www.elsevier.com/locate/ydbio

Developmental Biology

The role of GDNF in patterning the excretory system

Reena Shakyaa, Eek-hoon Jhoa,1, Pille Kotkaa,2, Zaiqi Wua, Nikolai Kholodilovb,

Robert Burkeb,c, Vivette D’Agatic, Frank Costantinia,*

aDepartment of Genetics and Development, Columbia University Medical Center, 630 W. 168th Street, New York, NY 10032, USAbDepartment of Neurology, Columbia University Medical Center, 630 W. 168th Street, New York, NY 10032, USAcDepartment of Pathology, Columbia University Medical Center, 630 W. 168th Street, New York, NY 10032, USA

Received for publication 24 January 2005, revised 28 March 2005, accepted 6 April 2005

Available online 10 May 2005

Abstract

Mesenchymal–epithelial interactions are an important source of information for pattern formation during organogenesis. In the

developing excretory system, one of the secreted mesenchymal factors thought to play a critical role in patterning the growth and branching

of the epithelial ureteric bud is GDNF. We have tested the requirement for GDNF as a paracrine chemoattractive factor by altering its site of

expression during excretory system development. Normally, GDNF is secreted by the metanephric mesenchyme and acts via receptors on the

Wolffian duct and ureteric bud epithelium. Misexpression of GDNF in the Wolffian duct and ureteric buds resulted in formation of multiple,

ectopic buds, which branched independently of the metanephric mesenchyme. This confirmed the ability of GDNF to induce ureter

outgrowth and epithelial branching in vivo. However, in mutant mice lacking endogenous GDNF, kidney development was rescued to a

substantial degree by GDNF supplied only by the Wolffian duct and ureteric bud. These results indicate that mesenchymal GDNF is not

required as a chemoattractive factor to pattern the growth of the ureteric bud within the developing kidney, and that any positional

information provided by the mesenchymal expression of GDNF may provide for renal branching morphogenesis is redundant with other

signals.

D 2005 Elsevier Inc. All rights reserved.

Keywords: Organogenesis; Kidney development; GDNF; Ret receptor tyrosine kinase; Ret; Hoxb7; Metanephric kidney; Wolffian duct; Ureteric bud;

Branching morphogenesis; Metanephric mesenchyme

Introduction

Mesenchymal–epithelial interactions are thought to play

a critical role in the growth and pattern formation of organs

that develop by branching morphogenesis, such as the

kidney and lung. During kidney development, the epithelial

ureteric bud (UB) emerges from the Wolffian duct, in

response to inductive signals from the metanephric mesen-

chyme, a specialized region of the nephrogenic cord (Saxen,

0012-1606/$ - see front matter D 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.ydbio.2005.04.008

* Corresponding author. Fax: +1 212 923 2090.

E-mail address: fdc3@columbia.edu (F. Costantini).1 Present address: Department of Life Science, University of Seoul, 90

Jeonnong-Dong, Dongdaemun-Gu, Seoul, Korea.2 Present address: National Institute of Chemical Physics and Biophysics

and Tallinn University of Technology, Department of Gene Technology,

Tallinn, Estonia.

1987). As the UB invades the metanephric mesenchyme,

further inductive signals from the mesenchyme and renal

stromal cells (Carroll and McMahon, 2003; Shah et al.,

2004; Vainio and Lin, 2002) induce the UB to undergo a

complex and stereotypic process of branching and elonga-

tion, eventually giving rise to the epithelium of the ureter,

renal pelvis, calyces, and collecting ducts (Al-Awqati and

Goldberg, 1998; Oliver, 1968). The ureteric bud, in turn,

secretes factors that induce the metanephric mesenchymal

cells to condense, convert to epithelia and eventually form

the various segments of the nephron (Carroll and McMahon,

2003; Saxen, 1987).

One of the main signaling pathways that promotes

ureteric bud branching morphogenesis involves the secreted

factor GDNF, which signals through the Ret receptor

tyrosine kinase and the co-receptor GFRa-1 (Sariola and

283 (2005) 70 – 84

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 71

Saarma, 2003). Prior to outgrowth of the UB from the

Wolffian duct, Ret and GFRa-1 are expressed throughout

the Wolffian duct, while GDNF is expressed broadly in the

nephrogenic cord surrounding the posterior duct (Hellmich

et al., 1996; Pachnis et al., 1993; Suvanto et al., 1996). As

the UB evaginates from the caudal end of the Wolffian duct,

the expression of GDNF becomes limited to and upregu-

lated in the adjacent metanephric blastema (Grieshammer

et al., 2004). Concomitantly, Ret and GFRa-1 are down-

regulated in the Wolffian duct and become restricted to the

newly formed ureteric bud. As UB branching progress, Ret

and GFRa-1 soon become restricted to the tips of UB

branches, and GDNF to the surrounding mesenchymal cells

at the periphery of the kidney (Pachnis et al., 1993; Sainio

et al., 1997).

The importance of this pathway for renal development

was established by the finding that null mutations in gdnf,

ret, or gfra-1 result in renal agenesis or severe dysgenesis,

due to the failure of the UB to emerge from the Wolffian

duct or to grow and branch normally (Cacalano et al., 1998;

Enomoto et al., 1998; Moore et al., 1996; Pichel et al., 1996;

Sanchez et al., 1996; Schuchardt et al., 1994, 1996).

However, the specific cellular and developmental processes

induced by GDNF remain unclear. While there were

conflicting reports as to whether GDNF induces UB cell

proliferation (Michael and Davies, 2004; Pepicelli et al.,

1997; Sainio et al., 1997; Vega et al., 1996), a recent

analysis of the behavior of ret�/� cells in mosaic kidneys

supports the conclusion that Ret signaling is particularly

important for the proliferation of cells at the growing UB

tips (Shakya et al., 2005). GDNF may also promote the

survival of UB cells (Towers et al., 1998), as it does for

some neuronal populations (Sariola and Saarma, 2003). A

third potential role, for which there is considerable evidence,

albeit indirect, involves specifying the pattern of branching

morphogenesis. A GDNF-soaked bead can induce the

outgrowth of ectopic buds from the Wolffian duct in organ

culture (Brophy et al., 2001; Pichel et al., 1996; Sainio et al.,

1997), while mutations that alter the distribution of GDNF

along the Wolffian duct can cause ectopic UBs to form in

vivo (Grieshammer et al., 2004; Kume et al., 2000).

Addition of GDNF to kidney cultures can cause increased

or abnormal UB branching (Pepicelli et al., 1997; Pichel et

al., 1996; Sainio et al., 1997; Towers et al., 1998; Vega et

al., 1996), while expression of activated forms of Ret in the

Wolffian duct and ureteric bud also induces ectopic UBs and

abnormal patterns of UB growth and branching (de Graaff et

al., 2001; Srinivas et al., 1999b). These studies have led to

the idea that GDNF/Ret signaling may specifically induce

branching of the UB epithelium (i.e., that it is a ‘‘ramogen’’),

and that it provides a chemoattractive cue, whose concen-

tration gradient is sensed by the UB tips and thus directs

their growth. The latter hypothesis was supported by studies

in which Ret-expressing cells were shown to migrate

towards a source of GDNF (Tang et al., 1998), as well as

by observations that GDNF may serve as a chemoattractant

for migrating enteric neural crest cells (Natarajan et al.,

2002; Young et al., 2001). Thus, a model has emerged in

which the localized expression of GDNF is important for

normal patterning of the excretory system, first in determin-

ing the site of initial outgrowth of the UB, and later in

determining the branching pattern within the developing

kidney (Lechner and Dressler, 1997; Sariola and Saarma,

2003; Sariola and Sainio, 1997).

Another potential role of GDNF involves the proximal–

distal patterning of the ureteric bud. GDNF is expressed

only at the periphery of the growing kidney, and several

genes expressed specifically in the peripheral UB tips,

including Ret and Wnt11, are upregulated by GDNF

(Pepicelli et al., 1997). Thus, it is possible that the pattern

of expression of these (and perhaps other) tip-specific genes

is a direct consequence of the localized expression of

GDNF.

To test these hypotheses in an in vivo situation, we

generated transgenic mice in which GDNF is ectopically

expressed in cells throughout the Wolffian duct and

ureteric bud epithelium. The effects of GDNF misexpres-

sion were examined first on a wild type background, in

which endogenous GDNF is also expressed by the

mesenchyme, and then on a gdnf knockout background,

in which endogenous GDNF is absent, and replaced by

the ectopically-expressed GDNF. We reasoned that if

GDNF were required only for UB cell survival and

proliferation, such alterations in its spatial distribution

might have little impact on the pattern of UB outgrowth

and branching; however, if GDNF served as a critical

chemoattractive factor, they should have profound effects

on UB branching morphogenesis. Our results support the

conclusion that GDNF stimulates bud formation by the

Wolffian duct epithelium and that the localized expression

of GDNF in the posterior nephrogenic cord is important

for the outgrowth of a single, correctly placed ureteric

bud. They also show that growth and branching of the

collecting duct system within the kidney can be perturbed

to some extent by the misexpression of GDNF in the

ureteric bud. Surprisingly, many aspects of kidney devel-

opment and UB morphogenesis were normal in mice in

which GDNF was expressed only in the Wolffian duct and

UB epithelial cells, but not in the mesenchyme. This

observation argues that, if the mesenchymal expression of

GDNF does provide positional cues for ureteric bud

growth and patterning, this information must be redundant

with other signals that can independently pattern the

ureteric bud.

Materials and methods

Generation of Hoxb7/rtTA transgenic mice

The Hoxb7 promoter (�1316 bp to +81 bp of the

Hoxb7 gene) (Kress et al., 1990) was excised from

Fig. 1. Excretory system defects in Hoxb7/GDNF transgenic mice. (A)

Schematic diagram of transgene construct. (B) and (D) Sagittal sections of

two transgenic kidneys at E18.5. Asterisks denote cystic UB tips in the

cortex. (C) and (E) Enlargements of boxed areas in B and D, showing

branching of cyst epithelium (arrows). Inset in C, dolichos biflorus lectin

(brown) staining confirms the UB origin of cystic epithelia; methyl green

counterstain. Inset in E shows hyperplasia of the cystic epithelium, which is

5–6 cell diameters in thickness compared to the simple epithelium of

normal collecting ducts. (F) The male reproductive tract is abnormally

dilated (e, epididymis) and branched ectopic UBs are found nearby

(arrowheads). t, testis; b, bladder. (G) Enlargement of the boxed area in

(F) showing extensive branching of ectopic UBs. H and E staining. Scale

bars, 200 Am.

R. Shakya et al. / Developmental Biology 283 (2005) 70–8472

pGEM-Blue with KpnI and AvaI, the ends blunted, and

subcloned into the EcoRV site of pBluescriptII KS+. The

Hoxb7 promoter in pBluescript was then excised with

XhoI and EcoRI and the EcoRI end blunted. Plasmid

pUHDrtTA2S-M2 (Urlinger et al., 2000) was digested

with XhoI and SacI to remove the CMV promoter,

leaving the rtTA2S-M2 gene followed by SV40 polyA

sequences. The SacI site was blunted, and the Hoxb7

promoter fragment was then cloned into the XhoI–SacI

fragment of the pUHDrtTA2S-M2 vector. The entire 2.7

kb Hoxb7/rtTA2S-M2/SV40-pA transgene (abbreviated

‘‘Hoxb7/rtTA’’) was excised from the vector with XhoI

and HindIII for pronuclear injection into B6CBAF1/J

mouse eggs (Hogan et al., 1994). Three transgenic

founder animals (RS-HTA2, RS-HTA3 and RS-HTA8)

were identified by Southern blot using EcoRI, which cuts

once within the transgene, using a probe generated from

the rtTA2S-M2 cDNA. Offspring of the three founders

were tested for expression of rtTA2S-M2 in kidney by

RT-PCR (data not shown) and by crossing to tetO/h-galreporter mice, inducing with Dox and staining for h-gal(e.g., Figs. 2C, D, 3A and data not shown). All

experiments in this paper were conducted using animals

from line RS-HTA2, on a mixed genetic background.

Inheritance of the transgene was monitored by PCR using

primers rtTA2S-a (5V CATGGCAAGACTTTCTGCGG)

and rtTA2S-b (5VTTGQTCTCAGAAGTGGGGGCA),

which amplified a band of ¨296 bp from the rtTA2S-

M2 sequence under the following conditions: 94-C, 5

min; 30 cycles of (94-C, 30 s; 58-C, 30 s; 72-C, 50 s);

72-C, 7 min.

Generation of Hoxb7/GDNF transgenic mice

A PmeI restriction site was introduced 5Vof the Hoxb7

promoter in pBluescriptII (KS+) (see above) while a

multiple cloning site (MCS) (5V EcoRI–HindIII–PacI–

NheI –KpnI –XhoI –AseI–NotI –BamHI–PstI –PmeI 3V)was introduced downstream of the Hoxb7 fragment. A

BamHI–PstI fragment including an intron and polyadeny-

lation sequences of the human h-globin gene was

subcloned into the MCS to generate plasmid Hoxb7-

MCS-hh-globin-pA. The mouse GDNF cDNA (¨636 bp)

was excised from plasmid GDNFXVL with HindIII and

partial BamHI digestions, HindIII end blunted, and

subcloned into EcoRI (blunted) and BamHI sites, upstream

of an IRES2-EGFP sequence in pBluescriptII (KS+). The

GDNF-IRES2-EGFP fragment was excised with NheI and

NotI, the NotI end blunted, and subcloned into the NheI

and BamHI (blunted) sites in the MCS of Hoxb7-MCS-hh-globin-pA. The final construct, RS#29, was verified by

restriction mapping and partial sequencing. The ¨5 kb

insert was excised with PmeI, gel-purified, and eluted in

injection buffer (Hogan et al., 1994). Transgenic fetuses

were identified by Southern blot using EcoRI and a mouse

GDNF cDNA probe (data not shown).

Fig. 2. Transgene constructs for inducible expression of GDNF and h-gal inthe Wolffian duct and ureteric bud. A–C, transgene constructs. A, Hoxb7/

rtTA2S-M2 (abbreviated Hoxb7/rtTA) or Axin2/rtTA2S-M2 (abbreviated

Axin2/rtTA). B, BiTetO/lacZ/GDNF (Kholodilov et al., 2004). C, tetO/lacZ

(Furth et al., 1994). D, expression of control tetO/lacZ transgene, activated

by Hoxb7/rtTA, in the renal collecting ducts of a 40-day-old bi-transgenic

mouse maintained on Dox. c, cortex; m, medulla; p, papilla.

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 73

Generation of Axin2-rtTA transgenic mice

The 5.7-kb insert of plasmid Axin2P-Luc (Jho et al.,

2002), containing the Axin2 promoter was excised with

MluI and HindIII, and the CMV promoter in pUHDrt-

Fig. 3. Ectopic ureteric buds emerging from the Wolffian duct of Hoxb7/rtTA

rtTA�tetO/lacZ bi-transgenic embryo with a single T-stage UB (arrow) that emerg

rtTA�BiTetO/lacZ/GDNF bi-transgenic embryo with a secondary T-stage UB (red

the more anterior Wolffian duct (yellow arrows). C, a strongly affected Hoxb7/rtTA

length of the Wolffian duct. Ectopic buds in more anterior regions of the Wolffia

TA2S-M2 (a gift of Dr. Wolfgang Hillen) was replaced

with the 5.7-kb Axin2 fragment, using the enzymes

described above for Hoxb7/rtTA. The Axin2-rtTA

plasmid was digested with AflII and HindIII and the

7-kb insert purified for microinjection. Genotyping was

performed with the same PCR primers as for Hoxb7/

rtTA.

BiTetO/lacZ/GDNF and tetO/lacZ transgenic mice and

GDNF mutant mice

Strain BiTetO/lacZ/GDNF has been described (Kholo-

dilov et al., 2004). The tetO/lacZ strain B6;SJL-Tg(tetop-

lacZ)2Mam/J (Furth et al., 1994) was obtained from The

Jackson Laboratory. The gdnflacZ knock-in null allele

(Sanchez et al., 1996) was obtained from M. Barbacid

(Bristol-Meyers Squib).

Transgene induction with Doxycycline

Pregnant females were fed 2 mg/ml Doxycycline

(Sigma D-9891), 5% sugar (w/v) in the water. Dox was

administrated continuously from day 8.5 of gestation in

the experiments of Figs. 3–6, from day 9.5 or 10.5 in

the rescue experiments (Figs. 7 and 8). Full induction

is achieved 1 day after the start of Dox (Kistner et al.,

1996). The rationale for delaying the induction in the

rescue experiments was to wait for a UB to form

naturally (¨E11), as occurs in some gdnf�/� embryos,

and then support its further growth by the induction of

the transgene-encoded GDNF. Whether this delay

contributed to the success of the rescue is not known.

�BiTetO/lacZ/GDNF bi-transgenic embryos at E11.5. A, control Hoxb7/

ed from the posterior end of the Wolffian duct. B, a weakly affected Hoxb7/

arrow) anterior to the normal UB (black arrow), and a few small buds along

�BiTetO/lacZ/GDNF bi-transgenic embryo with multiple UBs all along the

n duct had not yet branched at E11.5. Scale bar, 0.5 mm.

R. Shakya et al. / Developmental Biology 283 (2005) 70–8474

b-gal staining of whole mount tissues and cryosections

Tissues were fixed in fresh, ice-cold 2% PFA (parafor-

maldehye) and 0.2% glutaraldehyde in 1 � PIPES buffer

(0.1 M Pipes, 2 mM MgCl2, 2 mM EGTA, pH 6.9) 4-C for

1 h, washed in PBS, and postfixed in 0.2% glutaraldehyde

in 1 � PIPES buffer for 1 h at room temp. Alternatively,

tissues were fixed in 4% PFA in PBS for 1–3 h at 4-C. After

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 75

several washes in PBS, for sectioning tissues were

permeated with 15% and 30% sucrose in 0.1 M phosphate

buffer, embedded in OCT (Tissue-Tek\) and frozen in dry

ice. 12–15 Am sections were fixed in 2 mM MgCl2 and

0.2% glutaraldehyde in PBS for 5 min before staining with

X-gal. Sections and whole tissues were stained with fresh X-

gal (2 mM MgCl2, 2.12 mg/ml potassium ferrocyanide, 1.64

mg/ml potassium ferricyanide, 1 mg/ml X-gal in PBS).

Tissues were stored in 10% Formalin buffer, while

cryosections were mounted with non-aqueous mounting

medium.

In situ hybridization

In situ hybridization was performed with digoxigenin-

labeled riboprobes as described (Mendelsohn et al., 1999)

and on whole-mount tissues as described (Wilkinson, 1992).

Ret, GDNF, and GFRa1 anti-sense riboprobes were gen-

erated as described (Srinivas et al., 1999b). For Wnt11 anti-

sense riboprobe, the Wnt11 cDNA clone pnk3 was linearized

with XhoI and transcribed with T3 polymerase (Kispert et al.,

1996).

Results

A Hoxb7/GDNF transgene can induce abnormal branching

of ureteric bud-derived epithelia in vivo

The Hoxb7 gene is expressed throughout the Wolffian

duct and ureteric bud epithelium, and its promoter directs a

similar pattern of transgene expression (Kress et al., 1990;

Srinivas et al., 1999a,b). Using this approach, it was

previously found that the expression of constitutively active

forms of Ret could induce abnormalities in UB growth and

branching (de Graaff et al., 2001; Srinivas et al., 1999b).

Here, we sought to determine whether the ectopic expres-

sion of the Ret ligand GDNF would have similar effects. We

first generated transgenic mice that carried a GDNF cDNA

under the direct control of the Hoxb7 promoter (Fig. 1A). Of

23 independently generated Hoxb7/GDNF transgenic

ig. 4. Growth and branching of ectopic ureteric buds at E14.5 (A–F) and E18.5 (G–L). A, control Hoxb7/rtTA�tetO/lacZ bi-transgenic male, showing

xpression of h-gal in Wolffian (asterisk) and Mullerian (arrow) ducts, as well as UB branches in the kidney (k). a, adrenal; b, bladder; s, sympathetic ganglia; t

stis. B, Hoxb7/rtTA�BiTetO/lacZ/GDNF bi-transgenic male with multiple ectopic UBs, most ending blindly (white arrows) but some connecting to the

idney (black arrow). Two ureters in the correct position are indicated by asterisks. C, dorsal view of the specimen in B, showing connection of the ureters to

e medial pole of the kidneys, and connection of several ectopic UBs (black arrow) to the posterior pole. D, female Axin2/rtTA�BiTetO/lacZ/GDNF bi

ansgenic with multiple ectopic UBs, many of them branching. E, close-up of branching ectopic buds from D. g, gonad. F, section of specimen in E, showing

ranching epithelial buds along the Wolffian duct (asterisks), and expression of h-gal in a subset of cells in the Wolffian duct and ectopic buds, but not in the

ullerian duct (arrows). Note the absence of nephrogenesis in the mesenchyme surrounding the ectopic UBs. G, control Hoxb7/rtTA�tetO/lacZ bi-transgenic

howing expression in the vas deferens (v), epididymis (inset), ureters (u) and kidneys. H, Axin2/rtTA�BiTetO/lacZ/GDNF bi-transgenic with many ectopic

Bs (white arrows) that have undergone several rounds of branching, as well as multiple hydroureters (u). I, enlarged back view of H, showing extensively

ranched ectopic UBs on the epididymis. J, Hoxb7/rtTA�BiTetO/lacZ/GDNF bi-transgenic male with a triple ureter (red arrows) and a triplex kidney. K

ection of the multiplex kidney in J, showing multiple ureters and division of the kidney into three segments, separated by nephrogenic zones (arrows). L, a

emale Hoxb7/rtTA�BiTetO/lacZ/GDNF bi-transgenic with ectopic h-gal-positive buds (arrows) attached to the uterus and oviduct, but no remaining Wolffian

uct. LV, close-up of oviduct in L. LW close-up of a branched bud attached to uterus in L. Lj, section of LV, showing that the h-gal-positive branched buds are

ot continuous with the oviduct epithelium (arrows). Scale bars, 0.5 mm.

F

e

te

k

th

tr

b

M

s

U

b

s

f

d

n

founder mice examined at E18.5, two had multiple,

collecting duct-derived renal cysts (Figs. 1B–E) and one

of these also contained branched, ureteric bud-derived

epithelial tubules associated with the male reproductive

tract, surrounded by undifferentiated mesenchyme (Figs. 1F,

G), similar to abnormalities previously observed in mice

expressing a constitutively active form of Ret (Srinivas et

al., 1999b). As expected, the UB epithelium in these mice

expressed high levels of GDNF mRNA (data not shown).

The lack of any obvious defects in the remaining 21

transgenic animals appeared to be due to lack of, or very

low, expression of the transgene (data not shown). While the

phenotype of the two affected mice supported the hypoth-

esis that misexpression of GDNF could disrupt normal UB

branching morphogenesis, the low frequency of expression

of this transgene led us to use a different approach for

further studies.

A Doxycycline-inducible transgene system for regulated

expression in the Wolffian duct and ureteric bud

To examine in more detail the effects of GDNF

misexpression at different stages of excretory system

development, we employed the ‘‘Tet-on’’ system of

inducible transgene expression (Furth et al., 1994; Gossen

et al., 1995). We developed a transgenic line expressing

the Doxycycline (Dox)-dependent transcriptional activator

rtTA2S-M2 (Urlinger et al., 2000) under the control of

either the Hoxb7 promoter (Hoxb7/rtTA) or the Axin2

promoter (Axin2/rtTA) (Fig. 2A). Axin2, like Hoxb7, is

expressed in the Wolffian duct and UB epithelia but not

in the surrounding mesenchyme (Jho et al., 2002 and

data not shown). To test the efficacy of the Hoxb7/rtTA

transgene, we first used a tetO/lacZ reporter transgene

(Fig. 2C) (Furth et al., 1994). Adult mice carrying both

transgenes, which were maintained on Dox during pre-

and postnatal life, showed strong expression in the renal

collecting duct system (Fig. 2D). Similarly, Dox-treated

bi-transgenic embryos displayed strong expression of h-gal throughout the Wolffian duct, ureteric bud, vas

deferens, epididymis and seminal vesicles (Figs. 3A,

,

-

,

,

R. Shakya et al. / Developmental Biology 283 (2005) 70–8476

4A, 4G). In contrast, no h-gal expression was observed

in singly transgenic tetO/lacZ embryos treated with Dox,

or in bi-transgenic embryos in the absence of Dox (data

not shown). Thus, the Hoxb7/rtTA transgenic mice

represent a useful tool for conditional expression of

transgenes in cells of the Wolffian duct and ureteric bud

lineages, during both pre- and postnatal development.

Fig. 5. Tip-specific gene expression patterns are maintained in ectopic

ureteric buds. A and B, in E14.5 Hoxb7/rtTA�BiTetO/lacZ/GDNF bi-

transgenic fetuses that also carry a Hoxb7/GFP transgene (Srinivas et al.,

1999a), GFP is expressed throughout the ectopic UBs that formed along the

Wolffian duct. Arrows point to some of the highly branched ectopic buds,

and arrowheads in B point to an ectopic ureter. AV, whole mount in situ

hybridization for Ret in the same specimen shown in A. Ret is expressed

only at the tips of the ectopic buds (arrows). C, Ret in situ hybridization to a

section of a similar bi-transgenic embryo, showing tip-specific expression

in the ectopic buds (arrows) along the Wolffian duct (arrowheads). BV,whole mount in situ hybridization for Wnt11 in the same specimen shown

in B. Arrows, specific expression at the ectopic UB tips; arrowhead,

specific expression at tip of the ectopic ureter. D, Raldh2 is expressed in

stroma (arrows) surrounding the UBs within the kidney (k), but not in the

mesenchyme surrounding the ectopic UBs (asterisks); a, adrenal; g, gonad;

k, kidney. Scale bars, 0.3 mm.

Expression of GDNF in the Wolffian duct epithelium causes

supernumerary ureteric buds to emerge and branch outside

the kidney

To examine the effects of GDNF misexpression on

urogenital development, we crossed the Hoxb7/rtTA or the

Axin2/rtTA activator strain with a BiTetO-lacZ-GDNF

transgenic ‘‘responder’’ strain, which carries GDNF and

lacZ coding sequences under the control of a Dox-inducible,

bi-directional promoter (Fig. 2B and Kholodilov et al.,

2004), and administered Dox to the mothers beginning at

E8.5. At E11.5, the Hoxb7/rtTA�BiTetO/lacZ/GDNF bi-

transgenic embryos displayed multiple ectopic buds (aver-

age 7, range 0–21, N = 24) along the entire length of the

Wolffian duct (Figs. 3B, C). The variation in bud number

correlated with variability in the level of GDNF transgene

expression, as reflected by the intensity of h-gal staining(Fig. 3 and data not shown). The BiTetO/lacZ/GDNF

transgene was expressed in most or all cells of the Wolffian

duct and early UB, unlike the mosaic expression observed at

later stages (see below).

In bi-transgenic male embryos at E14.5, ectopic buds

were observed along the vas deferens and epididymis,

derivatives of the Wolffian duct. These buds had grown

larger since E11.5, and many had undergone secondary

branching (Figs. 4B–F). Most of the ectopic buds ended

blindly, but some connected to the metanephric kidney (e.g.,

Figs. 4B, C). By E18.5, branching of the ectopic buds was

often even more extensive (Figs. 4H, I), similar to what was

seen in Hoxb7/GDNF transgenics (Figs. 1F, G). In males,

the buds remained connected to the Wolffian duct deriva-

tives. In females, most of the Wolffian duct had degenerated

(as normally occurs by E15.5 in the absence of male

hormones, Kobayashi and Behringer, 2003) but the h-gal-positive buds remained as isolated epithelial structures,

embedded in the mesenchyme of the oviduct and uterus

(Fig. 4L). Presumably, these buds survived while the duct

degenerated, because they had differentiated from Wolffian

duct into ureteric bud epithelium (a conclusion supported by

marker gene expression patterns, as described below), and

were thus refractory to the mechanism that causes degen-

eration of the Wolffian duct epithelium in females.

In addition to the numerous ectopic buds, bi-transgenic

fetuses usually had a correctly-positioned ureter that

connected normally to the bladder and the medial pole of

the kidney (e.g., Figs. 4B, C). In some cases (37%, N = 26),

there were two or three ureters on one side (Figs. 4H, J, K),

each associated with a separate renal pelvis, resulting in a

duplex or triplex kidney (Figs. 4J, K). Frequently (54%, N =

26), one or more of the ureters was an expanded ‘‘hydro-

ureter’’ (Figs. 4H, J, K), which in males could be seen to

terminate on the sex duct instead of the bladder, thus

preventing proper drainage. This observation is consistent

with the model of Mackie and Stephens (1975), in which

abnormal positioning of the ureteric bud along the anterior–

posterior axis of the Wolffian duct is thought to result in an

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 77

ectopic ureter that terminates abnormally either inside, or

outside of the bladder.

Unexpectedly, in many bi-transgenic females (typically

those with the most ectopic UBs), the uterus was missing

in whole or in part (data not shown). As the uterus is

derived from the Mullerian duct (which normally devel-

ops parallel to the Wolffian duct—Fig. 4A), this suggests

that the Mullerian ducts either did not form fully, or

degenerated. As Ret is not expressed in the Mullerian

duct, it is unlikely that the GDNF secreted by the nearby

Wolffian duct and ectopic ureteric buds could have acted

directly on the Mullerian duct epithelium. An alternative

possibility is that the ectopic ureteric buds secreted a

factor(s) that inhibited Mullerian duct formation or

persistence either directly, or indirectly, but this hypoth-

esis remains to be further explored.

Fig. 6. GDNF misexpression in developing collecting ducts of Hoxb7/rtTA�BiTe

E18.5. A, Wild type kidney section. B, enlargement of wild type papilla. C, en

transgenic kidney, showing normal overall organization but a few scattered cyst

collecting ducts. F, enlargement of cortex and nephrogenic zone, showing a cortica

(U), lack of a normal-shaped pelvis (p), disorganization of the medullary region an

abnormally branched and cystic collecting ducts (*). I, enlargement of cortex, sh

detected by in situ hybridization in a bi-transgenic kidney. K, enlargement of the

duct cells. L, enlargement of the cortex of J, showing strong expression of GDNF

GDNF in the peripheral mesenchyme (bracket). A– I, H and E stain. Scale bars

magnification.

Ectopic buds express ureteric bud markers with proper

proximal–distal patterning in the absence of metanephric

mesenchyme or renal stroma

The buds that formed at inappropriate locations were

surrounded by mesenchymal cells, but this mesenchyme did

not condense as it does around the normal UB tips, nor did it

form epithelial vesicles (Figs. 1G, 4F, 4Lj). To determine if

this mesenchyme had properties of metanephric mesen-

chyme or renal stroma, we examined the expression of the

metanephric mesenchyme markers WT1 (Kreidberg et al.,

1993) and GDNF and the stromal markers FoxD1 (Hatini et

al., 1996) and Raldh2 (Niederreither et al., 2002). None of

these markers were expressed by the mesenchymal cells

surrounding the ectopic buds (Fig. 5D and data not shown).

Thus, ectopic ureteric buds do not induce the surrounding

tO/lacZ/GDNF bi-transgenic mice, and its effects of on kidney histology at

largement of wild type cortex and nephrogenic zone. D, Section of a bi-

s (*). E, enlargement of papilla from D, showing several cystic, branched

l cyst (*). G, section of a different bi-transgenic kidney, showing hydroureter

d numerous cysts (*). H, enlargement of medulla from G, showing several

owing several cystic collecting ducts (*). J, expression of GDNF mRNA

medulla of J, showing strong expression of GDNF in a subset of collecting

in a subset of collecting duct cells, and weaker expression of endogenous

, 0.3 mm. A, D, G at same magnification; B, C, E, F, H, I, K, L at same

Fig. 7. Rescue of kidney development in gdnf�/� mice by transgenic

misexpression of GDNF in the ureteric bud. A, lack of ureters or kidneys in

a newborn gdnf�/� mouse (a gdnf lacZ knock-in null allele, Sanchez et al.,

1996), stained for h-gal. g, a segment of gut; a, adrenals; t, testes; b,

bladder. B, a control gdnflacZ heterozygote, with normal kidneys expressing

h-gal in the pattern of gdnf. k, kidney; ur, ureter; ut, uterus; o, ovary. C, a

newborn ‘‘rescued’’ gdnf�/� mouse carrying the Hoxb7/rtTA and BiTetO/

lacZ/GDNF transgenes. On the left is a duplex kidney, and on the right is a

single kidney. h-gal stain in the ureters and ectopic UBs (arrows) is due to

expression of the BiTetO/lacZ/GDNF transgene, while h-gal in the kidney

is from both the gdnflacZ allele and the BiTetO/lacZ/GDNF transgene. D, a

different rescued newborn gdnf�/� mouse, with two kidneys and ureters

(not stained for h-gal). Arrows, ectopic UBs. Scale bar, 0.3 mm.

R. Shakya et al. / Developmental Biology 283 (2005) 70–8478

mesenchymal cells to form normal metanephric mesen-

chyme or renal stroma. This is consistent with the fact that

in normal development, metanephric mesenchyme appears

to be specified before the invasion of the ureteric bud

(Brophy et al., 2001; Grieshammer et al., 2004; Kreidberg

et al., 1993).

To examine patterning of the ectopic buds, we analyzed

expression of three genes, Ret, Wnt11, and GFRa-1, which

are expressed in tips of the normal branching UB epithelium,

but not in the UB trunks or the Wolffian duct at E14.5. The

expression of all three genes was restricted to the tips of the

ectopic buds (Fig. 5 and data not shown). Thus, the ectopic

buds resemble normal ureteric buds not only in their ability to

branch but also in their pattern of tip-specific gene

expression. The expression of UB markers with a normal

proximal–distal pattern appears to be intrinsic to the UB

branching morphogenesis program and does not require

inductive signals from the metanephric mesenchyme or

stroma. This conclusion was further supported by studies in

whichwild type E11.5 ureteric buds were cultured in a system

that allows branching morphogenesis in the absence of

mesenchymal cells (Qiao et al., 1999). The expression of Ret

(Qiao et al., 1999) and Wnt11 (B. Lu and F.C., unpublished

data) was also restricted to the tips of the branched ureteric

bud-derived epithelia in these cultures.

Renal collecting duct abnormalities induced by

misexpression of GDNF

The kidneys of the bi-transgenic mice displayed a range of

phenotypes: many appeared normal, while a few displayed

defects similar to, although less severe than, those observed

in the Hoxb7/GDNF mice shown in Fig. 1. Aside from

multiple ureters and kidneys, described above, 30% had

cortical collecting duct cysts (Figs. 6F, I) and/or dilated

medullary collecting ducts (Figs. 6E, H), 9% had abnormal

branching of medullary collecting ducts (Fig. 6H), and 23%

had a misshapen and dilated pelvis (Fig. 6G). These results

are consistent with our preliminary observations (Fig. 1) that

misexpression of GDNF in the UB epithelium can induce

abnormalities in its growth and branching. The heterogeneity

in phenotype, and the generally mild defects, seemed to be a

consequence of the variable and mosaic expression of the

BiTetO/lacZ/GDNF transgene in the kidney, as revealed by in

situ hybridization for GDNF mRNA (Figs. 6J–L) or staining

for h-gal (e.g., Fig. 4F). This mosaic expression was a

specific property of the BiTetO/lacZ/GDNF responder trans-

genic line, and apparently a consequence of transgene

methylation (data not shown), a well-established phenom-

enon (Allen et al., 1990; Engler et al., 1991). In contrast, the

Hoxb7/rtTA activator was uniformly expressed in the renal

collecting ducts, as shown by control experiments with the

tetO/lacZ responder transgene (Fig. 2D).

Since the GDNF transgene was expressed in a small

proportion of UB cells within the kidney, and endogenous

GDNF was expressed normally in the peripheral mesen-

chyme of these kidneys (Fig. 6L, bracket), we suspected that

the overall distribution of GDNF might be only minimally

altered. Thus, according to a model in which gradients of

secreted GDNF pattern the growth and branching of the UB,

the collecting duct system might be relatively normal in

these mice because, at the periphery of the kidney, GDNF

was still produced mostly in the mesenchyme and only in a

few UB cells. To further test this model, we next generated

animals that expressed GDNF solely in the ureteric bud

epithelium and lacked any mesenchymal GDNF expression.

GDNF expressed by the ureteric bud epithelium supports

kidney development in the absence of mesenchyme-derived

GDNF

To produce mice lacking endogenous GDNF in the

metanephric mesenchyme and expressing it only in the

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 79

Wolffian duct and ureteric bud lineages, we introduced a

gdnf null mutation. Hoxb7/rtTA, gdnf +/� mice were

crossed with BiTetO/lacZ/GDNF, gdnf +/� mice and the

resulting offspring were examined at term. The gdnf �/�

Fig. 8. Histology of ‘‘rescued’’ kidneys and expression of GDNF, Ret and FoxD1

shown in Fig. 7D. Note the similar organization to wild type (Fig. 6A), with we

enlargement of medulla from B, showing a few dilated collecting ducts (*). D a

kidney in B. The arrowhead in D indicates the thickened peripheral stromal layer,

green arrow in D points to a glomerulus, and the double arrow in E to a bifurca

organization comparable to wild type (Fig. 6A), but smaller in size. G, enlargement

enlargement of cortex and nephrogenic zone from F. The asterisks indicate UB tips

layer. I –J, in situ hybridization for GDNF in the rescued kidney shown in B. I, tr

cells in the medulla (black dots). IV, enlargement showing several ducts with GDN

smaller subset of collecting duct cells than in the medulla (small arrows), while end

is absent (compare to Fig. 6L). JVand JW, enlargements showing GDNF-expressing

shaped UB. K, in the same kidney, Ret is expressed primarily in the UB tips at t

mesenchyme. L, enlargement of K. Scale bars in IV, JV, JW are 0.05 mm; all others

offspring that did not inherit both transgenes either had

no kidneys (60%) (Fig. 7A) or tiny kidney rudiments

smaller than the adrenal gland (40%) (Fig. 8A), as

previously observed (Moore et al., 1996; Pichel et al.,

. A, a rudimentary kidney from a gdnf�/� mouse. B, the rescued kidney

ll-shaped pelvis (p), medulla, cortex and nephrogenic zone. a, adrenal. C,

nd E, enlargements of two regions of the nephrogenic zone of the rescued

and inset DVshows that these cells express the stromal marker FoxD1. The

ted UB at the periphery. F, a different rescued kidney, with normal overall

of papilla and pelvis from F, showing several dilated collecting ducts (*). H,

, the green arrow a glomerulus, and the black arrowhead a thickened stromal

ansgene-encoded GDNF is strongly expressed in a subset of collecting duct

F-positive cells. J, in the cortex, transgene-encoded GDNF is expressed in a

ogenous GDNF, usually expressed in the peripheral mesenchyme (bracket),

cells in collecting ducts (small arrows). The double arrow in JVindicates a T-he periphery of the kidney, despite the absence of GDNF expression in the

are 0.3 mm. D, DV, E at same magnification as C.

R. Shakya et al. / Developmental Biology 283 (2005) 70–8480

1996; Sanchez et al., 1996). In contrast, of the eight gdnf

�/� offspring that inherited and expressed both trans-

genes, three had kidneys that were essentially normal in

shape and position (Figs. 7C, D), although they were

somewhat smaller than those in wild type or gdnf +/�mice (Fig. 7B), and two of these had a duplex kidney

and ureter on one side. Thus, the transgenes had ‘‘rescued’’

kidney development to a substantial degree in these gdnf�/�mice. Of the remaining 5/8 mice, two more had kidneys

that were significantly larger than those in gdnf�/� mice,

but were misplaced or obviously cystic (not shown), and

three had no kidneys. All of the gdnf�/� mice, including

those with rescued kidney development, still displayed

aganglionosis of the gut (data not shown), as was expected

since the Hoxb7/rtTA transgene is not expressed in the gut;

this provided a phenotypic confirmation of the gdnf�/�genotype.

The ‘‘rescued’’ kidneys were remarkably close to

normal in histoarchitecture, with only minor histological

abnormalities. They contained a normally shaped pelvis, a

distinct medulla, a cortex with abundant glomeruli, a

peripheral nephrogenic zone containing comma and S-

shaped bodies, and an outer layer of FoxD1-expressing

stromal cells (Figs. 8D, DV, E, H). The stromal cell layer

was thicker than normal, as has been seen in some

mutants with defects in ureteric bud growth (Batourina et

al., 2001; de Graaff et al., 2001). Most importantly, the

developing collecting duct system showed many of the

hallmarks of normal patterning, with the ureteric bud tips

growing outward at the periphery of the kidney, and

clearly displaying the terminal bifurcation typical of UB

branching (Figs. 8E, J). The only obvious abnormalities

in the collecting system were seen in the medulla of two

rescued kidneys, where a few collecting ducts were

dilated (Figs. 8C, G). In addition, there were numerous

ectopic ureteric buds along the reproductive tracts, as

expected (Figs. 7C, D).

In situ hybridization confirmed that endogenous,

mesenchymal GDNF was absent (Fig. 8J compare to

Fig. 6L), and that the GDNF transgene was expressed

specifically in collecting duct cells (Figs. 8I, IV, J, JV, JW).The transgenic GDNF mRNA was expressed in only a

small proportion of medullary collecting duct cells (Figs.

8I, IV) and in even fewer cortical collecting duct cells

(Figs. 8J, JV, JW). However, the level of GDNF mRNA in

these cells appeared higher than it is in normal

mesenchyme cells. Thus, it appears that the GDNF

secreted by a small number of UB cells in these mice

was sufficient to support renal development. Despite the

absence of endogenous GDNF in the nephrogenic zone,

the strong expression of Ret and GFRa-1 mRNAs at the

UB tips was maintained (Figs. 8K, L and data not

shown). Thus, as in the ectopic ureteric buds induced to

form outside the kidney, the expression of UB tip-specific

markers in the kidney does not require a localized,

mesenchymal source of GDNF.

Discussion

Mesenchymal–epithelial interactions are an important

mechanism for patterning the growth of organs that form by

branching morphogenesis (Hogan and Yingling, 1998;

Vainio and Lin, 2002). In the developing excretory system,

GDNF is one of the factors secreted by mesenchymal cells

and believed to play a key role in patterning epithelial

growth and branching. Genetic studies in mice, in combi-

nation with organ culture studies using exogenous GDNF,

have led to a model in which the localized, mesenchymal

expression of GDNF is critical not only for positioning the

site of outgrowth of the UB from the Wolffian duct, but also

for patterning the branching and growth of the UB within

the developing kidney (Lechner and Dressler, 1997; Sariola

and Saarma, 2003; Sariola and Sainio, 1997; Vainio and Lin,

2002), a process that is important for normal renal

histoarchitecture (Al-Awqati and Goldberg, 1998; Oliver,

1968). Here, we have tested the requirement for GDNF as a

paracrine, chemoattractive factor, by altering its site of

expression during excretory system development. Our

findings confirm the conclusion that the localized expres-

sion of GDNF along the posterior Wolffian duct is important

for the formation of a single, correctly placed ureter. They

also support the role of GDNF as a ramogen, that is, a factor

that promotes the branching of an epithelial tube. However,

they do not support the view that the localized expression of

GDNF is critical for patterning the growth of the ureteric

bud within the kidney, since the replacement of mesen-

chymal GDNF with UB-derived GDNF had only minor

effects on kidney development.

In normal embryogenesis, a single ureteric bud evagi-

nates from the Wolffian duct and grows dorsally into the

metanephric mesenchyme, which expresses GDNF. The

misexpression of GDNF throughout the Wolffian duct

epithelium led to the outgrowth of as many as 20 ectopic

buds all along the Wolffian duct, demonstrating that the

entire Wolffian duct is competent to form ureteric buds. Our

findings are consistent with previous in vitro studies

showing that GDNF-soaked beads placed near the posterior

Wolffian duct can elicit the formation of supernumerary

buds (Brophy et al., 2001; Sainio et al., 1997; Towers et al.,

1998), and they extend previous in vivo observations that

mutations that slightly expand the domain of GDNF

expression in the nephrogenic cord can alter the sites of

UB outgrowth (Grieshammer et al., 2004; Kume et al.,

2000). Thus, the normally restricted expression site of

GDNF plays an important role in determining the correct

position of ureteric bud formation (Lechner and Dressler,

1997; Sainio et al., 1997). However, it is important to note

that, although most embryos lacking GDNF, Ret or Gfra1

fail to make a ureteric bud, some of them do form a UB in

approximately the correct position, which grows towards the

metanephric mesenchyme, although its elongation and

branching are severely impaired (Moore et al., 1996; Pichel

et al., 1996; Schuchardt et al., 1996). We also observed that,

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 81

even in transgenic fetuses with multiple ectopic buds along

the Wolffian duct, only the bud(s) that formed at or near the

correct position went on to form a ureter with a normal

connection to the kidney. Therefore, even when GDNF is

not correctly localized, other signals limited to the posterior

region, and probably produced by the metanephric mesen-

chyme, appear to contribute to the positioning and out-

growth of the ureter.

One important difference from previous studies is that, in

our experiments, GDNF was produced by the Wolffian duct

itself, that is, by the same epithelial tube that expresses the

GDNF receptors Ret and Gfra1. When the source of GDNF

is a bead or a population of mesenchymal cells outside the

Wolffian duct, it might generate a gradient of GNDF, which

could guide the ureteric bud towards the source of GDNF.

However, GDNF secreted by the Wolffian duct is unlikely

to form the same gradient—it would more likely form an

inverted gradient, with the highest levels of GDNF close to

the duct. Thus, the growth of buds away from the Wolffian

duct does not require a localized external source of GDNF,

but merely that the Wolffian duct cells be exposed to GDNF.

It is also intriguing that, despite the uniform expression of

the BiTetO/lacZ/GDNF transgene along the Wolffian duct

epithelium (Fig. 3C), the buds formed as discrete tubular

outgrowths, rather than as a continuous swelling of the

entire Wolffian duct. This suggests that a region of the

Wolffian duct epithelium that begins to bud in response to

GDNF sends out inhibitory signals that repress budding in

the adjacent region of the duct.

Unlike the ectopic buds induced by GDNF beads in

vitro, which do not branch again after their initial

evagination from the Wolffian duct (Brophy et al., 2001;

Sainio et al., 1997), many ectopic buds in the transgenic

mice continued to grow and branch repeatedly. This is

likely due to the continued expression of GDNF by the

epithelium of the ectopic buds. Many of these buds were

quite far from the developing kidney (and therefore not

exposed to factors secreted by the metanephric mesen-

chyme), and the mesenchymal cells surrounding them did

not display features of metanephric mesenchyme or renal

stroma. Therefore, it appears that the GDNF expressed by

the buds themselves is inducing their continued branching.

In contrast, when FGF-7 (which also signals through a

tyrosine kinase receptor) was expressed in the Wolffian

duct epithelium, it induced uniform swelling of the duct but

not budding or branching (unpublished data). This supports

the view that GDNF has the specific effect of inducing the

Wolffian duct and UB epithelium to branch (Davies et al.,

1999; Pepicelli et al., 1997; Towers et al., 1998; Vega et al.,

1996). The branching of the ectopic UBs did not follow the

stereotypical pattern that occurs within a normal developing

kidney. Atypical patterns of branching morphogenesis is

also seen in other situations in which the UB is induced to

branch outside of its normal relationship with metanephric

mesenchyme, for example, when cultured in an artificial

matrix (Qiao et al., 1999) or recombined with lung

mesenchyme lung (Kispert et al., 1996; Lin et al., 2003).

Therefore, the metanephric mesenchyme imposes pattern on

the growth and branching of the ureteric bud. Whether the

localized expression of GDNF within the metanephric

mesenchyme is a critical determinant of this pattern is a

question we address below.

One aspect of ureteric bud patterning that we found to be

independent of interaction with the metanephric mesen-

chyme was proximal–distal differentiation into tip vs.

trunk. It was previously observed that tip-specific expres-

sion of Ret and Wnt11 was maintained in E11.5 UBs

recombined with lung mesenchyme (Kispert et al., 1996),

although it was possible that localized expression of GDNF

in the lung mesenchyme accounted for this pattern, as both

Ret and Wnt11 are GDNF target genes (Pepicelli et al.,

1997). In our experiments, the normal tip-specific expres-

sion of Ret, Gfra1 and Wnt11 in ectopic buds from the

Wolffian duct, as well as in isolated wild type UBs cultured

without mesenchyme, showed that this pattern is an

intrinsic property of the developing UB. It does not depend

on a localized source of GDNF, as GDNF was expressed

throughout the epithelium of the ectopic buds, or through-

out the medium surrounding the cultured UBs. Nor do

ureteric bud tip and trunk cells represent two entirely

separate cell lineages with different patterns of gene

expression, as we have found that some tip cells give rise

to trunk cells during normal UB growth (Shakya et al.,

2005). How ureteric bud cells ‘‘know’’ whether they are in

the trunk or tip is an interesting problem that remains to be

solved.

To investigate the role of GDNF in patterning ureteric

bud branching morphogenesis within the developing kidney,

we first examined kidneys from newborn transgenic mice on

a wild type background, which misexpressed GDNF in the

UB epithelium while still expressing endogenous GDNF in

the metanephric mesenchyme. The extent of renal defects

varied considerably, from a few severely affected cases with

multiple branched, UB-derived cysts (e.g., Fig. 1), to others

with fewer and smaller cysts (Fig. 6), to many apparently

unaffected cases. This wide range of severity was apparently

a consequence of the variable levels of GDNF transgene

expression. The defects observed in the more severely

affected cases were similar to those previously observed in

transgenic mice that expressed ligand-independent forms of

Ret throughout the UB (de Graaff et al., 2001). This

confirms that the misexpression of GDNF can indeed

perturb the pattern of UB branching morphogenesis,

although this may be due to the elevated overall level of

secreted GDNF rather than to the altered spatial pattern of

expression. While these observations were consistent with

ability of GDNF to stimulate epithelial branching and

growth, they did not provide a clear answer regarding its

importance as a chemoattractive factor. The relatively

normal patterning of the collecting system in most of the

transgenic kidneys might imply that the site of GDNF

expression is not important for UB patterning, or it might

R. Shakya et al. / Developmental Biology 283 (2005) 70–8482

simply be a consequence of relatively weak expression of

the transgene, together with the normal expression of

endogenous GDNF in the peripheral metanephric mesen-

chyme (Fig. 6L). To better address this question, we

generated mice in which the endogenous, mesenchymal

expression of GDNF was eliminated.

In newborn gdnf�/� mice, we found that transgene-

encoded GDNF expressed only in the Wolffian duct and

UB epithelium was sufficient to support the development of

kidneys with many normal features, including a normal

overall shape and histoarchitecture, and a normally-shaped

pelvis, medulla, cortex and nephrogenic zone. Although the

difficulty in obtaining such animals precluded a devel-

opmental time course, the histoarchitecture of the kidney is

thought to reflect the earlier pattern of UB branching and

elongation, suggesting that these processes had occurred in

a largely normal manner. Furthermore, the nephrogenic

zone contained many ureteric bud tips, apparently growing

in the normal peripheral direction, and typical terminal

bifurcations were observed. The abnormal features of these

rescued kidneys were their reduced size compared to the

wild type, thickened peripheral stromal layer, and dilation

of a few collecting ducts. These features have been

previously observed in mice with a hypomorphic Ret

mutation (de Graaff et al., 2001), or mutations in other

genes that reduce Ret expression (Batourina et al., 2001).

We suggest that the level of transgene-encoded GDNF

expression was high enough to support kidney development

throughout most of fetal life, but at later stages, it decreased

to suboptimal levels, leading to the observed minor

abnormalities.

The only GDNF in the rescued kidneys was expressed

(and presumably secreted) by ureteric bud epithelial cells.

Therefore, it is difficult to imagine that the GDNF could

have formed the same concentration gradients as might

occur in a wild type kidney, where GDNF is secreted by the

metanephric mesenchymal cells. While it is conceivable that

binding of secreted GDNF to localized extracellular matrix

components could cause it to concentrate at specific sites

outside the UB, regardless of its site of synthesis, the

available experimental evidence argues against this possi-

bility: when fetal kidneys were incubated with soluble 125I-

labeled GDNF, it bound primarily to the UB tips (Sainio et

al., 1997). Thus, our findings argue against a model in

which gradients of GDNF are required to guide the

centrifugal growth of the UB tips, or one in which the

bifurcation of UB tips is determined by a double gradient of

GDNF in the surrounding mesenchyme (Sariola and

Saarma, 2003). We do not exclude the possibility that

GDNF is one of several factors that together pattern the

growth and branching of the ureteric bud, but if so, it

appears to be redundant with other patterning factors. Other

proteins that are expressed by the metanephric mesenchyme,

and may contribute to this process, include FGFs, HGF,

members of the TGF-h family such as BMP4 and BMP7,

and extracellular matrix components such as Glypican-3, to

name just a few (Carroll and McMahon, 2003; Davies,

2002; Davies and Fisher, 2002; Piscione and Rosenblum,

2002; Shah et al., 2004). While neurturin, another GDNF

family ligand, is an obvious candidate to be redundant with

GDNF, it is expressed only in the UB and thus is unlikely to

serve as a paracrine factor (Davies et al., 1999).

If GDNF is not required as a paracrine factor to pattern

UB branching, for what aspects of kidney development is it

important? GDNF promotes the outgrowth of the UB, and

also provides positional information that helps to determine

the site at which the UB will emerge from the Wolffian duct.

It stimulates the rapid proliferation of ureteric bud tip cells

(Michael and Davies, 2004; Pepicelli et al., 1997), a process

required to form the terminal ampullae, as shown by the

inability of ret�/� cells to contribute to the ampullae in

mosaic kidneys (Shakya et al., 2005). Formation of the

ampulla is an intermediate step in terminal branching by the

UB (Saxen, 1987; Watanabe and Costantini, 2004), and thus

the importance of GDNF/Ret signaling for formation of the

ampulla is consistent with its ability to promote UB

branching. The ability of GDNF expressed in the Wolffian

duct and ureteric bud epithelium to promote the repeated

branching of ectopic ureteric buds, independent of any

interaction with metanephric mesenchyme, also supports its

role as a ramogen. Finally, GDNF plays a continued role in

renal growth, as suggested by the reduced kidney size in

some GDNF heterozygous mutant mice (Cullen-McEwen et

al., 2001) or homozygotes for Ret hypomorphic alleles (de

Graaff et al., 2001; Jijiwa et al., 2004), as well as by studies

with GDNF antibodies (Towers et al., 1998; Vega et al.,

1996) or a Ret–Ig fusion protein (Ehrenfels et al., 1999) in

organ culture.

Acknowledgments

We thank Andreas Zimmer for the GDNF cDNA,

Wolfgang Hillen for the rtTA2S-M2 gene, Mariano Barbacid

for the gdnf mutant mice, and Cathy Mendelsohn and Doris

Herzlinger for critical comments on the manuscript. This

work was supported by a grant to F.C. from the NIDDK.

References

Al-Awqati, Q., Goldberg, M.R., 1998. Architectural patterns in branching

morphogenesis in the kidney. Kidney Int. 54, 1832–1842.

Allen, N.D., Norris, M.L., Surani, M.A., 1990. Epigenetic control of

transgene expression and imprinting by genotype-specific modifiers.

Cell 61, 853–861.

Batourina, E., Gim, S., Bello, N., Shy, M., Clagett-Dame, M., Srinivas,

S., Costantini, F., Mendelsohn, C., 2001. Vitamin A controls

epithelial/mesenchymal interactions through Ret expression. Nat.

Genet. 27, 74–78.

Brophy, P.D., Ostrom, L., Lang, K.M., Dressler, G.R., 2001. Regulation of

ureteric bud outgrowth by Pax2-dependent activation of the glial

derived neurotrophic factor gene. Development 128, 4747–4756.

R. Shakya et al. / Developmental Biology 283 (2005) 70–84 83

Cacalano, G., Farinas, I., Wang, L.C., Hagler, K., Forgie, A., Moore, M.,

Armanini, M., Phillips, H., Ryan, A.M., Reichardt, L.F., Hynes, M.,

Davies, A., Rosenthal, A., 1998. GFRalpha1 is an essential receptor

component for GDNF in the developing nervous system and kidney.

Neuron 21, 53–62.

Carroll, T.J., McMahon, A.P., 2003. Overview: the molecular basis of

kidney development. In: Vize, P.D., Woolf, A.S., Bard, J.B.L. (Eds.),

The Kidney. From Normal Development to Congenital Disease.

Academic Press, Amsterdam, pp. 343–376.

Cullen-McEwen, L.A., Drago, J., Bertram, J.F., 2001. Nephron endowment

in glial cell line-derived neurotrophic factor (GDNF) heterozygous

mice. Kidney Int. 60, 31–36.

Davies, J.A., 2002. Do different branching epithelia use a conserved

developmental mechanism? Bioessays 24, 937–948.

Davies, J.A., Fisher, C.E., 2002. Genes and proteins in renal development.

Exp. Nephrol. 10, 102–113.

Davies, J.A., Millar, C.B., Johnson Jr., E.M., Milbrandt, J., 1999. Neurturin:

an autocrine regulator of renal collecting duct development. Dev. Genet.

24, 284–292.

de Graaff, E., Srinivas, S., Kilkenny, C., D’Agati, V., Mankoo, B.S.,

Costantini, F., Pachnis, V., 2001. Differential activities of the RET

tyrosine kinase receptor isoforms during mammalian embryogenesis.

Genes Dev. 15, 2433–2444.

Ehrenfels, C.W., Carmillo, P.J., Orozco, O., Cate, R.L., Sanicola, M., 1999.

Perturbation of RET signaling in the embryonic kidney. Dev. Genet. 24,

263–272.

Engler, P., Haasch, D., Pinkert, C.A., Doglio, L., Glymour, M., Brinster,

R., Storb, U., 1991. A strain-specific modifier on mouse chromosome

4 controls the methylation of independent transgene loci. Cell 65,

939–947.

Enomoto, H., Araki, T., Jackman, A., Heuckeroth, R.O., Snider, W.D.,

Johnson, E.M.J., Milbrandt, J., 1998. GFRa1-deficient mice have

deficits in the enteric nervous system and kidneys. Neuron 21, 317–324.

Furth, P.A., St Onge, L., Boger, H., Gruss, P., Gossen, M., Kistner, A.,

Bujard, H., Hennighausen, L., 1994. Temporal control of gene

expression in transgenic mice by a tetracycline-responsive promoter.

Proc. Natl. Acad. Sci. U. S. A. 91, 9302–9306.

Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., Bujard, H.,

1995. Transcriptional activation by tetracyclines in mammalian cells.

Science 268, 1766–1769.

Grieshammer, U., Le, M., Plump, A.S., Wang, F., Tessier-Lavigne, M.,

Martin, G.R., 2004. SLIT2-mediated ROBO2 signaling restricts kidney

induction to a single site. Dev. Cell 6, 709–717.

Hatini, V., Huh, S.O., Herzlinger, D., Soares, V.C., Lai, E., 1996. Essential

role of stromal mesenchyme in kidney morphogenesis revealed by

targeted disruption of Winged Helix transcription factor BF-2. Genes

Dev. 10, 1467–1478.

Hellmich, H.L., Kos, L., Cho, E.S., Mahon, K.A., Zimmer, A., 1996.

Embryonic expression of glial cell-line derived neurotrophic factor

(GDNF) suggests multiple developmental roles in neural differentiation

and epithelial–mesenchymal interactions. Mech. Dev. 54, 95–105.

Hogan, B.L., Yingling, J.M., 1998. Epithelial/mesenchymal interactions

and branching morphogenesis of the lung. Curr. Opin. Genet. Dev. 8,

481–486.

Hogan, B., Bedington, R., Costantini, F., Lacy, E., 1994. Manipulating the

Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory,

Cold Spring Harbor.

Jho, E.H., Zhang, T., Domon, C., Joo, C.K., Freund, J.N., Costantini, F.,

2002. Wnt/beta-catenin/Tcf signaling induces the transcription of

Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol.

22, 1172–1183.

Jijiwa, M., Fukuda, T., Kawai, K., Nakamura, A., Kurokawa, K.,

Murakumo, Y., Ichihara, M., Takahashi, M., 2004. A targeting mutation

of tyrosine 1062 in Ret causes a marked decrease of enteric neurons and

renal hypoplasia. Mol. Cell. Biol. 24, 8026–8036.

Kholodilov, N., Yarygina, O., Oo, T.F., Zhang, H., Sulzer, D., Dauer, W.,

Burke, R.E., 2004. Regulation of the development of mesencephalic

dopaminergic systems by the selective expression of glial cell line-

derived neurotrophic factor in their targets. J. Neurosci. 24, 3136–3146.

Kispert, A., Vainio, S., Shen, L., Rowitch, D.H., McMahon, A.P., 1996.

Proteoglycans are required for maintenance of Wnt-11 expression in the

ureter tips. Development 122, 3627–3637.

Kistner, A., Gossen, M., Zimmermann, F., Jerecic, J., Ullmer, C., Lubbert,

H., Bujard, H., 1996. Doxycycline-mediated quantitative and tissue-

specific control of gene expression in transgenic mice. Proc. Natl. Acad.

Sci. U. S. A. 93, 10933–10938.

Kobayashi, A., Behringer, R.R., 2003. Developmental genetics of the

female reproductive tract in mammals. Nat. Rev., Genet. 4, 969–980.

Kreidberg, J.A., Sariola, H., Loring, J.M., Maeda, M., Pelletier, J.,

Housman, D., Jaenisch, R., 1993. WT-1 is required for early kidney

development. Cell 74, 679–691.

Kress, C., Vogels, R., De, G.W., Bonnerot, C., Meijlink, F., Nicolas, J.F.,

Deschamps, J., 1990. Hox-2.3 upstream sequences mediate lacZ

expression in intermediate mesoderm derivatives of transgenic mice.

Development 109, 775–786.

Kume, T., Deng, K., Hogan, B.L., 2000. Murine forkhead/winged helix

genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required for the early

organogenesis of the kidney and urinary tract. Development 127,

1387–1395.

Lechner, M.S., Dressler, G.R., 1997. The molecular basis of embryonic

kidney development. Mech. Dev. 62, 105–120.

Lin, Y., Zhang, S., Tuukkanen, J., Peltoketo, H., Pihlajaniemi, T., Vainio, S.,

2003. Patterning parameters associated with the branching of the

ureteric bud regulated by epithelial–mesenchymal interactions. Int. J.

Dev. Biol. 47, 3–13.

Mackie, G.G., Stephens, F.D., 1975. Duplex kidneys: a correlation of

renal dysplasia with position of the ureteral orifice. J. Urol. 114,

274–280.

Mendelsohn, C., Batourina, E., Fung, S., Gilbert, T., Dodd, J., 1999.

Stromal cells mediate retinoid-dependent functions essential for renal

development. Development 126, 1139–1148.

Michael, L., Davies, J.A., 2004. Pattern and regulation of cell proliferation

during murine ureteric bud development. J. Anat. 204, 241–255.

Moore, M.W., Klein, R.D., Farinas, I., Sauer, H., Armanini, M., Phillips,

H., Reichardt, L.F., Ryan, A.M., Carver-Moore, K., Rosenthal, A.,

1996. Renal and neuronal abnormalities in mice lacking GDNF. Nature

382, 76–79.

Natarajan, D., Marcos-Gutierrez, C., Pachnis, V., de Graaff, E., 2002.

Requirement of signalling by receptor tyrosine kinase RET for the

directed migration of enteric nervous system progenitor cells during

mammalian embryogenesis. Development 129, 5151–5160.

Niederreither, K., Fraulob, V., Garnier, J.M., Chambon, P., Dolle, P., 2002.

Differential expression of retinoic acid-synthesizing (RALDH) enzymes

during fetal development and organ differentiation in the mouse. Mech.

Dev. 110, 165–171.

Oliver, J., 1968. Nephrons and Kidneys: A Quantitative Study of

Developmental and Evolutionary Mammalian Renal Architectonics.

Hoeber Medical Division Harper and Row, New York.

Pachnis, V., Mankoo, B.S., Costantini, F., 1993. Expression of the c-ret

proto-oncogene during mouse embryogenesis. Development 119,

1005–1017.

Pepicelli, C.V., Kispert, A., Rowitch, D.H., McMahon, A.P., 1997. GDNF

induces branching and increased cell proliferation in the ureter of the

mouse. Dev. Biol. 192, 193–198.

Pichel, J.G., Shen, L., Sheng, H.Z., Granholm, A.C., Drago, J., Grinberg,

A., Lee, E.J., Huang, S.P., Saarma, M., Hoffer, B.J., Sariola, H.,

Westphal, H., 1996. Defects in enteric innervation and kidney develop-

ment in mice lacking GDNF. Nature 382, 73–76.

Piscione, T.D., Rosenblum, N.D., 2002. The molecular control of renal

branching morphogenesis: current knowledge and emerging insights.

Differentiation 70, 227–246.

Qiao, J., Sakurai, H., Nigam, S.K., 1999. Branching morphogenesis

independent of mesenchymal–epithelial contact in the developing

kidney. Proc. Natl. Acad. Sci. U. S. A. 96, 7330–7335.

R. Shakya et al. / Developmental Biology 283 (2005) 70–8484

Sainio, K., Suvanto, P., Davies, J., Wartiovaara, J., Wartiovaara, K., Saarma,

M., Arumae, U., Meng, X., Lindahl, M., Pachnis, V., Sariola, H., 1997.

Glial-cell-line-derived neurotrophic factor is required for bud initiation

from ureteric epithelium. Development 124, 4077–4087.

Sanchez, M.P., Silos-Santiago, I., Frisen, J., He, B., Lira, S.A., Barbacid,

M., 1996. Renal agenesis and the absence of enteric neurons in mice

lacking GDNF. Nature 382, 70–73.

Sariola, H., Saarma, M., 2003. Novel functions and signalling pathways for

GDNF. J. Cell Sci. 116, 3855–3862.

Sariola, H., Sainio, K., 1997. The tip-top branching ureter. Curr. Opin. Cell

Biol. 9, 877–884.

Saxen, L., 1987. Organogenesis of the Kidney. Cambridge Univ. Press,

Cambridge.

Schuchardt, A., D’Agati, V., Larsson-Blomberg, L., Costantini, F., Pachnis,

V., 1994. Defects in the kidney and enteric nervous system of mice

lacking the tyrosine kinase receptor Ret. Nature 367, 380–383.

Schuchardt, A., D’Agati, V., Pachnis, V., Costantini, F., 1996. Renal

agenesis and hypodysplasia in ret-k-mutant mice result from defects in

ureteric bud development. Development 122, 1919–1929.

Shah, M.M., Sampogna, R.V., Sakurai, H., Bush, K.T., Nigam, S.K., 2004.

Branching morphogenesis and kidney disease. Development 131,

1449–1462.

Shakya, R., Watanabe, T., Costantini, F., 2005. The role of GDNF/Ret

signaling in ureteric bud cell fate and branching morphogenesis. Dev.

Cell 8, 65–74.

Srinivas, S., Goldberg, M.R., Watanabe, T., D’Agati, V., al-Awqati, Q.,

Costantini, F., 1999a. Expression of green fluorescent protein in the

ureteric bud of transgenic mice: a new tool for the analysis of ureteric

bud morphogenesis. Dev. Genet. 24, 241–251.

Srinivas, S., Wu, Z., Chen, C.M., D’Agati, V., Costantini, F., 1999b.

Dominant effects of RET receptor misexpression and ligand-independ-

ent RET signaling on ureteric bud development. Development 126,

1375–1386.

Suvanto, P., Hiltunen, J.O., Arumae, U., Moshnyakov, M., Sariola, H.,

Sainio, K., Saarma, M., 1996. Localization of glial cell line-derived

neurotrophic factor (GDNF) mRNA in embryonic rat by in situ

hybridization. Eur. J. Neurosci. 8, 816–822.

Tang, M.J., Worley, D., Sanicola, M., Dressler, G.R., 1998. The RET-

glial cell-derived neurotrophic factor (GDNF) pathway stimulates

migration and chemoattraction of epithelial cells. J. Cell Biol. 142,

1337–1345.

Towers, P.R., Woolf, A.S., Hardman, P., 1998. Glial cell line-derived

neurotrophic factor stimulates ureteric bud outgrowth and enhances

survival of ureteric bud cells in vitro. Exp. Nephrol. 6, 337–351.

Urlinger, S., Baron, U., Thellmann, M., Hasan, M.T., Bujard, H., Hillen,

W., 2000. Exploring the sequence space for tetracycline-dependent

transcriptional activators: novel mutations yield expanded range and

sensitivity. Proc. Natl. Acad. Sci. U. S. A. 97, 7963–7968.

Vainio, S., Lin, Y., 2002. Coordinating early kidney development: lessons

from gene targeting. Nat. Rev., Genet. 3, 533–543.

Vega, Q.C., Worby, C.A., Lechner, M.S., Dixon, J.E., Dressler, G.R., 1996.

Glial cell line-derived neurotrophic factor activates the receptor tyrosine

kinase RET and promotes kidney morphogenesis. Proc. Natl. Acad. Sci.

U. S. A. 93, 10657–10661.

Watanabe, T., Costantini, F., 2004. Real-time analysis of ureteric bud

branching morphogenesis in vitro. Dev. Biol. 271, 98–108.

Wilkinson, D.G., 1992. Whole mount in situ hybridization of vertebrate

embryos. In: Wilkinson, D.G. (Ed.), In Situ Hybridization: A Practical

Approach. IRL Press, Oxford, pp. 75–83.

Young, H.M., Hearn, C.J., Farlie, P.G., Canty, A.J., Thomas, P.Q.,

Newgreen, D.F., 2001. GDNF is a chemoattractant for enteric neural

cells. Dev. Biol. 229, 503–516.