Download - A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus
![Page 1: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/1.jpg)
Abdulsalam Abu Libdeh, MDPediatric Endocrinologist
Makassed Islamic Hospital
![Page 2: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/2.jpg)
3 months old male infant, referred from Al-Watani hospital c/o fever, irritability, FTT and vomiting.
Past history: product of FT,NVD, birth wt: 3.6kg, at
Rafidia hospital. At 22d of age admitted to Al-Watani
hospital as he developed fever, irritability, vomiting and FTT.
![Page 3: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/3.jpg)
Investigations at al-Watani: Na :177 K: 4.5 Urea: 44 Crea: 0.9 LFT: NL CBC: NL Urinalysis : free
Family history: Parents were healthy and not consanguineous. A male sibling was diagnosed clinically previously to have nephrogenic diabetes insipidus.
He was started on hydrochlorothiazide 2mg/kg/day, but due to inadequate response, the patient was referred to Makassed hospital.
![Page 4: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/4.jpg)
Physical Examination: Wt: 4.42kg <3rd% Lt: 58cm 25th% Hc: 37.5cm <3rd% Temp: 37c HR: 130/min BP:
72/45 Positive findings on P/E Cachectic , irritable
![Page 5: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/5.jpg)
Investigations: Na+: 150 K+: 3.7 s.osmolality: 304mOsm/kg
BUN: 13 Crea: 0.5
LFT: NL Glu: 97 CBC: NL Blood gas: PH 7.52, HCO3 29, BE +6 Urine: osmolality: 145mOsm/kg
Na: 27
![Page 6: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/6.jpg)
●
●
![Page 7: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/7.jpg)
Investigations: Urine output: 9cc/kg/hr
Urine culture: positive for Klebsiella Blood culture: negative Renal U/S : normal GFR: 43ml/min/1.73m2
![Page 8: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/8.jpg)
Diagnosis
Diabetes Insipidus
Central Nephrogenic
![Page 9: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/9.jpg)
Minirin test:
Diagnosis: Nephrogenic Diabetes Insipidus
S.osmolality
Serum Na Urine osm
Before 304 149 65
After 318 157 96
![Page 10: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/10.jpg)
Kaluril (Amiloride & hydrochlorothiazide) 4mg/kg/day
Indomethacin 2mg/kg/day Feeding 180cc/kg/day (oral & gavage)
Upon discharge: Na: 139 s.osm: 323mOsm/kg urine osm: 85mOsm/kg U.O.P: 2.4cc/kg/hr Wt: 5.1kg
![Page 11: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/11.jpg)
![Page 12: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/12.jpg)
Primers for amplification and sequencing of the AVPR2 gene were:
Exon 1: For: attgaacttgctcctcaggc Rev.: gcttccctgaatcgtcaaac
Exon 2-start: For: ctaggagccaggaagtggg Rev.: gaagatgaagagctggggc
Exon 2-end: For: tcctcctacatgatcctggc Rev.: tggaggatctaggttgggttc
Exon 3: For: gtggctagggctgacgg Rev.: ccagtggctcccaggac
![Page 13: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/13.jpg)
Sequencing the DNA of the affected patient showed mis-sense mutation with replacement of G by A in codon 82 (TGC---TAC). This mutation predicted a substitution of Cysteine to Tyrosine (C82Y) at the amino acid residue of the AVPR2 gene
Patient
![Page 14: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/14.jpg)
Mother was heterozygous for this mutation (carrier)
Mother
![Page 15: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/15.jpg)
Father
![Page 16: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/16.jpg)
Sister
Sister was heterozygous for this mutation (carrier)
![Page 17: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/17.jpg)
![Page 18: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/18.jpg)
![Page 19: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/19.jpg)
Definition: NDI is a clinical disorder, characterized by a urinary concentrating defect resulting from resistance of the collecting duct to the antidiuretic action of vasopressin (AVP).
![Page 20: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/20.jpg)
Classification: Hereditary X-linked V2R Autosomal recessive AQP2 Autosomal dominant AQP2 Acquired Drugs (lithium, amphotericin B) Ureteral obstruction Acute or chronic renal failure Renal cystic disease Interstitial nephritis Nephrocalcinosis Toxic nephropathy due to hypokalemia
![Page 21: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/21.jpg)
X-linked recessive NDI is caused by mutations in the gene encoding the V2 vasopressin receptor (V2R) and is the most frequent genetic cause of the inherited NDI.
To date, 178 different mutations have been reported for V2R NDI, and the mutations spread throughout all portions of the protein.
![Page 22: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/22.jpg)
There are two different receptors for ADH: V1 (AVPR1) & V2 (AVPR2) receptors.
Activation of the V1 receptors:- a. Induces vasoconstriction b. Enhancement of prostaglandin release, while
Activation of V2 receptors:- a. Mediate the antidiuretic responses. b. Peripheral vasodilation
c. The release of factor VIIIc and von Willbrand’s factor from endothelial cells.
![Page 23: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/23.jpg)
Pathogenesis
![Page 24: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/24.jpg)
Clinical manifestations: Massive polyuriaVolume depletionHypernatremia HyperthermiaIrritability Constipation FTT Developmental delay & mental retardation
![Page 25: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/25.jpg)
Clinical manifestations: Diminished appetite & poor food intake due to consumption of large volume of waterGrowth abnormalities. Behavioral problems, including hyperactivity & short term memory problems.
![Page 26: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/26.jpg)
Diagnosis: water deprivation test If the serum osmolality is 290mOsm/kg or higher with a urine osmolality value <290mOsm/kg, water deprivation test is not necessary. To distinguish between central DI & NDI: administration of vasopressin 10-20mcg, followed by serial urine and serum osmolality measurements hourly for 4hrs.
![Page 27: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/27.jpg)
Maintenance of adequate fluid intake & access to free water. Infants require gastrostomy or NG tube feeding to ensure adequate fluid administration throughout day & night.
Minimizing urine output by limiting solute load with a low osmolar, low-sodium diet. For infants, human milk or a low solute formula, such as Similac PM 60/40 is preferred.
![Page 28: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/28.jpg)
Administering medications directed at decreasing urine output. Thiazide diuretics (2-3mg/kg/d) effectively induce Na loss & stimulate proximal tubule reabsorption of water. Potassium-sparing diuretics, amiloride (0.3mg/kg/d) by its additive effect with thiazide are often indicated.
![Page 29: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/29.jpg)
NSAIDs – indomethacin (2mg/kg/d) has an additive effect in reducing water excretion in some patients, dependent upon inhibition of renal prostaglandin synthesis.
Exogenous ADH: most patients with NDI have partial rather than complete resistance to ADH. It is therefore possible that attaining supraphysiologic hormone levels will increase the renal effect of ADH to a clinically important degree.
![Page 30: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/30.jpg)
Experimental approaches: most patients with congenital x-linked NDI have defective V2 vasopressin receptors that are unable to properly fold intracellularly and, as a consequence, correctly transfer to the cell surface. In vitro, the administration of selective, cell permeable nonpeptide V2 and V1a receptor antagonists were able to rescue mutant V2 receptors by promoting their proper folding and maturation. This resulted in the expression of functional cell surface V2 receptors, suggesting that such a therapeutic approach may be fruitful.
![Page 31: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/31.jpg)
Abu Libdeh Abdulsalam, Dweikat Imad & Abu-Libdeh Bassam
Department of Pediatrics, Makassed Hospital, Jerusalem
![Page 32: A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus](https://reader036.vdocuments.mx/reader036/viewer/2022062520/56815959550346895dc69634/html5/thumbnails/32.jpg)
Thank you for your attention