The dorsalizing and neural inducing genefollistatin is an antagonist ofBMP-4

Abraham Fainsoda,*, Kirsten Deißlerb, Ronit Yelina, Karen Maroma, Michal Epsteina,Graciela Pillemera, Herbert Steinbeisserc, Martin Blumb

aDepartment of Cellular Biochemistry, Hebrew University-Hadassah Medical School, P.O. Box 12272, Jerusalem 91120, IsraelbKarlsruhe Research Center, Institute of Genetics, P.O. Box 3640, Karlsruhe D-76021, Germany

cDepartment of Cell Biology, Max Planck Institute for Developmental Biology, P.O. Box 2109, Tu¨bingen D-72011, Germany

Received 3 February 1997; accepted 7 February 1997

Abstract

Specific signaling molecules play a pivotal role in the induction and specification of tissues during early vertebrate embryogenesis.BMP-4 specifies ventral mesoderm differentiation and inhibits neural induction inXenopus, whereas three molecules secreted from the organizer,noggin, follistatin andchordindorsalize mesoderm and promote neural induction. Here we report thatfollistatin antagonizes the activitiesof BMP-4 in frog embryos and mouse teratocarcinoma cells. InXenopusembryosfollistatin blocks the ventralizing effect ofBMP-4. Inmouse P19 cellsfollistatin promotes neural differentiation.BMP-4antagonizes the action offollistatin and prevents neural differentiation.In addition we show that thefollistatin andBMP-4proteins can interact directly in vitro. These data provide evidence thatfollistatin mightplay a role in modulatingBMP-4 activity in vivo. 1997 Elsevier Science Ireland Ltd.

Keywords:Embryonic development;Xenopus; Mouse;BMP-4; Follistatin; Spemann’s organizer

1. Introduction

The development of the neural system during vertebrateembryogenesis occurs in close temporal and spatial proxi-mity to the events of gastrulation. During gastrulation thethree germ layers arise, the embryonic axes get establishedand the basic body plan is laid down. Although it has beenknown for more than 70 years through the ground-breakingwork of Spemann and Mangold (1924) that the very sameembryonic tissue, the dorsal lip of the early amphibian gas-trula embryo, provides the signals for both dorsal develop-ment and neural induction, the molecular identity of factorsinvolved has remained elusive until recently.

To date the three secreted moleculesfollistatin, nogginandchordin have been identified as potential neural indu-cers. These molecules qualify as neural inducers by virtue oftheir ability to induce neural tissue upon ectopic expressionin the Xenopusanimal cap assay (Lamb et al., 1993; Hem-mati-Brivanlou et al., 1994; Sasai et al., 1995). These indu-cers were required to function in the absence of mesoderm,

which in turn can induce neural structures on its own incompetent ectoderm.noggin, follistatin and chordin areexpressed in the organizer tissue of the early frog gastrula(Smith and Harland, 1992; Hemmati-Brivanlou et al., 1994;Sasai et al., 1994). Fornogginandchordinan additional rolein dorsal development has been proposed based on exten-sive characterization of their dorsalizing activity in gain-of-function experiments inXenopus(Smith and Harland, 1992;Smith et al., 1993; Sasai et al., 1994).

In similar experimentsbone morphogenetic protein(BMP) 4, a member of the TGFb family of secreted growthfactors, has revealed characteristics opposite to the ones ofnoggin, follistatin andchordin. BMP-4 has been shown toexert a potent anti-neuralizing activity (Sasai et al., 1995;Wilson and Hemmati-Brivanlou, 1995) and to ventralizemesoderm (Ko¨ster et al., 1991; Dale et al., 1992; Jones etal., 1992, 1996; Fainsod et al., 1994; Steinbeisser et al.,1995). In the early amphibian gastrulaBMP-4 is expressedin the ventral and lateral marginal zone and in the prospec-tive neuroectoderm of the animal cap region (Fainsod et al.,1994; Schmidt et al., 1995). Recently it was shown thatchordin and noggin can bind toBMP-4 with high affinity(Kd = 320 pM and 19 pM, respectively; Piccolo et al., 1996;

Mechanisms of Development 63 (1997)39–50

0925-4773/97/$17.00 1997ElsevierScienceIrelandLtd. All rights reservedPI I S0925-4773(97)00673-4

* Corresponding author.Tel.: +97226758157; fax: +97226415848;e-mail: fainsod@gene.md.huji.ac.il

Zimmermanet al., 1996).A model has beenproposedbywhich signal transduction throughthe BMP receptorpath-way would lead to ventral and non-neural development,whereasblocking of this signaling by inactivation of theligand BMP throughbinding to chordin andnogginwouldallow neural and dorsal development of the amphibianembryo.

While thepotencyof theneuralandantineuralfactorsinquestion has beendemonstratedconvincingly in gain-of-function studiesin Xenopus, their endogenousembryonicfunction hasnot beenaddressed to the sameextent.Loss-of-function allelesin the mousehavebeencreated by tar-geted mutationsof thegenesencoding follistatin andBMP-4, andof theBMP receptor type I. While follistatin knock-out mice display a number of defects in tissuessuch asmuscle, skeleton,skin, teethandwhiskers, a neuralpheno-typewasnotdetected(Matzuk et al., 1995).Lossof BMP-4function in themouseresultedin embryoniclethalityduringgastrulationor earlyneurulation, with developmental retar-dation, disorganized posteriorstructures and reductionofextraembryonicmesoderm (Winnieret al., 1995).Theinac-tivation of the BMP receptor type I led to defectsandleth-ality atearlygastrulastagesandalack of mesodermal tissuein affectedembryos, suggesting anessential role for BMP-mediated signal transduction at this stageof development(Mishina et al., 1995).

In thepresentpaperwehavestudied theroleof follistatinin dorsaldevelopmentof theXenopusembryo andin neuralinduction in themouse system. In addition,we haveinves-tigated the functional antagonism between follistatin andBMP-4 in these processes. We show that thesesecretedfactors canbind to eachotherdirectly in vitro, suggestingthat the dorsalizing and neuralizing functions of noggin,follistatin andchordin aremediatedby thesamemolecularmechanism, theinactivationof theBMPsignaling pathway.

2. Results

2.1. follistatin as a dorsal gene

follistatin hasbeenshown to beexpressed in thedorsallipof the blastoporein Xenopusembryosat the onsetof gas-trulation (stage10–10.5). As developmentproceeds,cellsalong the dorsal midline in the invaginating mesodermalsheetcontinueto express follistatin transcripts (Hemmati-Brivanlou et al., 1994).The localization of follistatin tran-scriptssuggests thatthisgenemayhaveadorsal function inthe Xenopusembryo, in addition to its known role as aneural inducer.Sasaietal. (1995)haveshown thatfollistatinis ableto dorsalize Xenopusembryosuponinjection of syn-thetic RNA at the eight-cell stage.To obtaina quantitativeestimateof the extentof dorsalizationinducedby differentconcentrationsof follistatin the dorso-anterior index (DAI;Kao andElinson,1988)of embryosinjectedat thefour-cellstagewasdetermined.TheDAI valuesobservedwere6.8,7

and 7.4 for embryosinjected with 400, 800 and 1200 pgRNA, respectively, whereas control embryos exhibitedthenormalDAI valueof 5 (Fig. 1).

To furtherdetermineapossible involvementof follistatinin dorsaldevelopmentweanalyzedits expression patterninembryosdorsalizedby LiCl-treatment or ventralized byUV-irradiation. Embryoswere fixed at stage10.5–11 andprocessed for in situ hybridization with a follistatin-specificprobe.In dorsalized embryos follistatin becameexpressedthroughoutthe blastopore (Fig. 2C), in agreement with theacquired dorsalcharacteristicsof themarginal zone.In con-trast, ventralization of the embryo was accompanied by adown-regulation of follistatin transcripts(Fig. 2B). Theseobservationsshowedthatfollistatin behaved like other orga-nizer-specific geneswhoseexpression profile changedinaccordance with fatechangesof theprospective mesodermin the marginal zone.To determine whether the expandedfollistatin expression plays a role in the dorsalizedpheno-typeof LiCl- treatedembryosa rescueexperimentwasper-formed. In orderto inducea partial loss-of-functionof thisgene,antisense follistatin RNA (Steinbeisseret al., 1995)was injected into LiCl-tr eatedembryos. For quantitativeanalysisthe DAI of treated and/or injected embryos wasdetermined. Control embryostreated with LiCl exhibitedaDAI valueof 8.6,asevidenced by enlarged headstructuresand the lack of axial trunk structures(Fig. 2D). Antisensefollistatin RNA injection resulted in rescueof axial trunkdevelopment (DAI = 6.2; Fig. 3E). Theseresults showthatfollistatin is in partresponsible for thedorsalizedphenotypeof Li-treatedembryos,andthat this genemayplay a role indorsaldevelopmentof normalembryos.

2.2. follistatin as part of the dorsal-ventral patterningsystem

Injectionsof folli statinmRNA or antisenseRNA showedthat this genewasableto promote dorsal development.Toinvestigate this effect at the molecular level we analyzedwhether thedorsalization inducedby follistatin wasaccom-paniedby expansion or up-regulationof other dorsal-speci-fic genes. Two geneswerechosen for this analysis,gscandXnot-2, becausein addition to their dorsal-specificexpres-sion patternthey havebeenshownto be repressed by theventralizing signal,BMP-4 (von Dassowet al., 1993;Fain-sodetal., 1994;Steinbeisseretal., 1995).Embryosinjectedwith follistatin mRNA and processedfor whole mount insitu hybridizationshowed a clear expansion of the gscandXnot-2 expressiondomains(Fig. 3A,B,D,E). When anti-senseBMP-4 was injectedto createa partial loss-of-func-tion for thisventralizing signalthesameresultwasobtained(not shown). This indicatesthat follistatin asa dorsalgenecan promote the expressionof other organizer-specificgenes,which is a functionopposite to thatof theventraliz-ing growth factor BMP-4.

As a next step we testedwhether the reversecorrelationalsotakes place,namely if overexpressionof anorganizer-

40 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

Fig. 1. Dose-dependentdorsalization of Xenopusembryosby follistatin. Xenopusembryosat the four-cell stagewereinjectedin all four blastomereswitheitherprolactin (A) or with differentamountsof follistatin (B–D) mRNA. Theamountof follistatin senseRNA injected(pg/embryo)is markedin thelowerright corner(B, 400 pg/embryo;C, 800 pg/embryo;D, 1200pg/embryo).

Fig. 2. follistatin is involved in thedorsalization of Xenopusembryos.The follistatin patternof expressionwasdeterminedduringgastrulation in dorsalizedandventralizedembryosby wholemountin situhybridization.(A) Controluntreatedembryoexhibitingthenormalfollistatin expressionin thedorsallip. (B)Embryoventralizedby UV-irradiationwhich resultsin thedown-regulation of follistatin expression.(C) Dorsalizationof embryosinducedby LiCl resultedin theexpansion of follistatin expressionthroughouttheblastopore region.Supportfor a role of follistatin in dorsaldevelopmentwasobtainedby rescueofLiCl-treatedembryos.(D) Control embryostreatedwith LiCl to inducea dorsalizationto a DAI of about7.5. (E) Injection of follistatin antisenseRNA inLiCl-treatedembryosresultedin the rescueof axial structures.

41A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

specific geneleadsto theup-regulationof follistatin expres-sion. To that end we injected gsc mRNA into Xenopusembryosanddeterminedits effecton follistatin expression.Surprisingly, overexpressionof gsc prevented the follista-tin-expressingcells from invaginatingwith themesodermalsheet(Fig. 3C,F).As expected,overexpressionof the ven-tral gene BMP-4 repressed follistatin expression (notshown).

Previousanalysisof thefollistatin expressionpatterncon-cluded that at later gastrula stagesits transcripts are loca-lized to partof theprechordalplate(Hemmati-Brivanlou etal., 1994).Our in situ hybridization analysisshowedthatat

mid to lategastrulation, follistatin-positivecells canstill beobservedneartheblastoporeregionsuggesting that the fol-listatin andgscregionsof expressionalongthedorsalmid-line do not overlap. In situ hybridizationswereperformedon stage-matchedembryoswith probesfor bothgenes. Theresults further supported the observationthat follistatin-positivecells invaginateafter the gsc-expressingcells (notshown). Further support for this result was obtained byhybridizing thick horizontal sections (100 mm) of stage13embryoswith probes for both genes.Fig. 3G shows thatalong the dorsal midline gsc expression is more rostral(red) than that of follistatin (blue) which it borders

Fig. 3. Regulatoryinteractionsbetweenorganizer-specific genes.The interactionsbetweengeneswere studiedby in situ hybridization and RT-PCRofembryosinjectedwith different RNAs. gsc (A,D) and Xnot-2 (B,E) exhibitedexpansionin their expressiondomainsin embryosinjectedwith follistatinmRNA (D,E) ascomparedto prolactin injectedcontrol embryos(A,B). Injection of gscmRNA (F) preventedfollistatin-positivecells from invaginatingwhencomparedto control (prolactin)-injectedembryos(C). (G) Doublein situ hybridization with gsc(red)andfollistatin (blue).Dorsalview of anembryo(stage13) that showsthe extentof overlapin the expressionpatternsof thesetwo genes.blp, blastopore;DML, dorsalmidline; pp, prechordalplate.Aquantitativedeterminationof the interactionsbetweenmarginalzone-specific geneswasperformedby RT-PCR(H). The injectedRNAs aremarkedabovethe different lanes.The primersutilized for the different PCRreactionsaremarkedbelow the bands.HistoneH4 wasusedasa loadingcontrol.

42 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

caudally. follistatin expressionextendstowardsthe poster-ior endof the embryo. Theseobservations suggest that thefollistatin andgscexpression regions arenon-overlapping.

For a more quantitative analysis of the interactionsobserved by in situ hybridization, injected embryos wereprocessedfor RT-PCRfollowing RNA extraction. HistoneH4 RNA wasutilized asa loading control. As observed inthein situhybridizationanalysis,gscexpressionbecameup-regulated when follistatin was overexpressedor a partialloss-of-function of BMP-4 was induced (Fig. 3H). Bothdorsal-specific genes, gsc and follistatin, were able todown-regulate BMP-4 mRNA expression,in line with thedorsal-ventral antagonismdescribed before(Fig. 3H). Theregulation of follistatin itself, however, turned out to bemore complicated. BMP-4 overexpressionresulted in therepression of follistatin mRNA accumulation. On theother handgsc did not affect the level of follistatin tran-scripts (Fig. 3H). This observation is in line with thedoublein situ hybridizationwhich showedthatgsc- andfollistatin-expressing cells during invagination form two separatepopulationsthatdo not mix. Theobservation thatgscover-expressionpreventsfollistatin-positive cells from invaginat-ing further supports this suggestion.

2.3. follistatin as a neural inducer in P19 cells

Analysis of the role of follistatin during mousedevelop-ment hasbeenhampered becauseof the lack of a neuralphenotypeandthe relatively mild defectsof mesodermallyderived structures in mutant mice createdby a targetedmutation (Matzuk et al., 1995).In orderto assesstheinvol-vementof follistatin in neuraldevelopmentweturnedto the

embryonal carcinoma cell line P19. These cells do notdifferentiate spontaneously but can be triggered to do soby aggregationand treatment with specific chemical indu-cers,whereretinoicacid at 0.3mM inducesneural differen-tiation. Following the standard differentiation protocol(Rudnicki andMcBurney,1987)we analyzedthe temporalpatternof follistatin expressionon Northern blots.Neuronalinduction,which wasevidentmorphologically at aboutday6 of theexperiment,wasaccompaniedby a fastandstronginduction of follistatin expression(Fig. 4). In control cul-turesthat wereaggregated andtreated with ethanol, whichservedasthesolventfor retinoicacid, aweakinductionwasobservedstarting on day 5 (Fig. 4) which probablyreflectsinduction of neural differentiation by the aggregation pro-cess.

To test if follistatin can induceneural differentiation onits own, a Xenopusfolli statin expressionconstruct, undercontrol of the CMV promoter,was stably transfected intoP19 cell cultures. Untreated P19 cells and cultures trans-fected with the expression vector (pRC/CMV) servedascontrols. In theseexperiments cells were not aggregatedand no inducerswere applied. To enrich for postmitoticneuronalcell types follistatin transfectedcultureswereaddi-tionally selectedwith cytosinearabinoside(seeSection 4 fordetails). In keeping with its known role asa neuralinducerin Xenopus, follistatin expressionwas sufficient to induceneuraldifferentiation in P19 cells (Fig. 5C). This processwascharacterizedby cell morphology (Fig. 5) andby stain-ing with antibodiesspecificfor theneuronal markerneuro-filament(NF)-M (Fig. 5C), the pan-neural markerN-CAM(not shown) andthe glia markerglial fibrillary acidic pro-tein (not shown). Untransfected P19 cells (Fig. 5A) and

Fig. 4. follistatin mRNA is expressedin neuralinducedP19cells.Northern blot analysisof P19cells inducedtowardsneuraldifferentiation by aggregationandtheadditionof 0.3mM retinoicacid.Controlculturesweretreatedsimilarly with ethanolwhichservedasthesolventfor retinoicacid.RNA sampleswerepreparedat 24 h intervalsfor a total of 10 days.glyceraldehyde-3-phosphate-dehydrogenase(GAPDH) wasusedasa loadingcontrol.

43A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

vector transfectedcells (Fig. 5B) did not differentiate intoneuralcell typesunderthese conditions.

2.4. The antagonismbetween follistatin and BMP-4

Theexperimentspresenteddemonstratetheroleof follis-tatin in dorsal development of the frog Xenopusand inneural induction in mouseembryonal carcinoma cells. InXenopusembryosBMP-4 representsa growth factor thatcounteracts both theseprocessesby ventralizing the meso-derm and inhibiting neural induction. We therefore testedthe possibility of a functional antagonism of these twosecretedfactors.

To analyze the interplayof follistatin andBMP-4duringdorsaldevelopment,RNA microinjectionexperiments intoXenopusfour-cell embryos were performed. Injection ofBMP-4 mRNA (1200pg/embryo) resulted in stronglyven-tralized embryos(DAI = 0.78; n = 40; Fig. 6B). Injectionof BMP-4 (1200 pg/embryo) together with follistatinmRNA (800 pg/embryo) resulted in the complete rescueof the BMP-4 effects as evidenced from a DAI value of5.26 (n = 56; Fig. 6C). The DAI of embryos injectedwith800 pg follistatin RNA alone was in the order of 7. Thelower valuesobtained in embryos co-injected with BMP-4suggestantagonistic activities betweenthesetwo overex-pressedproteins.Furtherincreasein theamount of follista-tin mRNA to 1600pg/embryoresultedin a dorsalization ofthe co-injectedembryos(DAI = 6.35; n = 23; not shown).Controlembryosincluding uninjectedembryosandprolac-tin-injected embryos (1600pg/embryo;Fig. 6A) gaveDAIvaluesof 5 (n = 82) and4.93(n = 44), respectively.Theseexperiments demonstrate that follistatin and BMP-4 canantagonizeeachotheruponectopicoverexpressionin vivo.

44 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

To assessthe interaction of BMP-4andfollistatin duringneural induction, recombinanthuman(rh) BMP-4 proteinwasaddedto P19cell culturesstably expressing follistatin.Theneural-inducingactivity of follistatin wasquantitativelyantagonizedby addition of rhBMP-4 protein at concentra-tions.10 ng/ml (not shown). At themolecular level, addi-tion of rhBMP-4 resulted in thedose-dependentreductionofN-CAM RNA expressionin P19monolayer culturesstablyexpressingXenopusfollistatin. RT-PCR analysisrevealedareduction to backgroundlevelsafter8 daysof culturein thepresenceof 20 ng/ml rhBMP-4 (Fig. 6D). Control culturestransfected with the expressionvector pRC/CMV andgrown underidenticalconditionswith andwithout theaddi-tion of rhBMP-4 did notreveal anyN-CAM RNA expression(not shown).Theseexperimentsindicatea role of follistatinin neuraldifferentiation of P19cells. Takentogether, thesedatasuggest a functional antagonism between BMP-4 andfollistatin during mesodermal and neural development inXenopusandmouseP19teratocarcinomacells.

2.5. Direct binding betweenfollistatin and BMP-4

Mechanistically, the antagonismbetweenfolli statin andBMP-4 could be due to alterationsat the transcriptionallevel or to a direct protein–protein interaction of the twosecreted proteins.In the caseof BMP-4 an effect on thetranscription rate of follistatin could be mediated by thedownstreamsignaling cascade(Massague, 1996). For thereverse interaction, transcriptional regulation of BMP-4through a follistatin-mediated dorsal-specific signalingpathway seemsunlikely as no experimental evidenceforfollistatin function through a receptor has beenobtainedasyet. On theotherhand,themolecularanalysispresentedin Fig. 3 clearly showsthatfollistatin repressesBMP-4 tran-scription. This apparent paradox could be resolved, how-ever, if one would assumea direct interaction of the twoproteins. In such a scenario the BMP-4 transcriptionalrepressionwould be an indirect effect of the extracellularbinding of follistatin to BMP-4 that would prevent BMP-4from positively regulatingits own transcription (Daleet al.,1992; Shapira and Fainsod,unpublished observations). Adirect interactionof follistatin andBMP-4seems conceiva-ble,particularly asfollistatin inhibits thefunctionof anothermember of theTGFb family, activin, by sucha mechanism(Nakamuraet al., 1990).

To investigate a possible direct interaction betweenfol-listatin andBMP-4 we performedin vitro binding studies.To that end the Xenopusfollistatin protein (Hemmati-Bri-vanlouetal.,1994)wastaggedusing amycepitope(Evanetal., 1985) and expressed under the control of the CMVpromoter in human kidney 293 cells. Serum-free condi-tioned medium from these cultures was incubated withrhBMP-4 protein, followed by immunoprecipitation withanti-myc antibodies. The precipitated proteins were sepa-ratedonpolyacrylamidegelsundernon-reducingconditionsand analyzed by immunoblotting with a monoclonal anti-BMP-4antibody(Masuharaetal.,1995).A bandidenticalinsize to the recombinant BMP-4 protein and migrating aspreviously described (Masuhara et al., 1995) was onlydetectedin samples that contained the follistatin-myc pro-tein (Fig. 7). No BMP-4specific bandwasseenwhen con-ditioned media from vector-transfected cells (Fig. 7) orwhen protein extractswere prepared from the transfectedcells(Fig. 7). Whenuntaggedfollistatin wastransfectedandbindingreactionswereprecipitatedwith amousepolyclonalfollistatin antibodya weakbandof thecorrectsizewasalsodetected(Fig. 7). The weakbandwasattributed to the lowactivity of the anti-follistatin antibody. Theseco-precipita-tion experimentsshowthat BMP-4 and follistatin proteinscaninteract directly in vitro.

3. Discussion

3.1. follistatin as an organizergene

Themainfunctionsof thegastrulaorganizer(Spemann’sorganizer, Hensen’snode)aretheformation of dorsal/med-ial typesof mesodermsuchasnotochord, the dorsalizationof paraxial mesodermandthesecretionof signals that trig-ger neural induction. In previouswork it was shown thatfollistatin can induce neural differentiation without arequirement for mesoderm (Hemmati-Brivanlou et al.,1994; Sasaiet al., 1995). Theseexperiments establishedfollistatin asa direct neural inducer capable of performingsomeof the functionsattributed to theorganizer or its des-cendants.

In the present work we haveshownthat follistatin over-expressioncaninduceadose-dependentdorsalizationof theXenopus embryo. In addition, its expression becomes

Fig. 5. follistatin inducesneuraldifferentiation in P19cells. follistatin expressionresultedin neuraldifferentiation of uninducedP19cells. Cultureswerestainedfor the neuron-specific marker neurofilament(NF)-M. P19 cells were cultured as untreatedmonolayers (A), stably transfected with a controlexpressionvector,pRC/CMV (B), or a Xenopusfollistatin expressionconstructpRC/CMV-XFS (C).

Fig. 6. follistatin andBMP-4 provideantagonisticsignalsduringembryogenesisandneuraldifferentiation. The antagonismbetweenBMP-4 and follistatinwasstudiedin Xenopusembryos(A–C) andduringneuralinductionin P19cells (D). Xenopusembryoswereinjectedin all four blastomeresat thefour-cellstage.(A) Control embryosinjectedwith 1600pg of prolactin mRNA. (B) Embryosinjectedwith 1200pg BMP-4 mRNA exhibiteda strongventralizedphenotype.(C) Co-injection of a mixture of mRNAs containing1200pg BMP-4 RNA and800 pg follistatin RNA resultedin completerescueof normaldevelopment.Addition of rhBMP-4to theculturemediumresultedin inhibition of follistatin-mediatedneuraldifferentiation (D). follistatin-expressing P19cells (pRC/CMV-XFS) weretreatedwith increasingamountsof rhBMP-4andneuraldifferentiation wasmonitoredafter8 daysby RT-PCRusingN-CAM-specificprimers.

45A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

expandedthroughoutthemarginalzonewhenthefateof themesoderm is dorsalizedby a different treatment such asLiCl. Partial loss-of-function of follistatin by antisenseRNA injection into LiCl dorsalizedembryosshowed thatthis activity wasnecessaryfor thedorsalized phenotype.Atthe molecular level, follistatin not only induced the dorsa-lization of the embryobut promoted the expansion of theexpressiondomains of other organizer-specific genessuchasgscandXnot-2. All theseresultstakentogethershowthatfollistatin canmediate in part the dorsal identity of meso-derm in the embryo.Two other secretedproteins, nogginandchordin arealso localized in the organizer regionandare able to mediate most organizer functions (Smith andHarland, 1992; Lamb et al., 1993; Smith et al., 1993;Sasaiet al., 1994; Sasai et al., 1995). All three proteinsbelong to different families of proteinsbut they candorsa-lize mesoderm and induce neural differentiation in theabsence of mesoderm. This observation suggests thatfollistatin, noggin and chordin are part of the organizersignaling network which is needed to generate a completeorganizer.

3.2. follistatin as an antagonist of BMP-4

BMP-4 hasbeenshownto play an importantrole in thespatial restriction of theorganizer activity. This member oftheTGFb family providesastrongventralizingsignalin theembryo (Dale et al., 1992; Joneset al., 1992;Joneset al.,1996). It canprevent theformation of a fully activeorgani-zerwheninjectedin its vicinity by repressingtheactivity oforganizer-specific genes(von Dassowet al., 1993;Fainsod

et al., 1994;Steinbeisseret al., 1995).BMP-4hasalsobeenshownto prevent neuralinductionin animalcapassaysandto promote epidermaldevelopment(Sasaiet al., 1995;Wil-sonandHemmati-Brivanlou,1995;Xu et al., 1995).There-fore, BMP-4 also antagonizes both organizer functions,dorsalization of themesoderm andneuralinduction. In ani-mal capassays,BMP-4 proved to beanefficientantagonistof both noggin and chordin (Re’em-Kalma et al., 1995;Sasaiet al., 1995).

To testtheantagonismbetweenfollistatin andBMP-4weusedthewholeembryoventralizedby ectopically expressedBMP-4asthetestsystem. Overexpression of follistatin veryefficiently prevented the ventralizing activity of BMP-4.Injection of higher amountsof follistatin mRNA resultedin further dorsalization of the embryos,suggesting that theendogenousBMP-4 protein wasalso antagonized.Furthersupportfor theexistenceof suchanantagonismin vivo wasobtained in tissueculture. It hasbeenknown for some timethat in F9 embryonal carcinoma cells prior to differentia-tion, BMP-4 is expressed.Induction of differentiation intoparietal endoderm by a combination of retinoic acid andcAMP results in an 11–12-fold increase and decreaseofBMP-2 and BMP-4, respectively (Rogerset al., 1992). Inthis study the P19 cell line was chosen because it can beinducedto differentiateinto neural cellswith highefficiencyby retinoic acid treatment. Concomitant with the neuralinduction, follistatin mRNA expressionwas inducedpro-viding evidencefor a role of follistatin in neuralinductionin mouse embryonal carcinoma cells. More directly, over-expressionof follistatin in P19cellswassufficient to inducetheir differentiation without theneedfor aggregationand/or

Fig. 7. Direct interactionbetweenfollistatin andBMP-4proteins.Co-precipitation of BMP-4andfollistatin. Conditionedmediumor cell extractsfrom cellstransfectedeitherwith plasmidvector (pCDNA3), a Xenopusfollistatin expressionvectoror a myc-tagged follistatin expressionvectorweresubjectedtobindingwith BMP-4. Thecomplexwasimmunoprecipitatedwith anti-mycor anti-follistatin-specificantibodies,separatedon non-reducingpolyacrylamidegelsandanalyzedby immunoblotting with anti-BMP-4 monoclonalantibodies.The positionof rhBMP-4 proteinon the gel is markedby an arrow.

46 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

retinoic acid. In the light of the known neural-inducingactivity of follistatin in Xenopusthese results raisethepos-sibility that follistatin may play a role in neurulation in themouse as well. In embryonal carcinoma cells the neural-inducing activity of follistatin could beblockedby theaddi-tion of BMP-4proteinto theculturemedium. Regardlessofthe function of follistatin in the induction of neural differ-entiation of P19 cells, BMP-4 could efficiently block thisinduction andtheexpressionof neural markerslike N-CAM,further demonstrating the antagonism between thesetwoproteins.Supportfor theseobservationscomesfrom experi-ments whereit wasshownthat follistatin efficiently antag-onizes BMP-7, another member of the BMP family(Yamashitaet al., 1995).

3.3. Themodeof action of follistatin

follistatin was initially identified as an activin-bindingprotein which prevents the interaction of this growth factorwith its receptor (Nakamuraet al., 1990).Therefore, follis-tatin wasknownasaprotein capable of bindingto somebutnot all members of the TGFb family (Nakamura et al.,1990). Because BMP-4, like activin, is a member of theTGFb family it wasvery tempting to suggest thattheantag-onism between follistatin and BMP-4 was achievedbydirect interactionbetweenthesetwo proteins.Immunopre-cipitationexperimentsrevealedthatBMP-4 wasco-precipi-tated together with follistatin following binding in vitro.This modeof actionof follistatin suggeststhat theantagon-ismobservedin Xenopusembryoscould beachievedin vivoby binding to BMP-4. As a consequence,signalingthroughthe BMP receptorswould be inhibited, ventralization andepidermaldifferentiationwould bepreventedandneuraliza-tion anddorsalization could occur.In thecaseof P19cells,the overexpressedfollistatin would interact with a BMPprotein that prevents the embryonal carcinoma cells fromundergoing differentiation. To corroboratethat the role offollistatin in neural induction is mediatedthroughthe inhi-bition of BMPsignaling,cellsweretransfectedwith adomi-nantnegative BMP receptor. Introduction of this receptor,whichcanmediatesignalingof severalBMPproteins(Mas-sague, 1996), induced neural differentiation of P19 cellswithout further treatment (Deißler and Blum, unpublishedresults). This experiment suggests that a member of theBMP family helpsmaintain the P19 embryonal carcinomacells in their undifferentiated state. Further support for thissuggestion comesfrom theobservationthattheendogenousfollistatin geneis strongly activated in P19 cells with theinduction of differentiation. To identify the prospectiveBMP in the undifferentiated cells a screen by RT-PCRwasperformedfor BMP-4, BMP-2andBMP-7. Theresultsshowed that BMP-2 and BMP-7 were highly expressedinundifferentiatedP19cells whereasBMP-4RNA levelswereat thedetectionlimit (DeißlerandBlum, unpublishedobser-vations). As follistatin hasbeenshown to antagonizeBMP-7in theembryo (Yamashitaet al., 1995),andbecauseof high

identity between the BMP proteins(Hogan,1996)and thespecificityof theBMP receptor we concludethat thedomi-nant negative BMP receptor prevents signaling of theseBMP proteins. It seemslikely that follistatin can bind toBMP-2 and/orBMP-7 aswell, andthat an excess of BMP-4 canpreventthis interaction.

3.4. The organizer as an antagonist of BMP-4: a model

In the XenopusembryoBMP-4 is expressedduring gas-trulationalong themarginalzoneandin theanimalcap.Theonly regionwhereBMP-4 transcripts areabsentis theorga-nizer region itself (Fainsodet al., 1994; Schmidt et al.,1995). This localization is in perfect agreement with theactivities attributed to this gene.Although somematernalBMP-4 transcripts havebeendetected (Dale et al., 1992;Joneset al., 1992)a main surgein expressionof this genetakesplace with the onsetof gastrulation (Fainsodet al.,1994).Experimentaltreatmentsthatresultin theventraliza-tion of the embryo,UV-irradiation or suramin treatment,result in the precociousactivation of BMP-4 transcription(Fainsodet al., 1994).The capability of BMP-4 to repressdorsal-specific genessuggeststhatthe1 h delayin transcrip-tional activation of BMP-4 as comparedto the organizer-specificgenesallows their unencumberedexpressionat theonsetof gastrulation.

Togetherwith follistatin, three organizer proteins havebeenidentifiedwhosebiochemicalfunction is to sequesterBMP proteinsandprevent signalingthroughtheir receptors(Piccolo et al., 1996; Zimmerman et al., 1996). All threegeneschordin, follistatin andnoggin canperform themainactivities attributed to the organizer and its derivatives(Smith andHarland,1992;Lamb et al., 1993;Smith et al.,1993; Hemmati-Brivanlou et al., 1994; Sasaiet al., 1994;Sasaiet al., 1995). Transcripts of all threegenesappear inthe organizer region just prior to the onsetof gastrulationandtheir transcripts continuefor some time to be localizedin the invaginating dorsalmidline mesoderm. This patternof expressionsuggests that they canperformthe mesoder-mal patterningfunction in the dorsal lip of the blastoporebefore cells invaginate. As gastrulation proceeds and thecells of the dorsal mesoderm involute, thesesecreted pro-teinscanperformtheir neural-inducing function.

Theneural inducerhasbeenproposedto besecretedfromthedorsalmesodermal cells andto actupontheoverlayinganimalcap.As developmentproceedstranscriptsof all threegenestakedifferentpositionsalong thedorsalmidline, thusgenerating partially overlapping patterns of expression.Comparison of the dissociation constantsfor BMPs andtheir receptors(Kd = 35–250pM; Koeniget al., 1994;Iwa-sakietal.,1995),nogginandBMP-4(Kd = 20pM; Zimmer-man et al., 1996), chordin and BMP-4 (Kd = 300 pM;Piccoloet al., 1996)andactivin and follistatin (Kd = 1.3–200pM; Nakamuraet al., 1990;Schneyer et al., 1994) sug-gestsa pictureof high affinity interactions.If theaffinity offollistatin to BMP-4 is in thesamerangeasthat for activin

47A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

thenall threeorganizer geneswill bind BMP-4with similaraffinities andmore comparative studies will be required tounderstand the differencesand synergism betweentheseproteins.In this light thelossof function studiesfor nogginandfollistatin in themousehaveto beinterpreted.Thelackof a neural phenotypein follistatin null mice might becaused by the presence of chordin and noggin whichcould partially compensate the defect.

Al though expression of BMP-7 and BMP-2 can bedetected in the embryo (Clement et al., 1995; Hawley etal., 1995; Hemmati-Brivanlou and Thomsen, 1995; Stein-beisser and Fainsod,unpublished observations) it appearsthat all threeBMP binding factors are mainly functioningagainstBMP-4asthismember of theTGFb family seemstobeoneof themain signalsopposed to theorganizer. In theprocess of neural induction BMP-7 transcripts can bedetected in the animal cap region (Hawley et al., 1995;Steinbeisser and Fainsod, unpublished observations).BMP-7 also playsa role in preventingneural differentiationasshown by dominant negative BMP-7constructs (Hawleyet al., 1995). The BMP proteins have beenshown to becapable of forming homo- andheterodimerswith differentbiologicalproperties(Aonoetal.,1995).Therefore,someoftheactivitiesof theBMP bindingproteins,follistatin, chor-din andnoggin, might not bedirectedsolelyagainstBMP-4but againstother BMPs aswell.

4. Experimental procedures

4.1. RNA preparation and injection

CappedRNA for injection wasprepared usingthe CAPScribe (Boehringer) or RiboMax (Promega) kits asdescribed (Fainsod et al., 1994; Steinbeisseret al., 1995).The cap analog/GTP ratio usedwas 5:1. Injections wereperformedat the four-cell stageby injecting about4 nl ineachblastomere in the equatorialregion.

4.2. Wholemountin situ hybridization

Digoxigenin-labelled RNA probesweretranscribedusingtheRiboMaxkit (Promega)utilizi ng theRNA labellingmix(Boehringer). Localizationof transcripts by in situ hybridi-zation wasperformedasdescribed(Fainsodet al., 1994).

4.3. RT-PCR analysis

RNA from embryoswaspreparedby thephenol/guanidi-nium thiocyanatemethodusingtheTriPure reagent (Boeh-ringer).RT-PCR wasperformedasdescribedby Fainsodetal. (1994). The primers usedwere: BMP-4, 5′ GCATG-TAAGGATAAGTCGATC and 5′ GATCTCAGACTCA-ACGGCAC resultingin a 478bp fragmentafter23 cycles;gsc, 5′ GGAGAGGACTGCAGTCTGCATG and5′ TCTA-GAGTCGACTCAACTCTGCAGCTCAGTCCTGGA re-

sulting in a 590 BP fragment after 31 cycles;follistatin, 5′CAGTGCAGCGCTGGAAAG and5′ TGCGTTGCGGTA-ATTCAC resulting in a 229 bp fragmentafter 31 cycles;histoneH4, 5′ CGGGATAACATTCAGGGTATCACT and5′ ATCCATGGCGGTAACTGTCTTCTT resulting in a188 bp product after 19 cycles; N-CAM, 5′ ATTCTT-CCTGTGTCAAGTGG and 5′ TTGTTGGACAGGAC-TATGAAC, resultingin a 404 bp productafter 32 cycles;HPRT, 5′ GCTGGTGAAAAGGACCTCT and5′ CACAG-GACTAGAACACCTGC, resulting in a 249 bp productafter28 cycles.Quantitationwasperformedon a Phosphoi-mager(Fuji) andtheresultswere normalizedto thelevel ofhistoneH4 andHPRTtranscripts,for analysisof embryonicandP19 cell RNA, respectively.

4.4. Axis perturbation

UV-treatmentof embryoswasperformed30min afterthefertilization by placing the embryos in 1 × modifiedBarth’s solution on quartzslides.Embryos were irradiatedfor 60 s usinga GL 25 lamp(UVP). Theembryoswerenotmovedfor 1 h after theUV-treatment. To achievea partial-Li treatmentembryosat the32-cell stagewereincubatedfor20 min in a solution of 120 mM LiCl in 0.1 × Barth’ssolution. After the treatment the embryos were washedtwice in 0.1 × Barth’s andthenincubatedin thesamesolu-tion at roomtemperature.Fora full LiCl treatmenttheincu-bationtime wasextendedto 35 min (Fainsodet al., 1994).

4.5. P19 culture conditionsand treatments

P19cells were culturedin DMEM with the addition of10% fetal bovine serum.The differentiation protocol intoneuralcell typesusing retinoic acid as an inducer was asdescribed in Rudnicki andMcBurney (1987).For transfec-tion 107 cellswereelectroporatedwith 50mg plasmid DNA,and replated on gelatin-coated glass slides which wereplacedin tissueculture dishes (5 × 105 cells/10cm dish).Themediumwaschangedevery otherday;G418selection(400 mg/ml) was started after 48 h, cytosine arabinosideselection(5 mg/ml) 72 h after transfection. rhBMP-4 wasaddedto the medium at the indicatedconcentrationsandwas present for the entire culture period. After 10–14dayscellswerefixedfor immunohistochemistry andstainedwith antibodiesfollowing standard protocols.

4.6. Follistatin-myc/BMP-4 immunoprecipitation andimmunodetection

Themycepitopesequencerecognizedby the9E10mono-clonal antibody(Evanet al., 1985)wasaddedto the follis-tatin cDNA by polymerasechain reaction.The follistatincDNA was amplified with primers that add the mycsequenceEQKLISEEDL at the carboxy terminal end ofthe protein sequence.The myc-taggedfollistatin was sub-cloned into an eukaryotic expression vector (pCDNA3;

48 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

Invitrogen)andtransiently transfected into 293 cells usingDOTAP (Boehringer) under the conditionsrecommendedby the manufacturer. Conditioned medium (DMEM withno serum) collected from the secondto the fourth dayafter transfection was concentrated five-fold in a centri-con-10 unit (Amicon) was utilized as a sourceof follista-tin-myc. Binding reactions between rhBMP-4 (200 ng;Genetics institute, Cambridge, MA) and follistatin-myc(30 ml) were carried out in binding buffer (136.9 mMNaCl, 5.37 mM KCl, 1.26 mM CaCl2, 0.64 mM MgSO4,0.34mM Na2HPO4, 0.44mM KH2PO4, 0.49mM MgCl2, 25mM HEPES,0.5%BSA; Graff etal.,1994)for 1.5h atroomtemperature and then followed by immunoprecipitationunder standardconditions using anti-myc (9E10) ascitesfluid (1 ml) and protein A-agarose(Sigma). The immuno-precipitate was subjected to immunodetection with anti-BMP-4 following electrophoretic separation under non-reducing conditions and transfer to nitrocellulose mem-branes. Detection of BMP-4 was performed with ECL(Amersham)following the manufacturer’s conditions.

Acknowledgements

We thank E. De Robertis andY. Sasaifor the follistatinclone,D. Melton for theBMP receptor clones,K. Masuharafor theBMP-4antibodyandGeneticsInstitutefor recombi-nanthumanBMP-4protein.Wealsothank J.Yisraeli andE.Shapirafor advice.This work wassupported in part by theCouncil for TobaccoResearch, USA to A.F.

References

Aono, A., Hazana,M., Notoya,K., Taketomi,S.,Yamasaki,H., Tsukuda,R., Sasaki,S. and Fijusawa,Y. (1995) Potentectopic bone-inducingactivity of bonemorphogeneticprotein-4/7heterodimer. Biochem.Bio-phys.Res.Commun.210,670–677.

Clement,J.H.,Fettes,P.,Knochel,S.,Lef, J.andKnochel,W. (1995)Bonemorphogenetic protein 2 in the early developmentof Xenopuslaevis.Mech.Dev. 52, 357–370.

Dale, L., Howes,G., Price,B.M.J. andSmith, J.C.(1992)Bonemorpho-geneticprotein 4: a ventralizingfactor in early Xenopusdevelopment.Development 115,573–585.

Evan,G.I., Lewis, G.K., Ramsey,G. andBishop,J.M. (1985)Isolationofmonoclonalantibodiesspecific for humanc-myc proto-oncogenepro-duct.Mol. Cell. Biol. 5, 3610–3616.

Fainsod,A., Steinbeisser, H. andDeRobertis,E.M. (1994)Onthefunctionof BMP-4 in patterning the marginal zone of the Xenopusembryo.EMBO J. 13, 5015–5025.

Graff, J.M., Thies,R.S.,Song,J.J.,Celeste,A.J. andMelton, D.A. (1994)Studieswith a XenopusBMP receptorsuggestthat ventral mesoderm-inducing signals override dorsal signals in vivo. Cell 79, 169–179.

Hawley, S.H.B., Wunnenberg-Stapleton, K., Hashimoto, C., Laurent,M.N., Watabe,T., Blumberg,B.W. andCho,K.W.Y. (1995)Disruptionof BMP signalsin embryonicXenopusectodermleadsto direct neuralinduction. GenesDev. 9, 2923–2935.

Hemmati-Brivanlou, A. and Thomsen, G.H. (1995) Ventral mesodermalpatterningin Xenopusembryos:expressionpatternsand activities ofBMP-2 andBMP-4. Dev. Genet.17, 78–89.

Hemmati-Brivanlou, A., Kelly, O.G. andMelton, D.A. (1994)Follistatin,an antagonistof activin, is expressedin the SpemannOrganizeranddisplaysdirect neuralizingactivity. Cell 77, 283–295.

Hogan,B.L.M. (1996)Bonemorphogenetic proteins:multifunctionalreg-ulatorsof vertebratedevelopment. GenesDev. 10, 1580–1594.

Iwasaki,S.,Tsuruoka,N., Hattori,A., Sato,M., Tsujimoto,M. andKohno,M. (1995)Distribution andcharacterization of specificcellular bindingproteinsfor bonemorphogenetic protein-2.J. Biol. Chem.270, 5476–5482.

Jones,C.M., Lyons, K.M., Lapan, P.M., Wright, C.V.E. and Hogan,B.L.M. (1992) DVR-4 (bonemorphogenetic protein-4)as a posterior-ventralizingfactor in Xenopusmesoderminduction.Development115,639–647.

Jones,C.M., Dale, L., Hogan,B.L.M., Wright, C.V.E. and Smith, J.C.(1996) Bone morphogeneticprotein-4 (BMP-4) acts during gastrulastagesto causeventralization of Xenopusembryos.Development 122,1545–1554.

Kao,R.K. andElinson,R.P.(1988)Theentiremesodermal mantlebehavesas Spemann’sorganizer in dorsoanterior enhancedXenopuslaevisembryos.Dev. Biol. 127,64–77.

Koenig,B.B., Cook, J.S.,Wolsing, D.H., Ting, J., Tiesman,J.P.,Correa,P.E.,Olson,C.A., Pecquet, A.L., Ventura, F., Grant,R.A., Chen,G.-X.,Wrana,J.L., Massague,J. andRosenbaum, J.S.(1994)Characterizationandcloning of a receptorfor BMP-2 andBMP-4 from NIH 3T3 cells.Mol. Cell. Biol. 14, 5961–5974.

Koster, M., Plessow,S., Clement,J.H., Lorenz, A., Tiedemann, H. andKnochel,W. (1991)Bonemorphogenetic protein4 (BMP-4),a memberof the TGF-b family, in early embryosof Xenopuslaevis: analysisofmesoderminducingactivity. Mech.Dev. 33, 191–200.

Lamb,T.M., Knecht,A.K., Smith,W.C.,Stachel,S.E.,Economides, A.N.,Stahl, N., Yancopolous, G.D. and Harland, R.M. (1993) Neuralinduction by the secretedpolypeptide Noggin. Science 262, 713–718.

Massague,J. (1996)TGFb signaling:receptors,transducers andMad pro-teins.Cell 85, 947–950.

Masuhara,K., Nakase,T., Suzuki,S.,Takaoka,K., Matsui,M. andClarke-Anderson,H. (1995)Useof monoclonalantibodyto detectBoneMor-phogeneticProtein-4(BMP-4) Bone16, 91–96.

Matzuk,M.M., Lu, N., Vogel, H., Sellheyer,K., Roop,D.R. andBradley,A. (1995) Multiple defectsand perinatal death in mice deficient infollistatin. Nature374,360–363.

Mishina, Y., Suzuki, A., Ueno, N. and Behringer, R.R. (1995) Bmprencodesa type I bonemorphogeneticprotein receptorthat is essentialfor gastrulation during mouseembryogenesis. GenesDev. 9, 3027–3037.

Nakamura, T., Takio, K., Eto, Y., Shibai,H., Titani, K. and Sugino,H.(1990)Activin-bindingproteinfrom ratovaryis follistatin. Science247,836–838.

Piccolo,S., Sasai,Y., Lu, B. andDe Robertis,E.M. (1996)Dorsoventralpatterningin Xenopus: inhibition of ventralsignalsby directbindingofchordinto BMP-4. Cell 86, 589–598.

Re’em-Kalma, Y., Lamb, T. and Frank,D. (1995) Competitionbetweennogginandbonemorphogenetic protein4 activities may regulatedor-salizationduringXenopusdevelopment. Proc.Natl. Acad.Sci. USA 92,12141–12145.

Rogers,M.B., Rosen,V., Wozney, J.M. and Gudas,L.J. (1992) Bonemorphogenetic proteins-2 and -4 are involved in the retinoic acid-induceddifferentiation of embryoniccarcinomacells. Mol. Biol. Cell3, 189–196.

Rudnicki, M.A. and McBurney, M.W. (1987) Cell culture methodsandinduction of differentiation of embryonal carcinoma cell lines. InRobertson,E.J. (ed.), Teratocarcinomas and Embryonic Stem Cells,IRL Press,Oxford, pp. 19–49.

Sasai,Y., Lu, B., Steinbeisser, H., Geissert,D., Gont,L.K. andDe Rober-tis, E.M. (1994)Xenopuschordin: a novel dorsalizingfactor activatedby organizer-specific homeobox genes.Cell 79, 779–790.

Sasai,Y., Lu, B., Steinbeisser, H. andDeRobertis,E.M. (1995)Regulation

49A. Fainsodet al. / Mechanismsof Development63 (1997)39–50

of neuralinductionby the Chd andBmp-4 antagonisticpatterningsig-nals in Xenopus. Nature376,333–336.

Schmidt,J.E.,Suzuki,A., Ueno,N. andKimelman, D. (1995)LocalizedBMP-4 mediates dorsal/ventralpatterningin theearlyXenopusembryo.Dev. Biol. 169,37–50.

Schneyer,A.L., Rzucidlo,D.A. and Crowley, W.F. (1994)Characteriza-tion of uniquebinding kinetics of follistatin and activin or inhibin inserum.Endocrinology 135,667–674.

Smith, W.C. and Harland,R.M. (1992) Expression cloning of noggin,anew dorsalizingfactor localizedto the Spemannorganizerin Xenopusembryos.Cell 70, 829–840.

Smith, W.C., Knecht,A.K., Wu, M. and Harland,R.M. (1993) Secretednoggin protein mimics the Spemannorganizerin dorsalizingXenopusmesoderm.Nature361,547–549.

Spemann,H. andMangold,H. (1924)UberInduktionvonEmbryonalanla-gen durch ImplantationArtfremder Organisatoren. Roux Arch. Entw.mech.100,599–638.

Steinbeisser,H., Fainsod, A., Niehrs,C., Sasai,Y. andDe Robertis,E.M.(1995) The role of gsc and BMP-4 in dorsal-ventral patterningof themarginal zone in Xenopus: a loss of function study using antisenseRNA. EMBO J. 14, 5230–5243.

von Dassow,G., Schmidt, J.E.andKimelman, D. (1993)Inductionof theXenopusorganizer: expressionandregulation of Xnot, a novelFGFandactivin-regulated homeoboxgene.GenesDev. 7, 355–366.

Wilson, P.A. and Hemmati-Brivanlou, A. (1995) Induction of epidermisandinhibition of neuralfate by Bmp-4.Nature376,331–333.

Winnier,G., Blessing,M., Labosky,P.A.andHogan,B.L.M. (1995)Bonemorphogeneticprotein-4is requiredfor mesodermformation and pat-terning in the mouse.GenesDev. 9, 2105–2116.

Xu, R.-H.,Kim, J.,Taira,M., Zhan,S.,Sredni,D. andKung,H. (1995)Adominantnegativebonemorphogeneticprotein4 receptorcausesneur-alizationin Xenopusectoderm.Biochem.Biophys.Res.Commun. 212,212–219.

Yamashita, H., ten Dijke, P., Huylebroeck, D., Sampath,T.K., Andries,M., Smith, J.C., Heldin, C.-H. and Miyazono, K. (1995) Osteogenicprotein-1 binds to activin type II receptorsand inducescertain acti-vin-like effects.J. Cell Biol. 130,217–226.

Zimmerman,L.B., De Jesus-Escobar,J.M. andHarland,R.M. (1996)TheSpemannorganizer signalnogginbindsand inactivatesBoneMorpho-geneticProtein4. Cell 86, 599–606.

50 A. Fainsodet al. / Mechanismsof Development63 (1997)39–50