a novel mutation in the avpr2 gene in a palestinian family with nephrogenic diabetes insipidus

32
Abdulsalam Abu Libdeh, MD Pediatric Endocrinologist Makassed Islamic Hospital

Upload: ryu

Post on 02-Feb-2016

23 views

Category:

Documents


0 download

DESCRIPTION

A novel mutation in the AVPR2 gene in a Palestinian family with nephrogenic diabetes insipidus. Abdulsalam Abu Libdeh, MD Pediatric Endocrinologist Makassed Islamic Hospital. Case presentation. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Abdulsalam Abu Libdeh, MDPediatric Endocrinologist

Makassed Islamic Hospital

Page 2: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

3 months old male infant, referred from Al-Watani hospital c/o fever, irritability, FTT and vomiting.

Past history: product of FT,NVD, birth wt: 3.6kg, at

Rafidia hospital. At 22d of age admitted to Al-Watani

hospital as he developed fever, irritability, vomiting and FTT.

Page 3: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Investigations at al-Watani: Na :177 K: 4.5 Urea: 44 Crea: 0.9 LFT: NL CBC: NL Urinalysis : free

Family history: Parents were healthy and not consanguineous. A male sibling was diagnosed clinically previously to have nephrogenic diabetes insipidus.

He was started on hydrochlorothiazide 2mg/kg/day, but due to inadequate response, the patient was referred to Makassed hospital.

Page 4: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Physical Examination: Wt: 4.42kg <3rd% Lt: 58cm 25th% Hc: 37.5cm <3rd% Temp: 37c HR: 130/min BP:

72/45 Positive findings on P/E Cachectic , irritable

Page 5: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Investigations: Na+: 150 K+: 3.7 s.osmolality: 304mOsm/kg

BUN: 13 Crea: 0.5

LFT: NL Glu: 97 CBC: NL Blood gas: PH 7.52, HCO3 29, BE +6 Urine: osmolality: 145mOsm/kg

Na: 27

Page 6: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Page 7: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Investigations: Urine output: 9cc/kg/hr

Urine culture: positive for Klebsiella Blood culture: negative Renal U/S : normal GFR: 43ml/min/1.73m2

Page 8: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Diagnosis

Diabetes Insipidus

Central Nephrogenic

Page 9: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Minirin test:

Diagnosis: Nephrogenic Diabetes Insipidus

S.osmolality

Serum Na Urine osm

Before 304 149 65

After 318 157 96

Page 10: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Kaluril (Amiloride & hydrochlorothiazide) 4mg/kg/day

Indomethacin 2mg/kg/day Feeding 180cc/kg/day (oral & gavage)

Upon discharge: Na: 139 s.osm: 323mOsm/kg urine osm: 85mOsm/kg U.O.P: 2.4cc/kg/hr Wt: 5.1kg

Page 11: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus
Page 12: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Primers for amplification and sequencing of the AVPR2 gene were:

Exon 1: For: attgaacttgctcctcaggc Rev.: gcttccctgaatcgtcaaac

Exon 2-start: For: ctaggagccaggaagtggg Rev.: gaagatgaagagctggggc

Exon 2-end: For: tcctcctacatgatcctggc Rev.: tggaggatctaggttgggttc

Exon 3: For: gtggctagggctgacgg Rev.: ccagtggctcccaggac

Page 13: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Sequencing the DNA of the affected patient showed mis-sense mutation with replacement of G by A in codon 82 (TGC---TAC). This mutation predicted a substitution of Cysteine to Tyrosine (C82Y) at the amino acid residue of the AVPR2 gene

Patient

Page 14: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Mother was heterozygous for this mutation (carrier)

Mother

Page 15: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Father

Page 16: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Sister

Sister was heterozygous for this mutation (carrier)

Page 17: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus
Page 18: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus
Page 19: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Definition: NDI is a clinical disorder, characterized by a urinary concentrating defect resulting from resistance of the collecting duct to the antidiuretic action of vasopressin (AVP).

Page 20: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Classification: Hereditary X-linked V2R Autosomal recessive AQP2 Autosomal dominant AQP2 Acquired Drugs (lithium, amphotericin B) Ureteral obstruction Acute or chronic renal failure Renal cystic disease Interstitial nephritis Nephrocalcinosis Toxic nephropathy due to hypokalemia

Page 21: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

X-linked recessive NDI is caused by mutations in the gene encoding the V2 vasopressin receptor (V2R) and is the most frequent genetic cause of the inherited NDI.

To date, 178 different mutations have been reported for V2R NDI, and the mutations spread throughout all portions of the protein.

Page 22: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

There are two different receptors for ADH: V1 (AVPR1) & V2 (AVPR2) receptors.

Activation of the V1 receptors:- a. Induces vasoconstriction b. Enhancement of prostaglandin release, while

Activation of V2 receptors:- a. Mediate the antidiuretic responses. b. Peripheral vasodilation

c. The release of factor VIIIc and von Willbrand’s factor from endothelial cells.

Page 23: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Pathogenesis

Page 24: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Clinical manifestations: Massive polyuriaVolume depletionHypernatremia HyperthermiaIrritability Constipation FTT Developmental delay & mental retardation

Page 25: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Clinical manifestations: Diminished appetite & poor food intake due to consumption of large volume of waterGrowth abnormalities. Behavioral problems, including hyperactivity & short term memory problems.

Page 26: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Diagnosis: water deprivation test If the serum osmolality is 290mOsm/kg or higher with a urine osmolality value <290mOsm/kg, water deprivation test is not necessary. To distinguish between central DI & NDI: administration of vasopressin 10-20mcg, followed by serial urine and serum osmolality measurements hourly for 4hrs.

Page 27: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Maintenance of adequate fluid intake & access to free water. Infants require gastrostomy or NG tube feeding to ensure adequate fluid administration throughout day & night.

Minimizing urine output by limiting solute load with a low osmolar, low-sodium diet. For infants, human milk or a low solute formula, such as Similac PM 60/40 is preferred.

Page 28: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Administering medications directed at decreasing urine output. Thiazide diuretics (2-3mg/kg/d) effectively induce Na loss & stimulate proximal tubule reabsorption of water. Potassium-sparing diuretics, amiloride (0.3mg/kg/d) by its additive effect with thiazide are often indicated.

Page 29: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

NSAIDs – indomethacin (2mg/kg/d) has an additive effect in reducing water excretion in some patients, dependent upon inhibition of renal prostaglandin synthesis.

Exogenous ADH: most patients with NDI have partial rather than complete resistance to ADH. It is therefore possible that attaining supraphysiologic hormone levels will increase the renal effect of ADH to a clinically important degree.

Page 30: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Experimental approaches: most patients with congenital x-linked NDI have defective V2 vasopressin receptors that are unable to properly fold intracellularly and, as a consequence, correctly transfer to the cell surface. In vitro, the administration of selective, cell permeable nonpeptide V2 and V1a receptor antagonists were able to rescue mutant V2 receptors by promoting their proper folding and maturation. This resulted in the expression of functional cell surface V2 receptors, suggesting that such a therapeutic approach may be fruitful.

Page 31: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Abu Libdeh Abdulsalam, Dweikat Imad & Abu-Libdeh Bassam

Department of Pediatrics, Makassed Hospital, Jerusalem

Page 32: A novel mutation in the AVPR2 gene in a Palestinian family with  nephrogenic  diabetes  insipidus

Thank you for your attention