taenia solium: identification and preliminary characterization of a lipid binding protein with...
TRANSCRIPT
www.elsevier.com/locate/yexpr
Experimental Parasitology 116 (2007) 191–200
Taenia solium: Identification and preliminary characterizationof a lipid binding protein with homology to the SEC14 catalytic domain
Estrella Montero a, Luis Miguel Gonzalez a, Pedro Bonay b, Gabriela Rosas c,Beatriz Hernandez c, Edda Sciutto c, R. Michael E. Parkhouse d,*, Leslie J.S. Harrison e,*,
Miguel Angel Morales a, Teresa Garate a
a Instituto de Salud Carlos III, Centro Nacional de Microbiologıa, Ctra. Majadahonda Pozuelo Km 2,2, 28220, Majadahonda Madrid, Spainb Centro de Biologıa Molecular, Universidad Autonoma de Madrid, 28049, Madrid, Spain
c Departamento de Inmunologıa, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico, Mexico DF, Mexicod Instituto Gulbenkian de Ciencia, R. Quinta Grande 6, Apartado 14, P-2780-156 Oeiras Codex, Portugal
e University of Edinburgh, Royal (Dick) School of Veterinary Studies, Division of Veterinary Clinical Sciences, (incorporating Centre for Tropical
Veterinary Medicine), Easter Bush Veterinary Centre, Easter Bush, Roslin, Midlothian Scotland, EH25 9RG, UK
Received 6 October 2006; received in revised form 15 December 2006; accepted 20 December 2006Available online 23 January 2007
Abstract
The objective of this work is to identify proteins of the human and porcine parasite, Taenia solium, which may be exploited for controlof the parasite. Through screening a cDNA library of T. solium metacestodes, we have identified a novel Sec-14-like Taenia lipid-bindingprotein that may play an important role in membrane trafficking. The Sec14-like sequence is a single copy gene, encoding a putativepolypeptide of 320 amino acids and 36.1 kDa (sec14Tsol protein). Secondary amino acid structural analysis suggested that the sec14Tsolprotein might contain two distinct structural domains, an amino-terminal a-helix rich domain and a mixed a-helix/b-stand carboxy-ter-minal zone, showing homology with the conserved SEC14 domain found in a great number of proteins that bind lipids, as the regulatorsof membrane trafficking between Golgi membrane bilayers. Significantly, therefore, in a phosphoinositide-binding assay, sec14Tsol puri-fied recombinant protein specifically interacted with important lipid regulators of membrane trafficking, with a preference for PI(3)P2,PI(3,4)P2, PI(4,5)P2 and phosphatidic acid. Moreover, the sec14Tsol protein was localized in the Golgi apparatus of transfected cells andin the spiral canal region of T. solium metacestode tegument. As sec14Tsol protein may play an important role in membrane trafficking,its demonstrated localisation in the intact parasite tegument suggests its involvement in the function of the tegument and thus perhapsinteraction with the host.� 2007 Elsevier Inc. All rights reserved.
Index Descriptors and Abbreviations: SEC14 domain; Sec14-like gene; Lipid binding; Taenia solium; BCA, bicinchoninic acid; bp, base pair; BSA, bovineserum albumin; cDNA, copy deoxyribonucleic acid; EDTA, ethylenediaminetetraacetic acid; FITC, fluorescein isothiocyanate; Gal-T, beta 1-4-galactosyl-transferase; gDNA, genomic deoxyribonucleic acid; Kb, kilobase; kDA, kiloDalton; LPA, lysophosphatidic acid; LPC, lysophosphacholine; NRK,normal rat kidney; PA, phosphatidic acid; PBS, phosphate buffered saline; PBS/A-T, 1% BSA in PBS plus 0,1% Triton X-100; ORF open reading frame;PC, phosphatidylcholine; PCR, polymerase chain reaction; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PIP, phosphatidylinositol phosphate;PS, phosphatidyl serine; S1P sphingosine-1-phosphate; SEC14, S. cerevisiae gene.
0014-4894/$ - see front matter � 2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.exppara.2006.12.015
* Corresponding authors. Fax: +44 131 651 3903 (L.J.S. Harrison); fax:+351 21 4407970 (R.M.E. Parkhouse).
E-mail addresses: [email protected] (R.M.E. Parkhouse),[email protected] (L.J. Harrison).
1. Introduction
Taenia solium is responsible for porcine cysticercosis,and human taeniasis. In addition, the eggs can infecthumans, resulting in cysticercosis or neurocysticercosis.Neurocysticercosis is a serious disease resulting in highmorbidity and, in some cases, death (Flisser, 1998). The
192 E. Montero et al. / Experimental Parasitology 116 (2007) 191–200
parasite constitutes a serious public health problem inendemic areas of Latin America, Asia and Africa (White,1997), and has also been introduced into formerly non-en-demic areas (Schantz, 1996). The control of this parasite istherefore of importance and the development of specificand sensitive diagnosis and an effective vaccine against cys-ticercosis are important objectives. A rational approach todevelopment of a vaccine is through understanding thehost-parasite interaction and key aspects, perhaps unique,of parasite cell biology. This paper describes a tegumentlocated protein (sec14Tsol) of T. solium which has aSEC14 domain and, importantly, which binds lipid andwhich may therefore be involved in tegument function.
The SEC14 family of proteins is ubiquitous, with aconserved SEC14 domain that participates in essential lip-id-binding/transfer processes in many organisms, for exam-ple, the phosphatidilylinositol (PI)/phosphatidilcholine(PC) transferase (Sec14p) of Saccharomyces cerevisiae, acytosolic protein capable of binding and transferring PIand PC between membrane bilayers in vitro (Bankaitiset al., 1990; Cleves et al., 1991). Moreover, Sec14p playsa direct role in secretory function in vesicular transportof the Golgi apparatus (Bankaitis et al., 1989; Cleveset al., 1991; Kearns et al., 1998). Similar proteins have beendescribed in Arabidopsis thaliana (Jouannic et al., 1998),and Dictiostelium discoideum (Swigart et al., 2000). Otherexamples include, the tyrosine phosphatase-MEG2, locatedin secretion vesicles and specifically binding phosphatidylserine (PS) (Gjorloff-Wingren et al., 2000; Wang et al.,2002) and a peripheral membrane sec 14 like protein(PALT1) in plant cytokinesis, that binds phosphoinositideswith a preference for PI(5)P, PI(4,5)P2 and PI(3)P (Peter-man et al. (2004).
In addition to membrane localisation, the SEC14 con-served domain is also found in other cytosolic molecules,for example, the cellular retinaldehyde-binding protein(CRALBP) or a-tocopherol transfer protein (a-TTP) (Hos-omi et al., 1997; Arita et al., 1997), the guanine triphospha-tase activating proteins (GAPs) and guanine nucleotideexchange factors, such as the neurofibromin protein(NF1), the multidomain protein (TRIO), the proto-onco-gen of Dbl (Dbs) (Debant et al., 1996; Aravind et al., 1999).
The work presented in this paper describes the cloningand expression of a sec14Tsol protein of T. solium metaces-todes which similarly binds phosphoinositides, namely thephosphatidylinositols PI(3)P, PI(3,4)P2 PI(4,5)P2, andphosphatidic acid (PA), and is localized to the Golgi andthe spiral canals of T. solium metacestode tegument, sug-gesting a possible role in membrane-trafficking events asso-ciated with Golgi secretory pathways.
2. Materials and methods
2.1. The sec14Tsol cDNA clone
A T. solium metacestode cDNA library was preparedusing the Uni-ZAP� XR library kit (Strategene, La Jolla,
CA, USA) and the sec14Tsol cDNA clone was isolatedfrom the cDNA library by antibody screening (Monteroet al., 2003; Ferrer et al., 2005). The promising signal wastransformed into phagemid clones by helper phage rescue(Short et al., 1988). T. saginata and T. solium are of suchclose taxonomic relationship that each can be regarded asa model for the other (Harrison and Parkhouse, 1989).Thus, the library was screened using a pool of sera fromrabbits immunized with metacestode antigens from thesetwo taeniids, as described previously (Montero et al.,2003; Ferrer et al., 2005).
2.2. Preparation of protein extracts from T. solium
metacestodes
Taenia solium metacestodes were pulverized in a mortarand pestle to a fine powder, using dry ice keep the samplesfrozen. 1 mg of powder was resuspended in 6 ml of phos-phate buffered saline (PBS) and 60 ll of each proteaseinhibitors: PI-A (0.2 M ethylenediaminetetraaceti acid(EDTA), 0.2 M Ethylene glycol-bis-(b-amino-ethyl ether)N,N,N-tetra acetic acid (EGTA), 0.2 M N-ethylmaleimide(NEM) and PI-B (0.2 M phenylmethylsulfonyl fluoride(PMSF), 0.02 M N-tosyl-L-lysine chloromethyl ketone(TPCK), 0.2 M pepstatin) (Sigma–Aldrich). The proteinconcentration of the extract was determined by BCA pro-tein assay kit (Pierce Ltd.).
2.3. Sample collection and extraction of genomic DNA
(gDNA)
A total of 24 cysts, isolated from their porcine andbovine intermediate hosts, were analyzed. The samplescame from Morelos State, Mexico Each cyst was dissectedout and processed separately. The cysts were washed inPBS and stored at �20 �C until use. Cysts sample was usedto obtain the total gDNA. The cyst was divided into smallpieces, then digested with 200 ml of 10 mg/ml proteinase K(Sigma) in 3.8 ml of extraction buffer (50 mM Tris–ClH,pH 8, 50 mM EDTA and 100 mM NaCl) and 200 ml10% SDS, at 37 �C during 12 h. After the incubation, theDNA was extracted and precipitated with phenol-chloro-form and ethanol, respectively (Yang et al., 2001). The pel-let was suspended in Milli-Q sterile water (Millipore). TheDNA concentration was determinated by spectrophotome-try and the samples were stored at �20 �C.
2.4. Digestion and electrophoresis of T. solium gDNA,
Southern blotting, labelling and hybridisation procedures
Aliquots of T. solium metacestode gDNA (8 lg), pre-pared as described previously (Yang et al., 2001) weredigested to completion with AluI, EcoRI, PstI, RsaI,BamHI, HaeIII and HindIII (Roche Diagnostics) as recom-mended by the manufacturers. The digested DNA samplesand DIG II molecular mass markers (Roche Diagnostics,Germany) were simultaneously electrophoresed in 0.7%
E. Montero et al. / Experimental Parasitology 116 (2007) 191–200 193
(w/v) agarose gels. Digested DNA samples were transferredto positively charged nylon membranes (Roche Diagno-stics) (Southern, 1975). The sec14Tsol cDNA probe wasnon-radioactively labelled with digoxigenin-11-dUTP(Roche Diagnostics) by a random oligonucleotide primermethod, according to the manufactures’s instructions.Hybridisations and immunodetection were conducted asdescribed by Montero et al. (2003).
2.5. DNA sequencing
Sec14TsolcDNA was prepared from the recombinantplasmid using the Qiagen Plasmid Mini Kit (Qiagen, CA,USA) and the dideoxy chain termination sequencing reac-tion (Sambrook and Russell, 2001) was performed usingBig-Dye Terminator Cycle Sequencing Ready Reactionkit (Applied Biosystems, UK). Sequencing reactions wereautomatically analysed on an Applied Biosystems 3700DNA sequencer (Applied Biosystems).
2.6. DNA amplification
The extension of the 5 0 end of the sec14Tsol cDNA wasobtained by PCR, using standard PCR protocols (Greenand Olson, 1990) and maxipools prepared from aliquotsof the amplified T. solium metacestode expression libraryusing the recommended protocol for amplifying The Uni-ZapXR libraries (Strategene). The total volume of the reac-tion was 100 ll: 10 ll of Taq polymerase buffer 10· (10 mMTris–HCl, pH 8.3, 50 mM KCl, 6 mM MgCl2, 0.01% gela-tin) 0.2 mM of each dNTP, 1 ll of each primer, 0.5 ll oftaq polimerase (5 U/ll) Perkin-Elmer, 37.5 ll of waterand 40 ll of each maxipool. The program used was inicialdesnaturalization at 94 �C for 1 min, followed by 30 cyclesat 94 �C for 30 seg, 50 �C for 30 seg, and 72 �C for 3 minwith a final extension at 72 �C for 7 min. The primers usedwere universal T3 forward primer from k-Zap vector, andthe reverse primer Sec14TsolR1 (5 0TCAGAAGAAAGTTGTCGTCATCCGGGCA3 0) derived from the knownsec14Tsol cDNA sequence. The full sec14Tsol genomicsequence was obtained by PCR, using the Expand� longTemplate PCR system (Roche Diagnostic) and T. solium
gDNA. The primers prepared from sec14Tsol cDNA were:the forward primer Sec14TsolgeneF1 (5 0ACAGCTCAGAATCTACCTCCCAAG3 0) and the reverse primerSec14TsolgeneR1 (5 0TGTCAATCGACAGCCAGTTTGACG 3 0). The reaction was carried out following the man-ufacturer’s instructions. Working conditions for the PCRfor the PCR were 94 �C for 1 min, followed by 30 cyclesat 94 �C/30 s, 65 �C/30s and 68 �C/2.5 min and 68 �C/7 min (final extension). The amplified products were sepa-rated on 0.7% agarose gels, visualized under UV light byethidium bromide staining, subcloned into pGEM-T easyvector (Promega) and then sequenced as described above.Oligonucleotide primers were synthesized by RocheDiagnostics. PCR experiments were performed on a
programmable Perkin-Elmer GeneAmp� PCR system2400 (Applied Biosystems).
2.7. Computational analysis
The nucleotide sequence data reported here are availablein the EMBL, GenBank and DDBJ databases under theGenBank Accession Nos. AJ493439 (sec14Tsol cDNA)and AJ538190 (sec14Tsol gene). DNA sequences and pre-dicted amino acid sequence comparisons were carried outwith the GenBank+EMBL+DDBJ+PDB and all non-redundant GenBank CDS Translations +PDB+Swiss-Prot+PIR+PRF databases, using BLAST and PSI-BLASTalgorithm (Altschul et al., 1997), respectively. PHD (Rostand Sander, 1993), PSIPRED (McGuffin et al., 2000),PROSITE (Hulo et al., 2004) and DAS (Cserzo et al.,1997) computational programs were used to predict thesecondary structure of sec14Tsol protein. Identification ofconserved domains was detected by RPS-BLAST algo-rithm by using CD-Search (Marchler-Bauer et al., 2003),with a threshold of 0.00001.
2.8. Expression and purification of sec14Tsol recombinantprotein
The sec14Tsol cDNA was digested with SacI/KpnI(Roche Diagnostic) and cloned into the expression plasmidvector pQE-31 (Qiagen) which adds the 6X-His tag at theN-terminus of the recombinant protein. Escherichia coli
strain M15 [pREP4] was transformed with pQE-31-SEC14 construction. The induction of the sec14Tsol mole-cule in pQE-31 vector was carried out in Luria–Bertani(LB) medium at 37 �C during 4 h with 1 mM isopropyl-b-D-thiogalactopyranoside (IPTG), 200 lg/mL ampicillinand 25 lg/mL kanamycin (Sigma–Aldrich, USA). Thesec14Tsol recombinant protein was purified with the Ni–NTA Spin Kit (Qiagen) under native conditions asdescribed by the manufacturers. Protein concentrationwas determined by bicinchoninic acid (BCA) protein assaykit (Pierce, IL, USA).
2.9. Preparations of rabbit anti-sec14Tsol specific antiserum
Two female New Zealand white rabbits were pre-bled(2.0 ml, day 0) and then inoculated with 200 lg of sec14T-sol purified recombinant protein (day 0, subcutaneous inFreund’s complete adjuvant and days 21 and 49, intramus-cular with Freund’s incomplete adjuvant supplied by Beck-ton & Dickinson). On day 50 serum samples were collectedfrom the rabbits to check for the presence of antibodyusing the enzyme-linked immunosorbent assay (ELISA)and sec14Tsol purified recombinant protein as antigen.
2.10. Sec14 protein interaction with phospholipids
Commercial nitrocellulose PIP (phosphatidylinositolphosphate) strips� were purchased from Echelon Research
194 E. Montero et al. / Experimental Parasitology 116 (2007) 191–200
Lab (Salt Lake City, Utah, USA). These were spotted with100 pmol of different phospholipids, PI, phosphoinositides,namely PI(3)P, PI(4)P, PI(5)P, PI(3,4)P2, PI(3,5)P2,PI(4,5)P2, PI(3,4,5)P3, phosphatilylethanolamine (PE),PC, PS and PA or 100 pmol of lysophosphatidic acid(LPA), lisophosphacholine (LPC) and sphingosine-1-phos-phate (S1P). The strips were probed with 0.5 mg/mlsec14Tsol recombinant protein and the bound proteinswere detected by immunoblotting with anti-sec14Tsol anti-bodies as per the manufacturers instructions.
2.11. Subcellular localization of sec14Tsol protein
Sec14Tsol cDNA was subcloned into the vector pCMV-Tag 3A (Strategene) using EcoRI/ApaI. Fibroblasts (NRK,normal rat kidney) were grown to 33% confluence onround coverslips. Then the cells were transfected, using‘‘Lipofectamine plus’’ (Life Technology, UK), with therecombinant plasmid (PCMV-TAG-3A-SEC14Tsol), asdescribed by the manufacturers and incubated at 37 �Cfor 18 h. For immunofluorescence microscopy, the trans-fected cells were washed 6 times in PBS and fixed with2% (w/v) paraformaldehyde in PBS (20 min, 4 �C), andthen washed 6 times in PBS containing 1% (w/v) bovineserum albumin (PBS-BSA), 10 min each. The cells werepermeabilized with 0.1% (w/v) saponin in PBS-BSA (1 h,room temperature). Coverslips were incubated for 1 hupside down, room temperature, on a drop of rabbit poly-clonal antibody anti-beta 1-4-galactosyl-transferase (anti-GalT) (Bonay et al., 1996) and anti-c-myc monoclonalantibody in PBS-BSA-saponin. The covers were washed 6times with PBS-BSA-saponin and incubated with the sec-ond antibodies goat anti rabbit Ig-Texas Red (SouthernBiotechnology, AL, USA) and goat anti mouse Ig-fluores-cein isothiocyanate (FITC) in PBS-BSA-saponin for30 min. Finally, the coverslips were extensively washedwith PBS/BSA and were mounted onto glass slides usinga small drop of ‘‘Fluormount’’ (Molecular Probes-Eu-rope-BV, Netherland), sealed with nail polish, and visual-ized using a 63· PlanApoChromat NA 1.4 objective, witha Bio-Rad Radiance 2000 Confocal laser scanning micro-scope (Bio-Rad Laboratories, USA) mounted on a Axio-vert S100 TV microscope.
2.12. SDS–PAGE and Western-blot analysis
One-dimensional sodium dodecyl sulfate-polyacryl-amide gel electrophoresis (SDS–PAGE) and Western-blotanalysis of sec14Tsol purified protein was carried out using10% (w/v) polyacrylamide gels. The separated protein wastransferred to nitrocellulose membranes (Schleicher &Schuell, Germany) using a semi-dry blotting apparatus(Fasblot Biometra). The membranes were incubated withanti-sec14Tsol rabbit sera diluted 1:10000 in blocking solu-tion, for 1 h at 37 �C. After washing, a titrated goat anti-rabbit IgG conjugated with alkaline phosphatase (H andI chains) (Pierce), diluted 1:5000, was added. After an incu-
bation for 1 h at room temperature, the filters were devel-oped using NBT (75 mg mL�1 nitroblue tetrazolium saltin 70% (v/v) dimethylformamide) and BCIP (50 mg mL�1
5-bromo-4-chloro-3-indolyl phosphate toluidinium salt in100% dimethylformamide) (Sigma–Aldrich).
2.13. Histologic immunolocalization of sec14Tsol protein
Intact metacestodes were obtained by muscle dissectionof naturally infected pigs and placed on ice cold PBS. Thevesicular fluid was removed and non-specifically boundhost proteins were dissociated from T. solium metacestodesusing the procedure previously described (Rosas et al.,1998). Briefly, the tissue was incubated with 50 mM gly-cine–HCl, pH 2.5; 0.1% Triton X-100; 0.15 mM NaCl for30 s, and then the pH restored to neutrality by addingTris–HCl, pH 9.0. After further washing with cold PBS,6 lm cryostat section were cut in optimum-cutting-temper-ature compound (Miles), fixed in acetone for 10 min andstained with rabbit anti-recombinant sec14Tsol antibodies.The antiserum was diluted at 1:10000 in 1% BSA in PBSplus 0,1% Triton X-100 (PBS/A-T). The negative controlwas a pool of sera from naive rabbits, and the positive con-trol was a pool of sera from rabbits immunized with a mixof taeniid antigens (Montero et al., 2003; Ferrer et al.,2005). After washing three times in PBS/A-T, 5 min each,the slides were covered with a biotinylated goat anti-rabbitIgG (Immunomark Universal Kit, INC Biomedicals, CA,USA) for 30 min at room temperature, rinsed with PBS/A-T, and treated with streptavidin-peroxidase conjugate(HRP conjugated, ICN Biomedicals) for 30 min at roomtemperature. Peroxidase activity was visualized by incubat-ing the samples with 3 0,3-diaminobenzidine (DAB-PlusKit, Zymed Laboratories, Inc, CA, USA). The slides werecounterstained with Mayer’s hematoxylin, dehydrated,cleared and mounted.
3. Results
3.1. The sec14Tsol cDNA clone
The selected clone sec14Tsol cDNA, which was 1011 bpin length (GenBank Accession No. AJ493439), wassequenced and then further characterised. To confirm theopen reading frame (ORF) of sec14Tsol cDNA, we ampli-fied the 5 0 end of sec14Tsol cDNA with a PCR-cloningapproach, using PCR reaction and maxipools preparedfrom aliquots of the amplified T. solium metacestodeexpression library, as well as primers derived from boththe k-Zap vector and the known sec14Tsol cDNA (T3and Sec14TsolR1). Fragments of 300 bp were amplified,subcloned into pGEM-T-easy and sequenced. Afteranalysing the consensus sequence of the PCR products,the 5 0 sec14Tsol cDNA was extended by 111 bp. The com-plete nucleotide coding region (963 bp) and the deducedamino acid sequence of sec14Tsol protein, as well as the
E. Montero et al. / Experimental Parasitology 116 (2007) 191–200 195
nucleotide sequence of neighbouring upstream and down-stream regions are shown in Fig. 1.
The ORF encodes a polypeptide of 320 aa with a theo-retical molecular mass of 36.1 kDa and an isoelectric pointof 8.43. The initial ATG showed a purine in the �3 posi-tion upstream and a guanine in the + 4 position down-stream (Kozak, 1984), as well as 6 stop codons before theinitial ATG in the 5 0 untranslated region. A polyadenyla-tion signal and a poly (A) tail were localized in the 3 0
untranslated region (Fig. 1b, top).
3.2. Cloning, sequencing and genomic organization of sec14
T. solium gene
In order to obtain the genomic sequence of sec14Tsolgene (GenBank Accession No. AJ538190), we used LongExpand PCR protocols (Roche Diagnostic), T. solium
gDNA and primers Sec14TsolgeneF1 and Sec14Tsolgen-eR1, derived from both 5 0 and 3 0 ends of sec14Tsol cDNA.The forward primer was localized 4 bp behind to the initialATG codon (�4 position) and the reverse primer was local-ized 2 bp after the stop codon (+1070 position).
One PCR was carried out and a fragment of 2.8 Kb wasobtained (Fig. 2a, top) and sequenced. Comparison of thegDNA and cDNA sequences of sec14Tsol moleculerevealed the full T. solium sec14Tsol genomic sequence to
Fig. 1. Organization of the T. solium Sec14 gene and primary structure of secPanel a (top) depicts the standard features of the sec14Tsol gene, their positioregions are in black. Black lines represent the 5 0 end (107 bp) and 3 0 (52 bp) untsequence occupied a stretch of 2.9 Kb with 6 introns (black boxes) and 7 exsec14Tsol protein with the dotted region corresponding to the SEC14 catalyaminoacid length of the protein are indicated by numbers. Panel b (top) represrepresents the stop codon. Panel b (lower) details the predicted hydrophobic pro(–) Loose cut-off, (—) strict cut-off.
be 2964 bp, contain 6 introns (546, 225, 33, 756, 81 and217 bp) separated by 7 exons (142, 172, 59, 191, 111, 112and 166 bp), according to the splicing consensus sequencesGTGAGT and TNNTAG (Breathnach and Chambom,1981; Senapathy et al., 1990) (Fig. 1a). The genomic orga-nization, positions of initial and stop codons and the poly(A)-tail signal are also indicated.
When Southern analysis was carried out with T. solium
gDNA digested by AluI, EcoRI, PstI, RsaI, BamHI, HaeIIIand HindIII, using the sec14Tsol cDNA as a probe, thehybridisation patterns obtained suggested that the sec14T-sol is a single copy gene (Fig. 2b). Furthermore, the size ofthe bands was consistent with the sequence of the sec14Tsolgene.
The sec14Tsol gDNA and the predicted amino acidsequences were analyzed using EMBL and SWISS-PROTdatabanks by BLAST and PSI-BLAST algorithms withoutsignificant results.
3.3. Secondary structure and conserved domain analyses by
computational programs using the aminoacid sequence of
sec14Tsol protein
A possible secondary structure of sec14Tsol protein waspredicted by different computational programs. ProSitefound several putative post-translational motives,
14Tsol protein. The sec14Tsol gene contains the complete ORF (963 bp).n and length in bp. Noncoding regions of the gene are shaded and codingranslated regions (UTR) and the Poly (A) signal (2944–2949). The genomicons (grated boxes). Panel a (lower) depicts the structural features of thetic domain of the protein. The position of the catalytic domain and theents the full length amino acid sequence of sec14Tsol protein. The asteriskfile of sec14Tsol protein as determined by the Das bioinformatic program.
Fig. 2. Southern-blot analysis. In panel a, The genomicPCR product ofthe SEC14Tsol gene amplified using T. solium gDNA and primersSec14tsolgeneF1/Sec14tsolgeneR1, visualized after electrophoresis in a0.7% (w/v) agarose gel, revealing a 2883 bp band (lane 2). The negativecontrol of the reaction (line 1). The numbers on the right indicate themolecular weight kBstII standards. In panel b, T. solium gDNA wasanalyzed by high stringency Southern-blot T. solium gDNA was digestedwith a variety of restriction enzymes. The size of DNA fragments wasdetermined using DNA molecular-size standards (DIG II molecular massmarkers, Roche Diagnostic) (lane M). The numbers on the left indicatethe sizes (in Kb) of the molecular mass markers. AluI (lane 1), EcoRI (lane2), PstI (lane 3), RsaI (lane 4), BamHI (lane 5), HaeIII (lane 6), HindIII(lane 7).
196 E. Montero et al. / Experimental Parasitology 116 (2007) 191–200
including one N-glycosylation site and one N-myristylationsite and several phosphorylation sites. PHD and PSIPREDprograms indicated a possible mixed secondary structure ofsec14Tsol protein consisting of two distinct domains, oneamino-terminal (Nt)-a-helical domain and a carboxy-ter-minal (Ct)-a-helix/b-strand domain. PHD and DAS pro-grams did not find a peptide signal characteristic ofsecreted proteins. However, different hydrophobic zoneswere observed between amino acids 139 and 165 and astrong hydrophobic domain (154aa-165aa) was recognizedby the DAS program. The CD-search program, using anRPS-BLAST algorithm, identified the SEC14 domain witha score of 68.5 and E value of 1 e�12 in the Ct-a-helix/b-strand domain of sec14Tsol protein (Fig. 3). Hydrophobicaminoacids were located at the same position in sec14Tsolprotein as were the hydrophobic residues involved in phos-pholipids binding in SEC14p (see asterisk (*) in Fig. 3.).Thus these areas may constitute the lipid-binding site ofthe sec14Tsol protein functioning in phospholipidexchange. The grey box (Fig. 3) indicates a partial areaof the solvent-exposed face of the helix A10/T4, criticalfor the ability of the protein to execute phospholipidexchange (Sha et al., 1998). However, no conserved
domains were found in the domain of sec14Tsol protein,which is rich in a-helices such as SEC14p from S. cerevisiae.
3.4. Sec14Tsol protein specifically interacts with PI(3,4)P2,
PI(4,5)P2, PI (3)P and PA
A nitrocellulose membrane spotted with different phos-pholipids (Echelon Research lab) was probed with sec14T-sol purified recombinant protein (0.5 mg/ml), in order toidentify the possible phosphoinositide recognition domainand to determine the lipid-binding specifities of Sec14Tsolprotein. The bound protein was detected using the specificrabbit anti-sec14Tsol. As shown in Fig. 4, among the 15phospholipids analyzed, sec14Tsol recombinant proteinbound specifically to PI(3,4)P2, PI(4,5)P2, PI (3)P and PA.
3.5. Subcellular localization of sec14Tsol protein
The c-myc epitope expressed in fusion with the sec14T-sol recombinant protein allowed immunolocalization of theexpressed protein in NRK cells, transfected with recombi-nant plasmid pCMV-TAG-3A-SEC14Tsol (Fig. 5b). Atshort post-transfection times (18 h), sec14Tsol protein, infusion with the c-myc epitope, was clearly and preferentiallylocalized in structures corresponding to the trans Golgiapparatus, as confirmed by counter staining with theappropriate Gal-T, marker for the Golgi (Fig. 5a).
3.6. Localization of sec14Tsol native protein in the
metacestode stages of T. solium
The rabbit anti-sec14Tsol purified protein identified a 36kDa protein on Western-blot analysis using an extract of T.
solium metacestodes (data not shown). This antibody wasthen used to localize the sec14Tsol protein to the area ofthe metacestode tegument close to the spiral canals (Fig. 6).
4. Discussion
This work reports the entire sequence, genomic organi-sation and secondary structure prediction of a new gene,named sec14Tsol, from T. solium metacestode. Bioinfor-matic, functional and subcellular localization investiga-tions demonstrated that the parasite protein contains acarboxy terminal SEC14 domain, characteristic of regula-tors of membrane trafficking, and appropriately localizedin trans vesicles of the Golgi compartment. Consistent withthis, we also demonstrated specific binding of sec14Tsolprotein to different phospholipids that regulate membranetrafficking.
All of these observations, plus the localization of thesec14Tsol protein to the tegument at the spiral canal ofthe metacestode, suggest a possible role for sec14Tsol mol-ecule in binding and phospholipid exchange in membrane-trafficking events of the Golgi secretory pathway of themetacestode tegument. Such activity may be relevant toexchange of molecules between parasite and host.
Fig. 3. Sequence comparison between sec14Tsol protein from T. solium, SEC14 catalytic domain and SEC14p from S. cerevisiae. (Panel a) Alignment ofsec14Tsol protein and SEC14p Nt domains. (Panel b) Sequence alignment of the consensus SEC14 domain and the catalytic domains from sec14Tsolprotein and SEC14p using RPS-BLAST algorithm (E-value threshold = 0.00001). The score and the E-value were 68.5 and 1e�12, respectively. In (a) and(b), the PSIPRED secondary structure is shown above and below the alignment, with E representing b-strands and H showing a-helix regions. Residuenumbering for each sequence is shown at the sides. Hydrophobic aminoacids are in bold, critical basic aminoacid, Lys and Gln, essential for binding lipidsare indicated by vertical boxes. The asterisks (*) indicate hydrophobic residues involved in phospholipid binding in SEC14p. The gray box indicates apartial area of the solvent-exposed face of the helix A10/T4. The SEC14 catalytic domain is between brackets.
Fig. 4. Sec14Tsol protein specifically binds PI(3)P, PI(3,4)P2, PI (4,5)P2
and PA. PIP strips� spotted with of 15 different phospholipids: PI, PI(3)P,PI(4)P, PI(5)P, PI(3,4)P2, PI(3,5)P2, PI(4,5)P2, PI(3,4,5)P3, PE, PC, PS,PA, LPA, LPC, and S1P, was probed with the sec14Tsol recombinantprotein. Bound proteins were detected by immunoblotting with anti-sec14Tsol antibodies. Arrows indicate the lipids that sec14Tsol proteinbinds.
E. Montero et al. / Experimental Parasitology 116 (2007) 191–200 197
The complete cDNA sequence of sec14Tsol wasachieved by amplification of the original incomplete cDNAby PCR followed by sequencing reactions at the 5 0 end,thus extending the upstream region of sec14Tsol cDNAby 111 bp. The full-length 963 nucleotide open readingframe was deduced to encode a putative polypeptide of320 amino acids, with a predicted molecular mass of 36.1kDa and an isoelectric point of 8.43.
In order to establish the genomic sequence we amplifiedthe sec14Tsol gene from metacestode T. solium gDNA by
PCR using a set of primers from the sec14Tsol cDNA.The resulting DNA sequence of 2.9 Kb incorporated sixintrons separated by seven exons plus standard featuresof an eukaryotic protein-coding gene, and confirmed thecDNA sequence. Finally, Southern blot analysis of DNAfragments, after digestion with specific restriction enzymes,were consistent with sec14Tsol gene as a single copy gene.Any possible 5 0 regulatory regions of the sec14Tsol genewill be ascertained by primer extension analysis in orderto determine the transcription initiation site of the gene.
Bioinformatic analysis of the cDNA and genomicsequences of sec14Tsol carried out with Gen-Bank+EMBL+DDBJ+PDB databases was uninformative.Using the Prosite program, however, the sec14Tsol amino-acid sequence was predicted to contain N-glycosylation,phosphorylation and myristylation postransductionalmotifs characteristic of eukaryotic proteins. The mostinteresting prediction came from the CD-search serviceand PSIPRED program, which detected a similar arrange-ment of a-helix and b-strands in the SEC14 Ct domain ofboth sec14Tsol protein and SEC14p (Fig. 3).
Moreover, a multiple alignment of the carboxy-terminalconserved sequences of sec14Tsol protein and SEC14p,both rich in hydrophobic aminoacids (Fig. 3), suggestedthat this region may constitute the hydrophobic lipid-binding site of sec14Tsol protein. Significantly, sec14Tsolprotein also contained the critical basic aminoacid Lys atposition 239 as well as the polar Gln202, and both are essen-tial for binding lipids (Sha et al., 1998; Aravind et al.,1999). Sha et al. proposed that the solvent-exposed faceof helix A10/T4, which defines the most hydrophobicregion of the SEC14p in the Ct domain, is critical for the
Fig. 5. Localization of transfected sec14Tsol protein to the trans-Golgi apparatus. NRK cells were transfected with recombinant plasmid pCMV-TAG-3A-SEC14Tsol and stained with a FITC-coupled antibody system for the SEC14 protein (an anti-c-myc monoclonal antibody), counterstained with arabbit anti-beta 1-4-galactosyl-transferase and a Texas red-coupled goat anti-rabbit antibody, and analyzed by confocal fluorescence microscopy. Panel ashows the Texas Red channel, beta 1-4-galactosyl-transferase expression in trans-Golgi apparatus. Panel b shows the FITC channel, pCMV-c-myc-sec14Tsol recombinant protein expression. Panel c shows the two channels overlapped to evaluate colocalisation.
Fig. 6. Localisation of sec14Tsol in the T. solium metacestode tegument. Metacestode cryostat sections were incubated with a rabbit preimmune serum (aand b) or with rabbit antibodies against sec14Tsol recombinant protein (c and d), developed with biotinylated goat anti-rabbit IgG plus streptavidin-peroxidase conjugate and counterstained with hematoxilin. The arrows in panel d indicate the areas in the metacestode tegument where sec14Tsol proteinwas localized. This corresponds to the area of the tegument which is close to the spiral canals. 10X (a and c), 40X (b and d).
198 E. Montero et al. / Experimental Parasitology 116 (2007) 191–200
ability of the protein to execute phospholipid exchange.Notably, a similar helix hydrophobic region was found inthe aminoacid sequence of the sec14Tsol Ct-domain(Fig. 3) suggesting that sec14Tsol protein might functionin phospholipid exchange. The SEC14 lipid-bindingdomain is present in many intracellular proteins (Bankaitiset al., 1989; Crabb et al., 1991; Arita et al., 1997; Sha et al.,1998; Aravind et al., 1999; Gjorloff-Wingren et al., 2000;Wang et al., 2002; Peterman et al., 2004) with anestablished and broad role in coordinating phospholipidmetabolism, vesicle trafficking, secretion, regulation ofsignal-transduction pathways and maintaining thesecretory vesicle flow from the late Golgi compartment(Hay and Martin, 1993).
The functional correlate of the bioinformatic analysiswas directly demonstrated. A specific interaction of impor-tant regulators of membrane trafficking [PI(3,4)P2,PI(4,5)P2 and PI (3)P)] and PA with the sec14Tsol recom-binant molecule was observed, and we suggest that thisinteraction is through its SEC14 domain. Of these,PI(3,4)P2 might play a role during phagocytosis, andpossibly macropinocytosis (Dormann et al., 2004), throughbinding to as yet unidentified protein(s) involved in theseprocesses. In addition, as PI(4,5)P2 is involved in recep-tor-regulated pathways of hydrolysis (Rhee and Bae,1997) and a diversity of other cellular processes (Toker,1998), PI(3)P could be involved in membrane traffickingfrom the Golgi to the endosomes (Stack et al., 1993).
E. Montero et al. / Experimental Parasitology 116 (2007) 191–200 199
Finally, PA is an important precursor for the synthesis ofCDP-diacylglycerol, which is the starting substrate forthe synthesis of PI, and cardiolipin in mammalian cellsand, in addition, PS in yeast (Bishop and Bell, 1998). Nota-bly, the same domain that was identified in PATL1, boundsimilar or identical lipids [PI(5)P, PI(4,5)P2 and PI (3)P]and this finding suggests a role for PATL1 in membranetrafficking events (Peterman et al., 2004). Taken together,these results suggest that sec14Tsol protein functions inmembrane trafficking, and indeed in transfected cells,sec14Tsol protein was located in the late Golgi compart-ment. At the level of the intact metacestode, sec14Tsol pro-tein was largely localized in the tegument associated withthe spiral canal, which is the space between the folded sur-face of the coiled neck of the metacestode and its bladderwall. As the tegument has a role in nutrient exchange, itis possible that sec14Tsol protein plays a critical role in thisfunction, controlling nutrient exchange between the meta-cestode and the host, which in neurocysticercosis means,the human brain.
The crystal structure of the S. cerevisae SEC14p (Shaet al., 1998) resolves into two different domains: a Ct-a-he-lix/b-sheet region that forms a hydrophobic pocket forphospholipid-binding, and an unusual surface helix (A10/T4) that has been hypothesized to play a critical role indriving SEC14-mediated phospholipid exchange. The Ntdomain of a-helix (129 aa) alone is sufficient for SEC14ptargetting to yeast Golgi membranes (Cleves et al., 1991;Sha et al., 1998). Given this information, sec14Tsol proteinsecondary structure was compared with that of the S. cere-visiae SEC14p using the PSIPRED program. The analysisshowed a possible mixed structure for sec14Tsol proteinconsisting of two different regions, an Nt-a-helix domainand a Ct-a-helix/b-sheet domain. Moreover, a multiplealignment of SEC14 domain and Sec14Tsol showed a car-boxy-terninal conserved sequences rich in hydrophobicaminoacids (Fig. 3) suggested that this region might consti-tute the hydrophobic pocket or the lipid binding surface of17H protein.
In contrast to the conserved lipid-binding domain, theNt-a-helical domain SEC14p of S. cerevisiae, is extremelydivergent in other phospholipid binding proteins (Aravindet al., 1999). Three anti-parallel a-helix A2, A3 and A4 areheld together by their hydrophobic interior and form a tri-pod-like motif. The Nt domain is sufficient to directSEC14p to the Golgi complex (Cleves et al., 1991). Thus,Sha and Luo (1999) suggest this motif is responsible fortargetting SEC14p to the Golgi complex membranethrough interactions with an unidentified receptor. In rela-tion to this, PSIPRED showed a rich hydrophobic a-helicaldomain in the sec14Tsol protein Nt region. Notably, thedisposition of a-helix and the presence of numerous hydro-phobic aminoacids in the sec14Tsol protein Nt domainwere very similar to SEC14p (Fig. 3), suggesting that thisdomain could be involved in targetting the protein to Golgimembranes.
In conclusion, we describe a novel molecule of cestodes,sec14Tsol protein, which may serve to exchange hydropho-bic ligands between membrane bilayers in a similar mannerto the phospholipid binding/transfer SEC14p of S. cerevisiae.The characteristic Nt a-helical domain of sec14Tsol proteincould be important to this function by permitting a stableassociation between cellular membranes, a possibility thatwould explain the subcellular location of sec14Tsol proteinto trans Golgi vesicles. Similarly, since sec14Tsol protein islocated in the tegument of the spiral canal region ofT. solium metacestodes, it may be important in controllingnutrient transport and waste disposal.
We are grateful to Drs. E. Ferrer, M. Cortez, Zully Cab-rera (BIOMED, Universidad de Carabobo, Venezuela) forsupply of T. solium parasite material and Marisela Hernan-dez (IIB, Universidad Nacional Autonoma de Mexico,Mexico) in preparing the gDNA from T. solium metaces-todes. This work was supported by UE-INCO Grant(DCIC 18CT9500002), FIS (97/0141 and 00/401) andMEC/British Council Grant (HB96-43). The authorsE. Montero and L.M. Gonzalez were supported by astudent fellowship and a postdoc fellowship, respectively,by Instituto de Salud Carlos III (Spain) as well as fromRICET (FIS).
References
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller,W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucleic AcidsResearch 25, 3389–3402.
Aravind, L., Neuwald, A.F., Pointg, C.P., 1999. SEC14p-like domains inNF1 and dbl-like proteins indicate lipid regulation of Ras and Rhosignalling. Current Biology 9, 195–197.
Arita, M., Nomura, K., Arai, H., Inoue, K., 1997. a-Tocopherol transferprotein stimulates the secretion of a-tocopherol from a cultured livercell line through a brefeldin A-insensitive pathway. Proceedings of theNational Academy of Sciences of the USA 94, 12437–12441.
Bankaitis, V.A., Malehorn, D.E., Emr, S.D., Greene, R., 1989. TheSaccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that isrequired for transport of secretory proteins from the yeast Golgicomplex. The Journal of Cell Biology 108, 1271–1281.
Bankaitis, V.A., Aitken, J.R., Cleves, A.C., Dowhan, W., 1990. Anessential role for a phospholipid transfer protein in yeast Golgifunction. Nature 11, 561–562.
Bishop, W.R., Bell, R.M., 1998. Assembly of phospholipids into cellularmembranes: biosynthesis, transmembrane movement and intracellulartranslocation. Annual Review of Cell Biology 4, 579–610.
Bonay, P., Muro, S., Fresno, M., Alaron, B., 1996. Intra-Golgi transportinhibition by megalomicin. The Journal of Biological Chemistry 16,3719–3726.
Breathnach, R., Chambom, P., 1981. Organization and expression ofeukaryotic split genes coding for proteins. Annual Review ofBiochemistry 50, 349–383.
Cleves, A.E., McGee, T.P., Whitters, E.A., Champion, K.M., Aitken,J.R., Dowhan, W., Goebl, M., Bankaitis, V.A., 1991. Mutations in theCDP-choline pathway for phospholipid biosynthesis bypass therequirement for an essential phospholipid transfer protein. Cell 64,789–800.
Crabb, J.W., Gaur, V.P., Garwin, G.G., Marx, S.V., Chapline, C.,Johnson, C.M., Saari, J.C., 1991. Topological and epitope mapping of
200 E. Montero et al. / Experimental Parasitology 116 (2007) 191–200
the cellular retinaldehide-binding protein from retina. The Journal ofBiological Chemistry 266, 16674–16683.
Cserzo, M., Wallin, E., Simon, I., Von Heijine, G., Elofsson, A., 1997.Prediction of transmembrane alpha-helices in procariotic membraneproteins: the Dense Alignment Surface method. Protein 10, 673–676.Devant, A., Serra-Pages, C., Seipel, K., O’Brien, S., Tang, M., Park,S.H., Streuli, M. (1996). The multidomain protein Trio binds the LARtransmembrane tyrosine phosphatase, contains a protein kinasedomain, and has separate rac-specific and rho-specific guaninenucleotide exchange factor domains. Biochemistry 93, 5466–5471.
Debant, A., Serra-Pages, C., Seipel, K., O’Brien, S., Tang, M., Park, SH.,Streuli, M., 1996. The multidomain protein Trio binds the LARtransmembrane tyrosine phosphatase, contains a protein kinasedomain, and has separate rac-specific and rho-specific guaninenucleotide exchange factor domains. Proceedings of the NationalAcademy of Sciences of the USA 28, 5466–5471.
Dormann, D., Weijer, G., Dowler, S., Weijer, C.J., 2004. In vivo analysisof 3-phosphoinositide dynamics during dictyostelium phagocytosisand chemotaxis. Journal of Cell Science 15, 6497–6509.
Ferrer, E., Gonzalez, L.M., Foster-Cuevas, M., Cortez, M.M., Davila, I.,Rodriguez, M., Sciutto, E., Harrison, L.J., Parkhouse, R.M., Garate,T., 2005. Taenia solium: characterization of a small heat shock protein(Tsol-sHSP35.6) and its possible relevance to the diagnosis andpathogenesis of neurocysticercosis. Experimental Parasitology 110,1–11.
Flisser, A., 1998. Neurocysticercosis in Mexico. Parasitology Today 4,131–137.
Gjorloff-Wingren, A., Saxena, M., Han, S., Wang, X., Alonso, A.,Renedo, M., Oh, P., Williams, S., Schnitzer, J., Mustelin, T., 2000.Subcellular localization of intracellular protein tyrosine phosphatasesin T cells. European Journal of Immunology 30, 2412–2421.
Green, E.D., Olson, M.V., 1990. Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction.Proceedings of the National Academy of Sciences of the USA 87,1213–1217.
Harrison, L.J.S., Parkhouse, R.M.E., 1989. Taenia saginata and Taenia
solium: reciprocal models. Acta Leiden 57, 143–152.Hay, J.C., Martin, T.F., 1993. Phosphatidylinositol transfer protein
required for ATP dependent priming of Ca(2+)-activated secretion.Nature 9, 572–575.
Hosomi, A., Arita, M., Sato, Y., Kiyose, C., Ueda, T., Igarashi, O., Arai,H., Inoue, K., 1997. Affinity for alpha-tocopherol transfer protein as adeterminant of the biological activities of vitamin E analogs. FEBSLetters 409, 105.
Hulo, N., Sigrist, C.J., Le Saux, V., Langendijk-Genovaux, P.S., Bordoli,L., Gattiker, A., 2004. Recent improvements to the PROSITEdatabase. Nucleic Acids Research 1, 32.
Jouannic, N., Lepetit, M., Vergnolle, C., Cantrel, C., Gardies, A.M.,Kader, J.C., Arondel, V., 1998. Isolation of a cDNA from Arabidopsiss
thaliana that complements the sec 14 mutant of yeast. EuropeanJournal of Biochemistry 258, 402.
Kearns, B.G., Alb Jr., J.G., Bankaitis, V., 1998. Phosphatidylinositoltransfer proteins: the long and winding road to physiological function.Trends in Cell Biology 8, 276–282.
Kozak, M., 1984. Compilation and analysis of sequences upstream fromthe translation start site in eukaryotic mRNAs. Nucleic AcidsResearch 12, 857–863.
Marchler-Bauer, A., Anderson, J.B., DeWeese-Scott, C., Fedorova, N.D.,Geer, L.Y., He, S., Hurwitz, D.I., Jackson, J.D., Jacobs, A.R.,Lanczycki, C.J., Liebert, C.A., Liu, C., Madej, T., Marchler, G.H.,Mazumder, R., Nikolskaya, A.N., Panchenko, A.R., Rao, B.S.,Shoemaker, B.A., Simonyan, V., Song, J.S., Thiessen, P.A., Vasud-evan, S., Wang, Y., Yamashita, R.A., Yin, J.J., Bryant, S.H., 2003.
CDD: a curated Entrez database of conserved domain alignments.Nucleic Acids Research 31, 383–387.
McGuffin, L.J., Bryson, K., Jones, D.T., 2000. The PSIPRED proteinstructure prediction server. Bioinformatics 4, 404–405.
Montero, E., Gonzalez, L.M., Harrison, L.J.S., Parkhouse, R.M.E.,Garate, T., 2003. Taenia solium cDNA sequence encoding a putativeimmunodiagnostic antigen for human cysticercosis. Journal of Chro-matography B 25, 255–269.
Peterman, T.K., Ohol, Y.M., McReynolds, L.J., Luna, E.J., 2004.Patellin1, a novel Sec14-like protein, localizes to the cell plate andbinds phosphoinositides. Plant Physiology 136, 3080–3094.
Rhee, S.G., Bae, Y.S., 1997. Regulation of phosphoinositide-specificphospholipase C enzymes. Biologycal Chemistry 272, 15045–15048.
Rosas, G., Cruz-Revilla, C., Fragoso, G., Lopez-Casillas, F., Perez, A.,Bonilla, M.A., Rosales, R., Sciutto, E., 1998. Taenia crassiceps
cysticercosis: humoral immune response and protection elicited byDNA immunization. The Journal of Parasitology 84, 516–523.
Rost, B., Sander, C., 1993. Prediction of protein secondary structure atbetter than 70% accuracy. Journal of Molecular Biology 232, 584–599.
Sambrook, J., Russell, D.W., 2001. Molecular cloning: a laboratorymanual, Third ed. Cold Spring Harbor: Cold Spring Harbor Labo-ratory Press, New York.
Schantz, P.M., 1996. Taenia solium cysticercosis/Taeniasis is a potentiallyeradicable disease: developing a strategy for action and obstacles toovercome. In: Garcia, H.H., Martinez, M. (Eds.), Teniasis/Cisticerco-sis por T. solium. I.C.N., Lima, Peru, pp. 227–230.
Senapathy, P., Shapiro, M.B., Harris, N.L., 1990. Splice junctions, branchpoints sites and exons: sequence statistics, identification, and applica-tions to the genome project. Methods in Enzymology 183, 252–278.
Sha, B., Luo, M., 1999. PI transfer protein: the specific recognition ofphospholipids and its functions. Biochemical et Biophysica Acta 1441,268–277.
Sha, B., Phillips, S.E., Bankaitis, V.A., Luo, M., 1998. Crystal structure ofthe Saccharomyces cerevisiae phosphatidylinositol-transfer protein.Nature 391, 506–509.
Short, J.M., Fernandez, J.M., Sorge, J.A., Huse, W.D., 1988. LambdaZap: a bacteriophage lambda expression vector with in vivo excisionproperties. Nucleic Acids Research 16, 7583–7600.
Southern, E.M., 1975. Detection of specific sequences among DNAfragments separated by gel electrophoresis. Journal of MolecularBiology 98, 503–517.
Stack, J.H., Herman, P.K., Schu, P.V., Emr, S.D., 1993. A membraneassociated complex containing the vps15 protein kinase and the vps 34Pi3-kinase is essential for protein sorting to the yeast lysosome-likevacuole. The EMBO Journal 14, 3339–3348.
Swigart, P., Insall, R., Wilkins, A., Cockcroft, S., 2000. Purification andcloning of phosphatidylinositol transfer proteins from Dyctyostelium
didcoideum: homologues of both mammalian PITPs and Saccharomy-
ces cerevisiae Sec14p are found in the same cell. Biochemistry Journal347, 837.
Toker, A., 1998. The synthesis and cellular roles of phosphatidylinositol4,5-bisphosphate. Current Opinion in Cell Biology 10, 254–261.
Wang, X., Huynh, H., Gjorloff-Wingren, A., Monosov, E., Stridsberg, M.,Fukuda, M., Mustelin, T., 2002. Enlargement of secretory vesicles byprotein tyrosine phosphatase PTP-MEG2 in rat basophilic leukaemiamast cells and jurkat T cells. Journal of Immunology 168, 4612–4619.
White, A.C., 1997. Neurocysticercosis. A major cause of neurologicaldisease worldwide. Clinical Infectious Diseases 24, 101–113.
Yang, Z.Q., Zuo, Y.X., Yao, Y.G., Chen, X.W., Yang, G.C., Zhang,Y.P., 2001. Analysis of the 18S rRNA genes of Sarcocystis speciessuggests that the morphologically similar organisms from cattle andwater buffalo should be considered the same species. MolecularBiochemical Parasitology 115, 283–288.