R E S E A R C H L E T T E R
Developmentofmicrosatellitemarkers forPythiumhelicoidesYin-Ling1,2, Wei Zhou3, Keiichi Motohashi2, Haruhisa Suga4, Hirokazu Fukui5 & Koji Kageyama2
1The United Graduate School of Agricultural Science, Gifu University, Gifu, Japan; 2River Basin Research Center, Gifu University, Gifu, Japan; 3School of
Environmental Science and Engineering, Shanghai Jiaotong University, Shanghai, China; 4Life Science Research Center, Gifu University, Gifu, Japan; and5Faculty of Applied Biological Science, Gifu University, Gifu, Japan
Correspondence: Yin-Ling, The United
Graduate School of Agricultural Science, Gifu
University, 1-1 Yanagido, Gifu 501-1193,
Japan. Tel./fax: 181 5829 32063; e-mail:
Received 16 September 2008; revised 30
December 2008; accepted 7 January 2009.
First published online 17 February 2009.
DOI:10.1111/j.1574-6968.2009.01518.x
Editor: Bernard Paul
Keywords
Pythium; dual-suppression PCR; TAIL-PCR; SSR;
molecular marker.
Abstract
A strategy combining dual-suppression PCR and thermal asymmetric interlaced PCR
was used to determine sequences flanking microsatellite regions in Pythium helicoides.
The primer pairs were designed to amplify loci containing (AC)n, (GA)n, (AGC)n,
(CAC)n(CAA)n, (TCA)n and (CTTT)n repeats from the P. helicoides nuclear
genome. The PCR products of each primer pair, amplified from three representative
isolates collected from different hosts and locations, were cloned and sequenced.
Different degrees of polymorphism were detected among these microsatellite
markers. The numbers of alleles were 6, 2, 4, 11, 4 and 4 in YL-AC, YL-AGC,
YL-CAA, YL-CTTT, YL-GA and YL-TCA, respectively. Allele analysis of 30
P. helicoides isolates showed length polymorphisms in all loci, except for YL-AC,
using capillary electrophoresis. Thus, we have developed a simple method for
designing PCR primers to amplify microsatellite markers from P. helicoides.
Introduction
The oomycete Pythium helicoides was originally isolated from
Dahlia root and described in 1930, but there were few
subsequent reports on the species until recently. Pythium
helicoides was recently isolated from bell pepper in Florida,
and is considered to be virulent in several crops (Chellemi
et al., 2000). In Japan, the species was identified as a pathogen
causing root rot of miniature rose and kalanchoe in ebb and
flow irrigation systems (Kageyama et al., 2002; Watanabe et al.,
2007). The root rot disease has also been observed in rock-
wool cultures of cutting rose and has spread all over the
country. Furthermore, it has been reported that P. helicoides
causes root and crown rot of strawberry, and damping off of
chrysanthemum (Suzuki & Yoneyama, 2005; Watanabe et al.,
2005; Tsukiboshi et al., 2007). Population genetics studies are
needed in order to develop strategies to control the occurrence
and spread of this pathogen.
In recent years, several molecular methods have been used
in the characterization of Pythium isolates, including the use
of random amplified polymorphic DNA (RAPD) markers
(Herrero & Klemsdal, 1998; Kageyama et al., 1998; Matsu-
moto et al., 2000), amplified fragment length polymorph-
isms (AFLP) (Garzon et al., 2005) and restriction fragment
length polymorphisms (RFLP) (Harvey et al., 2000, 2001).
Both RAPD and AFLP analyses are fast and convenient
procedures; however, they can only detect dominant mar-
kers, and thus cannot be used to identify heterozygotes in
diploid species such as P. helicoides. Furthermore, RAPD
analysis is poorly reproducible, especially between labora-
tories and researchers. RFLP analysis is very informative, but
time consuming, because Southern blots are needed.
Microsatellites or simple sequence repeats are tandemly
repeated motifs of one to six bases found in eukaryotic
genomes (Hamada et al., 1982), including fungi (Tautz,
1989). Since they were first described (Litt & Luty, 1989;
Tautz, 1989; Weber & May, 1989), microsatellites have been
widely used as tools in studies of genetic variation in natural
populations, because they are codominant, multiallelic,
highly polymorphic and require only small amounts of
DNA for PCR analysis. Microsatellites can be amplified
using primer pairs complementary to their flanking regions,
and fragment length polymorphisms are detected by gel
electrophoresis. To amplify microsatellite loci by PCR,
primers must be developed using the flanking sequences.
Sequence information for primer design can be obtained by
constructing and screening a small insert plasmid library
(Queller et al., 1993) or by enriching a DNA library for
microsatellites (Karagyozov et al., 1993); however, both of
these methods are labor-intensive and expensive. Therefore,
FEMS Microbiol Lett 293 (2009) 85–91 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
several alternative strategies, including modifications of the
RAPD method, PCR isolation of microsatellite arrays and
primer extension enrichment protocols (Zane et al., 2002),
have been devised. However, none of these methods have
been widely adopted.
The objectives of this study were to apply dual-
suppression PCR (Lian & Hogetsu, 2002) and thermal
asymmetric interlaced (TAIL)-PCR (Liu & Whittier, 1995)
to develop microsatellite markers for P. helicoides, and
to verify the usefulness of these markers for population
analyses of P. helicoides.
Materials and methods
Isolates and DNA extraction
In this study, nine P. helicoides isolates were chosen,
which represent its known ranges of geographical locations
and hosts (Table 1; working numbers 1–9). Genomic DNA
was extracted from mycelia following the procedure of
Kageyama et al. (2003).
Dual-suppression PCR
As the first step in isolating microsatellite loci, fragments with
microsatellite sequences at one end were obtained by dual-
suppression PCR (Lian & Hogetsu, 2002). The followed
procedure was used to construct adaptor-ligated DNA
libraries. Samples of genomic DNA (5mg) from the isolate H-
5 were digested with the enzymes AccII, AfaI, AluI, EcoRV,
HaeIII and SspI (Toyobo, Osaka, Japan) according to the
manufacturer’s instructions. The DNA fragments were pur-
ified using the GENECLEAN SPIN Kit (Qbiogene, Carlsbad,
CA), and then ligated to adaptors (Lian & Hogetsu, 2002)
consisting of a 48-mer (50-GTAATACGACTCACTATAGGGC
ACGCGTGGTCGACGGCCCGGGCTGGT- 30) and an 8-mer
with the 30 end capped by an amino residue (50-ACCAGCCC
-NH2-30), using a DNA ligation kit (Takara Bio Inc., Shiga,
Japan). The resulting DNA libraries were then used as
templates in PCR amplifications with primer pairs consisting
of the adaptor primer AP2 (50-CTATAGGGCACGCGTGGT-
30), designed from the longer adaptor strand, and one of the
10 microsatellite primers, (AC)10, (GA)10, (AAT)7, (AGC)10,
(CAA)7, (CAT)10, (TCA)10, (TGC)10, (AGTG)5 and (CTTT)5.
The 50-mL PCR reactions contained 1mL of template DNA,
1mM of each primer, 1.25 U of rTaq DNA polymerase (Takara
Bio Inc.), 200mM dNTPs, 400 ngmL�1 bovine serum albumin
(BSA) (Wako, Osaka, Japan) and 1� PCR buffer (10 mM
Tris-HCl, pH 8.3, 50 mM KCl and 1.5 mM MgCl2), and were
performed in a 2700 DNA Thermal Cycler (Applied Biosys-
tems, Norwalk, CN). The reactions consisted of an initial
denaturation for 4 min at 94 1C, followed by 35 cycles of 94 1C
for 1 min, 60 1C for 0.5 min and 72 1C for 2 min, with a final
extension at 72 1C for 10 min. PCR products were cloned into
the pT7Blue T-vector (Takara Bio Inc.) using a DNA ligation
kit (Takara Bio Inc.) and cloned. Selected clones were
amplified using the M13M4 and M13Rv primers. The PCR
products were purified using the Gene Elute PCR purification
kit (Sigma, Ronkonkoma, NY), and then sequenced using the
M13M4 and M13Rv primers and the Big DyeTM Terminator
V3.1 Cycle Sequencing Ready Reaction kit (Applied Biosys-
tems). The sequencing reaction products were analyzed on an
ABI 3100 DNA sequencer (Applied Biosystems). Consensus
sequences were based on results of the forward and reverse
sequencing reactions.
TAIL-PCR
In order to determine the sequence of the flanking region on
the other side of each microsatellite, TAIL-PCR was per-
formed according to the protocol developed by Liu & Whittier
(1995), using genomic DNA from isolate H-5. The TAIL-PCR
method utilizes an arbitrary degenerate (AD) reverse primer,
together with three interlaced specific sense primers in con-
secutive reactions. The three sense primers were based on the
sequences obtained from the microsatellite clones described
Table 1. Isolates of Pythium helicoides used in this study
Working
numbers
Isolate
numbers Origin Location
1 H-5 Rose Gifu, Japan
2 OMF3 Rose Oita, Japan
3 OMF6 Rose Oita, Japan
4 OB5-2 Rose Oita, Japan
5 SPH-1 Rose Shizuoka, Japan
6 NaStr1 Strawberry Nagano, Japan
7 TCG1 Strawberry Tochigi, Japan
8 GF-59 Kalanchoe Gifu, Japan
9 CBS286.31 Phaseolus vulgaris USA
10 GF-107 Rose Gifu, Japan
11 MH-P2 Rose Gifu, Japan
12 MH-y2 Rose Gifu, Japan
13 MH-y3 Rose Gifu, Japan
14 GF-99002 Rose Gifu, Japan
15 GF-18 Rose Gifu, Japan
16 GF-20 Rose Gifu, Japan
17 GF-78 Rose Gifu, Japan
18 1Wak-600 Rose Wkayama, Japan
19 2nig Rose Niigata, Japan
20 MAFF425443 Pinto bean Nara, Japan
21 SP-KR05-B2 Rose Shizuoka, Japan
22 SP-KR03-4 Rose Shizuoka, Japan
23 SP-KR04-B3 Rose Shizuoka, Japan
24 SP-KR04-2 Rose Shizuoka, Japan
25 SP-KR05-2 Rose Shizuoka, Japan
26 SP-KS04-A2 Rose Shizuoka, Japan
27 OM3 Rose Oita, Japan
28 OM4 Rose Oita, Japan
29 OB5-1 Rose Oita, Japan
30 OB7-2 Rose Oita, Japan
FEMS Microbiol Lett 293 (2009) 85–91c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
86 Yin-Ling et al.
above, and designed using the computer program PRIMER
PREMIER 5 (Premier Biosoft International, CA). The three
arbitrary degenerate primers AD1, 50-NGTCGASWGANAW
GAA-30; AD2, 50-TGWGNAGSANCASAGA-30; and AD3,
50-AGWGNAGWANCAWAGG-30 were used in a separate
reaction series with each set of sense primers. The series of
three PCR reactions (designated as primary, secondary and
tertiary TAIL) were performed as follows: the primary and
secondary TAIL reactions were carried out in 20mL with 0.8 U
of rTaq DNA polymerase and 1�PCR buffer. The primary
TAIL reaction also included 20mg of genomic DNA, 0.2mM
primary specific primer, 5mM arbitrary primer and 200mM
dNTPs. The secondary TAIL reaction contained 1mL of a 1/50
dilution of the primary PCR product, 0.2mM secondary
specific primer, 3mM of the arbitrary primer and 25mM
dNTPs. The tertiary TAIL reactions were performed in
100mL with 1mL of a 1/10 dilution of the secondary TAIL
product, 3.5 U of rTaq DNA polymerase, 25mM dNTPs,
1� PCR buffer, 0.2mM of the tertiary specific primer and
0.2mM of the arbitrary primer. The thermal cycle protocols
were the same as those used by Liu & Whittier (1995). Selected
major bands resulting from the TAIL reactions were purified
from gels using the Get Pure DNA Kit (Dojindo Laboratories)
according to the manufacturer’s instructions, and then cloned
and sequenced. The resulting sequences were used to design
primers specific to the regions flanking the microsatellites. All
primers were between 18 and 24 nucleotides in length, with
annealing temperatures (Tm) between 55 and 65 1C and GC
contents of 40–60%. Primer pairs were designed to amplify
products of 100–600 bp.
Microsatellite amplification
The microsatellite flanking primers were tested using 10
isolates of P. helicoides listed in Table 1. Each PCR amplifica-
tion was carried out in a 25-mL reaction mixture that
contained 20 ng of genomic DNA, 1 mM of each microsatel-
lite primer, 0.625 U of rTaq DNA polymerase, 200 mM
dNTPs, 400 ng mL�1 BSA and 1� PCR buffer. The amplifi-
cation conditions were as described for the dual-suppression
PCR reactions, except that the annealing temperatures were
between 55 and 65 1C.
Characteristics of microsatellite loci
To investigate the characteristics of microsatellite loci am-
plified by six primer pairs, 30 P. helicoides isolates (Table 1)
were used for allele analysis. The PCR was performed with a
50 fluorescent-labeled forward primer and a 50 unlabeled
tailed reverse primer to resolve an ‘additional-A’ problem
(Applied Biosystems). The size of individual PCR products
at each microsatellite locus was determined using an auto-
matic ABI 3100 DNA sequencer with LIZ size standard
GeneScan-500 and analyzed using GENEMAPPERs software
v 4.0 (Applied Biosystems). GENEPOP 4.0 on the internet was
used to calculate the observed and expected heterozygosities
and to test the linkage disequilibrium between loci.
Results
Dual-suppression PCR
Genomic DNA fragments of the H-5 isolate that were
digested with restriction enzymes were used to create
adaptor-ligated DNA libraries. The libraries were used as
templates in PCR reactions with an adaptor primer and each
of 10 tandem repeat primers. One hundred and seventy-four
clones of PCR products from the DNA libraries were ran-
domly selected to be sequenced. Sequences containing at
least seven dinucleotide, four trinucleotide, or four tetranucleo-
tide repeat motifs were recognized as microsatellites. Using this
threshold, 104 of the 174 clones were selected (Table 2).
No clone was obtained after PCR amplification with two of 10
tandem repeat primers, (AAT)n and (CAT)n. One clone,
derived from the (CAA)n motif PCR amplification, contained
a compound repeat (CAC)n(CAA)n instead of the expected
repeat sequence (CAA)n. Finally, 31 clones having adequate
sequences to design specific primer sets for TAIL-PCR were
selected. Table 3 shows six TAIL-PCR primer sets that were used
to amplify flanking sequences for the microsatellite markers.
TAIL-PCR
TAIL-PCR was performed in order to amplify the sequence on
the other side of each selected microsatellite. Twenty-four of
31 primer sets gave one or two specific and clearly visible
Table 2. Number of clones with microsatellite repeats obtained by
suppression PCR using genomic DNA digested with six restriction
enzymes
Restriction
enzyme
Recognized
sequence
Sequenced
clones
Clones containing
microsatellite
repeats (%)
AccII 50-CG�����
CG-30
GC GC-5038 34 (89.5)
AfaI 50-AG�����
CT-30
TC GA -5044 30 (68.2)
AluI 50-AG�����
CT-30
TC GA-5016 10 (62.5)
EcoRV 50-GAT�����
ATC-30
CTA TAG-5 020 9 (45.0)
HaeIII 50-GG�����
CC-30
CC GG-5040 21 (52.5)
SspI 50-AAT�����
ATT-30
TTA TAA-5016 0 (0)
Total 174 104 (59.8)
FEMS Microbiol Lett 293 (2009) 85–91 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
87Microsatellite markers for Pythium helicoides
bands after the tertiary PCR reactions (data not shown).
Each of these main bands was cloned for DNA sequencing.
All of the resulting clones contained microsatellites; how-
ever, six of the sequences were rejected from further analysis
due to their high GC content. Each of the remaining 18
clones contained one of the microsatellites, (AC)n, (GA)n,
(AGC)n, (CAC)n(CAA)n, (TCA)n, (TGC)n, (AGTG)n or
(CTTT)n. These clones were used to design primers for
amplification of microsatellite-containing regions.
Microsatellite amplification
Eighteen microsatellite primer sets were designed from the
sequences obtained by TAIL-PCR and tested with DNA
isolated from nine representative isolates of P. helicoides.
Bands were successfully amplified from all isolates with 10 of
the primer pairs.
Sequence analysis for polymorphic loci
In order to confirm that the PCR products amplified using
the designed primers would contain microsatellite loci,
and to determine whether the variability in size would
correspond to a variable number of repeat motifs, the PCR
products were sequenced. Four to 18 positive clones of each
of the PCR products obtained using 10 primer pairs with
each of three isolates, H-5, OMF3 and CBS286.31, were
sequenced. Six of 10 primer sets contained microsatellite
repeats and were selected for further studies (Table 4). For
these six markers, the lengths of the amplified regions, and
the numbers of microsatellite repeats in the various alleles
found in the isolates, are shown in Table 5. Among all six
loci in the isolates, the PCR products ranged in length from
113 to 523 bp. The numbers of alleles (i.e. with different
numbers of microsatellite repeats) ranged from two (locus
YL-AGC) to 11 (locus YL-CTTT).
Characteristics of microsatellite loci
Thirty P. helicoides isolates in Table 1 were tested to perform
further genetic study with the six microsatellite markers
(Fig. 1). Microsatellite allele sizes from all isolates were
scored with the locus, except for YL-AC (Table 4). In the
locus YL-AC, the size could not be evaluated because of
nonspecific amplification. The number of alleles for five loci
varied from four to 16. The mean of alleles per locus was 4.8
at all of 30 isolates. The expected and observed heterozygos-
ities (He and Ho) ranged from 0.56 to 0.65 and 0.58 to 1.00,
respectively. None of the diploid type isolates was observed
in locus YL-CTTT. No significant linkage disequilibrium
was found between locus YL-GA and other loci tested.
Discussion
A new method for the isolation of microsatellite markers
from P. helicoides genome is described in this study. A
combination of dual-suppression PCR and TAIL-PCR was
successfully applied in order to determine the sequences of
the flanking regions of each microsatellite.
In the first step of this process, dual-suppression PCR was
successfully used to amplify microsatellite sequences from
digested and adaptor-ligated DNA libraries. This method
is used to selectively amplify DNA fragments that have both
Table 3. Sequences of six primer sets designed for TAIL-PCR
Primer name Primer sequence (50–30)
AC1 CAGGTCGAATGGAAGTATGTGC
AC2 TGTGGTCGGTATTGTATTGG
AC3 ATTTGGTGCGGTTGAGAA
GA1 TCTTCACCGTTGGGATCCCAG
GA2 AAACACCTAGCCTTGCTTTCAGC
GA3 TTCAGGAATCGCAGCTGAGC
AGC1 TCGGCCTACGGCCCAGGATT
AGC2 CCTACGGCCCAGGATTGA
AGC3 CCAGGATTGAGCTAGTAGCAGT
CAA1 CTATGGAACGCGGGCATGACAA
CAA2 CCCACACGCCACATCCAAAGC
CAA3 ACCATAAGCGCCTGCATCGACAC
TCA1 TCTTTCCAACGCTACTTCT
TCA2 GATTCTGTGCTGCGTCTC
TCA3 ATTGGCTATGGTGTATGTTGTG
CTTT1 ATTGGGTCGGCGGCGTGTA
CTTT2 TGTGGTCGGTATTGTATTGG
CTTT3 CATTTGGTGCGGTTGAGA
123
121
H-5
OMF3
117
121
119121
119
117
120 130 140110 bp
120 130 140110 bp
120 130 140110 bp
CBS286.31
Fig. 1. Capillary electropherograms of amplification fragments in the
YL-GA locus of Pythium helicoides isolates H-5, OMF3 and CBS286.31.
Numbers indicate the size in base pairs.
FEMS Microbiol Lett 293 (2009) 85–91c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
88 Yin-Ling et al.
a microsatellite repeat sequence and an adaptor sequence.
Amplification of fragments with the same adaptor on both
ends is suppressed, because of intramolecular hybridization
between the adaptor on the 50 end and its complement on
the 30 end. Nagai et al. (2006) used a similar method in
population genetic studies of the toxic dinoflagellate Alex-
andrium minutum (Dinophyceae) and found that among 480
sequenced clones, 87 clones (18%) contained microsatellites
at one end. In our study, 104 (59.8%) of the 174 sequenced
clones contained repeats at one end.
Six restriction enzymes were used to develop the adaptor-
ligated DNA libraries. In general, we obtained larger numbers
of useful microsatellite clones from the libraries developed
using the four-base recognition enzymes. Of these, AccII was
found to be the most useful for P. helicoides, because c. 90% of
the sequenced clones from this library contained microsatel-
lites. Tamura et al. (2005) tested the same six restriction
enzymes as those used in this study in Brassica rapa,
and obtained better results with EcoRV and SspI. These
observations suggest that the optimum restriction enzymes
for cloning microsatellites might be different among taxo-
nomic groups.
Our efforts to isolate the other flanking region of each
microsatellite using either dual-suppression PCR or inverse
PCR (Ochman et al., 1988) were not successful. The TAIL-
PCR approach is a simple and efficient technique for genomic
analysis in plant molecular biology (Liu & Whittier, 1995).
By combining dual-suppression PCR with TAIL-PCR, we
were able to find the flanking regions on the other sides of
the microsatellites that were isolated from P. helicoides. Using
TAIL-PCR, we were able to amplify clean, microsatellite-
containing products using 24 (77%) of the 31 primer sets
tested. This was similar to the percentage reported for Lepto-
sphaeria maculans (75%) (Blaise et al., 2007).
Our results indicated that the chances of cloning a
microsatellite repeat motif were 60% by dual-suppression
PCR in the first step of the combined process, and 77% by
TAIL-PCR in the second step of the process. Thus, our
overall success rate (46%) in cloning microsatellite markers
with flanking sequences on both sides was relatively high. In
contrast, the percentages of positive clones that are obtained
by traditional methods usually range from 0.04% to 12%
(Zane et al., 2002). The approach developed in this study
substantially reduces both the time and the costs in the
development of microsatellite markers.
Table 4. Characteristics of microsatellite markers isolated from Pythium helicoides
Locus Microsatellite motif Primer sequence (50–30) Tm ( 1C) Size (bp)� No. of alleles� Hew Hoz
YL-AC (AC)n CCAGCATCCACGGCAATC 60 –‰ –‰ –‰ –‰
CAGGTCGAATGGAAGTATGTGC
YL-GA (GA)n TTCAGGAATCGCAGCTGAGC 65 113–123 7 0.56 1.00
ATGCGAGACTGAAGGAATGAGA
YL-AGC (AGC)n CCAGGATTGAGCTAGTAGCAGT 60 249–282 4 0.66 0.58
CGTCTTCGTAACTTCGGT
YL-CAA (CAC)n(CAA)n GAACCCAAGCAGTTTCCTGTTAGC 60 516–528 5 0.64 0.91
CGTTTTGAGGGCGTTGCGGTC
YL-TCA (TCA)n GCAATCACAGCTCCCACA 60 163–190 7 0.65 1.00
TCTTTCCAACGCTACTTCT
YL-CTTT (CTTT)n ACACCAACCATATGCTTT 55 143–203 16 –z 0.97
AGAAAGTACGAGGATGAC
�The size and number of alleles were evaluated by capillary electrophoresis of PCR products from 30 isolates.wExpected heterozygosity derived from 12 diploid type data.zObserved heterozygosity derived from 12 diploid type data.‰Allele analysis was not performed because of nonspecific band occurrence.zThe analysis was not performed because of no diploid type data.
Table 5. Variation of repeat numbers in six microsatellite loci
Primer
name Isolate
Amplicon
length (bp)
Number of repeats in different
alleles
YL-AC H-5 147–181 9 14 13
OMF3 9 14
CBS286.31 18 25 26
YL-GA H-5 113–121 9 10 11 12
OMF3 10 11
CBS286.31 11 12
YL-AGC H-5 250–253 6
OMF3 6
CBS286.31 5 6
YL-CAA H-5 517–523 517 616
OMF3 517
CBS286.31 618 717
YL-TCA H-5 162–182 10
OMF3 9 10
CBS286.31 3 4 9 10
YL-CTTT H-5 145–209 6 12 13 14 17 22
OMF3 6 11 13 15 16
CBS286.31 7 8
FEMS Microbiol Lett 293 (2009) 85–91 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
89Microsatellite markers for Pythium helicoides
Ten of 18 primer sets designed using the flanking regions
on both sides of the microsatellites were successfully used to
amplify bands of the expected sizes from all nine P. helicoides
isolates. Sequence data from three isolates confirmed that
the length polymorphisms in six of these primer sets were
truly due to differences in the numbers of nucleotide motif
repeats. Four loci contained microsatellites, but did not
show polymorphisms. Using the six polymorphic microsa-
tellite markers, 31 alleles were detected among three repre-
sentative isolates, and thus indicated a significant variation
among the isolates. In many organisms, the allelic size
variations of microsatellite markers often result from differ-
ences in the number of simple sequence repeats. However,
it has been reported that nucleotide insertions or deletions
in the flanking regions of the repeat areas might also be
responsible for allelic variations (Orti et al., 1997). In our
study, there were no insertions or deletions in the flanking
regions of the microsatellites, except for two clones of isolate
CBS286.31 at locus YL-TCA that have one base pair inser-
tion. However, it was unaffected in a further analysis,
because of a 3-bp repeat.
More than three alleles were detected in individual P. heli-
coides isolates for each of the loci YL-AC, YL-GA, YL-TCA and
YL- CTTT. This phenomenon was previously reported for
Phytophthora infestans (van der Lee et al., 2001), Phytophthora
cinnamomi (Dobrowolski et al., 2002), Phytophthora ramorum
(Ivors et al., 2006) and Plasmopara viticola (Gobbin et al.,
2003). To explain this, van der Lee et al. (2001) suggested that
trisomy might occur in P. infestans in nature. The multiple
alleles in P. cinnamomi were explained by meiotic nondisjunc-
tion and heterokaryosis. Gobbin et al. (2003) speculated that
heterokaryosis could have taken place in P. viticola. Ivors et al.
(2006) suggested gene duplication and trisomy. Kageyama
et al. (2007) reported that P. helicoides should have a hetero-
karyon, and that each nucleus may have different sequences,
based on their detection of interisolate variation in the rRNA
gene ITS region. Thus, the presence of multiple alleles at a
single locus in P. helicoides might result from trisomy, hetero-
karyosis, gene duplication and/or meiotic nondisjunction.
Allele analysis of 30 P. helicoides isolates showed length
polymorphisms in all loci, except for YL-AC, using capillary
electrophoresis. Thus, the analysis of PCR products will
allow a population genetic study using numerous isolates.
References
Blaise F, Remy E, Meyer M, Zhou L, Narcy JP, Roux J, Balesdent
MH & Rouxel T (2007) A critical assessment of Agrobacterium
tumefaciens-mediated transformation as a tool for
pathogenicity gene discovery in the phytopathogenic fungus
Leptosphaeria maculans. Fungal Genet Biol 44: 123–138.
Chellemi DO, Mitchell DJ, Kannwischer-Mitchell ME, Rayside
PA & Rosskopf EN (2000) Pythium spp. associated with bell
pepper production in Florida. Plant Dis 84: 1271–1274.
Dobrowolski MP, Tommerup IC, Blakeman HD & O’Brien PA
(2002) Non-Mendelian Inheritance revealed in a genetic
analysis of sexual progeny of Phytophthora cinnamomi with
microsatellite markers. Fungal Genet Biol 35: 197–212.
Garzon CD, Geiser DM & Moorman GW (2005) Diagnosis and
population analysis of Pythium species using AFLP
fingerprinting. Plant Dis 89: 81–89.
Gobbin D, Pertot I & Gessler C (2003) Identification of
microsatellite markers for Plasmopara viticola and
establishment of high throughput method for SSR analysis.
Eur J Plant Pathol 109: 153–164.
Hamada HJ, Petrino MG & Kakanuga T (1982) A novel repeated
element with Z-DNA-forming potential is widely found in
evolutionarily diverse eukaryotic genomes. P Natl Acad Sci
USA 79: 6465–6469.
Harvey PR, Butterworth PJ, Hawke BG & Pankhurst CE (2000)
Genetic variation among populations of Pythium irregulare in
southern Australia. Plant Pathol 49: 619–627.
Harvey PR, Butterworth PJ, Hawke BG & Pankhurst CE (2001)
Genetic and pathogenic variation among cereal, medic and
subclover isolates of Pythium irregulare. Mycol Res 105: 85–93.
Herrero ML & Klemsdal SS (1998) Identification of Pythium
aphanidermatum using the RAPD technique. Mycol Res 102:
136–140.
Ivors K, Garbelotto M, Vries ID, Ruyter-Spira C, Hekkert BT,
Rosenzweig N & Bonants PJM (2006) Microsatellite markers
identify three lineages of Phytophthora ramorum in US
nurseries, yet single lineages in US forest and European
nursery populations. Mol Ecol 15: 1493–1505.
Kageyama K, Uchino H & Hyakumachi M (1998)
Characterization of the hyphal swelling group of Pythium:
DNA polymorphisms and cultural and morphological
characteristics. Plant Dis 82: 218–222.
Kageyama K, Aoyagi T, Sunouchi R & Fukui H (2002) Root rot of
miniature roses caused by Pythium helicoides. J Gen Plant
Pathol 68: 15–20.
Kageyama K, Komatsu T & Suga H (2003) Refined PCR protocol
for detection of plant pathogens in soil. J Gene Plant Pathol 69:
153–160.
Kageyama K, Senda M, Asano T, Suga H & Iishiguro K (2007)
Intra-isolate heterogeneity of the ITS region of rDNA in
Pythium helicoides. Mycol Res 111: 416–423.
Karagyozov L, Kalcheva ID & Chapman VM (1993) Construction
of random small-insert genomic libraries highly enriched for
simple sequence repeats. Nucleic Acids Res 21: 3911–3912.
Lian C & Hogetsu T (2002) Development of microsatellite
markers in black locust (Robinia pseudoacacia) using dual-
suppression-PCR technique. Mol Ecol Notes 2: 211–213.
Litt M & Luty JA (1989) A hypervariable microsatellite revealed
by in vitro amplification of a dinucleotide repeat within the
cardiac muscle actin gene. Am J Human Gene 44: 397–401.
FEMS Microbiol Lett 293 (2009) 85–91c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
90 Yin-Ling et al.
Liu YG & Whittier F (1995) Thermal asymmetric interlaced PCR:
automatable amplification and sequencing of insert end
fragment from P1 and YAC clones for chromosome walking.
Genomics 25: 674–681.
Matsumoto C, Kageyama K, Suga H & Hyakumachi M (2000)
Intraspecific DNA polymorphisms of Pythium irregulare.
Mycol Res 104: 1333–1341.
Nagai S, McCauley L, Yasuda N, Erdner DL, Kulis DM, Matsuyama
Y, Itakura S & Anderson DM (2006) Development of
microsatellite markers in the toxic dinoflagellate Alexandrium
minutum (Dinophyceae). Mol Ecol Notes 6: 756–758.
Ochman H, Gerber AS & Hartl DL (1988) Genetic applications of
an inverse polymerase chain reaction. Genetics 120: 621–625.
Orti G, Pearse DE & Avise J (1997) Phylogenetic assessment of
length variation at a microsatellite locus. P Natl Acad Sci USA
94: 10745–10749.
Queller DC, Strassmann JE & Hughes CR (1993) Microsatellites
and kinship. Trends Ecol Evol 8: 285–288.
Suzuki M & Yoneyama C (2005) Occurrence of Pythium root rot
of strawberry caused by Pythium helicoides (abstract in
Japanese). Jpn J Phytopathol 71: 209.
Tamura K, Nishioka M, Hayashi M, Zhang Z, Lian C, Hougetsu T
& Harada K (2005) Development of microsatellite markers by
ISSR-suppression-PCR method in Brassica rapa. Breed Sci 55:
247–252.
Tautz D (1989) Hypervariability of simple sequences as a general
source for polymorphic DNA markers. Nulceic Acids Res 17:
6463–6471.
Tsukiboshi T, Chikuo Y, Ito Y, Matsushita Y & Kageyama K
(2007) Root and stem rot of chrysanthemum caused by five
Pythium species in Japan. J Gen Plant Pathol 73: 293–296.
Van der Lee T, Robold A, Testa A, van ‘t Klooster JW & Govers F
(2001) Mapping of avirulence genes in Phytophthora infestans
with amplified fragment length polymorphism markers
selected by bulked segregant analysis. Genetics 157: 949–956.
Watanabe H, Horinouchi H, Tanahashi I & Kageyama K (2005)
Occurrence of root rot of strawberry caused by Pythium
helicoides, and pathogenicity to several crop (abstract in
Japanese). Jpn J Phytopathol 71: 209–210.
Watanabe H, Taguchi H, Hyakumachi M & Kageyama K (2007)
Pythium and Phytophthora species associated with root and
stem rots of kalanchoe. J Gene Plant Pathol 73: 81–88.
Weber JL & May PE (1989) Abundant class of human DNA
polymorphism which can be typed using the polymerase chain
reaction. Am J Human Gene 44: 388–396.
Zane L, Bargelloni L & Patarnello T (2002) Strategies for
microsatellite isolation: a review. Mol Ecol 11: 1–16.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Table S1. Accession number of six microsatellite loci in
Pythium helicoides.
Please note: Wiley-Blackwell is not responsible for the
content or functionality of any supporting materials sup-
plied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
FEMS Microbiol Lett 293 (2009) 85–91 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
91Microsatellite markers for Pythium helicoides