Download - Supplementary Information Riboswitches in eubacteria sense ... · Nelson et al. and Breaker c-di-AMP Riboswitches Supplementary Information Riboswitches in eubacteria sense the second

Nelson et al. and Breaker c-di-AMP Riboswitches

Supplementary Information

Riboswitches in eubacteria sense the

second messenger c-di-AMP

James W. Nelson1, Narasimhan Sudarsan

2,3, Kazuhiro Furukawa

3,*, Zasha

Weinberg2,3

, Joy X. Wang3,**

, Ronald R. Breaker2,3,4

†

1Department of Chemistry, Yale University, Box 208107, New Haven, CT 06520,

USA 2Howard Hughes Medical Institute,

3Department of Molecular, Cellular and

Developmental Biology, Yale University, Box 208103, New Haven, CT 06520, USA. 4Department of Molecular Biophysics and Biochemistry, Yale University, Box

208103, New Haven, CT 06520, USA.

Current addresses: *Faculty of Pharmaceutical Sciences, The University of

Tokushima, Tokushima, Japan; **Center for Clinical and Translational

Metagenomics, Brigham and Women's Hospital, Boston, MA 02115

† To whom correspondence should be addressed. E. mail: [email protected]

Dr. Ronald R. Breaker

Tel: (203) 432-9389

Fax: (203) 432-0753

E-mail: [email protected]

Nature Chemical Biology: doi:10.1038/nchembio.1363

mailto:[email protected]


Supplementary Results

Supplementary Figure 1│In-line probing of 165 ydaO RNA with yeast extract. a,

Pattern of spontaneous cleavage resulting from equilibrium dialysis/in-line probing of the

B. subtilis 165 ydaO RNA in the absence of any added compounds or in the presence of

specific dilutions of yeast extract. Annotations, including the sites of structural

modulation, are as described in the legend for Fig. 1d. b, Mass spectrometry of an HPLC

fraction that induces 165 ydaO RNA conformational change (active fraction) and an

adjacent fraction that does not induce conformational change (inactive fraction). The

most prominent peak unique to the active fraction (arrow) corresponds to the mass (m/z =

346.0554 for the [M-H]- ion) of adenosine monophosphate. MS/MS analysis (data not

shown) further suggested that this compound was either adenosine 5′ monophosphate, or

one of its close structural isomers (adenosine 2′- or 3′-monophosphate). Given our

previous examination and exclusion of 5´ AMP as a biologically relevant ligand for ydaO

RNAs5, we hypothesized that the natural ligand included an AMP moiety that was not

stable under the ionization conditions used for mass spectrometry, leading us to test a

wide variety of potential ligand candidates (Supplementary Fig. 2), including c-di-AMP.



Supplementary Figure 2│Screening for analogs of 5´ AMP that are bound by the B.

subtilis 165 ydaO RNA. Depicted are the regions of several in-line probing gels

corresponding to the sites of modulation denoted 1 and 2 as described in Fig. 1d. The

concentrations used for each compound in the box are 0.01, 0.1 and 1 mM, and these

results are compared to that for c-di-AMP at 0.01 mM. 5´ IMP denotes inosine-5´-

monophosphate and A 5´PS denotes adenosyl-5´-phosphosulfate. Other annotations are

as described in the legend to Fig. 1d.



Supplementary Figure 3│In-line probing of the 165 ydaO RNA in the absence and

presence of 100 nM c-di-AMP. This data (see the legend to Fig. 1 for details) was used

in conjunction with the data in Fig. 1d to map the sites of spontaneous cleavage. Note

that some sites of spontaneous cleavage (occurring 3´ of the nucleotide identified) can

only be estimated due to low resolution of the gels (particularly sites closer to the 3´

terminus of the construct).



Supplementary Figure 4 (Part 1)│Ligand binding by the yuaA RNA from B. subtilis. a, PAGE analysis in-line probing reactions using 150 yuaA RNA from B. subtilis exposed

to various concentrations of c-di-AMP (100 pM to 10 μM) or ATP (17.8 μM to 3.16

mM). Methods and annotations are as described for Fig. 1d.



Supplementary Figure 4 (Part 2)│b, Sequence, secondary structure, and structural

modulation of the 150 yuaA RNA from B. subtilis. Locations were mapped using the data

in a. c, Plot of the fraction of riboswitch RNA bound to ligand versus the logarithm of the

molar concentration of c-di-AMP as inferred from the modulation of spontaneous

cleavage products in a. The KD value of this riboswitch for c-di-AMP is ~450 pM, and

the curve is consistent with that expected for a one-to-one binding interaction between

RNA and ligand.



Supplementary Figure 5│Examining the KD for the 165 ydaO construct by in-line

probing using an RNA concentration near the lower limit of detection (~0.1 nM). a,

PAGE analysis of an in-line probing assay with 165 ydaO RNA from B. subtilis exposed

to various concentrations of c-di-AMP (5 pM to 100 nM). Methods and annotations are

as described for Fig. 1d. b, Plot of the fraction of riboswitch RNA bound to ligand versus

the logarithm of the molar concentration of c-di-AMP as inferred from the modulation of

spontaneous cleavage products in a. Note that half maximal modulation occurs at ~100

pM but that the curve remains steeper than that expected for a 1-to-1 interaction,

suggesting that the RNA concentration remains higher than the KD for ligand binding.



Supplementary Figure 6│In-line probing analysis of the 144 ydaO RNA construct

from B. subtilis. a, Sequence and secondary structure model for the 144 ydaO RNA from

B. subtilis. b, PAGE analysis of an in-line probing assay with 144 ydaO RNA exposed to

various concentrations of c-di-AMP (100 pM to 10 μM) or ATP (17.8 μM to 3.16 mM).

Other annotations are as described in the legend to Fig. 1d. c, Plot of the fraction of

RNAs undergoing structural modulation versus the logarithm of the concentration of c-

di-AMP. Values were derived by evaluating the bands undergoing changes in b. Error

bars are the standard deviation of the normalized fraction modulated for bands 1, 2 and 5.



Supplementary Figure 7│Modulation of a c-di-AMP riboswitch from B. subtilis by

c-di-AMPSS, a phosphorothioate-modified analog of c-di-AMP. a, Chemical structure

of c-di-AMPSS. b, PAGE analysis of an in-line probing assay of ydaO 165 exposed to

various concentrations of c-di-AMPSS (100 pM to 100 μM). Annotations are as described

in the legend to Fig. 1d. c, Plot of the fraction of RNAs undergoing structural modulation

versus the logarithm of the concentration of c-di-AMPSS. Values were derived by

evaluating the bands undergoing changes in b. Note that, although the calculated KD is

approximately 7 nM, this is near the expected concentration of RNA in the reaction tubes.

Therefore, the actual KD is most likely lower than this value.



Supplementary Figure 8│Evidence of preferential c-di-AMP binding by a ydaO

RNA representative from Nostoc punctiforme. a, PAGE analysis of an in-line probing

assay with 139 ydaO RNA from Nostoc punctiforme that was exposed to various

concentrations of c-di-AMP or to 1 mM ATP. Vertical lines identify in-line probing

products whose amounts change on addition of c-di-AMP. Methods and other annotations

are as described for Fig. 1d. b, Sequence, secondary structure, and structural modulation

of the 139 ydaO RNA from N. punctiforme. Locations were mapped using the data in a.

c, Plot of the fraction of riboswitch RNA bound to ligand versus the logarithm of the

molar concentration of c-di-AMP as inferred from the modulation of spontaneous

cleavage products in a. The KD value of this riboswitch for c-di-AMP is ~30 nM, and the

curve depicted is that expected for a one-to-one binding interaction between RNA and

ligand.




RNA representative from Syntrophus aciditrophicus. a, PAGE analysis of an in-line

probing assay with 137 ydaO RNA from Syntrophus aciditrophicus exposed to various

concentrations of c-di-AMP or 1 mM ATP. Methods and annotations are as described for

Supplementary Fig. 8. b, Sequence, secondary structure, and structural modulation of

the 137 ydaO RNA from S. aciditrophicus. Locations were mapped using the data in a. c,

Plot of the fraction of riboswitch RNA bound to ligand versus the logarithm of the molar

concentration of c-di-AMP as inferred from the modulation of spontaneous cleavage

products in a. The KD value of this riboswitch for c-di-AMP is ~550 pM, and the curve

depicted is that expected for a one-to-one binding interaction between RNA and ligand.




RNA representative from Clostridium acetobutylicum. a, PAGE analysis of an in-line

probing assay with 130 ydaO RNA from Clostridium acetobutylicum exposed to various

concentrations of c-di-AMP or 1 mM ATP. Methods and annotations are as described for

Supplementary Fig. 8.b, Sequence, secondary structure, and structural modulation of the

130 ydaO RNA from C. acetobutylicum. Locations were mapped using the data in a. c,

Plot of the fraction of riboswitch RNA bound to ligand versus the logarithm of the molar

concentration of c-di-AMP as inferred from the modulation of spontaneous cleavage

products in a. The KD value of this riboswitch for c-di-AMP is ~1 nM, and the curve

depicted is that expected for a one-to-one binding interaction between RNA and ligand.



Supplementary Figure 11│In-line probing analysis of the 165 ydaO RNA construct

from B. subtilis under sub-optimal conditions. a, PAGE analysis of an in-line probing

assay with ydaO RNA from B. subtilis exposed to various concentrations of c-di-AMP

and ATP with 10 mM MgCl2 and at 37 °C for 16 hours. Methods and other annotations

are as described for Fig. 1d. b, Plot of the fraction of riboswitch RNA bound to ligand

versus the logarithm of the molar concentration of c-di-AMP as inferred from the

modulation of spontaneous cleavage products in a at sites 1, 2, and 3. Not unexpectedly,

the KD of c-di-AMP has increased relative to that obtained under standard in-line probing

conditions to 10 nM. Importantly, however, no consistent modulation with ATP is

observed at concentrations even as high as 5 mM.



Supplementary Figure 12│Riboswitch-mediated gene expression with constructs

driven by different promoters. a, Construct design wherein the promoter (P) is either

the native promoter for the ydaO gene, or the promoter for the B. subtilis lysC gene. b,

Predicted intrinsic transcription terminator stem for the B. subtilis ydaO riboswitch and

its fusion to the lacZ reporter gene. c, Plot of the amount of reporter gene (see b)

expression observed in B. subtilis YP79 cells carrying a knock-out of the disA gene,

normalized to the level observed with unaltered B. subtilis cells, grown in lysogeny broth.

Error bars are the standard deviation of three independent measurements.



Supplementary Figure 13 (previous page)│Genomic locations of c-di-AMP

riboswitches in several organisms. Each riboswitch occurs singularly (denoted by hairpin

annotation), but in some instances appears to control the expression of several genes in an

operon. For representative 3 in B. anthracis, the gene with the asterisk indicates the

presence of an unannotated pseudogene with sequence similarity to a portion of potE (a

putrescine transporter). This possible gene is followed by a large intergenic region and

then the gene for hemolytic enterotoxin HBL (not depicted). The gene name for yuaA

(now ktrA) has been updated in response to recent protein function studies61

, while ydaO

has been renamed potE due to its similarity to this gene as determined by Protein-

BLAST.

The riboswitch locations in these organisms are typical of the patterns of associations

observed between c-di-AMP riboswitches and the genes they likely control among

diverse bacterial lineages. For example, c-di-AMP riboswitches almost exclusively

control genes involved in cell wall metabolism in Actinobacteria, whereas members of

this same riboswitch class in Cyanobacteria and Bacillales appear to control genes more

directly related to overcoming osmotic stress.



Supplementary Figure 14 (previous page)│In-line probing of the 165 ydaO RNA in

increasing concentrations of c-di-AMP or ATP. Polyacrylamide gel electrophoresis

(PAGE) analysis of an in-line probing assay with 165 ydaO RNA exposed to various

concentrations of c-di-AMP (100 pM to 10 μM in half-log intervals) or ATP (17.8 μM to

3.16 mM in quarter-log intervals). NR, T1 and ‒

OH designate no reaction, partial

digestion with either RNase T1 (cleaves after guanosine nucleotides) or hydroxide ions

(cleaves after any nucleotide),. Precursor RNA (Pre) and certain RNase T1 cleavage

product bands are identified. Locations of spontaneous RNA cleavage changes brought

about by c-di-AMP (regions 1 through 6) are identified by asterisks. This is the full

length gel presented in part in Fig. 1d in the main text.



Supplementary Figure 15 │Mutation of conserved nucleotides in the 165 ydaO RNA

abolishes c-di-AMP binding. In-line probing analyses of WT and M1 through M4

RNAs in the absence (‒ ) or presence of 10 nM c-di-AMP. This is the full length image

of the gel sections presented in Fig. 2c and Fig. 2d.



Supplementary Figure 16│Deletion of the pseudoknot in 165 ydaO RNA abolishes

ATP binding and modestly reduces c-di-AMP binding. In-line probing analysis of M5

in the absence (‒ ) of ligand, or presence of increasing c-di-AMP or 1 mM ATP. The gel

images depict the region encompassing sites 1 through 6 with annotations as described

for Fig. 1d. This is the full gel presented in Fig. 2d.



Supplementary Figure 17│In vitro transcription termination of the yuaA RNA. PAGE analysis of an in vitro transcription termination assay using the yuaA riboswitch

from B. subtilis. T is the riboswitch-terminated RNA transcript and FL is the full-length

run-off transcript. M is a marker lane comprising the transcription products from a similar

DNA template encoding the riboswitch plus six additional nucleotides beyond the

predicted terminator site. This is the full length gel presented in Fig. 3a. Note that the

additional lane at the right of the gel is not present in the cropped image, as it is simply

the same reaction presented in the marker lane.



Supplementary Table 1. Category assignment of genes for protein domains

controlled by c-di-AMP riboswitches. Genes predicted to be controlled by the c-di-

AMP riboswitch were manually assigned to one of several categories listed below based

on the description of domain(s) within that gene from the conserved domain database

(see Materials and Methods). Genes that are not grouped into these categories are not

shown here, but can be found in the Supplementary Online Material file. These categories

are the basis for Fig. 4.

Category Domain

accession

Brief description (from the Conserved Domain Database)

Amino Acid

Metabolism

cd00245 Coenzyme B12-dependent glutamate mutase epsilon

subunit-like family; contains proteins similar to

Clostridium cochlearium glutamate mutase (Glm) and

Streptomyces tendae Tu901 NikV.

cd00712 Glutamine amidotransferases class-II (GATase)

asparagine synthase_B type.

cd01991 The C-terminal domain of Asparagine Synthase B.

cd04732 HisA.

COG0289 Dihydrodipicolinate reductase [Amino acid transport and

metabolism]

COG1509 Lysine 2,3-aminomutase [Amino acid transport and

metabolism]

TIGR00036 dihydrodipicolinate reductase.

TIGR00653 glutamine synthetase, type I.

Amino Acid

Transporters

cd03262 HisP and GlnQ are the ATP-binding components of the

bacterial periplasmic histidine and glutamine permeases,

respectively.

COG0531 Amino acid transporters [Amino acid transport and

metabolism]

COG0833 Amino acid transporters [Amino acid transport and

metabolism]

COG1174 ABC-type proline/glycine betaine transport systems,

permease component [Amino acid transport and

metabolism]

COG1732 Periplasmic glycine betaine/choline-binding (lipo)protein

of an ABC-type transport system (osmoprotectant binding

protein) [Cell envelope biogenesis, outer membrane]

COG2113 ABC-type proline/glycine betaine transport systems,

periplasmic components [Amino acid transport and

metabolism]

pfam04069 Substrate binding domain of ABC-type glycine betaine

transport system.



TIGR00909 amino acid transporter.

Anion

Transporter

cd00625 Anion permease ArsB/NhaD.

cd02035 ArsA ATPase functions as an efflux pump located on the

inner membrane of the cell.

cd03293 NrtD and SsuB are the ATP-binding subunits of the

bacterial ABC-type nitrate and sulfonate transport

systems, respectively.

cd07042 Sulfate Transporter and Anti-Sigma factor antagonist

domain of SulP-like sulfate transporters, plays a role in

the function and regulation of the transport activity,

proposed general NTP binding function.

cd07043 Sulfate Transporter and Anti-Sigma factor antagonist)

domain of anti-anti-sigma factors, key regulators of anti-

sigma factors by phosphorylation.

COG0659 Sulfate permease and related transporters (MFS

superfamily) [Inorganic ion transport and metabolism]

COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems,

periplasmic components [Inorganic ion transport and

metabolism]

COG1392 Phosphate transport regulator (distant homolog of PhoU)

[Inorganic ion transport and metabolism]

TIGR01183 nitrate ABC transporter, permease protein.

Cell Wall

Metabolism

cd00118 Lysin domain, found in a variety of enzymes involved in

bacterial cell wall degradation.

cd00254 Lytic Transglycosylase (LT) and Goose Egg White

Lysozyme (GEWL) domain.

cd00761 Glycosyltransferase family A (GT-A) includes diverse

families of glycosyl transferases with a common GT-A

type structural fold.

cd01635 Glycosyltransferases catalyze the transfer of sugar

moieties from activated donor molecules to specific

acceptor molecules, forming glycosidic bonds.

cd02541 Prokaryotic UGPase catalyzes the synthesis of UDP-

glucose.

cd02549 A sub-family of peptidase family C39.

cd02874 Cortical fragment-lytic enzyme (CFLE) is a peptidoglycan

hydrolase involved in bacterial endospore germination.

cd03255 This family is comprised of MJ0796 ATP-binding

cassette, macrolide-specific ABC-type efflux carrier

(MacAB), and proteins involved in cell division (FtsE),

and release of lipoproteins from the cytoplasmic

membrane (LolCDE).



COG0308 Aminopeptidase N [Amino acid transport and

metabolism]

COG0702 Predicted nucleoside-diphosphate-sugar epimerases [Cell

envelope biogenesis, outer membrane / Carbohydrate

transport and metabolism]

COG0739 Membrane proteins related to metalloendopeptidases [Cell

envelope biogenesis, outer membrane]

COG0791 Cell wall-associated hydrolases (invasion-associated

proteins) [Cell envelope biogenesis, outer membrane]

COG0797 Lipoproteins [Cell envelope biogenesis, outer membrane]

COG1213 Predicted sugar nucleotidyltransferases [Cell envelope

biogenesis, outer membrane]

COG1652 Uncharacterized protein containing LysM domain

[Function unknown]

COG2317 Zn-dependent carboxypeptidase [Amino acid transport

and metabolism]

COG3409 Putative peptidoglycan-binding domain-containing protein

[Cell envelope biogenesis, outer membrane]

COG3773 Cell wall hydrolyses involved in spore germination [Cell

envelope biogenesis, outer membrane]

COG4942 Membrane-bound metallopeptidase [Cell division and

chromosome partitioning]

pfam00062 C-type lysozyme/alpha-lactalbumin family.

pfam00877 NlpC/P60 family.

pfam01435 Peptidase family M48.

pfam01464 Transglycosylase SLT domain.

pfam01471 Putative peptidoglycan binding domain.

pfam01551 Peptidase family M23.

pfam01943 Polysaccharide biosynthesis protein.

pfam06737 Transglycosylase-like domain.

pfam07486 Cell Wall Hydrolase.

PRK13914 invasion associated secreted endopeptidase; Provisional

TIGR00413 rare lipoprotein A.

TIGR02869 spore cortex-lytic enzyme.

TIGR02884 delta-lactam-biosynthetic de-N-acetylase.

TIGR02899 spore coat assembly protein SafA.

TIGR02917 putative PEP-CTERM system TPR-repeat lipoprotein.

Hypothetical

Osmoprotectant

cd01427 Haloacid dehalogenase-like hydrolases.

cd03788 Trehalose-6-Phosphate Synthase (TPS) is a



glycosyltransferase that catalyzes the synthesis of

alpha,alpha-1,1-trehalose-6-phosphate from glucose-6-

phosphate using a UDP-glucose donor.

COG1877 Trehalose-6-phosphatase [Carbohydrate transport and

metabolism]

pfam08472 Sucrose-6-phosphate phosphohydrolase C-terminal.

TIGR00685 trehalose-phosphatase.

Misc.

Transporters

cd00134 Bacterial periplasmic transport systems use membrane-

bound complexes and substrate-bound, membrane-

associated, periplasmic binding proteins (PBPs) to

transport a wide variety of substrates, such as, amino

acids, peptides, sugars, vitamins and inorganic ions.

cd00267 ABC (ATP-binding cassette) transporter nucleotide-

binding domain; ABC transporters are a large family of

proteins involved in the transport of a wide variety of

different compounds, like sugars, ions, peptides, and more

complex organic molecules.

cd00995 The substrate-binding domain of an ABC-type

nickel/oligopeptide-like import system contains the type 2

periplasmic binding fold.

cd01115 Permease SLC13 (solute carrier 13).

cd01116 Permease P (pink-eyed dilution).

cd03228 The MRP (Multidrug Resistance Protein)-like transporters

are involved in drug, peptide, and lipid export.

cd03230 This family of ATP-binding proteins belongs to a

multisubunit transporter involved in drug resistance (BcrA

and DrrA), nodulation, lipid transport, and lantibiotic

immunity.

cd03257 The ABC transporter subfamily specific for the transport

of dipeptides, oligopeptides (OppD), and nickel (NikDE).

cd03295 OpuCA is the ATP binding component of a bacterial

solute transporter that serves a protective role to cells

growing in a hyperosmolar environment.

cd06174 The Major Facilitator Superfamily (MFS) is a large and

diverse group of secondary transporters that includes

uniporters, symporters, and antiporters.

cd06261 Transmembrane subunit (TM) found in Periplasmic

Binding Protein (PBP)-dependent ATP-Binding Cassette

(ABC) transporters which generally bind type 2 PBPs.

COG1277 ABC-type transport system involved in multi-copper

enzyme maturation, permease component [General

function prediction only]

COG3932 Uncharacterized ABC-type transport system, permease



components [General function prediction only]

Na+ or K

+

Transporters

cd00293 USP: Universal stress protein family.

cd01987 USP domain is located between the N-terminal sensor

domain and C-terminal catalytic domain of this

Osmosensitive K+ channel histidine kinase family.

cd01988 The C-terminal domain of a subfamily of Na+ /H+

antiporter existed in bacteria and archaea.

COG0475 Kef-type K+ transport systems, membrane components


COG0569 K+ transport systems, NAD-binding component


COG0591 Na+/proline symporter [Amino acid transport and

metabolism / General function prediction only]

COG1055 Na+/H+ antiporter NhaD and related arsenite permeases


COG2060 K+-transporting ATPase, A chain [Inorganic ion transport

and metabolism]

COG2156 K+-transporting ATPase, C chain [Inorganic ion transport

and metabolism]

COG2216 High-affinity K+ transport system, ATPase chain B


COG3158 K+ transporter [Inorganic ion transport and metabolism]

COG3263 NhaP-type Na+/H+ and K+/H+ antiporters with a unique

C-terminal domain [Inorganic ion transport and

metabolism]

pfam00375 Sodium:dicarboxylate symporter family.

pfam00582 Universal stress protein family.

pfam00924 Mechanosensitive ion channel.

pfam00999 Sodium/hydrogen exchanger family.

pfam02702 Osmosensitive K+ channel His kinase sensor domain.

pfam03814 Potassium-transporting ATPase A subunit.

TIGR00931 Na+/H+ antiporter NhaC.

TIGR00932 transporter, monovalent cation:proton antiporter-2 (CPA2)

family.

TIGR00933 potassium uptake protein, TrkH family.

TIGR02121 sodium/proline symporter.

Signal

Transduction

cd00075 Histidine kinase-like ATPases; This family includes

several ATP-binding proteins for example: histidine

kinase, DNA gyrase B, topoisomerases, heat shock protein

HSP90, phytochrome-like ATPases and DNA mismatch



repair proteins

cd00082 Histidine Kinase A (dimerization/phosphoacceptor)

domain; Histidine Kinase A dimers are formed through

parallel association of 2 domains creating 4-helix bundles;

usually these domains contain a conserved His residue and

are activated via trans-autophosphorylation by the

catalytic domain of the histidine kinase.

cd00130 PAS domain; PAS motifs appear in archaea, eubacteria

and eukarya.

cd00156 Signal receiver domain; originally thought to be unique to

bacteria (CheY, OmpR, NtrC, and PhoB), now recently

identified in eukaryotes ETR1 Arabidopsis thaliana; this

domain receives the signal from the sensor partner in a

two-component systems; contains a phosphoacceptor site

that is phosphorylated by histidine kinase homologs;

usually found N-terminal to a DNA binding effector

domain; forms homodimers

cd06225 Histidine kinase, Adenylyl cyclase, Methyl-accepting

protein, and Phosphatase (HAMP) domain.

COG2205 Osmosensitive K+ channel histidine kinase [Signal

transduction mechanisms]

COG3103 SH3 domain protein [Signal transduction mechanisms]

pfam08239 Bacterial SH3 domain.

smart00287 Bacterial SH3 domain homologues.

B12-Related cd00245 Coenzyme B12-dependent glutamate mutase epsilon

subunit-like family; contains proteins similar to

Clostridium cochlearium glutamate mutase (Glm) and

Streptomyces tendae Tu901 NikV.

cd00512 Coenzyme B12-dependent-methylmalonyl coenzyme A

(CoA) mutase (MCM)-like family; contains proteins

similar to MCM, and the large subunit of Streptomyces

coenzyme B12-dependent isobutyryl-CoA mutase (ICM).

cd02065 B12 binding domain (B12-BD).

pfam02310 B12 binding domain.

SAM-Related cd01335 Radical SAM superfamily.

cd02440 S-adenosylmethionine-dependent methyltransferases

(SAM or AdoMet-MTase), class I; AdoMet-MTases are

enzymes that use S-adenosyl-L-methionine (SAM or

AdoMet) as a substrate for methyl-transfer, creating the

product S-adenosyl-L-homocysteine (AdoHcy).

tRNA

Synthetase

cd00165 S4/Hsp/ tRNA synthetase RNA-binding domain; The

domain surface is populated by conserved, charged

residues that define a likely RNA-binding site; Found in



stress proteins, ribosomal proteins and tRNA synthetases;

This may imply a hitherto unrecognized functional

similarity between these three protein classes.

cd00673 Alanyl-tRNA synthetase (AlaRS) class II core catalytic

domain.

COG0013 Alanyl-tRNA synthetase [Translation, ribosomal structure

and biogenesis]



Supplementary Table 2. DNA primers used in this study.

Primer

Name

Originally

from Sequence (5´ to 3´) Purpose

ydaO1 Ref. 5 TAATACGACTCACTATAGGGAA

AACAAATCGCTTAATC

Forward primer for amplifying

WT 165, WT 144, M3, M4, and

M5 ydaO from B. subtilis

ydaO2 Ref. 5 CATCGAACACAGGTTTCATTC Reverse primer for amplifying

WT, M3, and M4 ydaO 165 from

B. subtilis

ydaO3 This study ATCTCCTCTCACGAACGC Reverse primer for amplifying

WT 144 from B. subtilis

ydaO4 This study TAATACGACTCACTATAGGGTC

TCTTTTACCGCTTAATCAAACA

CG


WT yuaA 148 from B. subtilis

ydaO5 This study CCTCCTCTCTGTATACGCCTAC

G

Reverse primer for amplifying

WT yuaA 148 from B. subtilis

ydaO6 This study ATCTCCTCTCACGAACGC Reverse primer for amplifying

WT ydaO 144 from B. subtilis

ydaO7 This study TAATACGACTCACTATAGGGAA

AACAAATCGCTTAATCTGAAAT

CAGAGCGGGGGACCCAATAGA

ACGGCTTTTTGCCGTTGGGGTG

AATCCTTTTTAGG

Forward primer for primer

extension of M1 and M2 ydaO

165

ydaO8 This study CATCGAACACAGGTTTCATTCA

TCTCCTCTCACGAACGCTTACG

AGGTTAGCTGACCGATTCGGGC

ATATGAGAGTTAGCCCTACCTA

AAAAGGATTCACCC

Reverse primer for primer

extension of M1 ydaO 165

ydaO9 This study CATCGAACACAGGTTTCATTCA

TCTCCTCTCACGAACGCTTACG

AGGTTCGCTGACGGATTCGGGC

ATATGAGAGTTAGCCCTACCTA

AAAAGGATTCACCC


extension of M2 WT ydaO 165

ydaO10 This study ACGAACGCTTACGAGG Reverse primer for amplification

of M5 ydaO RNA

ydaO11 This study TAATACGACTCACTATAGGGTA

ATGCATGGCGCTTAATCCTCGA

TTCAAGAGGAGCGGGGGACCC

GTTCTCCTGGGGCGTATCGCC


extension of ydaO from S.

aciditrophicus

ydaO12 This study GAGTCCCCTCATCGATGCCTGC

GAGGTTAGCTGACGGGCTCGG

GCCGAAGAGGTGCCCTACGCC

AAATGGCGATACGCCCCAGG


extension of ydaO from S.

aciditrophicus

ydaO13 This study TAATACGACTCACTATAGGGTA

ATATCATTAGCCTAAATTTTAA

A

Forward primer for amplification

of ydaO from C. acetobutylicum

ydaO14 This study AATCTTCCTCCTTTTATTCTACG Reverse primer for amplification

of ydaO from C. acetobutylicum



ydaO15 This study TAATACGACTCACTATAGGGTT

TAGTGGGTAGCCTAATTCAAAT

TCATGAAAGCTGAATTTGGAAC

GGAGGAACCAATGTTTGGGGC

TAATC


extension of ydaO from N.

punctiforme PCC 73102

ydaO16 This study GGGGGTTCCTTCCATTGCCTAC

GGAGTTAGCTGACGGGCTAAG

ACTGGAAGGTGTCTCTCATAAG

ATTAGCCCCAAACATTGG


extension of ydaO from N.

punctiforme PCC 73102

ydaO17 This study AAGGAATTCAAAAATAATGTT

GTCCTTTTAAATAAGATCTGAT

AAAATGTGAACTAA

AGAAAACAAATCGCTTAATCTG

AAATCAG

Primer meant for cloning

the ydaO leader with

containing a lysine promoter

with an engineered EcoRI

site. ydaO18 This study TTACCGCTAATGTCATGGCAAA

ATTGCC


the region upstream of cdaA orf

for generating the 5 flank of the

cdaA KO fragment.

ydaO19 This study GAGATTTATCTAATTTCTTTTTT

CTTTTCCTCGTCCTCCAAGATTT

CAGTC

Reverse primer for amplifying the

region upstream of cdaA orf for

generating the 5 flank of the

cdaA KO fragment. Also contains

a region complementary to the

erythromycin forward primer

ydaO20

ydaO20 This study AAGAAAAAAGAAATTAGATAA

ATCTC


the erythromycin cassette

ydaO21 This study CACAGCCCAGCGGTTGTTTAAG

AATCTGCGCAAAAGACATAAT

CGATTCAC

Reverse primer for amplifying the

erythromycin cassette

ydaO22 This study GTGAATCGATTATGTCTT

TTGCGCAGATTCTTAAACAA

CCGCTGGGCTGTG

Forward primer for building

the 3 flank of the cdaA KO

fragment with the

erythromycin 3

complement. ydaO23 This study TCCTTTTCAATCGTTTCATCTGC

GTTTTCCAAATTCAC

Reverse primer to generate the 3

flank of the cdaA KO fragment.

ydaO24 This study AACAGAATTCGATTTTAGCCTC

TGTTTTTTTATTTTTGGTAAGTA

AA

Forward primer for cloning the

ydaO promoter region with EcoRI

site (-466 nt from the ydaO

translation start site)

ydaO25 This study AAAGGATCCTGAACAACAAAA

AACACAGAGGCAAACGGATGC

CCCTGTGCC

Reverse primer for cloning the

ydaO promoter region with a

BamHI site (-129 nt from the

ydaO translation start site)

ydaO26 This study AAAGGATCCTGAACAACAAAA

AACTTAGAGGCAAACGGATGC

CCCTGTGCC

Reverse primer for cloning the

ydaO promoter region that creates

a terminator mutation (M6) with a

BamHI site



ydaO27 This study CCCGAATCCGTCAGCGAACCTC

GTAAGCGTT

Forward primer for construction

of M1 reporter construct

ydaO28 This study AACGCTTACGAGGTTCGCTGAC

GGATTCGGG

Reverse primer for construction

of M1 reporter construct

ydaO29 This study TACGACAAATTGCAAAAATAA

TGTTGTCCTTTTAAATAAGATC

TGATAAAATGTGAACTAAATTG

TATATGTTAAATTTCATACAGT

CT

Forward primer containing lysC

promoter from B. subtilis for in

vitro transcription termination

assay of the yuaA riboswitch.

ydaO30 This study CACGGATCCGGCAAATTGCTT

ATTTTTAATTCTTCCCAA

Reverse primer for amplification

of the yuaA riboswitch (-238 to

+30 with respect to the

translational start site), used in in

vitro transcription

ydaO31 This study TTTTTGAAACAAAAAAGATTATT

GCAAAGAATGGCCGATAAT

Reverse primer for amplification

of the yuaA riboswitch (-238 to -

28 with respect to the

translational start site), the marker

used in in vitro transcription



Supplementary References

63. Holtmann, G., Bakker, E.P., Uozumi, N., Bremer, E. KtrAB and KtrCD: two

K+ uptake systems in Bacillus subtilis and their role in adaptation to

hypertonicity. J. Bacteriol. 185, 1289-1298 (2003).


Download - Supplementary Information Riboswitches in eubacteria sense ... · Nelson et al. and Breaker c-di-AMP Riboswitches Supplementary Information Riboswitches in eubacteria sense the second

Top Related