Download - Dna nanotechnology
Small Idea’s Big Impact’s
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
Shrishaila cdDept of Genetics and Plant Breeding
DNA NANOTECHNOLOGY
SEMINAR 2 ON
IntroductionHistory of NanotechnologyNano particlesApplications of NanotechnologyDNA NanotechnologyDNA Nano StructuresCase StudiesApplications of DNA NanotechnologyConclusions
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
Nanotechnology
“Nanotechnology is the art and science of manipulating matter at nanoscale”
‘Nano’ is a Greek word, means Dwarf
1 nm = 10ˉ m ⁹ i.e. one billionth of a meter
Shrishaila CD(GPB) UASR
Nano scale
Shrishaila CD(GPB) UASR
Richard Feynman, Father of nanotechnologyNobel Laureate(Physics)1965
Norio Taniguchicoined the term “Nanotechnology” (1974)
Michael Faraday 1831
Shrishaila CD(GPB) UASR
Nano Particle
Shrishaila CD(GPB) UASR(Royal Society and Royal Academy of Engineering, 2004)
TOP DOWN APPROACH
METHODS OF NANOPARTICLE PRODUCTION
Shrishaila CD(GPB) UASR(Royal Society and Royal Academy of Engineering, 2004)
BOTTOM UP APPROACH
Shrishaila CD(GPB) UASR
Properties of Nano particles
• Every substance regardless of composition exhibits new properties when the size is reduced to nano scale
• Properties of material is changed due to quantum effect
Shrishaila CD(GPB) UASR
Things behave differently in nano-world
Carbon in the form of Graphite (i.e. pencil lead) is soft, at the nano-scale, can be stronger than steel and is six times lighter
Nano-scale copper is a highly elastic metal at room temperature, stretching to 50 times its original length without breaking
Shiny orange yellow Gold changes its colour to brownish black on reducing the size
Absorption of solar radiation in photovoltaic cells is much higher in nanoparticles than it is in thin films of continuous sheets of bulk material
Shrishaila CD(GPB) UASR
Tools of Nanotechnology
Dendrimers
Quantumdots
Nanosensors
FullerenesCarbon Nanotubes
Nano Chips
C60
3D macromolecules
Dendrimers
Shrishaila CD(GPB) UASR
ApplicationsOf
Nanotechnology
Shrishaila CD(GPB) UASR
In Agriculture and Allied SciencesFood science and technology
Smart packaging with Nano silicon embedded durethan polymer to enhance the shelf life of the food materials
Seed technology
Use of carbon Nanotubes increases the germination through better penetration of the moisture
Soil remediation
Nanotech-based soil binder called SoilSet employed to avoid soil erosion
Water treatments
magnetite (iron oxide) nanocrystals to capture and remove arsenic from contaminated water
Agricultural Engineering Issues
Nano coating of agricultural tools to increase their resistance against wear and corrosion
Shrishaila CD(GPB) UASR
Operates like human nose &Identify different types of odours and their concentrations
e-Nose
Medicine Cancer treatment ,Bone treatment, Drug delivery
Smaller, faster, more energy efficient and powerful computing and other IT-based systems
Information Technology
Advanced packaging materials, sensors and lab-on-chips for food quality testing
Foods and beverages
Shrishaila CD(GPB) UASR
DNA Nanotechnology
Shrishaila CD(GPB) UASR
It is the design and manufacture of artificial nucleic acid structures for technological uses
Also known as Nucleic Acid Nanotechnology
DNA is the carrier of Genetic information but here used as a structural component
Shrishaila CD(GPB) UASR
History of DNA Nanotechnology
• 1964-Holliday Junction• 1970-Sticky Ends • 1980-DNA Nanotechnology• 1991-first synthetic 3D DNA Nanostructure developed• 1998-2D DNA Lattice• 2006-2D DNA Origami developed• 2009-3D DNA Origami developed
Shrishaila CD(GPB) UASR
DNA nanotechnology was first laid out by Nadrian C Seeman in the early 1980s
In 1991, Seeman's laboratory published a report on the first synthetic cube made up of DNA
Shrishaila CD(GPB) UASR
DNA Nanostructures
Shrishaila CD(GPB) UASR
Why DNA IN NANO WORLD
• Basic Geometric and Thermodynamic properties of DNA are well known and predictable by available software's like TILE SOFT, GenoCAD
• DNA’s Ladder like structure provides the key frame work to the scientists
• Existence of commercially available modifying enzymes• Persistent length of DNA is about 500Å• Self assembly property of DNA makes easy to construct the variety of
structures in a predictable manner• Shapes of DNA nanostructures can be controllable• Synthesis of SsDNA is less expensive• Assembled structures can be characterized by various techniques like
AFM,TEM,CryoEM
Shrishaila CD(GPB) UASR
Construction of DNA Nanostructures
Mainly by using the following motifs• Stem loop(Hair pin) structure• Sticky ends• Holliday Junction
Shrishaila CD(GPB) UASR
Stem loop
Unpaired region occur in Ss DNA or RNA The structure is also known as a hairpin or hairpin loop
Shrishaila CD(GPB) UASR
Sticky ends
• An overhang is a stretch of unpaired nucleotides in the end of a DNA molecule
• These overhangs are in most cases Palindromic• Sticky ends are often used to combine two DNA nanostructures
together via hybridization of their complementary SsDNA
Shrishaila CD(GPB) UASR
Holliday junction
• Robin Holliday proposed its existence in 1964• Two parallel DNA helices form a junction with one strand of each
DNA helix crossing over to the other DNA helix
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
DNA Lattice A DNA tile is a DNA nanostructure that has a number of sticky ends on its sides, which are termed pads
A DNA lattice is a DNA nanostructure composed of a group of DNA tiles that are assembled together via hybridization of their pads
Winfree, Yang and Seeman (1996) developed a family of DNA tiles known collectively as DX tiles
Shrishaila CD(GPB) UASR
DNA Cube
• It is the first 3D DNA Structure• DNA Axes connected to form the cube• Each edge of the cube has 2 molecules
of dsDNA which are connected to each other
• It contains 6 different strands
Shrishaila CD(GPB) UASR
DNA Origami
• Rothemund used the 5 SsDNA of M13 Phage 2006
• In 2009 Anderson et al. Extended to 3D Origami
• It is the nanoscale folding of SsDNA to create non-arbitrary two- and three-dimensional shapes
• SARSE software is using for developing the structure
Shrishaila CD(GPB) UASR
DNA Nanotubes
• Double cross over arrays can be folded to form the DNA Nanotubes
• Can be made in to rings and spirals• Potential use in the fields of Drug delivery Gene therapy Electronic circuits
Shrishaila CD(GPB) UASR
DNA Polyhedron
• By shih, Quispe & joyce 2004• By folding the five 40bp synthetic Ss DNA using a wire frame
structures
Shrishaila CD(GPB) UASR
Case studies
Shrishaila CD(GPB) UASR
Fabrication of DNA nanotubes using origami-basednanostructures with sticky ends
Mohammad Mousavi-Khattat ,Adele Rafati ,Pooria Gill
5th February 2015
Objective:- Fabrication of DNA nanotubes using a minimum numbers of staple oligomers for DNA origami
Shrishaila CD(GPB) UASR
Materials and methods
M13mp18 phage genome caDNAno
S1 CCAACGTGCAGGTCATTCGTAS2 CACTATTCCGGTTCATGGTCGS3 TTCCAGTTCCCTTAAGCAGGCS4 GAGATAGGGTTGACGCGCGGGGAGAGGCGGTS5 ACGGCCAGTGCCTGTTTCCTGS6 CATGCCTCAAAGGGGCGCTCAS7 GAGGATCAAAGAACGTCGGGAS8 GGCAAAATTGGAACGCTGCATS9 ATCATGGGCTCACAAATGAGTGAGCTAACTCACS10 GGTACCGACGAGCCAGTGTAAS11 GAAAATCTTGCCCTCACCAGTS12 AGCGGTCCACGCTGGTTGAGAGACGCCAGG
Shrishaila CD(GPB) UASR
S13 TGTGAAATTGTTATCCTCATAGCAAGCTTGS14 ACAACATAGCTCGAGACTCTAS15 CAGCTGACTGTTTGCGAAATCS16 CTGGCCCTTGCCCCTAAATCAAAAGAATAGCCCS17 AGCCTGGCTTTCCAGTGGACTS18 GAGACGGCGTGCCAAAGAGTCS19 GTGGTTTTCGGCCAAGTGTTGS20 TTGCGTATTGGGGTTGCAGCAS21 ATTAATTGCGTTCGAAAAACCGTCTATCACGS22 CTGCCCGGGTGCCTATTCCACS23 AACCTGTGCCATAAGGAAGAAS24 TAATGAATTCTTTTTCACCGC
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
Results
TEM Image
Shrishaila CD(GPB) UASR
STM Image
Shrishaila CD(GPB) UASR
Self-assembled aptamer-tethered DNA nanotrains fortargeted transport of molecular drugs
in cancer theranostics
Guizhi Zhu, Jing Zheng, Erqun Song, Michael Donovan, Kejing Zhang, Chen Liu, and Weihong Tana
May 14, 2013
Shrishaila CD(GPB) UASR
Materials and Methods
Preparation of sgc8–NTrs and Drug Loading into Nanotrains
M1:- 5’CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGC3’
M2:-5’TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT3’
Sgc8 :-5’ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA3’ Sgc8–trigger 5’TGCTGCTGCTGCTGCTGCACGACGTTTATCTAACTGCTGCGCCGCCGGG3’
5 NOD.Cg-Prkdc (scid) IL2 mice were purchased from The Jackson Laboratory and maintained under pathogen Free conditions
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASRGuizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
ATOMCALLY MODIFIED ORGANISMS
In March 2004, ETC Group reported on a nanotech research initiative in Thailand
That aims to atomically modify the characteristics of local rice varieties.
Researchers “drilled” a hole through the membrane of a rice cell in order to insert a nitrogen atom that would stimulate the rearrangement of the rice’s DNA.
Shrishaila CD(GPB) UASR
Researchers have been able to alter the colour of a local rice variety from purple to green Named as BKOS6
Thai jasmine rice (Oryza sativa L. cv.KDML 105) Rice embryos bombarded with N++N2+ ions at an energy level of 60 keVand ion fluence of 2×1016 ions/cm2
Shrishaila CD(GPB) UASR
HAT-RAPD was applied for analysis of genomic variation in the mutant out Of 10 primers, two primers detected two additional DNA bands at 450 bp and 400 bp. Indicates presence of amino acid sequence of flavanoids
Shrishaila CD(GPB) UASR
Applications of DNA Nanotechnology
Shrishaila CD(GPB) UASR
DNA is the best nano wire in existence BCZ..1. It can self assemble2. It can self replicate3. It can adopt various states and conformations
Rapid Disease Detection using the DNA NanotubesAnd Molecular treatment
Shrishaila CD(GPB) UASR
Wide range of uses ranging from building blocks to robotics
DNA Robotics
Used in making much smaller microchips than the current semiconductor fabrication technology
DNA Nanochips
Shrishaila CD(GPB) UASR
DNA Computers
DNA can be used to make computers instead of silicon.• Maya-II is an example.
DNA Sensorsmade to detect any metal• Much faster than traditional testfor lead and mercury
Shrishaila CD(GPB) UASR
DNA Walkers
DNA nanotechnology can be used to create walking bipedal nano robots• The walkers move on a DNA track
Protein structure determination
NANO Mosquitoes Used in militaries
Shrishaila CD(GPB) UASR
NANO In INDIA
• The Department of Science and Technology has a plan called Nano Mission. It promotes basic research, infrastructure development, nano-applications and technology development, human resource development, and international collaborations. And it is headed by BHARATH RATNA Dr. C N R RAO
• The Department of Electronics and Information Technology focuses on nano electronics and technology development and on nanofabrication.
Shrishaila CD(GPB) UASR
Two centres in India focusing on development of nanotechnology were established in
BENGALURU and MUMBAI
• India is among the top ten publishing countries in this area with rise in 9.1%in the past ten years
• In 2013 , 87 patents in nanotechnology were published by Indian assignees
Shrishaila CD(GPB) UASR
Shrishaila CD(GPB) UASR
Future work
Shrishaila CD(GPB) UASR
Conclusions
Inaugurating the Global Forum On Agricultural Research(GFAR)Triennial conference –New Delhi 2006 ,President Dr. A.P.J ABDUL KALAM Focussed on the Nanotechnology as the new technology that must be applied in Agriculture and Food industry
Shrishaila CD(GPB) UASR
Thank youFor your visit inNano world…