development of microsatellite markers for pythium helicoides

R E S E A R C H L E T T E R

Developmentofmicrosatellitemarkers forPythiumhelicoidesYin-Ling1,2, Wei Zhou3, Keiichi Motohashi2, Haruhisa Suga4, Hirokazu Fukui5 & Koji Kageyama2

1The United Graduate School of Agricultural Science, Gifu University, Gifu, Japan; 2River Basin Research Center, Gifu University, Gifu, Japan; 3School of

Environmental Science and Engineering, Shanghai Jiaotong University, Shanghai, China; 4Life Science Research Center, Gifu University, Gifu, Japan; and5Faculty of Applied Biological Science, Gifu University, Gifu, Japan

Correspondence: Yin-Ling, The United

Graduate School of Agricultural Science, Gifu

University, 1-1 Yanagido, Gifu 501-1193,

Japan. Tel./fax: 181 5829 32063; e-mail:

[email protected]

Received 16 September 2008; revised 30

December 2008; accepted 7 January 2009.

First published online 17 February 2009.

DOI:10.1111/j.1574-6968.2009.01518.x

Editor: Bernard Paul

Keywords

Pythium; dual-suppression PCR; TAIL-PCR; SSR;

molecular marker.

Abstract

A strategy combining dual-suppression PCR and thermal asymmetric interlaced PCR

was used to determine sequences flanking microsatellite regions in Pythium helicoides.

The primer pairs were designed to amplify loci containing (AC)n, (GA)n, (AGC)n,

(CAC)n(CAA)n, (TCA)n and (CTTT)n repeats from the P. helicoides nuclear

genome. The PCR products of each primer pair, amplified from three representative

isolates collected from different hosts and locations, were cloned and sequenced.

Different degrees of polymorphism were detected among these microsatellite

markers. The numbers of alleles were 6, 2, 4, 11, 4 and 4 in YL-AC, YL-AGC,

YL-CAA, YL-CTTT, YL-GA and YL-TCA, respectively. Allele analysis of 30

P. helicoides isolates showed length polymorphisms in all loci, except for YL-AC,

using capillary electrophoresis. Thus, we have developed a simple method for

designing PCR primers to amplify microsatellite markers from P. helicoides.

Introduction

The oomycete Pythium helicoides was originally isolated from

Dahlia root and described in 1930, but there were few

subsequent reports on the species until recently. Pythium

helicoides was recently isolated from bell pepper in Florida,

and is considered to be virulent in several crops (Chellemi

et al., 2000). In Japan, the species was identified as a pathogen

causing root rot of miniature rose and kalanchoe in ebb and

flow irrigation systems (Kageyama et al., 2002; Watanabe et al.,

2007). The root rot disease has also been observed in rock-

wool cultures of cutting rose and has spread all over the

country. Furthermore, it has been reported that P. helicoides

causes root and crown rot of strawberry, and damping off of

chrysanthemum (Suzuki & Yoneyama, 2005; Watanabe et al.,

2005; Tsukiboshi et al., 2007). Population genetics studies are

needed in order to develop strategies to control the occurrence

and spread of this pathogen.

In recent years, several molecular methods have been used

in the characterization of Pythium isolates, including the use

of random amplified polymorphic DNA (RAPD) markers

(Herrero & Klemsdal, 1998; Kageyama et al., 1998; Matsu-

moto et al., 2000), amplified fragment length polymorph-

isms (AFLP) (Garzon et al., 2005) and restriction fragment

length polymorphisms (RFLP) (Harvey et al., 2000, 2001).

Both RAPD and AFLP analyses are fast and convenient

procedures; however, they can only detect dominant mar-

kers, and thus cannot be used to identify heterozygotes in

diploid species such as P. helicoides. Furthermore, RAPD

analysis is poorly reproducible, especially between labora-

tories and researchers. RFLP analysis is very informative, but

time consuming, because Southern blots are needed.

Microsatellites or simple sequence repeats are tandemly

repeated motifs of one to six bases found in eukaryotic

genomes (Hamada et al., 1982), including fungi (Tautz,

1989). Since they were first described (Litt & Luty, 1989;

Tautz, 1989; Weber & May, 1989), microsatellites have been

widely used as tools in studies of genetic variation in natural

populations, because they are codominant, multiallelic,

highly polymorphic and require only small amounts of

DNA for PCR analysis. Microsatellites can be amplified

using primer pairs complementary to their flanking regions,

and fragment length polymorphisms are detected by gel

electrophoresis. To amplify microsatellite loci by PCR,

primers must be developed using the flanking sequences.

Sequence information for primer design can be obtained by

constructing and screening a small insert plasmid library

(Queller et al., 1993) or by enriching a DNA library for

microsatellites (Karagyozov et al., 1993); however, both of

these methods are labor-intensive and expensive. Therefore,

FEMS Microbiol Lett 293 (2009) 85–91 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

several alternative strategies, including modifications of the

RAPD method, PCR isolation of microsatellite arrays and

primer extension enrichment protocols (Zane et al., 2002),

have been devised. However, none of these methods have

been widely adopted.

The objectives of this study were to apply dual-

suppression PCR (Lian & Hogetsu, 2002) and thermal

asymmetric interlaced (TAIL)-PCR (Liu & Whittier, 1995)

to develop microsatellite markers for P. helicoides, and

to verify the usefulness of these markers for population

analyses of P. helicoides.

Materials and methods

Isolates and DNA extraction

In this study, nine P. helicoides isolates were chosen,

which represent its known ranges of geographical locations

and hosts (Table 1; working numbers 1–9). Genomic DNA

was extracted from mycelia following the procedure of

Kageyama et al. (2003).

Dual-suppression PCR

As the first step in isolating microsatellite loci, fragments with

microsatellite sequences at one end were obtained by dual-

suppression PCR (Lian & Hogetsu, 2002). The followed

procedure was used to construct adaptor-ligated DNA

libraries. Samples of genomic DNA (5mg) from the isolate H-

5 were digested with the enzymes AccII, AfaI, AluI, EcoRV,

HaeIII and SspI (Toyobo, Osaka, Japan) according to the

manufacturer’s instructions. The DNA fragments were pur-

ified using the GENECLEAN SPIN Kit (Qbiogene, Carlsbad,

CA), and then ligated to adaptors (Lian & Hogetsu, 2002)

consisting of a 48-mer (50-GTAATACGACTCACTATAGGGC

ACGCGTGGTCGACGGCCCGGGCTGGT- 30) and an 8-mer

with the 30 end capped by an amino residue (50-ACCAGCCC

-NH2-30), using a DNA ligation kit (Takara Bio Inc., Shiga,

Japan). The resulting DNA libraries were then used as

templates in PCR amplifications with primer pairs consisting

of the adaptor primer AP2 (50-CTATAGGGCACGCGTGGT-

30), designed from the longer adaptor strand, and one of the

10 microsatellite primers, (AC)10, (GA)10, (AAT)7, (AGC)10,

(CAA)7, (CAT)10, (TCA)10, (TGC)10, (AGTG)5 and (CTTT)5.

The 50-mL PCR reactions contained 1mL of template DNA,

1mM of each primer, 1.25 U of rTaq DNA polymerase (Takara

Bio Inc.), 200mM dNTPs, 400 ngmL�1 bovine serum albumin

(BSA) (Wako, Osaka, Japan) and 1� PCR buffer (10 mM

Tris-HCl, pH 8.3, 50 mM KCl and 1.5 mM MgCl2), and were

performed in a 2700 DNA Thermal Cycler (Applied Biosys-

tems, Norwalk, CN). The reactions consisted of an initial

denaturation for 4 min at 94 1C, followed by 35 cycles of 94 1C

for 1 min, 60 1C for 0.5 min and 72 1C for 2 min, with a final

extension at 72 1C for 10 min. PCR products were cloned into

the pT7Blue T-vector (Takara Bio Inc.) using a DNA ligation

kit (Takara Bio Inc.) and cloned. Selected clones were

amplified using the M13M4 and M13Rv primers. The PCR

products were purified using the Gene Elute PCR purification

kit (Sigma, Ronkonkoma, NY), and then sequenced using the

M13M4 and M13Rv primers and the Big DyeTM Terminator

V3.1 Cycle Sequencing Ready Reaction kit (Applied Biosys-

tems). The sequencing reaction products were analyzed on an

ABI 3100 DNA sequencer (Applied Biosystems). Consensus

sequences were based on results of the forward and reverse

sequencing reactions.

TAIL-PCR

In order to determine the sequence of the flanking region on

the other side of each microsatellite, TAIL-PCR was per-

formed according to the protocol developed by Liu & Whittier

(1995), using genomic DNA from isolate H-5. The TAIL-PCR

method utilizes an arbitrary degenerate (AD) reverse primer,

together with three interlaced specific sense primers in con-

secutive reactions. The three sense primers were based on the

sequences obtained from the microsatellite clones described

Table 1. Isolates of Pythium helicoides used in this study

Working

numbers

Isolate

numbers Origin Location

1 H-5 Rose Gifu, Japan

2 OMF3 Rose Oita, Japan

3 OMF6 Rose Oita, Japan

4 OB5-2 Rose Oita, Japan

5 SPH-1 Rose Shizuoka, Japan

6 NaStr1 Strawberry Nagano, Japan

7 TCG1 Strawberry Tochigi, Japan

8 GF-59 Kalanchoe Gifu, Japan

9 CBS286.31 Phaseolus vulgaris USA

10 GF-107 Rose Gifu, Japan

11 MH-P2 Rose Gifu, Japan

12 MH-y2 Rose Gifu, Japan

13 MH-y3 Rose Gifu, Japan





18 1Wak-600 Rose Wkayama, Japan

19 2nig Rose Niigata, Japan

20 MAFF425443 Pinto bean Nara, Japan

21 SP-KR05-B2 Rose Shizuoka, Japan

22 SP-KR03-4 Rose Shizuoka, Japan

23 SP-KR04-B3 Rose Shizuoka, Japan



26 SP-KS04-A2 Rose Shizuoka, Japan

27 OM3 Rose Oita, Japan

28 OM4 Rose Oita, Japan



FEMS Microbiol Lett 293 (2009) 85–91c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

86 Yin-Ling et al.

above, and designed using the computer program PRIMER

PREMIER 5 (Premier Biosoft International, CA). The three

arbitrary degenerate primers AD1, 50-NGTCGASWGANAW

GAA-30; AD2, 50-TGWGNAGSANCASAGA-30; and AD3,

50-AGWGNAGWANCAWAGG-30 were used in a separate

reaction series with each set of sense primers. The series of

three PCR reactions (designated as primary, secondary and

tertiary TAIL) were performed as follows: the primary and

secondary TAIL reactions were carried out in 20mL with 0.8 U

of rTaq DNA polymerase and 1�PCR buffer. The primary

TAIL reaction also included 20mg of genomic DNA, 0.2mM

primary specific primer, 5mM arbitrary primer and 200mM

dNTPs. The secondary TAIL reaction contained 1mL of a 1/50

dilution of the primary PCR product, 0.2mM secondary

specific primer, 3mM of the arbitrary primer and 25mM

dNTPs. The tertiary TAIL reactions were performed in

100mL with 1mL of a 1/10 dilution of the secondary TAIL

product, 3.5 U of rTaq DNA polymerase, 25mM dNTPs,

1� PCR buffer, 0.2mM of the tertiary specific primer and

0.2mM of the arbitrary primer. The thermal cycle protocols

were the same as those used by Liu & Whittier (1995). Selected

major bands resulting from the TAIL reactions were purified

from gels using the Get Pure DNA Kit (Dojindo Laboratories)

according to the manufacturer’s instructions, and then cloned

and sequenced. The resulting sequences were used to design

primers specific to the regions flanking the microsatellites. All

primers were between 18 and 24 nucleotides in length, with

annealing temperatures (Tm) between 55 and 65 1C and GC

contents of 40–60%. Primer pairs were designed to amplify

products of 100–600 bp.

Microsatellite amplification

The microsatellite flanking primers were tested using 10

isolates of P. helicoides listed in Table 1. Each PCR amplifica-

tion was carried out in a 25-mL reaction mixture that

contained 20 ng of genomic DNA, 1 mM of each microsatel-

lite primer, 0.625 U of rTaq DNA polymerase, 200 mM

dNTPs, 400 ng mL�1 BSA and 1� PCR buffer. The amplifi-

cation conditions were as described for the dual-suppression

PCR reactions, except that the annealing temperatures were

between 55 and 65 1C.

Characteristics of microsatellite loci

To investigate the characteristics of microsatellite loci am-

plified by six primer pairs, 30 P. helicoides isolates (Table 1)

were used for allele analysis. The PCR was performed with a

50 fluorescent-labeled forward primer and a 50 unlabeled

tailed reverse primer to resolve an ‘additional-A’ problem

(Applied Biosystems). The size of individual PCR products

at each microsatellite locus was determined using an auto-

matic ABI 3100 DNA sequencer with LIZ size standard

GeneScan-500 and analyzed using GENEMAPPERs software

v 4.0 (Applied Biosystems). GENEPOP 4.0 on the internet was

used to calculate the observed and expected heterozygosities

and to test the linkage disequilibrium between loci.

Results

Dual-suppression PCR

Genomic DNA fragments of the H-5 isolate that were

digested with restriction enzymes were used to create

adaptor-ligated DNA libraries. The libraries were used as

templates in PCR reactions with an adaptor primer and each

of 10 tandem repeat primers. One hundred and seventy-four

clones of PCR products from the DNA libraries were ran-

domly selected to be sequenced. Sequences containing at

least seven dinucleotide, four trinucleotide, or four tetranucleo-

tide repeat motifs were recognized as microsatellites. Using this

threshold, 104 of the 174 clones were selected (Table 2).

No clone was obtained after PCR amplification with two of 10

tandem repeat primers, (AAT)n and (CAT)n. One clone,

derived from the (CAA)n motif PCR amplification, contained

a compound repeat (CAC)n(CAA)n instead of the expected

repeat sequence (CAA)n. Finally, 31 clones having adequate

sequences to design specific primer sets for TAIL-PCR were

selected. Table 3 shows six TAIL-PCR primer sets that were used

to amplify flanking sequences for the microsatellite markers.

TAIL-PCR

TAIL-PCR was performed in order to amplify the sequence on

the other side of each selected microsatellite. Twenty-four of

31 primer sets gave one or two specific and clearly visible

Table 2. Number of clones with microsatellite repeats obtained by

suppression PCR using genomic DNA digested with six restriction

enzymes

Restriction

enzyme

Recognized

sequence

Sequenced

clones

Clones containing

microsatellite

repeats (%)

AccII 50-CG��

CG-30

GC GC-5038 34 (89.5)

AfaI 50-AG��

CT-30

TC GA -5044 30 (68.2)

AluI 50-AG��

CT-30

TC GA-5016 10 (62.5)

EcoRV 50-GAT��

ATC-30

CTA TAG-5 020 9 (45.0)

HaeIII 50-GG��

CC-30

CC GG-5040 21 (52.5)

SspI 50-AAT��

ATT-30

TTA TAA-5016 0 (0)

Total 174 104 (59.8)


87Microsatellite markers for Pythium helicoides

bands after the tertiary PCR reactions (data not shown).

Each of these main bands was cloned for DNA sequencing.

All of the resulting clones contained microsatellites; how-

ever, six of the sequences were rejected from further analysis

due to their high GC content. Each of the remaining 18

clones contained one of the microsatellites, (AC)n, (GA)n,

(AGC)n, (CAC)n(CAA)n, (TCA)n, (TGC)n, (AGTG)n or

(CTTT)n. These clones were used to design primers for

amplification of microsatellite-containing regions.

Microsatellite amplification

Eighteen microsatellite primer sets were designed from the

sequences obtained by TAIL-PCR and tested with DNA

isolated from nine representative isolates of P. helicoides.

Bands were successfully amplified from all isolates with 10 of

the primer pairs.

Sequence analysis for polymorphic loci

In order to confirm that the PCR products amplified using

the designed primers would contain microsatellite loci,

and to determine whether the variability in size would

correspond to a variable number of repeat motifs, the PCR

products were sequenced. Four to 18 positive clones of each

of the PCR products obtained using 10 primer pairs with

each of three isolates, H-5, OMF3 and CBS286.31, were

sequenced. Six of 10 primer sets contained microsatellite

repeats and were selected for further studies (Table 4). For

these six markers, the lengths of the amplified regions, and

the numbers of microsatellite repeats in the various alleles

found in the isolates, are shown in Table 5. Among all six

loci in the isolates, the PCR products ranged in length from

113 to 523 bp. The numbers of alleles (i.e. with different

numbers of microsatellite repeats) ranged from two (locus

YL-AGC) to 11 (locus YL-CTTT).

Characteristics of microsatellite loci

Thirty P. helicoides isolates in Table 1 were tested to perform

further genetic study with the six microsatellite markers

(Fig. 1). Microsatellite allele sizes from all isolates were

scored with the locus, except for YL-AC (Table 4). In the

locus YL-AC, the size could not be evaluated because of

nonspecific amplification. The number of alleles for five loci

varied from four to 16. The mean of alleles per locus was 4.8

at all of 30 isolates. The expected and observed heterozygos-

ities (He and Ho) ranged from 0.56 to 0.65 and 0.58 to 1.00,

respectively. None of the diploid type isolates was observed

in locus YL-CTTT. No significant linkage disequilibrium

was found between locus YL-GA and other loci tested.

Discussion

A new method for the isolation of microsatellite markers

from P. helicoides genome is described in this study. A

combination of dual-suppression PCR and TAIL-PCR was

successfully applied in order to determine the sequences of

the flanking regions of each microsatellite.

In the first step of this process, dual-suppression PCR was

successfully used to amplify microsatellite sequences from

digested and adaptor-ligated DNA libraries. This method

is used to selectively amplify DNA fragments that have both

Table 3. Sequences of six primer sets designed for TAIL-PCR

Primer name Primer sequence (50–30)

AC1 CAGGTCGAATGGAAGTATGTGC

AC2 TGTGGTCGGTATTGTATTGG

AC3 ATTTGGTGCGGTTGAGAA

GA1 TCTTCACCGTTGGGATCCCAG

GA2 AAACACCTAGCCTTGCTTTCAGC

GA3 TTCAGGAATCGCAGCTGAGC

AGC1 TCGGCCTACGGCCCAGGATT

AGC2 CCTACGGCCCAGGATTGA

AGC3 CCAGGATTGAGCTAGTAGCAGT

CAA1 CTATGGAACGCGGGCATGACAA

CAA2 CCCACACGCCACATCCAAAGC

CAA3 ACCATAAGCGCCTGCATCGACAC

TCA1 TCTTTCCAACGCTACTTCT

TCA2 GATTCTGTGCTGCGTCTC

TCA3 ATTGGCTATGGTGTATGTTGTG

CTTT1 ATTGGGTCGGCGGCGTGTA

CTTT2 TGTGGTCGGTATTGTATTGG

CTTT3 CATTTGGTGCGGTTGAGA

123

121

H-5

OMF3

117

121

119121

119

117

120 130 140110 bp

120 130 140110 bp

120 130 140110 bp

CBS286.31

Fig. 1. Capillary electropherograms of amplification fragments in the

YL-GA locus of Pythium helicoides isolates H-5, OMF3 and CBS286.31.

Numbers indicate the size in base pairs.


88 Yin-Ling et al.

a microsatellite repeat sequence and an adaptor sequence.

Amplification of fragments with the same adaptor on both

ends is suppressed, because of intramolecular hybridization

between the adaptor on the 50 end and its complement on

the 30 end. Nagai et al. (2006) used a similar method in

population genetic studies of the toxic dinoflagellate Alex-

andrium minutum (Dinophyceae) and found that among 480

sequenced clones, 87 clones (18%) contained microsatellites

at one end. In our study, 104 (59.8%) of the 174 sequenced

clones contained repeats at one end.

Six restriction enzymes were used to develop the adaptor-

ligated DNA libraries. In general, we obtained larger numbers

of useful microsatellite clones from the libraries developed

using the four-base recognition enzymes. Of these, AccII was

found to be the most useful for P. helicoides, because c. 90% of

the sequenced clones from this library contained microsatel-

lites. Tamura et al. (2005) tested the same six restriction

enzymes as those used in this study in Brassica rapa,

and obtained better results with EcoRV and SspI. These

observations suggest that the optimum restriction enzymes

for cloning microsatellites might be different among taxo-

nomic groups.

Our efforts to isolate the other flanking region of each

microsatellite using either dual-suppression PCR or inverse

PCR (Ochman et al., 1988) were not successful. The TAIL-

PCR approach is a simple and efficient technique for genomic

analysis in plant molecular biology (Liu & Whittier, 1995).

By combining dual-suppression PCR with TAIL-PCR, we

were able to find the flanking regions on the other sides of

the microsatellites that were isolated from P. helicoides. Using

TAIL-PCR, we were able to amplify clean, microsatellite-

containing products using 24 (77%) of the 31 primer sets

tested. This was similar to the percentage reported for Lepto-

sphaeria maculans (75%) (Blaise et al., 2007).

Our results indicated that the chances of cloning a

microsatellite repeat motif were 60% by dual-suppression

PCR in the first step of the combined process, and 77% by

TAIL-PCR in the second step of the process. Thus, our

overall success rate (46%) in cloning microsatellite markers

with flanking sequences on both sides was relatively high. In

contrast, the percentages of positive clones that are obtained

by traditional methods usually range from 0.04% to 12%

(Zane et al., 2002). The approach developed in this study

substantially reduces both the time and the costs in the

development of microsatellite markers.

Table 4. Characteristics of microsatellite markers isolated from Pythium helicoides

Locus Microsatellite motif Primer sequence (50–30) Tm ( 1C) Size (bp)� No. of alleles� Hew Hoz

YL-AC (AC)n CCAGCATCCACGGCAATC 60 –‰ –‰ –‰ –‰

CAGGTCGAATGGAAGTATGTGC

YL-GA (GA)n TTCAGGAATCGCAGCTGAGC 65 113–123 7 0.56 1.00

ATGCGAGACTGAAGGAATGAGA

YL-AGC (AGC)n CCAGGATTGAGCTAGTAGCAGT 60 249–282 4 0.66 0.58

CGTCTTCGTAACTTCGGT

YL-CAA (CAC)n(CAA)n GAACCCAAGCAGTTTCCTGTTAGC 60 516–528 5 0.64 0.91

CGTTTTGAGGGCGTTGCGGTC

YL-TCA (TCA)n GCAATCACAGCTCCCACA 60 163–190 7 0.65 1.00

TCTTTCCAACGCTACTTCT

YL-CTTT (CTTT)n ACACCAACCATATGCTTT 55 143–203 16 –z 0.97

AGAAAGTACGAGGATGAC

�The size and number of alleles were evaluated by capillary electrophoresis of PCR products from 30 isolates.wExpected heterozygosity derived from 12 diploid type data.zObserved heterozygosity derived from 12 diploid type data.‰Allele analysis was not performed because of nonspecific band occurrence.zThe analysis was not performed because of no diploid type data.

Table 5. Variation of repeat numbers in six microsatellite loci

Primer

name Isolate

Amplicon

length (bp)

Number of repeats in different

alleles

YL-AC H-5 147–181 9 14 13

OMF3 9 14

CBS286.31 18 25 26

YL-GA H-5 113–121 9 10 11 12

OMF3 10 11

CBS286.31 11 12

YL-AGC H-5 250–253 6

OMF3 6

CBS286.31 5 6

YL-CAA H-5 517–523 517 616

OMF3 517

CBS286.31 618 717

YL-TCA H-5 162–182 10

OMF3 9 10

CBS286.31 3 4 9 10

YL-CTTT H-5 145–209 6 12 13 14 17 22

OMF3 6 11 13 15 16

CBS286.31 7 8



Ten of 18 primer sets designed using the flanking regions

on both sides of the microsatellites were successfully used to

amplify bands of the expected sizes from all nine P. helicoides

isolates. Sequence data from three isolates confirmed that

the length polymorphisms in six of these primer sets were

truly due to differences in the numbers of nucleotide motif

repeats. Four loci contained microsatellites, but did not

show polymorphisms. Using the six polymorphic microsa-

tellite markers, 31 alleles were detected among three repre-

sentative isolates, and thus indicated a significant variation

among the isolates. In many organisms, the allelic size

variations of microsatellite markers often result from differ-

ences in the number of simple sequence repeats. However,

it has been reported that nucleotide insertions or deletions

in the flanking regions of the repeat areas might also be

responsible for allelic variations (Orti et al., 1997). In our

study, there were no insertions or deletions in the flanking

regions of the microsatellites, except for two clones of isolate

CBS286.31 at locus YL-TCA that have one base pair inser-

tion. However, it was unaffected in a further analysis,

because of a 3-bp repeat.

More than three alleles were detected in individual P. heli-

coides isolates for each of the loci YL-AC, YL-GA, YL-TCA and

YL- CTTT. This phenomenon was previously reported for

Phytophthora infestans (van der Lee et al., 2001), Phytophthora

cinnamomi (Dobrowolski et al., 2002), Phytophthora ramorum

(Ivors et al., 2006) and Plasmopara viticola (Gobbin et al.,

2003). To explain this, van der Lee et al. (2001) suggested that

trisomy might occur in P. infestans in nature. The multiple

alleles in P. cinnamomi were explained by meiotic nondisjunc-

tion and heterokaryosis. Gobbin et al. (2003) speculated that

heterokaryosis could have taken place in P. viticola. Ivors et al.

(2006) suggested gene duplication and trisomy. Kageyama

et al. (2007) reported that P. helicoides should have a hetero-

karyon, and that each nucleus may have different sequences,

based on their detection of interisolate variation in the rRNA

gene ITS region. Thus, the presence of multiple alleles at a

single locus in P. helicoides might result from trisomy, hetero-

karyosis, gene duplication and/or meiotic nondisjunction.

Allele analysis of 30 P. helicoides isolates showed length

polymorphisms in all loci, except for YL-AC, using capillary

electrophoresis. Thus, the analysis of PCR products will

allow a population genetic study using numerous isolates.

References

Blaise F, Remy E, Meyer M, Zhou L, Narcy JP, Roux J, Balesdent

MH & Rouxel T (2007) A critical assessment of Agrobacterium

tumefaciens-mediated transformation as a tool for

pathogenicity gene discovery in the phytopathogenic fungus

Leptosphaeria maculans. Fungal Genet Biol 44: 123–138.

Chellemi DO, Mitchell DJ, Kannwischer-Mitchell ME, Rayside

PA & Rosskopf EN (2000) Pythium spp. associated with bell

pepper production in Florida. Plant Dis 84: 1271–1274.

Dobrowolski MP, Tommerup IC, Blakeman HD & O’Brien PA

(2002) Non-Mendelian Inheritance revealed in a genetic

analysis of sexual progeny of Phytophthora cinnamomi with

microsatellite markers. Fungal Genet Biol 35: 197–212.

Garzon CD, Geiser DM & Moorman GW (2005) Diagnosis and

population analysis of Pythium species using AFLP

fingerprinting. Plant Dis 89: 81–89.

Gobbin D, Pertot I & Gessler C (2003) Identification of

microsatellite markers for Plasmopara viticola and

establishment of high throughput method for SSR analysis.

Eur J Plant Pathol 109: 153–164.

Hamada HJ, Petrino MG & Kakanuga T (1982) A novel repeated

element with Z-DNA-forming potential is widely found in

evolutionarily diverse eukaryotic genomes. P Natl Acad Sci

USA 79: 6465–6469.

Harvey PR, Butterworth PJ, Hawke BG & Pankhurst CE (2000)

Genetic variation among populations of Pythium irregulare in

southern Australia. Plant Pathol 49: 619–627.

Harvey PR, Butterworth PJ, Hawke BG & Pankhurst CE (2001)

Genetic and pathogenic variation among cereal, medic and

subclover isolates of Pythium irregulare. Mycol Res 105: 85–93.

Herrero ML & Klemsdal SS (1998) Identification of Pythium

aphanidermatum using the RAPD technique. Mycol Res 102:

136–140.

Ivors K, Garbelotto M, Vries ID, Ruyter-Spira C, Hekkert BT,

Rosenzweig N & Bonants PJM (2006) Microsatellite markers

identify three lineages of Phytophthora ramorum in US

nurseries, yet single lineages in US forest and European

nursery populations. Mol Ecol 15: 1493–1505.

Kageyama K, Uchino H & Hyakumachi M (1998)

Characterization of the hyphal swelling group of Pythium:

DNA polymorphisms and cultural and morphological

characteristics. Plant Dis 82: 218–222.

Kageyama K, Aoyagi T, Sunouchi R & Fukui H (2002) Root rot of

miniature roses caused by Pythium helicoides. J Gen Plant

Pathol 68: 15–20.

Kageyama K, Komatsu T & Suga H (2003) Refined PCR protocol

for detection of plant pathogens in soil. J Gene Plant Pathol 69:

153–160.

Kageyama K, Senda M, Asano T, Suga H & Iishiguro K (2007)

Intra-isolate heterogeneity of the ITS region of rDNA in

Pythium helicoides. Mycol Res 111: 416–423.

Karagyozov L, Kalcheva ID & Chapman VM (1993) Construction

of random small-insert genomic libraries highly enriched for

simple sequence repeats. Nucleic Acids Res 21: 3911–3912.

Lian C & Hogetsu T (2002) Development of microsatellite

markers in black locust (Robinia pseudoacacia) using dual-

suppression-PCR technique. Mol Ecol Notes 2: 211–213.

Litt M & Luty JA (1989) A hypervariable microsatellite revealed

by in vitro amplification of a dinucleotide repeat within the

cardiac muscle actin gene. Am J Human Gene 44: 397–401.


90 Yin-Ling et al.

Liu YG & Whittier F (1995) Thermal asymmetric interlaced PCR:

automatable amplification and sequencing of insert end

fragment from P1 and YAC clones for chromosome walking.

Genomics 25: 674–681.

Matsumoto C, Kageyama K, Suga H & Hyakumachi M (2000)

Intraspecific DNA polymorphisms of Pythium irregulare.

Mycol Res 104: 1333–1341.

Nagai S, McCauley L, Yasuda N, Erdner DL, Kulis DM, Matsuyama

Y, Itakura S & Anderson DM (2006) Development of

microsatellite markers in the toxic dinoflagellate Alexandrium

minutum (Dinophyceae). Mol Ecol Notes 6: 756–758.

Ochman H, Gerber AS & Hartl DL (1988) Genetic applications of

an inverse polymerase chain reaction. Genetics 120: 621–625.

Orti G, Pearse DE & Avise J (1997) Phylogenetic assessment of

length variation at a microsatellite locus. P Natl Acad Sci USA

94: 10745–10749.

Queller DC, Strassmann JE & Hughes CR (1993) Microsatellites

and kinship. Trends Ecol Evol 8: 285–288.

Suzuki M & Yoneyama C (2005) Occurrence of Pythium root rot

of strawberry caused by Pythium helicoides (abstract in

Japanese). Jpn J Phytopathol 71: 209.

Tamura K, Nishioka M, Hayashi M, Zhang Z, Lian C, Hougetsu T

& Harada K (2005) Development of microsatellite markers by

ISSR-suppression-PCR method in Brassica rapa. Breed Sci 55:

247–252.

Tautz D (1989) Hypervariability of simple sequences as a general

source for polymorphic DNA markers. Nulceic Acids Res 17:

6463–6471.

Tsukiboshi T, Chikuo Y, Ito Y, Matsushita Y & Kageyama K

(2007) Root and stem rot of chrysanthemum caused by five

Pythium species in Japan. J Gen Plant Pathol 73: 293–296.

Van der Lee T, Robold A, Testa A, van ‘t Klooster JW & Govers F

(2001) Mapping of avirulence genes in Phytophthora infestans

with amplified fragment length polymorphism markers

selected by bulked segregant analysis. Genetics 157: 949–956.

Watanabe H, Horinouchi H, Tanahashi I & Kageyama K (2005)

Occurrence of root rot of strawberry caused by Pythium

helicoides, and pathogenicity to several crop (abstract in

Japanese). Jpn J Phytopathol 71: 209–210.

Watanabe H, Taguchi H, Hyakumachi M & Kageyama K (2007)

Pythium and Phytophthora species associated with root and

stem rots of kalanchoe. J Gene Plant Pathol 73: 81–88.

Weber JL & May PE (1989) Abundant class of human DNA

polymorphism which can be typed using the polymerase chain

reaction. Am J Human Gene 44: 388–396.

Zane L, Bargelloni L & Patarnello T (2002) Strategies for

microsatellite isolation: a review. Mol Ecol 11: 1–16.

Supporting Information

Additional Supporting Information may be found in the

online version of this article:

Table S1. Accession number of six microsatellite loci in

Pythium helicoides.

Please note: Wiley-Blackwell is not responsible for the

content or functionality of any supporting materials sup-

plied by the authors. Any queries (other than missing

material) should be directed to the corresponding author

for the article.



development of microsatellite markers for pythium helicoides

Documents