transcriptome analysis of cold acclimation in barley albina and xantha mutants

Running head: Cold response in chloroplast developmental mutants

Author for Correspondence: Luigi Cattivelli: Istituto Sperimentale per la Cerealicoltura Via S.

Protaso 402 - 29017 Fiorenzuola d'Arda (PC) Italy. Tel: +390523983758; fax +390523983750; e-

mail: [email protected]

Research Area: Environmental Stress and Adaptation

Plant Physiology Preview. Published on April 7, 2006, as DOI:10.1104/pp.105.072645

Copyright 2006 by the American Society of Plant Biologists

www.plant.org on January 21, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2006 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/

http://www.plant.org

2

Transcriptome analysis of cold acclimation in barley albina and xantha mutants

Jan T. Svensson1* Cristina Crosatti2*, Chiara Campoli2,3, Roberto Bassi3, Antonio Michele Stanca2,

Timothy J. Close1 and Luigi Cattivelli2

1Department of Botany and Plant Sciences, University of California, Riverside, CA, 92521, USA.

2CRA Istituto Sperimentale per la Cerealicoltura Via S. Protaso 302 - 29017 Fiorenzuola d'Arda

(PC) Italy. 3Dipartimento Scientifico e Tecnologico - Università di Verona, Strada Le Grazie 15,

37134 Verona, Italy.

* = authors contributed equally




3

Footnotes: This work was supported by the GENEFUN (functional genetics) program, the FIRB

programs N° RBNE01LACT (plant-stress) and RBAU01E3CX, and USDA/CSREES/IFAFS (2001-

52100-11346).

Author for Correspondence: Luigi Cattivelli: Istituto Sperimentale per la Cerealicoltura Via S.

Protaso 402 - 29017 Fiorenzuola d'Arda (PC) Italy. Tel: +390523983758; fax +390523983750; e-

mail: [email protected]




4

Abstract

Previously, we have shown that barley plants carrying a mutation preventing chloroplast

development are completely frost susceptible as well as impaired in the expression of several cold-

regulated genes. Here we investigated the transcriptome of barley albina and xantha mutants and

the corresponding wild type (WT) to assess the effect of the chloroplast on expression of cold-

regulated genes. First, by comparing control WT against cold hardened WT plants 2,735 probe sets

with statistically significant changes (p = 0.05, ≥2-fold change) were identified. Expression of these

WT cold-regulated genes was then analyzed in control and cold hardened mutants. Only about 11%

of the genes cold-regulated in WT were regulated to a similar extent in all genotypes (chloroplast-

independent cold-regulated genes); this class includes many genes known to be under Cbf control.

Cbf genes were also equally induced in mutants and WT plants. About 67% of WT cold-regulated

genes were not regulated by cold in any mutant (chloroplast-dependent cold-regulated genes). We

found that the lack of cold regulation in the mutants is due to the presence of signaling pathway(s)

normally cold-activated in WT but constitutively active in the mutants, as well as to the disruption

of low-temperature signaling pathway(s) due to the absence of active chloroplasts. We also found

that photooxidative stress signaling pathway is constitutively active in the mutants. These results

demonstrate the major role of the chloroplast in the control of the molecular adaptation to cold.




5

Introduction

Plants can increase their freezing tolerance in response to low, non-freezing temperatures, a

phenomenon known as cold acclimation or hardening. The molecular dissection of cold acclimation

reveals a complex process characterized by the coordinated up- or down-regulation of hundreds of

cold-regulated genes. The signal transduction pathways leading to expression of cold-regulated

genes in Arabidopsis involves a regulatory network (Shinozaki and Yamaguchi- Shinozaki, 2000;

Thomashow, 2001; Fowler and Thomashow, 2002) where a few regulatory genes control many

genes in the cold response. The C-repeat binding factor (Cbf) genes (also known as DREB1),

regulators of the cold-induced transcriptional cascade, have been shown to increase freezing

tolerance when overexpressed in transgenic plants (Jaglo-Ottosen et al., 1998; Liu et al., 1998). Yet,

additional pathways are apparent from transcriptional profiling of plants overexpressing Cbf genes,

where low temperature evoked elevated expression of additional genes despite the constitutive

expression of Cbf regulators (Fowler and Thomashow, 2002). Similarly, in barley and wheat, many

genes are cold-regulated (Cattivelli et al., 2002) including Cbf-like sequences (Choi et al., 2002;

Vágújfalvi et al., 2005) that trans-activate cold-regulated genes (Xue, 2002; 2003). The Cbf locus

on chromosome 5 co-segregates with a frost resistance QTL in T. monococcum (Vágújfalvi et al.,

2003) and barley (Choi et al 2002; Francia et al., 2004). A number of adaptive mechanisms

including accumulation of proline and other osmolytes, alterations in carbon metabolism and

changes in lipid membrane composition, are part of the cold hardening process (Iba, 2002). To what

extent these varied processes are regulated by factors other than Cbf’s has not yet been thoroughly

explored.

The ability of plants to develop a frost resistant phenotype is associated with the presence of

light and photosynthetic activity during cold acclimation. Plants can perceive variations in day-

length, light quality and light intensity. Chloroplasts utilize light as a source of energy and react to

variations in light intensity by adapting metabolism to the redox state of the electron transport chain

(Pfannschmidt et al., 1999; 2001). An increased PSII excitation pressure (the relative reduction state

of Qa, the first stable electron acceptor of PSII, Huner et al., 1998) is one of the primary stimuli

promoting expression of cold-regulated genes (Gray et al., 1997, Ndong et al., 2001). Consequently,

exposure to cold in the absence of light reduces the induction of several cold-regulated genes

(Crosatti et al., 1999; Kobayashi et al., 2004). Also several morphological traits associated with

cold acclimation such as the development of a compact rosette growth habit in winter cereals

(Fowler and Carles, 1979), are dependent on the PSII excitation pressure (Gray et al., 1997).

Freezing tolerance was not detected in Arabidopsis and other plants acclimated in the dark, under




6

low light intensity, or at normal light intensity in the presence of the photosynthesis inhibitor

DCMU (Wanner and Junttila, 1999; Bourion et al., 2003). Although light in combination with low

temperature is an essential factor to promote cold acclimation, low temperature alone can still

promote part of the cold response. In addition, cold-regulated genes can be induced to high levels

even in the absence of light, when no enhancement of freezing tolerance can be detected (Grossi et

al., 1998; Wanner and Junttila, 1999).

Barley genetic stocks offer a unique collection of chloroplast deficient mutants, most of them

characterized at genetic and biochemical levels (Henningsen et al., 1993). Although these mutations

are generally lethal, the large endosperm of barley seeds supports plant growth for several weeks,

allowing analysis of the mutants at a seedling stage. In this work we analyzed four non allelic

albina (alb-e16, alb-f

17) and xantha (xan-s

46, xan-b

12) mutants characterized by a block in

subsequent steps of the chloroplast development (Henningsen et al., 1993). In the albina mutants

the leaves are completely white. alb-e16

accumulates about 5% of protochlorophyllide (Pchlide)

present in wild type (WT) and the plastids are characterized by the presence of small crystalline

prolamellar bodies. alb-f17 accumulates about 70% of Pchlide present in WT and most of it is

converted to chlorophyllide (Chlide); after illumination large crystalline prolamellar bodies are

frequent but primary lamellar layers are absent. The mutant xan-s46

synthesizes carotenoids, Chlide

and a small amount of chlorophyll; expanded and transformed prolamellar bodies with short

profiles of lamellar layers are present. Leaves of xan-b12 contain carotenoids and up to 6% of the

chlorophyll present in the WT. Many small diameter grana with 2 to 3 discs are formed and most of

the paired lamellar profiles occur in a few giant grana (Henningsen et al., 1993).

Several recent works have described the molecular response to cold, drought, heat and salinity in

Arabidopsis (Seki et al.; 2002; Kreps et al., 2002; Rizhsky et al.; 2004) and other species (Ozturk et

al., 2002; Rabbani et al., 2003; Wang, 2003). The combination of transcriptional profiling with

genetic mutants or transgenic plants represents a powerful tool for dissecting the molecular

networks supporting cellular functions. The analysis of Arabidopsis mutants with chilling sensitive

phenotype led to the identification of genes with a critical role in plant adaptation to low

temperature (Provart et al., 2003). Mutants of Arabidopsis with defects in chloroplast function were

employed to investigate plastid control over nuclear gene expression leading to the identification of

a regulatory master-switch (Richly et al., 2003).

Previously, we have shown that barley plants carrying mutations preventing chloroplast

development, beside the expected albina or xantha phenotype, are completely frost susceptible as

well as impaired in the expression of several cold-regulated genes (Baldi et al., 1999; Dal Bosco et

al., 2003). The recent availability of a barley microarray (Close et al., 2004) provided a new tool to




7

describe the barley stress response and the role of the chloroplast in cold acclimation. In the present

work we investigated four chloroplast barley mutants (albina e16, albina f

17, xantha s46 and xantha

b12 – Henningsen et al., 1993) and the corresponding WT with the Affymetrix Barley1 GeneChip®

to assess the effect of the chloroplast on the expression of cold-regulated genes.

Results

Modification of the transcriptome in albina and xantha mutants at 20°C

For analysis of chloroplast mutants under non-chilling conditions, plants were grown at 20°C and

the transcriptome of each mutant was compared to WT using the 22k Barley1 GeneChip (Close et

al., 2004). Triplicate array data was analyzed using two fold change as the cutoff followed by

analysis for statistically significant changes using t-test and a false discovery rate (FDR) correction

(Benjamini and Hochberg) for multiple testing (Reiner et al., 2003). Microarray data was analyzed

for differentially expressed genes by comparing mutants to WT (Table I A). For simplicity we refer

to probe sets as genes. The number of differentially expressed genes was much higher in the three

earliest mutants (alb-e16, alb-f

17and xan-s46 – 2,391, 2,286 and 2,201 respectively) than in the

genotype closest to WT (xan-b12

, 896) (Table 1A). These genes represent between 19.6 (xan-s46)

and 9% (xan-b12) of the transcriptome detected with the microarray. A detailed discussion of the

changes in gene expression associated with normal chloroplast development will be the objective of

a separate publication.

Modification of wild type and mutant transcriptome in response to cold treatment

Exposure to low temperature is known to modify the plant transcriptome. Genes up- or down-

regulated by cold treatment depend on the cultivar examined, light, temperature and length of the

treatment. When the mRNA population from six day cold treated WT plants was compared with the

transcriptome of WT grown at 20°C (control), 1,911 genes were more than 2 fold up-regulated by

low-temperature and 824 genes were more than 2 fold down-regulated by low-temperature (Table I

B). Since WT plants exposed to 3°C for six days developed a cold hardened phenotype, we can

assume that these changes in the transcriptome were part of the low temperature response leading to




8

freezing tolerance. All together, these cold-regulated genes represent about 24.6% of the

transcriptome.

As with WT, in each mutant the exposure to cold promoted variations in gene expression.

However, the number of cold-regulated genes was smaller in the mutants compared to WT (Table I

B). The genes cold-regulated in the mutants represent only between 8.8 and 11.5% of the mutant

transcriptomes, much less than the 24.6% observed in WT. There was a similar number of cold up-

regulated genes in alb-e16, alb-f

17 and xan-b12 (798, 834 and 811 respectively), whereas the number

of up-regulated genes was lower in xan-s46 (703). The number of cold down-regulated genes was

similar for xan-b12 and xan-s

46 (316 and 331 respectively). Little less than twice as many cold-

repressed genes were found in alb-e16 (542) and alb-f

17 (591). Cold-regulated genes indicated in

Table I B are listed in Supplementary Table 1.

Functional classification according to “GO biological process” (see materials and methods) of

cold up-regulated genes showed a higher proportion of stress-related genes (“response to abiotic

and biotic stimuli”, “response to stress”) in mutants compared to WT. In contrast, the category

“protein metabolism”, had a higher proportion in WT compared to mutants for induced genes

(Table II columns B, C, D, E, F and Supplementary Table 2). These results suggest that the normal

process of adjusting protein metabolism during cold-acclimation might be limited in chloroplast

defective mutants, whereas genes involved in the general stress response are still regulated in

response to stress. Similarly, a striking difference was also observed when analyzing “GO cellular

components”. Among up-regulated genes the mutants had very few associated with “ribosomes”,

whereas for WT there were 6.5% up-regulated “ribosome”-related genes (Table II).

Classification of mutant and wild type cold responsive genes

The lists of the cold-regulated genes identified in WT and chloroplast mutants were compared to

resolve the component genes into classes described in Figure 1. Briefly, WT cold-regulated genes

were sub-divided into three classes: (1) chloroplast-dependent; (2) chloroplast-independent and (3)

chloroplast development-dependent (Figure 1 and Table III). The chloroplast development-

dependent class was further separated into three subgroups; (3a) xan-b12-dependent, (3b) xan-s

46-

dependent and (3c) alb-f17-dependent. In addition, we found a forth class comprising cold-regulated

genes that were expressed in all four mutants but not in WT, which were termed albina/xantha

dependent (Figure 1 and Table III). Other mutations affecting cold acclimation might also be




9

present in the genetic background of albina and xantha mutants. It seems unlikely that genes

affected by other mutations are included in classes 1 (chloroplast-dependent), 2 (chloroplast-

independent) and 4 (albina/xantha dependent) since these mutations would have to be present in all

four mutants to be included in one of those classes (Figure 1). Similarly, for classes 3b and 3c,

classification is based on two and three mutants, respectively. For class 3a, classification is only

based on one mutant (xan-b12) and this class may contain genes affected by other mutations. Genes

not fitting any of the above classes were grouped as “other” (class 5 – Figure 1 and Table III).

Genes belonging to this class are not further discussed in this work.

When functional categories of the chloroplast-dependent and chloroplast-independent up-

regulated gene classes were compared, analysis of the “GO biological processes” showed that a

higher proportion of stress-related genes (“response to abiotic and biotic stimuli”, “response to

stress”) was present in the chloroplast–independent class while genes belonging to the category

“protein metabolism”, were more frequent in the chloroplast-dependent cold-regulated genes. The

analysis of “GO cellular components” pointed out a major difference for genes associated with

“ribosomes”, all cold-regulated genes belonging to this category were classified as chloroplast-

dependent (Table II columns G, H, and Supplementary Table 2). The class of chloroplast

development-dependent cold-regulated genes is characterized by high proportions of stress-related

genes (GO biological processes) and absence of ribosomes (GO cellular components), a profile

similar to that one of the chloroplast–independent class (Table II column I, and Supplementary

Table 2).

The results of Table II point out that genes classified as stress-related were distributed among

both chloroplast-independent and chloroplast developmental-dependent classes, while genes related

to ribosomes were all among the chloroplast-dependent genes.

The chloroplast controls the regulation of most WT cold-regulated genes

A total of 1,332 and 498 genes were more than 2 fold up- or down-regulated, respectively, only

in WT and not in any mutant (chloroplast-dependent cold-regulated genes, Figure 1 class 1). These

genes represent 69.7% of the 1,911 up-regulated and 60.4% of the 824 down-regulated genes

detected in WT exposed to low temperature (Table III). These WT cold-regulated genes can be

chloroplast-dependent for either of two reasons; (1) one or more normally cold-activated signaling

pathway(s) may be active at 20°C in the mutants, so there is no cold-induction/repression in the




10

mutant above an already high/low basal level of expression, or (2) a low-temperature signaling

pathway may be disrupted in the mutants, resulting in a constant expression level not modify neither

by mutation nor by cold treatment.

After a Quality Threshold (QT) clustering analysis the genes up-regulated by cold in WT were

divided in 14 clusters (Figure 2A) plus 198 genes not clustered and therefore assigned as

unclassified. Genes in clusters 1 - 4 were more expressed in mutants than in WT at 20°C. These

genes were induced upon cold-treatment in WT but show no or very little induction in cold-treated

mutants. Only in cluster 2, a slight induction upon cold-treatment was detected in the mutants.

These expression profiles are in agreement with constitutive activation in the mutants at 20°C of

signaling pathways activated by cold in the WT. Gene in cluster 5 were also up-regulated in the

mutants at 20°C, nevertheless after cold treatment their expression was slightly reduced in all

mutants except in xan-b12 where the reduction of the expression level was much stronger. Genes in

cluster 6 and 7 showed a significant induction at 20°C only in xan-b12 (cluster 5) or alb-e

16 (cluster

6), while no significant induction was achieved by cold in any mutants. The expression pattern of

genes in cluster 8-14 supports the hypothesis of a disrupted signaling pathway. Clusters 8, 9 and 10

contain genes with similar expression levels in WT and mutants at 20°C, after cold-treatment no

change (clusters 8 and 9) or a minimal change (cluster 10) in the expression levels was detected in

mutants, whereas higher expression (induction) in WT was evident. Genes in clusters 11-14 showed

small variations in their expression in the mutants compared to WT at 20°C, but without reaching

the expression level detected in WT after cold treatment. The exposure of the mutants to cold did

not affect the expression of these genes.

Cluster analysis of the chloroplast-dependent down-regulated genes identified 7 clusters plus

132 genes not clustered and therefore assigned as unclassified (Figure 2B). Genes in cluster 1 were

less expressed in mutants at 20°C compared to WT at 20°C and no significant change in expression

levels was observed in mutants upon cold-treatment, whereas WT showed a clear cold-dependent

down regulation, a behavior in agreement with constitutive repression in mutants at 20°C of

signaling pathways that are normally repressed by low temperature in WT. The genes in cluster 2

showed a small down-regulation in the mutants at 20°C and a further down-regulation after cold

treatment. Cluster 3 indicates constitutive activation of some signaling pathways at 20˚C, in the

albina mutants, but not the xantha mutants. The predicted subcellular location of proteins encoded

by genes in cluster 3 indicated that 33 out of 61 of these peptides are targeted to the chloroplast.

Clusters 4-7 contain genes with similar expression levels at 20°C in all genotypes, whereas after

cold treatment their expression was down-regulated only in WT; consistent with a hypothesis of a

blocked signaling pathway in the mutants.




11

The WT cold-induced genes classified as chloroplast-dependent included a high proportion of

genes related to protein synthesis and no known stress related genes. A total of 317 up-regulated

genes were annotated as ribosomal protein, elongation factor, initiation factor or component of the

proteasome. We found 256 genes encoding various ribosomal proteins (241 up-regulated), 125

belong to cluster 4 indicatives of a constitutive activation at 20˚C of a low temperature signaling

pathway; 25 and 43 to cluster 8 and 9 respectively, representing pathways disrupted by mutations.

Furthermore, all key genes involved in lipid biosynthesis (acyl CoA thioesterase, MGDG synthase,

phosphatidylglycerolphosphate synthase, acyl-(acyl carrier protein) thioesterase –Xu et al., 2002;

Miege et al., 1999) were cold up-regulated in a chloroplast dependent manner.

Among the WT cold-repressed genes classified as chloroplast-dependent, there were many genes

encoding enzymes involved in photosynthesis and components of the light harvesting complex;

which is consistent with the absence of photosynthetic activity in albina and xantha genotypes.

Along with these intuitively expected classes there were also 201 probe sets corresponding to

novel genes without blast “hits” to the database (E-value cutoff e-10). Such genes may perhaps

provide new insights about a general adaptation mechanism. All probe sets with a chloroplast-

dependent behavior are listed in Supplementary Table 3.

Expression of previously known cold-regulated genes is chloroplast independent

A total of 243 up-regulated and 59 down-regulated probe sets were cold-regulated in all

genotypes. These genes were termed chloroplast-independent (Figure 1 and Table III class 2). This

is only 12.7% and 7.2% of up- and down-regulated WT cold-regulated genes. Among the up-

regulated genes, there were 39 sequences coding well known stress-related proteins, including a 1

Cbf-like (Choi et al., 2002), 5 Dehydrins/LEA (Dhn5, Dhn7 and Dhn8, Choi et al., 1999), 2 ABA

and 9 low temperature responsive (Ltr) proteins, 4 ice recrystallisation inhibitors, 3 Blt14, 1 Blt101,

1 Cor14, 1 amino acid selective channel protein, (reviewed in Cattivelli et al., 2002), 2 heat shock

proteins, 7 early light inducible proteins (ELIP, Shimosaka et al., 1999) and several enzymes

involved in the accumulation of compatible solutes (e.g. pyrroline-5-carboxylate synthetase,

Delauney and Verma; 1993). All probe sets with a chloroplast-independent behavior are listed in

Supplementary Table 4.

QT clustering of the chloroplast-independent genes identified three up- (1 – 3; Figure 2C) and

one down-regulated (Figure 2D) clusters underlining some differences in the expression profile.

Twenty chloroplast independent genes (all down regulated) were not clustered and assigned as




12

unclassified. Analysis of the three up-regulated clusters showed that only genes in cluster 1 were

expressed to a similar extent in all genotypes at both 20˚C and after cold treatment. Up-regulated

cluster 1 contains almost all the previously known stress-related genes cited above. Genes in cluster

2 were less expressed in mutants compared to WT at 20°C and this difference persisted after cold

treatment. Cluster 3 shows an opposite trend to cluster 2; genes were expressed more in mutants

compared to WT both at 20˚C and after cold-treatment. Interestingly, the expression levels of these

genes in xan-s46, alb-f

17 and alb-e16 at 20˚C were similar to the levels in cold treated WT. Most of

the chloroplast independent down-regulated genes showed already at 20°C a reduced expression in

the mutants compared to WT. This reduction was progressively stronger moving from xan-b12 (the

genotype closest to WT) to alb-e16 (the most extreme mutant). In all genotypes the cold treatment

promoted a further reduction of the expression level of the genes in cluster 1 (Figure 2D).

Some WT cold-regulated genes are regulated by a specific chloroplast developmental stage

The chloroplast defective mutants reported in this work represent four subsequent steps in plastid

biogenesis. We asked whether up- or down-regulation of WT cold-regulated genes could be linked

to progress in chloroplast development (Figure 1 and Table III class 3). Ninety up- and 38 down-

regulated genes behaved in a similar manner in WT and mutant xan-b12 (the last step in plastid

biogenesis considered in this work) while they were not induced nor repressed in the mutants

representing earlier steps of chloroplast biogenesis. Cold regulation of these genes can therefore be

associated with the xan-s46 to xan-b

12 transition. Seventeen up- and 7 down-regulated genes were

found associated with the alb-f17 to xan-s

46 transition since they behaved in a similar manner in WT,

xan-b12 and xan-s

46 but not in alb-f17 and alb-e

16. Finally, 38 up- and 33 down-regulated genes were

found associated with the alb-e16 to alb-f

17 transition. Among the cold up-regulated chloroplast

development-dependent genes we found several previously described stress responsive genes such

as lipocalin (Charron et al., 2002), Cor14b (Dal Bosco et al., 2003) and Wcor518. Many of the cold

down-regulated chloroplast development-dependent genes encode for chlorophyll A/B binding

(Cab) proteins and other components of the photosynthetic apparatus: 4 Cab genes were repressed

in WT and xan-b12

, one Cab genes was repressed in WT xan-b

12 and xan-s46, while 11 Cab genes

were repressed in all genotypes except alb-e16. Since the mRNAs corresponding to all these genes

were not detected in alb-e16 at 20°C, the ability of the other mutants to down-regulate these genes at




13

low temperature mainly reflects the ability of the plant to express these genes at 20°C. All probe

sets with a chloroplast-development dependent behavior are listed in Supplementary Table 5.

Albina/xantha dependent non-WT cold-regulated genes

Chloroplast mutants induced or repressed a common set of genes after cold-treatment regardless

of the developmental stage of the plastids. We found 123 up-regulated and 44 down-regulated genes

responsive to cold in all four mutants but not in WT. These genes were termed albina/xantha

dependent (Figure 1 and Table III class 4). Among the up-regulated, there were numerous known

stress-responsive genes such as Dhn3, Dhn4 and Dhn9 (Choi et al., 1999) and genes encoding heat

shock proteins, early-light induced proteins (Shimosaka et al., 1999), sucrose-synthase (Guy et al.,

1992) and water stress induced proteins. This suggests a higher cold susceptibility of the chloroplast

mutants compared to WT. The probe sets regulated by cold in all mutants but not in WT are listed

in Supplementary Table 6.

Overlap between cold-dependent and photo-oxidative-dependent signaling pathways

Albina and xantha mutants are characterized by the lack of carotenoids (albina) and disruption of

the assembly of photosynthetic membranes (albina and xantha). These conditions might cause

severe photo oxidative damage during exposure to light. Since oxidative signaling is a part of the

cold response (Prasad et al.,1994) the constitutive activation in the mutants of signaling pathways

normally induced by low temperature in WT might be explained by the overlap between cold-

dependent and photo-oxidative-dependent signaling pathways. To explore this hypothesis we used

the nucleotide sequences of genes described as induced by oxidative stress in Arabidopsis (Desikan

et al., 2001; Rossell et al., 2002) to identify the homologous barley genes. These putative barley

oxidative responsive genes were then cross-referenced with the lists of the cold-regulated genes

described in this work. Fourteen common sequences were used in real time qRT-PCR to assess gene

expression in WT and mutants treated with norfluorazon, a herbicide that blocks carotenoid

biosynthesis, in comparison to control and cold treated samples. With one exception only, all genes

induced by norfluorazon and by cold in WT were also constitutively expressed in the alb-e16 and

alb-f17

mutants at 20°C suggesting that albina plants were exposed to photo-oxidative stress even at

20°C. In contrast, only a subset of the genes induced by norfluorazon in WT were constitutively




14

expressed in xan-s46

(9 genes) and xan-b12(2 genes), a behavior that can be attributed to the

protective activity of the carotenoids against photo-oxidation (white bars in Figure 3).

During the search for genes up-regulated by oxidative stress and by cold, two genes induced by

oxidative stress and not by cold in WT (isocitrate lyase and glycerophosphoryl diester

phosphodiesterase) as well as two genes up-regulated only by cold in WT plants and not in any

mutants (60S ribosomal protein and ribosomal protein L7A) were also identified (grey and black

bars, respectively in Figure 3).

The Real Time qRT-PCR experiments also provided validation of the array data. The correlation

coefficient between expression values detected in real time and the corresponding values obtained

from the array analysis was r = 0.71 (significant at 0.01%).

The expression of some early cold induced transcription factors in albina and xantha mutants is

chloroplast independent

Present knowledge suggests that transient induction of Cbf proteins has an important role in the

control of the hardening process (Fowler and Thomashow, 2002, Francia et al., 2004; Vágújfalvi et

al., 2005). The analysis of the barley mutants described above was performed after six days of cold

acclimation, which is not suitable for detecting early and transient responses. Cbf transcripts

accumulate rapidly and transiently within 15 min of transfer to low temperature and continue to

increase over the next 2 h. Later, they begin to decline and return to near the initial level by about

24 h (Liu et al., 1998; Choi et al., 2002). The mutants were therefore examined for transient Cbf

expression during the early phases of the cold response. A cDNA containing the AP2 and Cbf-

signature conserved domains (Jaglo et al., 2001) was used to probe RNA samples in northern blots

from WT and mutants grown at 20°C or exposed at 3°C for 4 h. The barley Cbf gene family was

vigorously induced by cold in wild type and chloroplast mutants (Figure 4A). Further analyses were

carried out with reverse transcription PCR (RT-PCR) on specific Cbf-like sequences. BCbf1 ,

HvCbf1 and the Cbf-like sequence corresponding to the accession number BG367653 were cold

induced to a similar extent in mutants and WT plants after 4 and 8 h of cold treatment, and

expression was greatly reduced after 24 h of cold treatment. Beside Cbfs, a barley sequence

(HvICE1, Tondelli et al., 2006) highly homologous to the Arabidopsis ICE1 (a constitutively

expressed activator of Cbf induction - Chinnusamy et al., 2003) and the cold-regulated barley gene

Hv-WRKY38 (a cold induced transcription factor belonging to the ICE1 regulon- Marè et al., 2004)




15

were also investigated and their expression profile was identical in mutants and WT plants (Figure

4B) .

Many studies have recently investigated the activation of transcription, during cold acclimation,

due to Cbf action in Arabidopsis. Arabidopsis sequences ascribed to the Cbf regulon were

downloaded from GenBank (dehydrins, P5CS, genes involved in sugars metabolism, transporter,

proteolysis and other transcription factors - Fowler and Thomashow, 2002; Vogel et al., 2005) and

used in homology searches to identify the corresponding barley genes. A total of 19 barley

sequences corresponding to Arabidopsis Cbf-regulated genes (E-value cut off = ≤ e-10) were found.

Seven of these sequences that could be analyzed in the expression data identified 10 probe sets

present on the barley array, all but two belong to the chloroplast independent cold-regulated gene

class. This means that expression of the ICE1 - Cbf cold signaling pathway is unaffected by

chloroplast mutations.

Discussion

We used the Barley1 GeneChip (Close et al. 2004) to compare the molecular response to cold of a

WT barley and four chloroplast-defective mutants. The effect of the chloroplast on the expression

of genes cold-regulated in WT was much higher than the effect of the chloroplast on the

transcriptome overall. A total of 66.9% of the 2,735 WT cold-regulated genes were not cold-

regulated or not correctly cold-regulated in the mutants. These genes were classified as chloroplast-

dependent (Figure 1 and Table III –class 1). At 20°C, 896 to 2,391 genes, depending on the mutant

analyzed, had altered expression levels relative to WT. This was 9.0 to 19.6% of the transcriptome

(Table I). Together these results demonstrate that the chloroplast has a major role in the control of

molecular adaptation to cold. Furthermore, while the differences between WT and mutants were

significantly reduced in xan-b12 (the mutant closest to WT), the effect of some progress in

chloroplast development on the expression of genes identified as cold-regulated in WT was much

smaller. The xan-b12 mutation still affects the expression of 1,830 genes (about 66.9% of the WT

cold-regulated genes) and only 223 genes (8.2% of the WT cold-regulated genes) are cold regulated

in a chloroplast development-dependent manner. We conclude that a fully operational chloroplast

rather than a specific step in chloroplast development is required for normal cold-dependent

regulation of the transcriptome.

Several chloroplast signals of different origin are known to influence gene expression. Redox

status of the electron transport chain, accumulation of reactive oxygen species, intermediates of the




16

chlorophyll biosynthesis and accumulation of sugars all can provides signals for the regulation of

nuclear genes coding for plastid and non plastid proteins (Escoubas et al., 1995; Jarvis, 2003). Some

of these signaling mechanisms are also involved in the response to low temperature. Exposure to

cold promotes changes in the redox state (Huner et al., 1996) and accumulation of reactive oxygen

species (Foyer et al., 1994). There are two plausible explanations for the expression characteristics

of chloroplast-dependent cold-regulated genes. Signaling pathways activated by cold in WT might

be constitutively active in the mutants at 20°C leading to the constitutive expression/repression of

WT cold-regulated genes. Alternatively, if no change is observed after cold-treatment it may reflect

disruption of low temperature signaling pathways. We have found evidence for both factors. About

one third of the chloroplast-dependent cold-regulated genes were already expressed in the mutants

at 20°C at levels similar to cold treated WT, and cold-treatment did not significantly change the

expression of those genes in the mutants (clusters 1-4 in Figure 2A; cluster 1 in Figure 2B). This

indicates a constitutive activation of signaling pathways in the mutants at 20°C. Conversely,

clusters 8-14 in Figure 2A and clusters 5-7 in Figure 2B contain genes that were cold regulated in

WT but not significantly regulated by cold in the mutants. These examples seem to correlate to

disruption of low temperature signaling pathways in the mutants. Therefore, the absence of a fully

functioning chloroplast either leads to a lack of induction/repression of WT cold-regulated genes or

causes a shift of the transcriptome (genes normally regulated by cold-treatment are

induced/repressed at 20°C).

The mutants respond to cold-treatment by activating a set of albina/xantha dependent cold-

regulated genes (123 up- and 44 down-regulated) whose expression was not induced or repressed in

WT (Table III). Some of these up-regulated genes encode known stress responsive proteins, for

example three members of the Dhn family (Dhn3, Dhn4, and Dhn9), previously found to be induced

by freeze/thaw (not induced at 4°C) and by dehydration-treatment (Zhu et al., 2000). In fact, 63

(51%) out of 123 up-regulated genes were also induced in drought-treated barley (unpublished

data). This suggests that cells without active chloroplasts tend to activate stress signaling pathways

more readily than does WT upon exposure to low temperature. Apparently, plants with defective

chloroplasts are more predisposed to stress. Functional classification of all mutant and WT cold-

regulated genes supports this observation. A higher proportion of stress-related genes were found in

mutants than in WT (Table II).

Among cold-regulated genes identified in WT, the largest group encodes products related to

protein synthesis, particularly ribosomal proteins. Among mutant cold-regulated genes there are

relatively fewer involved in protein metabolism and none classified as “ribosomes” (Table II).

Induction of genes involved in protein synthesis has been one of the major changes previously




17

reported during chilling response in Arabidopsis. When 12 chilling sensitive mutants were analyzed

under normal (22°C) and chilling (13°C) conditions, all mutants failed to up-regulate these genes in

response to chilling (Provart et al., 2003). As in our study, Provart et al. (2003) found a set of genes

that were induced or expressed only in the mutants and not in WT after chilling treatment, however

no functional classification was given for those genes. We found numerous genes involved in

protein biosynthesis that were expressed to a similar extent in the mutants at 20°C as by low

temperature in the WT. This is consistent with Baldi et al. (2001), who reported that two ribosomal

protein genes and a gene encoding elongation factor 1Bβ were cold-induced in green barley leaves

but constitutively expressed at high level in albina and etiolated leaves. The data reported in our

work further support a role of the chloroplast in the regulation of protein synthesis machinery

through a signal activated by cold.

Previously described cold-regulated genes (Cattivelli et al., 2002) were almost all included in the

chloroplast-independent cold-regulated gene class (Figure 1 –class 2). The Cbf-like genes (Figure 4)

and certain Dhn genes were among these chloroplast-independent genes. Barley Cbf-genes interact

with the C-Repeat/DRE motif (G/a)(C/t)CGAC (Xue, 2002). A search for this cis-element

(http://intra.psb.ugent.be:8080/PlantCARE/) in promoters of barley cold-regulated genes found

several copies of C-Repeat/DRE in the promoters of Dhn5 and Dhn8 (3 and 5, respectively), two

genes classified as chloroplast-independent using our work. In Arabidopsis, cold-induction of genes

coding for DHNs and pyrroline-5-carboxylate synthetase (also chloroplast-independent in our

experiment) was under the control of CBF transcription factors (Jaglo-Ottosen et al., 1998; Fowler

and Thomashow, 2002). The induction of Cbf-like genes and of putative Cbf-target genes in albina

and xantha plants suggest that the Cbf transduction pathway is active in the mutants and, therefore,

independent of a fully activated chloroplast. The fact that the majority of the WT cold response was

impaired in the mutants suggests the requirement of other factors for the activation of most cold-

mediated responses. When the transcriptome of WT and Cbf-over-expressing Arabidopsis plants

was investigated at normal and low temperature, only 12% of the cold-responsive genes were

ascribed to the Cbf regulon, suggesting likewise that the majority of the cold-regulated genes are

partially or completely independent from the Cbf system (Fowler and Thomashow, 2002). Our

results parallel this observation. We show that a fully functional chloroplast is required to promote

the molecular changes associated with cold acclimation.

The description of the cold response in WT barley and in four independent chloroplast mutants

allowed the identification of three main pathways containing more than 80% of the WT cold-

regulated genes: (1) cold-regulated genes unaffected by any mutations, including Cbf genes and

many genes known to be under Cbf control; (2) cold-regulated genes constitutively induced,




18

although to different levels, in all mutants, including those activated in response to photo oxidative

stress and (3) cold-regulated genes belonging to signaling pathway(s) disrupted in all mutants,

whose expression consequently was not, or was only marginally responsive to cold. In addition we

also found several others expression profiles grouping genes regulated by cold in a mutant-

dependent manner. Since only a minor portion of cold-regulated genes belong to the same

regulatory pathway as Cbf, we conclude that factors deriving from the chloroplast in addition to Cbf

are required to promote the full suite of molecular changes associated with cold acclimation.

Experimental procedures

Genetic materials

A spring barley (Hordeum vulgare cv. Bonus) and four non allelic albina (alb-e16, alb-f

17) and

xantha (xan-s46

, xan-b12) mutants obtained by chemical or physical mutagenesis in the genetic

background of cv. Bonus (Henningsen et al., 1993) were used. All mutants were maintained as

heterozygous stocks and after germination a 3:1 segregation was observed. These mutations

affecting chloroplast development have been located in the chloroplast biogenesis pathway as

described by Henningsen et al. (1993).

Growth conditions

WT and mutants were germinated in peat pots and grown in controlled-environment chamber for 8

d at 20°C with 12 h photoperiod (300 µmol m-2 s-1). When the first leaf was fully emerged the plants

were treated for 6 d at 3°C ,12 h light (150 µmol m-2 s-1) / 1°C ,12 h dark. Plants were harvested into

liquid nitrogen. Control plants were harvested after 8 d at 20°C. All samples were collected in the

middle of the light period. This experiment was conducted three times to yield three independent

biological replicates. To analyze the involvement of the photo-oxidative stress, seeds of WT and

mutants were imbibed for 3 h in water containing 0 (control) or 50 µM norfluorazon. The hydrated

seeds were grown in growth controlled-environment chamber as above except that light intensity

was 10 µmol m-2 s-1for the first 8 d and 200 µmol m-2 s-1 for the next 6 d. During the growth treated

plants were watered 2 times with 50 µM norfluorazon.

For analysis of Cbf expression, treated samples were collected after 4, 8 and 24 h of cold

treatment in the light.




19

RNA isolation and array hybridization

Total RNA was prepared using TRIZOL reagent according to the method published at the

Arabidopsis functional genomics consortium website

(www.Arabidopsis.org/info/2010_projects/comp_proj/AFGC/RevisedAFGC/site2RnaL.htm#isolati

on) and further cleaned using RNeasy columns (Qiagen, Valencia, CA, USA) following the

manufacturer’s instructions. Purified RNA was adjusted to a final concentration of 1 µg/µl in DEPC

treated water. All RNA samples were quality assessed prior to beginning the labeling procedure by

running a small amount of each sample (typically 200-250 ng) on a RNA Lab-On-A-Chip (Caliper

Technologies Corp., Mountain View, CA, USA) using an Agilent Bioanalyzer 2100 (Agilent

Technologies, Palo Alto, CA, USA).

Single-stranded, then double-stranded cDNA was synthesized from the poly(A)+ mRNA present

in the isolated total RNA (10 µg total RNA starting material each sample reaction) using the

SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen Corp., Carlsbad, CA, USA) and poly

(T)-nucleotide primers that contained a sequence recognized by T7 RNA polymerase. A portion of

the resulting double stranded cDNA was used as a template to generate biotin-tagged cRNA from

an in vitro transcription reaction (IVT), using the BioArray High-Yield RNA Transcript Labeling

Kit (T7) (Enzo Diagnostics, Inc., Farmingdale, NY, USA). The resulting biotin-tagged cRNA (15

µg) was fragmented to strands of 35-200 bases in length following Affymetrix protocols.

Fragmented target cRNA (10 µg) was hybridized at 45°C with rotation for 16 hours (Affymetrix

GeneChip Hybridization Oven 320) to probe sets present on an Affymetrix Barley1 GeneChip

arrays. The arrays were washed and then stained (SAPE, streptavidin-phycoerythrin) on an

Affymetrix Fluidics Station 400, followed by scanning on a Hewlett-Packard GeneArray scanner.

These steps were performed at the DNA and Protein Microarray Facility, University of California,

Irvine (http://sense.ucicom.uci.edu/dmaf/).

Data analysis

Scanned images were analyzed using the software MicroArray Suite 5.0 (MAS 5) (Affymetrix, Inc.,

Santa Clara, CA, USA). Expression analysis was done using default values. Scaling (global

normalization) was done to a target signal of 500 using data from all probe sets. Quality control

values, present calls, background, noise, scaling factor, spike controls and the 3’/5’ ratios of




20

GAPDH and tubulin showed low variation. Two of the control probe sets (TIF 5A and actin)

showed high 3’/5’ ratio variation, similar results were obtained in other experiments and in other

labs (Close et al., 2004).

MAS 5.0 data were imported to the software GeneSpring 7.0 (Silicon Genetics, Redwood City,

USA) for analysis. Each chip was normalized to the median of the measurements taken from that

chip, probe sets with normalized signal value below 0.35 were transformed to 0.35, and probe set

normalization was done to the median value of each probe set or in some cases to specific samples.

The data transformation of normalized values below 0.35 to 0.35 was done in order to “floor”

absent genes. The 75th percentile of absent calls was 80 (pre-normalization) which corresponded to

a normalized value of 0.35.

Two comparisons were done (i) WT control compared to each mutant control and (ii) control

compared to cold-treated for each genotype. Baseline was set as WT control in (i) and as each

genotype control for (ii). The experiment was repeated three times and each replicate was initially

analyzed separately. Each probe set contain 11 paired perfect match and mismatch 25-mer probes

which are used to calculate the detection call and the signal. The MAS 5.0 algorithm uses a non-

parametric statistical test (Wilcoxon signed rank test) of whether significantly more perfect match

probes have higher signal than their corresponding mismatch probes to produce a detection call;

present, marginal or absent for each probe set. Data for genes not actually expressed (absent)

represent experimental noise and can generate false positives. For this reason we used detection

calls (present) as an initial filtering step. For decreasing probe sets, those with a detection call of

present in the baseline samples and at least a two fold change were further considered. For

increasing probe sets, those with a present call and two-fold change were further considered.

Replicate datasets were analyzed by Boolean searches such that only genes found in intersections

were further analyzed. For example an up-regulated gene had to be two-fold or more up-regulated

in all three replicates. These genes were further analyzed for statistically significant changes by a

Welch t-test and the Benjamini and Hochberg false discovery rate correction for multiple testing

(Reiner et al., 2003); the FDR adjusted p-value cutoff was set to 0.05.

For clustering we normalized each probe set to the median of that probe set. Clustering was done

using the Quality Threshold (QT) clustering function in GeneSpring. The minimum clusters size

was set at 20 genes and the minimal correlation coefficient (Pearson) to 0.7.

The Arabidopsis International Resource Gene Ontology (TAIR-GO) web site

(http://www.arabidopsis.org/tools/bulk/go/index.jsp) was used for functional classification. The

classification is based on Arabidopsis gene identifiers, therefore only genes with a homologue (cut




21

off E-value = e-10) in Arabidopsis were classified. Blast search results were exported from HarvEST

1.35 (www.harvest.ucr.edu).

Expression analysis of early cold induced transcription factors

15 µg of total RNA for each sample were separated on an agarose formaldehyde gel and transferred

to a positively charged nylon filter (Millipore, Billerica, MA, USA). A XbaI-HindIII DNA

fragment of 382 bp encompassing the conserved Cbf regions contains an AP2 domain and Cbf-

signature (Jaglo et al., 2001) was cleaved from BCbf1 (accession AF298230), labeled with [α-32P]

dCTP using random priming and used as probe. Identity between the probe and the corresponding

region of others known Cbf-like barley gene is >68%. The hybridization was performed using

UltraHyb buffer (Ambion, Austin, TX, USA) at 42°C. Detection was performed with a phosphor-

imager system, Typhoon 9210 (Amersham Biosciences, Piscataway, NJ, USA) and data quantified

with ImageQuant software (Amersham Biosciences, Piscataway, NJ, USA).

For reverse transcription PCR, first strand synthesis was done using 200 U of SuperScriptII

RNase H- reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and a poly(T) primer from 4µg of

total RNA following the manufacturer’s recommendations, except for the use of the RNaseH (final

volume of 20µl). Three Cbf-like transcripts were amplified using the following primers: BCbf1

(AF298230, probe set contig15617_at) 5’-TACATCTCGTCCGGCGACCTGTTGGAGC-3’ and

5’-AACTTAGCACAATTGAATCGGATGAGATC-3’ (annealing 60°C); HvCbf1 (AF418204,

probe set contig13523_at) 5’-GGATGCTCATTGCCCCTCCT-3’ and 5’-

AGCCCCAACACTCCTTCGGA-3’ (annealing 55°C); BG367653 (probe set: contig2479_at) 5’-

AGCTGGACGTCCTGAGCGACATG-3’ and 5’-GCTCTGTTTCCCCAATTTGCAC-3’

(annealing 58°C). Two additional sequences coding Hv-WRKY38 (Marè et al., 2004)

5’CCGTCAAAGCCTCGCAGACAAAGC3’ and 5’TATGGAACGGAACATTTGAATGA3’

(annealing 58°C) and HvICE1 a barley homolog of the Arabidopsis ICE1 gene (Tondelli et al.,

2006) 5’CTGAGCAATGCAAGGATGG3’ and 5’GACACAGGGTAGTGACATCAGG3’

(annealing 55°C) were also investigated. The transcripts were amplified from 400 ng of cDNA as

template and 2 U of Taq DNA polymerase (Invitrogen) using 28 cycles (94°C for 1 min, annealing

for 30 sec, 72°C for 30 sec) followed by a final extension step at 72°C for 7 min. RT-PCR reactions

performed with primers designed on the gene coding for β-actin protein was used as standard.

Amplification products were separated on 2% agarose gel.




22

Real time qRT-PCR

Real time quantitative RT-PCR was performed with SYBR Green fluorescence detection in a real

time PCR thermal cycler (GeneAmp 5700, Perkin-Elmer). PCR mix was prepared with 100 ng of

cDNA, 10µl of Platinum SYBR Green qPCR Supermix UDG (Invitrogen, Carlsbad, CA, USA), 1

µl of ROX Reference Dye, MgCl2 (final concentration 3mM), forward and reverse primers (final

concentration 0.2 µM) in a total volume of 25 µl. The cycling conditions were: 2 min at 50°C and 2

min at 95°C, followed by 40 cycles of 95°C for 15 s / 60°C for 60 s. Melting curve analysis was

performed after PCR to evaluate the presence of non-specific PCR products and primer dimers.

Normalization was carried out with β-actin constitutively expressed gene. The probe sets and the

corresponding primer pairs used for the analysis are reported in the Supplementary Table 7.

The Real-Time qRT-PCR data were plotted as the ∆Rn fluorescence signal versus the cycle

number. The PE Biosystems 5700 Detection System software calculates the ∆Rn using the equation

∆Rn = (Rn+)-(Rn

-), were Rn+ is the fluorescence signal of the product at any given time and Rn is the

fluorescence signal of the baseline emission during cycles 6 to 13. An arbitrary threshold was set at

the midpoint of the log ∆Rn versus cycle number at which the ∆Rn crosses the threshold (Ct). The Ct

value was used to calculate the fold changes (FC) in each sample with respect to the expression

level found in WT plants at 20°C (baseline) with the following formula:

FC = 2-∆∆Ct, where ∆∆Ct = (Ct target – Ctβ-act)sample – (Ct target – Ctβ-act)BON control

The mean concentration of the β-actin gene was used as a control for input RNA. The data are

expressed as log2 of the average FC of three independent experiments; standard variation in all

samples was lower than 20%.

Acknowledgements

We thank Dr. J.D. Heck and K. Nguyen at the University of California Irvine DNA Array Core

Facility for excellent services, and Prof D. von Wettstein and Dr. David Simpson for the kind gift of

barley mutants.




23

References

Baldi P, Grossi M, Pecchioni N, Valè G, Cattivelli L (1999) High expression level of a gene

coding for a chloroplastic amino acid selective channel protein is correlated to cold acclimation

in cereals. Plant Mol Biol 41: 233-243

Baldi P, Valè G, Mazzucotelli E, Govoni C, Faccioli P, Stanca AM, Cattivelli L (2001) The

transcripts of several components of the protein synthesis machinery are cold regulated in a

chloroplast-dependent manner in barley and wheat. J Plant Physiol 158: 1541-1546

Bourion V, Lejeune-Hénaut I, Munier-Jolain N Salon C (2003) Cold acclimation of winter and

spring peas: carbon partitioning as affected by light intensity. Eur J Agr 19: 535-548

Cattivelli L, Baldi P, Crosatti C, Di Fonzo N, Faccioli P, Grossi M, Mastrangelo AM,

Pecchioni N, Stanca AM (2002) Chromosome regions and stress-related sequences involved in

resistance to abiotic stress in Triticeae. Plant Mol Biol 48: 649-665

Choi D-W, Rodriguez EM, Close TJ (2002) Barley Cbf3 gene identification , expression pattern,

and map location. Plant Physiol 129: 1-7

Close T J, Wanamaker S L, Caldo R A, Turner SM, Ashlock DA, Dickerson JA, Wing RA,

Muehlbauer GJ, Kleinhofs A, Wise RP (2004) A new resource for cereal genomics: 22K

barley GeneChip comes of age. Plant Physiol 134: 960–968

Crosatti C, Polverino de Laureto P, Bassi R, Cattivelli L (1999) The interaction between cold

and light controls the expression of the cold-regulated barley gene cor14b and the accumulation

of the corresponding protein. Plant Physiol 119: 671-680

Dal Bosco C, Busconi M, Govoni C, Baldi P, Stanca AM, Crosatti, C, Bassi R Cattivelli L.

(2003) Cor gene expression in barley mutants affected in chloroplast development and

photosynthetic electron transport. Plant Physiol 131: 793-802.

Delauney A, Verma PS (1993) Proline biosynthesis and osmoregulation in plants. Plant J 4: 215-

223

Desikan R, Mackerness AH, Hancock JT, Neill SJ (2001) Regulation of the Arabidopsis

transcriptome by oxidative stress. Plant Physiol 127: 159-172

Escoubas J M, Lomas M, LaRoche J, Falkowski PG (1995) Light intensity regulation of cab

gene transcription is signaled by the redox state of the plastoquinone pool. Proc Natl Acad Sci

USA 92: 10237-10241

Fowler DB, Carles RJ (1979) Growth, development and cold tolerance of fall acclimated cereal

grains. Crop Sci 19: 915–922




24

Fowler S, Thomashow MF. (2002) Arabidopsis transcriptome profiling indicates that multiple

regulatory pathways are activated during cold acclimation in addition to the CBF cold response

pathway. Plant Cell 14: 1675-1690.

Foyer C, Lelandais M, Kunert KJ (1994) Photooxidative stress in plants. Physiol Plant 92: 696-

717

Francia E, Rizza F, Cattivelli L, Stanca AM, Galiba G, Tóth B, Hayes PM, Skinner JS,

Pecchioni N (2004) Two loci on chromosome 5H determine low temperature tolerance in the

new ‘winter’ x ‘spring’ (‘Nure’ x ‘Tremois’) barley map. Theor Appl Genet 108: 670-680

Gray GR, Chauvin LP, Sarhan F, Huner NPA (1997) Cold acclimation and freezing tolerance. A

complex interaction of light and temperature. Plant Physiol 114: 467-474

Grossi M, Giorni E, Rizza F, Stanca AM, Cattivelli L (1998) Wild and cultivated barleys show

differences in the expression pattern of a cold-regulated gene family under different light and

temperature conditions. Plant Mol Biol 38: 1061-1069

Guy CL, Huber JLA, Huber SC (1992) Sucrose phosphate synthase and sucrose accumulation at

low temperature. Plant Physiol 100: 502-508

Henningsen KW, Boyton JE, von Wettstein D (1993) Mutants at xantha and albino loci in

relation to chloroplast biogenesis in barley (Hordeum vulgare L.). The Royal Danish Academy

of Sciences and Letters, Copenhagen, Denmark

Huner NPA, Maxwell DP, Gray GR, Savitch LV, Krol M, Ivanov AG, Falk S (1996) Sensing

environmental temperature change through imbalances between energy supply and energy

consumption: redox state of photosystem II. Physiol Plant 98: 358–364

Iba K (2002) Acclimative response to temperature stress in higher plants: approaches of gene

engineering for temperature tolerance. Ann Rev Plant Physiol Plant Mol Biol 53: 225–245

Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T, Thomashow MF

(2001) Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor

cold-response pathway are conserved in Brassica napus and other plant species. Plant Physiol

127: 910–917

Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998)

Arabidopsis CBF1 overexpression induces cor genes and enhances freezing tolerance. Science

280: 104-106

Jarvis P (2003) Intracellular signalling: the language of the chloroplast. Curr Biol 13: 314-316

Kobayashi F, Takumi S, Nakata M, Ohno R, Nakamura T, Nakamura C (2004) Comparative

study of the expression profiles of the Cor/Lea gene family in two wheat cultivars with

contrasting levels of freezing tolerance. Physiol Plant 120: 585–594




25

Kreps J, Wu Y, Chang H-S, Zhu T, Wang X, Harper J (2002) Transcriptome changes for

Arabidopsis in response to salt, osmotic and cold stress. Plant Physiol 130: 2129–2141

Liu Q, Sakuma Y, Abe H, Kasuga M, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998)

Two transcriptional factors, DREB1 and DREB2, with an EREP/AP2 DNA binding domain,

separate two cellular signal transduction pathways in drought- and low temperature- responsive

gene expression, respectively, in Arabidopsis. Plant Cell 10: 1391-1406

Miege C, Marechal E, Shimojima M, Awai K, Block M A, Ohta H, Takamiya K, Douce R,

Joyard J (1999) Biochemical and topological properties of type A MGDG synthase, a spinach

chloroplast envelope enzyme catalyzing the synthesis of both prokaryotic and eukaryotic

MGDG. Eur J Biochem 265: 990-1001

Ndong C, Danyluk J, Huner NPA, Sarhan F (2001) Survey of gene expression in winter rye

during changes in growth temperature, irradiance or excitation pressure. Plant Mol Biol 45: 691-

703

Ozturk ZN, Talamé V, Deyholos M, Michalowski CB, Galbraith DW, Gozukirmizi N,

Tuberosa R, Bohnert HJ (2002) Monitoring large-scale changes in transcript abundance in

drought- and salt-stressed barley. Plant Mol Biol 48: 551-573

Pfannschmidt T, Nilsson A, Allen JF (1999) Photosynthetic control of chloroplast gene

expression. Nature 397: 625-628

Pfannschmidt T, Schutze K, Brost M, Oelmuller R (2001) A novel mechanism of nuclear

photosynthesis gene regulation by redox signal from the chloroplast during photosystem

stoichiometry adjustment. J Biol Chem 276: 36125-36130

Prasad TK, Anderson MD, Martin BA, Stewart CR (1994) Evidence for chilling-induced

oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell 6: 65-

74

Provart NJ, Gil P, Chen W, Han B, Chang H-S, Wang X, Zhu T (2003) Gene expression

phenotypes of Arabidopsis associated with sensitivity to low temperatures. Plant Physiol 132:

893-906

Rabbani MA, Maruyama K, Abe H, Khan MA, Katsura K, Ito Y, Yoshiwara K, Seki M,

Shinozaki K, Yamaguchi-Shinozaki K (2003) Monitoring expression profiles of rice genes

under cold, drought, and high-salinity stresses and abscisic acid application using cDNA

microarray and RNA gel-blot analyses. Plant Physiol. 133: 1755-1767.

Reiner A, Yekutieli D, Benjamini Y (2003) Identifying differentially expressed genes using false

discovery rate controlling procedure. Bioinformatics 19: 368-375




26

Richly E, Dietzmann A, Biehl A, Kurth J, Laloi C, Apel K, Salamini F, Leister D (2003)

Covariations in the nuclear chloroplast transcriptome reveal a regulatory master switch. EMBO

Reports 4: 491-498

Rizhsky L, Liang H, Shuman J, Shulaev V, Davletova S, Mittler R (2004) When defense

pathways collide: the response of Arabidopsis to a combination of drought and heat stress. Plant

Physiol 134: 1-14

Rossell JB, Wilson IW, Pogson BJ (2002) Global changes in gene expression in response to high

light in arabidopsis. Plant Physiol 130: 109-1120

Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A,

Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai J,

Hayashizaki Y,Shinozaki K (2002) Monitoring the expression profiles of 7000 Arabidopsis

genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J

31: 279-292

Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low

temperature: differences and cross-talk between two stress signalling pathways. Curr Opin Plant

Biol 3: 217-223

Tondelli A, Francia E, Barabaschi D, Aprile A, Skinner JS, Stockinger EJ, Stanca AM,

Pecchioni N (2006) Mapping regulatory genes as candidates for cold and drought stress

tolerance in barley. Theor Appl Genet, 112: 445-454

Thomashow MF, Gilmour SJ, Stockinger EJ, Jaglo-Ottosen KR, Zarka DG (2001) Role of the

Arabidopsis CBF transcriptional activators in cold acclimation. Physiol. Plant 112: 171-175

Vágújfalvi A, Galiba G, Cattivelli L, Dubcovsky J (2003) The cold regulated transcriptional

activator Cbf3 is linked to the frost-tolerance gene Fr-A2 on wheat chromosome 5A. Mol Gen

Genomics 269: 60-67.

Vágújfalvi A, Aprile A, Miller A, Dubcovsky J, Delogu G, Galiba G, Cattivelli L (2005) The

expression of several Cbf genes at the Fr-A2 locus is linked to frost resistance in wheat. Mol Gen

Genomics 274: 506-514.

Wang H, Miyazaki S, Kawai K, Deyholos M, Galbraith DW, Bohnert HJ (2003) Temporal

progression of gene expression responses to salt shock in maize roots. Plant Mol Biol 52: 873-

891

Wanner LA, Junttila O (1999) Cold-induced freezing tolerance in Arabidopsis. Plant Physiol 120:

391–399




27

Xu C, Hartel H, Wada H, Hagio M, Yu B, Eakin C, Benning C (2002) The pgp1 mutant locus of

arabidopsis encodes a phospha tidylglycerolphosphate sytnthase with impaired activity. Plant

Physiol 129: 594-604

Xue GP (2002) Characterization of the DNA-binding profile of barley HvCBF1 using an enzymatic

method for rapid quantitative and high-throughput analysis of the DNA-binding activity. Nucl

Acids Res 30: e77

Xue GP (2003) The DNA-binding activity of an AP2 transcriptional activator HvCBF2 involved in

regulation of low-temperature responsive genes in barley is modulated by temperature. Plant J

33: 373-383

Zhu B, Choi D-W, Fenton R, Close TJ (2000) Expression of the barley dehydrin multigene family

and the development of freezing tolerance. Mol Gen Genet 264: 145-153

Figure legends

Figure 1. Classification of mutant and WT cold-regulated genes. Four major classes are: (1)

chloroplast-dependent (cold-regulated genes induced or repressed only in WT and not regulated by

cold in any mutant); (2) chloroplast-independent (cold-regulated genes induced or repressed in all

genotypes); (3) chloroplast development-dependent (cold-regulated genes induced or repressed in

WT and the mutants closest to WT); class 3 was further separated into three subclasses; (3a) xan-

b12-dependent (WT cold-regulated genes induced or repressed in xan-b

12 and WT); (3b) xan-s46-

dependent (WT cold-regulated genes induced or repressed in xan-s46, xan-b

12 and WT); (3c) alb-f17-

dependent (WT cold-regulated genes induced or repressed in alb-f17, xan-s

46, xan-b12 and WT); (4)

albina/xantha dependent non WT cold-regulated genes (mutant cold-regulated genes induced or

repressed in all four mutants but not cold regulated in WT). In addition, genes not classified into

groups 1-4 were classified as other (5). For class 5 only four examples are shown, other

permutations exist for this class. The diagram states each genotype (columns) and the different

classes (rows) and shows in what genotype(s) a gene of a specific class is expressed. WT = wild

type; xan-b12 = xantha mutant b12; xan-s46 = xantha mutant s46; alb-f17 = albina mutant f17; alb-

e16 = albina mutant e16. Note1:




28

Figure 2. Quality threshold (QT) clustering of chloroplast-dependent and chloroplast independent

genes. Y-axis is the normalized signal intensities (log10) scale and in the x-axis samples are ordered

according to their involvement in the chloroplast developmental pathway. The minimum clusters

size was set at 20 genes and the minimal correlation coefficient (Pearson) to 0.7. For each set the

average expression level is shown; A: chloroplast-dependent (up-regulated); B: chloroplast

dependent (down-regulated); C: chloroplast independent (up-regulated); D: chloroplast independent

(down-regulated). QT clustering orders the clusters based on number of genes in the clusters in

descending order these clusters were re-ordered for clarity. WT = wild type; b = xantha mutant b12;

s = xantha mutant s46; f = albina mutant f17; e = albina mutant e16. Control and cold-treated samples

as indicated. All lists are available in supplementary tables 3 and 4.

Figure 3. Real Time qRT-PCR analysis of 18 sequences involved in the response to photo oxidative

and cold stress.

A: WT and mutants plants grown at 20°C for 8 d (C, control), were treated with norfluorazon (NF,

see materials and methods) or exposed at 3°C for 6 d (H, hardened). The data are expressed as log2

of the average fold change (FC) of three independent experiments using the value of WT control

sample as a baseline (value = 0 in the plot). The threshold value above which a gene is considered

induced (2X) is indicated. WT = wild type; Xan b12 = xantha mutant b12;Xan s46 = xantha mutant

s46; Alb f17 = albina mutant f17; Alb e16 = albina mutant e16.

B: The probe sets and the corresponding annotations of the genes analyzed. The primers used for

the analysis are reported in the Supplementary Table 7

Figure 4. Analysis of Cbf expression in wild type and chloroplast mutants of barley.

A: Northern blot analysis, each lane contained 15 µg of total RNA from the samples indicated

(20°C, control and 3°C, cold treated for 4 h) and probed with a radio-labeled cDNA fragment

cleaved from BCbf1 (accession n. AF298230) encompassing the conserved Cbf regions only (AP2

and Cbf signature, Jaglo-Ottosen et al., 2001).

B: RT-PCR analysis of barley Cbf sequences made on RNA isolated from control (T0, 20°C) and

cold treated (T4, T8 and T24, 3°C for 4, 8 and 24 h) mutants and WT plants. The Cbf sequences

used in the analysis were BCbf1 (AF298230, probe set: contig15617_at), HvCbf1 (AF418204, probe

set: contig13523_at), the Cbf-like sequence BG367653 (probe set: contig2479_at). Beside Cbfs,

HvICE1 (probe set: contig 21686_at) a barley sequence highly homologous to the Arabidopsis ICE1

(Tondelli et al., 2006) and the barley gene Hv-WRKY38 (probe set: contig4386_at; Marè et al.,

2004) a cold-regulated transcription factor belonging to the ICE1 regulon were also investigated.




29

Normalization was carried out with β-actin. e16 = albina-e16; f17 = albina-f17; s46 = xantha-s

46; b12

= xantha-b12; WT = wild type.




30

Table I. Present calls on Barley1 GeneChip and number of genes (probe sets) detecting transcripts

more than 2 fold up- or 2 fold-down regulated in the indicated comparisons. A, each albina or

xantha mutant grown at 20°C compared against WT (baseline) grown under the same conditions

and B, cold treated samples (6 d at 3°C) from each genotype compared against their control (20°C)

samples (baseline).

Comparison Present callsa Genes 2x up-

regulated

Genes 2x down-

regulated

Tot. (2x up +

2x down)

% of present

calls

A- mutants 20°C against wild type 20°C

xan-b12

vs wild type 9,910 626 270 896 9.0

xan-s46

vs wild type 11,249 1,624 577 2,201 19.6

alb-f17

vs wild type 11,804 1,717 569 2,286 19.4

alb-e16

vs wild type 12,527 1,573 818 2,391 19.1

B- cold-treated (3°C) against control (20°C)

wild type cold vs control 11,133 1,911 824 2,735 24.6

xan-b12 cold vs control 10,720 811 316 1,127 10.5

xan-s46 cold vs control 11,694 703 331 1,034 8.8

alb-f17 cold vs control 12,402 834 591 1,425 11.5

alb-e16 cold vs control 12,919 798 542 1,340 10.4

Footnote a: number of probe sets with present calls in one or both of the sample points (control and cold-treated). See

materials and methods for explanation of “present” calls. xan-b12 = xantha mutant b12; xan-s46 = xantha mutant s46;

alb-f17 = albina mutant f17; alb-e16 = albina mutant e16

.




31

Table II. Functional classification (biological processes and cellular components) of the

genes cold-regulated in mutants and WT. Categorization based on the GO annotation search

tool available at the TAIR web site using the homologous sequences of Arabidopsis (E-value

cut off = ≤ e-10). Only those categories with the greatest difference are listed above. Complete

ontology of cellular components and biological processes are listed in Supplementary Table 2.

A B C D E F G H I

GO Biological

process

Array (%)a

WT (%)a

xan-b12

(%)a xan-s

46 (%)a

alb-f17

(%)a

alb-e16

(%)a Chloro-dep (%)a

Chloro-indep

(%)a

Chloro-dev_dep

(%)a

Up-regulated

Response to abiotic/biotic

stimulus 3.4 3.2 6.2 7.0 6.7 6.0 2.1 8.6 6.0

Response to stress

2.2 2.5 5.2 6.3 5.5 4.7 1.4 8.6 5.3

Protein metabolism

7.8 10.1 5.9 5.3 5.5 6.4 11.9 5.3 6.0

Down-regulated

Response to abiotic/biotic

stimulus 3.4 4.5 4.5 4.6 6.2 4.2 4.8 5.7 0.9

Response to stress

2.2 2.3 2.8 2.7 2.1 2.8 2.1 2.3 2.8

Protein metabolism

7.8 7.1 3.8 5.4 4.1 5.6 7.4 5.7 6.5

GO Cellular

component

Array

(%)

WT

(%)

xan-b12

(%)

xan-s46

(%)a

alb-f17

(%)a

alb-e16

(%)

Chloro-

dep

(%)

Chloro-

indep (%)

Chloro-

dev_dep

(%)

Up-regulated

Ribosome 1.9 6.5 0.0 0.0 0.2 0.2 8.5 0.0 0.0

Down-regulated

Ribosome 1.9 1.7 0.0 0.3 1.6 1.4 2.7 0.0 0.0

Footnote a: for each group of cold-regulated genes reported in the columns B-I, numbers denote the percentage

of genes (probe sets) belonging to GO categories. Annotations for the whole array were added for comparison in

column A. WT = cold-regulated genes in wild type; xan-b12 = cold-regulated genes in xantha mutant b12; xan-

s46 = cold-regulated genes in xantha mutant s46; alb-f17 = cold-regulated genes in albina mutant f17; alb-e16 =

cold-regulated genes in albina mutant e16; Chloro-dep = chloroplast-dependent cold-regulated genes; Chloro-

indep = chloroplast-independent cold-regulated genes; Chloro-dev_dep = chloroplast developmental-dependent

cold-regulated genes.




32

Table III. Classification of the genes (probe sets) cold-regulated in WT and/or in the

mutants.

Classes of cold-regulated genes Genes 2x up-

regulated

% of WT

2x upa

Genes 2x

down-

regulated

% of WT 2x

downa

Tot. (2x up +

2x down)

1 - Chloroplast-dependent 1,332 69.7 498 60.4 1,830

2 - Chloroplast-independent 243 12.7 59 7.2 302

3a- Chloroplast development-

dependent xan-b12

90 4.7 38 4.6 128

3b- Chloroplast development-

dependent xan-s46

17 0.9 7 0.8 24

3c- Chloroplast development-

dependent alb-f17

38 2.0 33 1.7 71

4 - Albina/xantha dependent 123 nab 44 nab 167

5 - Other 869 nac 783 nac 1652

Footnote a: calculated as percentage of up- or down regulated WT cold-regulatedgenes, 1,911 and 824,

respectively; b: not applicable because not included in WT cold-regulated genes; c: not applicable because

only partially included in WT cold-regulated genes (see Figure 1).




transcriptome analysis of cold acclimation in barley albina and xantha mutants

Documents