. Int Immunol 9, 461-466.
Maurer, D., Ebner, C, Reininger, B., Fiebiger, E., Kraft, D., Kinet, J. P., and Stingl, G.
(1995). The high affinity IgE receptor (Fc epsilon RI) mediates IgE-dependent allergen
presentation. J Immunol 154, 6285-6290.
Maurer, D., Fiebiger, E., Reininger, B., Ebner, C, Petzelbauer, P., Shi, G. P., Chapman, H.
A., and Stingl, G. (1998). Fc epsilon receptor I on dendritic cells delivers IgE-boundmultivalent antigens into a cathepsin S-dependent pathway ofMHC class II presentation. J
Immunol 161,2131-2139.
Maurer, D., Fiebiger, E., Reininger, B., Wolff-Winiski, B., Jouvin, M. H., Kilgus, O.,
Kinet, J. P., and Stingl, G. (1994). Expression of functional high affinity immunoglobulin E
receptors (Fc epsilon RI) on monocytes of atopic individuals. J Exp Med 779, 745-750.
Maurer, D., Fiebiger, S., Ebner, C, Reininger, B., Fischer, G. F., Wichlas, S., Jouvin, M.
H., Schmitt-Egenolf, M., Kraft, D., Kinet, J. P., and Stingl, G. (1996). Peripheral blood
dendritic cells express Fc epsilon RI as a complex composed of Fc epsilon RI alpha- and Fc
epsilon RI gamma-chains and can use this receptor for IgE-mediated allergen presentation.J Immunol 757, 607-616.
Messner, B., Stutz, A. M., Albrecht, B., Peiritsch, S., and Woisetschlager, M. (1997).
Cooperation of binding sites for STAT6 and NF kappa B/rel in the IL-4-induced up¬
regulation of the human IgE germline promoter. J Immunol 759, 3330-3337.
Metzger, H., Alcaraz, G., Hohman, R., Kinet, J. P., Pribluda, V., and Quarto, R. (1986).The receptor with high affinity for immunoglobulin E. Annu Rev Immunol 4, 419-470.
REFERENCES 119
Min, B., Prout, M., Hu-Li, J., Zhu, J., Jankovic, D., Morgan, E. S., Urban, J. F., Jr., Dvorak,A. M., Finkelman, F. D., LeGros, G., and Paul, W. E. (2004). Basophils produce IL-4 and
accumulate in tissues after infection with a Th2-inducing parasite. J Exp Med 200, 507-517.
Minty, A., Chalon, P., Derocq, J. M., Dumont, X., Guillemot, J. C, Kaghad, M., Labit, C,
Leplatois, P., Liauzun, P., Miloux, B., and et al. (1993). Interleukin-13 is a new human
lymphokine regulating inflammatory and immune responses. Nature 362, 248-250.
Mohapatra, S. S., and Lockey, R. F. (2001). Molecular characterization of allergens. Clin
Rev Allergy Immunol 27, 203-213.
Mombaerts, P., Mizoguchi, E., Grusby, M. J., Glimcher, L. H., Bhan, A. K., and Tonegawa,S. (1993). Spontaneous development of inflammatory bowel disease in T cell receptormutant mice. Cell 75, 274-282.
Moore, K. W., de Waal Malefyt, R., Coffman, R. L., and O'Garra, A. (2001). Interleukin-10
and the interleukin-10 receptor. Annu Rev Immunol 79, 683-765.
Morawetz, R. A., Gabriele, L., Rizzo, L. V., Noben-Trauth, N., Kuhn, R., Rajewsky, K.,
Müller, W., Doherty, T. M., Finkelman, F., Coffman, R. L., and Morse, H. C, 3rd (1996).Interleukin (IL)-4-independent immunoglobulin class switch to immunoglobulin (Ig)E in
the mouse. J Exp Med 184, 1651-1661.
Morita, E., Kaneko, S., Hiragun, T., Shindo, H., Tanaka, T., Furukawa, T., Nobukiyo, A.,and Yamamoto, S. (1999). Fur mites induce dermatitis associated with IgE hyperproductionin an inbred strain of mice, NC/Kuj. J Dermatol Sei 79, 37-43.
Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T.
(2000). Class switch recombination and hypermutation require activation-induced cytidinedeaminase (AID), a potential RNA editing enzyme. Cell 702, 553-563.
Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O.,and Honjo, T. (1999). Specific expression of activation-induced cytidine deaminase (AID),a novel member of the RNA-editing deaminase family in germinal center B cells. J Biol
Chem 274, 18470-18476.
Negrao-Correa, D. (2001). Importance of immunoglobulin E (IgE) in the protectivemechanism against gastrointestinal nematode infection: looking at the intestinal mucosae.
Rev Inst Med Trop Sao Paulo 43, 291-299.
Negrao-Correa, D., Adams, L. S., and Bell, R. G. (1996). Intestinal transport and
catabolism of IgE: a major blood-independent pathway of IgE dissemination during a
Trichinella spiralis infection of rats. J Immunol 757, 4037-4044.
Neuhaus-Steinmetz, U., Glaab, T., Daser, A., Braun, A., Lommatzsch, M., Herz, U., Kips,J., Alarie, Y., and Renz, H. (2000). Sequential development of airway hyperresponsivenessand acute airway obstruction in a mouse model of allergic inflammation. Int Arch AllergyImmunol 727, 57-67.
Novak, N., and Bieber, T. (2002). To bend or not to bend. Nat Immunol 3, 607-608.
120 REFERENCES
Novak, N., Kraft, S., and Bieber, T. (2003a). Unraveling the mission of FcepsilonRI on
antigen-presenting cells. J Allergy Clin Immunol 777, 38-44.
Novak, N., Tepel, C, Koch, S., Brix, K., Bieber, T., and Kraft, S. (2003b). Evidence for a
differential expression of the FcepsilonRIgamma chain in dendritic cells of atopic and
nonatopic donors. J Clin Invest 777, 1047-1056.
Ogilvie, B. M. (1964). Reagin-Like Antibodies In Animals Immune To Helminth Parasites.
Nature 204, 91-92.
Perez-Montfort, R., Kinet, J. P., and Metzger, H. (1983). A previously unrecognizedsubunit of the receptor for immunoglobulin E. Biochemistry 22, 5722-5728.
Phalipon, A., and Corthesy, B. (2003). Novel functions of the polymeric Ig receptor: well
beyond transport of immunoglobulins. Trends Immunol 24, 55-58.
Phillips, N. E., and Parker, D. C. (1983). Fc-dependent inhibition of mouse B cell
activation by whole anti-mu antibodies. J Immunol 730, 602-606.
Plaut, M., Pierce, J. H., Watson, C. J., Hanley-Hyde, J., Nordan, R. P., and Paul, W. E.
(1989). Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI
or to calcium ionophores. Nature 339, 64-67'.
Prausnitz, C. (1921). Studie über die Ueberempfindlichkeit. Zentralbl Bakteriol 86, 160-
169.
Prescott, S. L., Macaubas, C, Holt, B. J., Smallacombe, T. B., Loh, R., Sly, P. D., and Holt,P. G. (1998). Transplacental priming of the human immune system to environmental
allergens: universal skewing of initial T cell responses toward the Th2 cytokine profile. J
Immunol 160, 4730-4737.
Priquet, v. (1963). Allergic In: Gell PGH, Coombs RRA, eds. Clinical aspects of
immunology.
Pritchard, D. I. (1993). Immunity to helminths: is too much IgE parasite—rather than host-
protective? Parasite Immunol 75, 5-9.
Prussin, C, and Metcalfe, D. D. (2003). 4. IgE, mast cells, basophils, and eosinophils. J
Allergy Clin Immunol 777, S486-494.
Pruzansky, J. J., and Patterson, R. (1986). Binding constants of IgE receptors on human
blood basophils for IgE. Immunology 55, 257-262.
Punnonen, J., Aversa, G., Cocks, B. G., McKenzie, A. N., Menon, S., Zurawski, G., de
Waal Malefyt, R., and de Vries, J. E. (1993). Interleukin 13 induces interleukin 4-
independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl
Acad Sei U S A 90, 3730-3734.
REFERENCES 121
Ra, C, Jouvin, M. H., and Kinet, J. P. (1989). Complete structure of the mouse mast cell
receptor for IgE (Fc epsilon RI) and surface expression of chimeric receptors (rat-mouse-human) on transfected cells. J Biol Chem 264, 15323-15327.
Ravetch, J. V., and Bolland, S. (2001). IgG Fc receptors. Annu Rev Immunol 79, 275-290.
Regnault, A., Lankar, D., Lacabanne, V., Rodriguez, A., Thery, C, Rescigno, M., Saito, T.,
Verbeek, S., Bonnerot, C, Ricciardi-Castagnoli, P., and Amigorena, S. (1999). Fcgammareceptor-mediated induction of dendritic cell maturation and major histocompatibility
complex class I-restricted antigen presentation after immune complex internalization. J ExpMed 759, 371-380.
Renshaw, B. R., Fanslow, W. C, 3rd, Armitage, R. J., Campbell, K. A., Liggitt, D., Wright,B., Davison, B. L., and Maliszewski, C. R. (1994). Humoral immune responses in CD40
ligand-deficient mice. J Exp Med 750, 1889-1900.
Rigby, L. J., Trist, H., Snider, J., Hulett, M. D., Hogarth, P. M., and Epa, V. C. (2000).Monoclonal antibodies and synthetic peptides define the active site of FcepsilonRI and a
potential receptor antagonist. Allergy 55, 609-619.
Rihet, P., Demeure, C. E., Bourgois, A., Prata, A., and Dessein, A. J. (1991). Evidence for
an association between human resistance to Schistosoma mansoni and high anti-larval IgElevels. Eur J Immunol 27, 2679-2686.
Riske, F., Hakimi, J., Mallamaci, M., Griffin, M., Pilson, B., Tobkes, N., Lin, P., Danho,
W., Kochan, J., and Chizzonite, R. (1991). High affinity human IgE receptor (Fc epsilonRI). Analysis of functional domains of the alpha-subunit with monoclonal antibodies. J
Biol Chem 266, 11245-11251.
Rivera, J., Kinet, J. P., Kim, J., Pucillo, C, and Metzger, H. (1988). Studies with a
monoclonal antibody to the beta subunit of the receptor with high affinity for
immunoglobulin E. Mol Immunol 25, 647-661.
Rook, G. A., and Stanford, J. L. (1998). Give us this day our daily germs. Immunol Today79, 113-116.
Schmitz, J., Thiel, A., Kuhn, R., Rajewsky, K., Muller, W., Assenmacher, M., and
Radbruch, A. (1994). Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is
not dependent on IL-4 from non-Th cells. J Exp Med 779, 1349-1353.
Schüler, G., and Steinman, R. M. (1985). Murine epidermal Langerhans cells mature into
potent immunostimulatory dendritic cells in vitro. J Exp Med 161, 526-546.
Seder, R. A., Paul, W. E., Dvorak, A. M., Sharkis, S. J., Kagey-Sobotka, A., Niv, Y.,
Finkelman, F. D., Barbieri, S. A., Galli, S. J., and Plaut, M. (1991). Mouse splenic and bone
marrow cell populations that express high-affinity Fc epsilon receptors and produceinterleukin 4 are highly enriched in basophils. Proc Natl Acad Sei U S A 55, 2835-2839.
Sepp, E., Julge, K., Vasar, M., Naaber, P., Bjorksten, B., and Mikelsaar, M. (1997).Intestinal microflora of Estonian and Swedish infants. Acta Paediatr 86, 956-961.
122 REFERENCES
Shea-Donohue, T., and Urban, J. F., Jr. (2004). Gastrointestinal parasite and host
interactions. Curr Opin Gastroenterol 20, 3-9.
Shin, E. H., Osada, Y., Chai, J. Y., Matsumoto, N., Takatsu, K., and Kojima, S. (1997).Protective roles of eosinophils in Nippostrongylus brasiliensis infection. Int Arch AllergyImmunol 114 Suppl 1, 45-50.
Simister, N. E., and Mostov, K. E. (1989). An Fc receptor structurally related to MHC class
I antigens. Nature 337, 184-187.
Smith, D. H., Malone, D. C, Lawson, K. A., Okamoto, L. J., Battista, C, and Saunders, W.
B. (1997). A national estimate of the economic costs of asthma. Am J Respir Crit Care Med
156, 787-793.
Smurthwaite, L., Walker, S. N., Wilson, D. R., Birch, D. S., Merrett, T. G, Durham, S. R.,and Gould, H. J. (2001). Persistent IgE synthesis in the nasal mucosa of hay fever patients.Eur J Immunol 37, 3422-3431.
Soumelis, V., Reche, P. A., Kanzler, H., Yuan, W., Edward, G., Homey, B., Gilliet, M.,
Ho, S., Antonenko, S., Lauerma, A., etal. (2002). Human epithelial cells trigger dendritic
cell mediated allergic inflammation by producing TSLP. Nat Immunol 3, 673-680.
Sporik, R., Holgate, S. T., Platts-Mills, T. A., and Cogswell, J. J. (1990). Exposure to
house-dust mite allergen (Der p I) and the development of asthma in childhood. A
prospective study. N Engl J Med 323, 502-507.
Stewart, G. A., Thompson, P. J., and McWilliam, A. S. (1993). Biochemical properties of
aeroallergens: contributory factors in allergic sensitization? Pediatr Allergy Immunol 4,163-172.
Strachan, D. P. (1989). Hay fever, hygiene, and household size. Bmj 299, 1259-1260.
Sunyer, J., Anto, J. M., Tobias, A., and Burney, P. (1999). Generational increase of self-
reported first attack of asthma in fifteen industrialized countries. European Community
Respiratory Health Study (ECRHS). Eur Respir J 14, 885-891.
Sutton, B. J., and Gould, H. J. (1993). The human IgE network. Nature 366, 421-428.
Tada, T., Okumura, K., Platteau, B., Beckers, A., and Bazin, H. (1975). Half-lives of two
types of rat homocytotropic antibodies in circulation and in the skin. Int Arch Allergy ApplImmunoW5, 116-131.
Takai, T. (2002). Roles of Fc receptors in autoimmunity. Nat Rev Immunol 2, 580-592.
Takhar, P., Smurthwaite, L., Coker, H. A., Fear, D. J., Banfield, G. K., Carr, V. A.,
Durham, S. R., and Gould, H. J. (2005). Allergen drives class switching to IgE in the nasal
mucosa in allergic rhinitis. J Immunol 174, 5024-5032.
Tan, B. B., Weald, D., Strickland, I., and Friedmann, P. S. (1996). Double-blind controlled
trial of effect of housedust-mite allergen avoidance on atopic dermatitis. Lancet 347, 15-18.
REFERENCES 123
Tanaka, K., Okamoto, Y., Nagaya, Y., Nishimura, F., Takeoka, A., Hanada, S., Kohno, S.,and Kawai, M. (1988). A nasal allergy model developed in the guinea pig by intranasal
application of 2,4-toluene diisocyanate. Int Arch Allergy Appl Immunol 55, 392-397.
Tang, M. L., Kemp, A. S., Thorburn, J., and Hill, D. J. (1994). Reduced interferon-gammasecretion in neonates and subsequent atopy. Lancet 344, 983-985.
Toru, H., Kinashi, T., Ra, C, Nonoyama, S., Yata, J., and Nakahata, T. (1997). Interleukin-
4 induces homotypic aggregation of human mast cells by promoting LFA-l/ICAM-1
adhesion molecules. Blood 59, 3296-3302.
Turner, C. R., Andresen, C. J., Smith, W. B., and Watson, J. W. (1996). Characterization of
a primate model of asthma using anti-allergy/anti-asthma agents. Inflamm Res 45, 239-245.
Turner, H., and Kinet, J. P. (1999). Signalling through the high-affinity IgE receptor Fc
epsilonRI. Nature 402, B24-30.
Turner, K. J., Feddema, L., and Quinn, E. H. (1979). Non-specific potentiation of IgE by
parasitic infections in man. Int Arch Allergy Appl Immunol 55, 232-236.
Valent, P., Bevec, D., Maurer, D., Besemer, J., Di Padova, F., Butterfield, J. H., Speiser,W., Majdic, O., Lechner, K., and Bettelheim, P. (1991). Interleukin 4 promotes expressionof mast cell ICAM-1 antigen. Proc Natl Acad Sei U S A 55, 3339-3342.
Valentine, M. D. (1992). Anaphylaxis and stinging insect hypersensitivity. Jama 268, 2830-
2833.
van den Biggelaar, A. H., van Ree, R., Rodrigues, L. C, Lell, B., Deelder, A. M.,
Kremsner, P. G., and Yazdanbakhsh, M. (2000). Decreased atopy in children infected with
Schistosoma haematobium: a role for parasite-induced interleukin-10. Lancet 356, 1723-
1727.
Vercelli, D., Jabara, H. H., Arai, K., and Geha, R. S. (1989). Induction of human IgE
synthesis requires interleukin 4 and T/B cell interactions involving the T cell receptor/CD3
complex and MHC class II antigens. J Exp Med 169, 1295-1307.
Voehringer, D., Shinkai, K., and Locksley, R. M. (2004). Type 2 immunity reflects
orchestrated recruitment of cells committed to IL-4 production. Immunity 20, 267-277'.
von Bubnoff, D., Geiger, E., and Bieber, T. (2001). Antigen-presenting cells in allergy. J
Allergy Clin Immunol 705, 329-339.
von Mutius, E., Weiland, S. K., Fritzsch, C, Duhme, H., and Keil, U. (1998). Increasing
prevalence of hay fever and atopy among children in Leipzig, East Germany. Lancet 357,862-866.
Wan, T., Beavil, R. L., Fabiane, S. M., Beavil, A. J., Sohi, M. K., Keown, M., Young, R. J.,
Henry, A. J., Owens, R. J., Gould, H. J., and Sutton, B. J. (2002). The crystal structure of
IgE Fc reveals an asymmetrically bent conformation. Nat Immunol 3, 681-686.
124 REFERENCES
Wang, B., Rieger, A., Kilgus, O., Ochiai, K., Maurer, D., Fodinger, D., Kinet, J. P., and
Stingl, G. (1992). Epidermal Langerhans cells from normal human skin bind monomeric
IgE via Fc epsilon RI. J Exp Med 775, 1353-1365.
Wang, H. W., Tedla, N., Lloyd, A. R., Wakefield, D., and McNeil, P. H. (1998). Mast cell
activation and migration to lymph nodes during induction of an immune response in mice. J
Clin Invest 702, 1617-1626.
Wang, L. F., Lin, J. Y., Hsieh, K. H., and Lin, R. H. (1996). Epicutaneous exposure of
protein antigen induces a predominant Th2-like response with high IgE production in mice.
J Immunol 156, 4077-4082.
Warner, J. A., Jones, C. A., Jones, A. C, and Warner, J. O. (2000). Prenatal origins of
allergic disease. J Allergy Clin Immunol 705, S493-498.
Watanabe, N., Katakura, K., Kobayashi, A., Okumura, K., and Ovary, Z. (1988). Protective
immunity and eosinophilia in IgE-deficient SJA/9 mice infected with Nippostrongylusbrasiliensis and Trichinella spiralis. Proc Natl Acad Sei U S A 55, 4460-4462.
Wedemeyer, J., Tsai, M., and Galli, S. J. (2000). Roles of mast cells and basophils in innate
and acquired immunity. Curr Opin Immunol 72, 624-631.
Weisbroth, S. H., Friedman, S., and Scher, S. (1976). The parasitic ecology of the rodent
mite, Myobia musculi. III. Lesions in certain host strains. Lab Anim Sei 26, 725-735.
Wills-Karp, M., Santeliz, J., and Karp, C. L. (2001). The germless theory of allergicdisease: revisiting the hygiene hypothesis. Nat Rev Immunol 7, 69-75.
Wilson, D. R., Merrett, T. G., Varga, E. M., Smurthwaite, L., Gould, H. J., Kemp, M.,
Hooper, J., Till, S. J., and Durham, S. R. (2002). Increases in allergen-specific IgE in BAL
after segmental allergen challenge in atopic asthmatics. Am J Respir Crit Care Med 165,22-26.
Yamaguchi, M., Lantz, C. S., Oettgen, H. C, Katona, I. M., Fleming, T., Miyajima, I.,
Kinet, J. P., and Galli, S. J. (1997). IgE enhances mouse mast cell Fc(epsilon)RI expressionin vitro and in vivo: evidence for a novel amplification mechanism in IgE-dependentreactions. J Exp Med 755, 663-672.
Yanagihara, Y., Kajiwara, K., Basaki, Y., Ikizawa, K., Ebisawa, M., Ra, C, Tachimoto, H.,and Saito, H. (1998). Cultured basophils but not cultured mast cells induce human IgE
synthesis in B cells after immunologic stimulation. Clin Exp Immunol 777, 136-143.
Yazdanbakhsh, M., Kremsner, P. G., and van Ree, R. (2002). Allergy, parasites, and the
hygiene hypothesis. Science 296, 490-494.
Ying, S., Humbert, M., Barkans, J., Corrigan, C. J., Pfister, R., Menz, G., Lärche, M.,
Robinson, D. S., Durham, S. R., and Kay, A. B. (1997). Expression of IL-4 and IL-5
mRNA and protein product by CD4+ and CD8+ T cells, eosinophils, and mast cells in
bronchial biopsies obtained from atopic and nonatopic (intrinsic) asthmatics. J Immunol
755, 3539-3544.
REFERENCES 125
Yoshimoto, T., and Paul, W. E. (1994). CD4pos, NKl.lpos T cells promptly produceinterleukin 4 in response to in vivo challenge with anti-CD3. J Exp Med 779, 1285-1295.
126 REFERENCES
Acknowledgements 127
Acknowledgements
Als erstes möchte ich mich bei Hans Hengartner und Rolf Zinkernagel bedanken, die mich
in ihre Arbeitsgruppe aufgenommen haben und mir die Möglichkeit gaben, meine
Doktorarbeit in ihrem Institut durchzuführen. Ein besonderer Dank gilt meinem
Doktorvater, Hans Hengartner, der mir stets sein Vertrauen zu spüren gab.
Most of all I would like to thank my super-supervisor, Kathy McCoy, for her enormous
support, constant encouragements, and tireless smile during the entire time of my thesis. I
am extremely grateful for her invaluable help, be it in practical lab-work, project
discussions, or thesis proofreading. Kathy not only taught me a great deal about
immunology, but was also the most fun boss I could ever hope to work with!
I will never forget the glorious time of the Girls' Lab G43! I wish to thank the fabulous
girls Marianne Martinic, Kathy McCoy, Nicola Harris, and Nathalie Oetiker, who besides
being great lab-mates also became good friends. The coffee-breaks, dinners, parties, and
above all many, many laughs created a fantastic atmosphere, and I consider myself
extremely lucky for having worked in such a great environment.
Herzlichen Dank an meine PhD-mates Raphael Zellweger, Katja Fink und Philippe Krebs
für die gute Stimmung, die wir während der letzten vier Jahre untereinander hatten, sowie
für die genüsslichen Gourmet-PhD-Treffen. Un grand merci speziell an Rafi, der in der
strengen Abschlussphase dieser Doktorarbeit immer für gute Unterhaltung und Glacé-
Pausen zu haben war.
Ein grosser Dank gilt Sarah Hatak für die wertvolle Hilfe bei den unendlichen ELISAs
sowie gegen schlechte Haltung und verspannten Nacken.
Ich möchte mich herzlich bei Pascale Ohnsorg bedanken, weil sie mir erlaubte, meine
„Supervisor"-Fähigkeiten zu trainieren, und weil sie immer so wunderbar unkompliziert
war.
128 Acknowledgements
I wish to thank all the members of Expimm for keeping the institute together and making it
so diverse and special. I am grateful for the help and support from all of you, and for those
valuable interactions, which have made my time here an enriching experience. Many thanks
to the jogging-crew for such energy-reloading and entertaining breaks, and to the computer-
experts for countless IT-support.
Ganz besonders möchte ich mich bei meinen Eltern bedanken, für ihre grenzenlose
Unterstützung und enormes Vertrauen. Mamo i Tato dziekuje Warn bardzo!
Meinem Freund, Beat Sigrist, bin ich dafür, dass er mir stets Unterstützung, Kraft, Mut,
Freude und Liebe schenkt (und jeden Morgen das feine Müsli zubereitet!) zutiefst dankbar.
Curriculum Vitae
Curriculum Vitae
Personal
Name
Date of birth
Place of birth
Nationality
Marital status
Work address
Home address
Languages
Veronika Pochanke
07.09.1975
Bielsko-Biala, Poland
Swiss and Polish
single
Institute of Experimental Immunology
University Hospital Zürich
Schmelzbergstrasse 12
8091 Zürich, Switzerland
Phone:+41 (0)44 255 27 34
FAX:+41 (0)44 255 44 20
e-mail: [email protected]
Waffenplatzstrasse 51
8002 Zürich, Switzerland
German, English, French, Polish, Esperanto
Education
2001 to present
2000-2001
1996-2000
1998 - 1999
1991-1996
Doctoral thesis: "The Interplay of IgE and its High
Affinity Receptor FcsRI" at the Institute of
Experimental Immunology of the University Hospitaland the Swiss Federal Institute of Technology ETH,
Zürich, Switzerland, under the supervision of Prof. Dr.
Hans Hengartner and Dr. Kathy D. McCoy
Diploma thesis: "Analysis of Gene Silencing in StablyTransfected Cell Lines" at the Laboratory of Molecular
Biotechnology LBTM of the University of Lausanne,
Switzerland, under the supervision of Prof. Dr. Nicolas
Mermod - Faculty Award (Prix de Faculté)
Studies in Biology at the University of Lausanne,Switzerland
Exchange student in Biology at the University of South
Carolina, Columbia, USA - President's Honor List,Dean's Honor List
Gymnasium Typus C, Kantonsschule am Burggraben,St. Gallen, Switzerland