R

S(

ARa

b

a

ARRA

KTSsSPM

1

icisH(

Sl

0d

Veterinary Immunology and Immunopathology 140 (2011) 252–258

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology

journa l homepage: www.e lsev ier .com/ locate /vet imm

esearch paper

equence analysis of Toll-like receptor genes 1–10 of goatCapra hircus)

. Rajaa, A.R. Vignesha,1, B. Ann Marya,1, K.G. Tirumurugaana, G. Dhinakar Raja,∗,anjith Katariab, B.P. Mishrab, K. Kumanana

Department of Animal Biotechnology, Madras Veterinary College, Chennai 600 007, IndiaDNA Fingerprinting Unit, National Bureau of Animal Genetic Resources, Karnal, Haryana, India

r t i c l e i n f o

rticle history:eceived 24 September 2010eceived in revised form 3 January 2011ccepted 6 January 2011

eywords:oll-like receptorsequencingequence analysisimple modular architecture research tool

a b s t r a c t

This study involved cloning and sequencing of the coding regions of all 10 Toll-like receptor(TLR) genes of goat. Goat TLR 1–10 gene sequences revealed a high degree of nucleotideidentity with sheep and cattle sequences (>90%) and 75–85% with pig, mouse and humansequences. At the amino acid level, 85–99% similarity was observed with sheep and cattleand 60–85% with pig, mouse and human. TLR9c DNA of goat showed the highest aminoacid identity to that of sheep (99%) while TLR8 cDNA showed the lowest identity of 88.7%to that of sheep. Variations were seen in the number of leucine rich repeats (LRRs) of goatTLRs as compared to other ruminant species with maximum differences in the TLR3 gene.Phylogenetic analysis through molecular evolution and genetic analysis (MEGA) software

hylogenetic treeulti dimensional scaling

and multi dimensional scaling revealed a high degree of conservation of goat TLRs withthose from other species. However when the TIR domain of all the TLRs were compared,goat TLR7 TIR alone showed a high divergence of 19.3 as compared to sheep sequences.This is the first report of the full-length cDNA sequences of all the 10 TLR genes of goatswhich would be a useful tool for the study of evolutionary lineages and for phylogenetic

analysis.

. Introduction

During the recent past, there has been rapid progressn understanding the innate immunity against microbialomponents and its critical role in host defense against

nfection. The early concept was that the innate immuneystem of the host nonspecifically recognized microbes.owever, following the discovery of Toll-like receptors

TLRs) in the mid-1990s it has been clearly shown that

Abbreviations: TLR, Toll-like receptor; cDNA, complementary DNA;MART, simple modular architecture research tool; MEGA, molecular evo-ution and genetic analysis; TIR, Toll-interleukin 1 receptor domain.∗ Corresponding author. Tel.: +91 093810 36277; fax: +91 44 25369301.

E-mail address: dhinakarraj@yahoo.com (G.D. Raj).1 Both authors contributed equally to this work.

165-2427/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.vetimm.2011.01.007

© 2011 Elsevier B.V. All rights reserved.

pathogen recognition by the innate immune system isbroadly specific, relying on germline-encoded pattern-recognition receptors (PRRs) that have evolved to detectrelatively conserved components of pathogens referredto as pathogen associated molecular patterns (PAMPs)(Akira et al., 2001; Janeway and Medzhitov, 2002). ThePAMPs recognized by TLRs include lipids, lipoproteins,proteins and nucleic acids derived from a wide range ofmicrobes such as bacteria, viruses, parasites and fungi(Akira et al., 2006). TLRs are type I transmembrane pro-teins with three domains, ecotodomain, transmembraneand Toll-interleukin 1 (IL-1) receptor (TIR) domains. The

ectodomain consists of leucine-rich repeats that medi-ate the recognition of PAMPs, while the cytoplasmic TIRdomain mediates downstream signal transduction.

Binding of ligands to TLRs triggers at least two importantcell signaling pathways. One pathway involves MyD88, an

and Im

A. Raja et al. / Veterinary Immunology

adaptor protein shared by most of the TLRs that leads tothe activation of the transcription factor NF-�B resultingin the release of pro-inflammatory cytokines. The otherpathway involves maturation of antigen-presenting cells(APCs) and increased expression of major histocompatabil-ity complex (MHC) molecules, co-stimulatory molecules,CD40 and interferon beta or Type 1 interferon. Both signalsare essential for the initiation of T cell-mediated immunity(Pasare and Medzhitov, 2004). To date, the TLR family com-prises a total of 13 genes, of which 10 have been identifiedin human, pig, mouse, cattle and sheep (Chang et al., 2006,2009; Werling and Coffey, 2007; McGuire et al., 2006).The ligand recognition regions of TLRs for intracellularpathogens (e.g. viruses), TLR3, 7, 8 and 9, are located in theendosomal compartment within the cytoplasm whereasthe bacterial and fungal ligand recognition regions on TLR1,2, 4, 5, 6 and 10 are found on the cell surface. Species-specific differences in recognition of TLR ligands such assingle-stranded RNA, bacterial DNA and flagellin have beenobserved between man and mouse (Farhat et al., 2010;Keestra et al., 2008; Roberts et al., 2005). These differencesmay be due to distinct selective pressure on each host toadapt to new environments and pathogens.

Significant progress has been made to delineate theTLR’s association with disease resistance and susceptibil-ity in man and mouse. TLR genes in other animals are lesswell defined. With respect to the sequence informationin the public database the full-length sequence data hasbeen reported for 10 TLR genes in human, mouse, pig, cat-tle, sheep and chicken. The TLR10 counterpart of humanhas not been reported in mouse however it is thought tobe a non-functional pseudogene (Takeda and Akira, 2005).There is a paucity of information with respect to goats(Capra hircus). Knowledge of the innate immune mecha-nism and signaling mediated through TLRs could providemore insight into the disease resistance of goats. Esteveset al. (2008) showed that neonatal goats expressed higherlevels of TH-1 type cytokines to different TLR ligands thanadult goats. There is a recent publication from our groupwhich details the TLR expression profile in different tis-sues in an Indian breed of goat (Tirumurugaan et al., 2010).In this study, we have generated the full-length sequenceinformation of the TLR genes 1–10 and generated a compar-ative analysis with respect to other species namely human,mouse, sheep, pig, chicken and cattle.

2. Materials and methods

2.1. Samples

Peripheral blood samples were collected from one-yearold apparently healthy Barbari breed of goats maintained

at the University Research Farm, Madhavaram, Chennai,India. Peripheral blood mononuclear cells (PBMCs) wereisolated from heparinized blood by centrifugation overHistopaque 1.077 (Sigma, USA) and resuspended in RPMI1640 (Sigma, USA) at 1.5 × 106 cells/ml.

munopathology 140 (2011) 252–258 253

2.2. Isolation of RNA and cDNA Synthesis

Total cellular RNA was isolated from the isolated cellsusing TRIzol reagent (Invitrogen, USA) as per manu-facturer’s protocol. The extracted RNA was checked forits quantity and purity by Biophotometer (Eppendorf,Germany). The cDNA was synthesized by using HighCapacity cDNA synthesis kit (Applied Biosystems, USA) asfollows: 1 �g of RNA in 8 �l of DEPC water was mixed with2 �l of random hexamers and incubated at for 60 ◦C for5 min, snap cooled on ice followed by the addition of 10 �lof 2× cDNA master mix. The cDNA was synthesized by incu-bating at 37 ◦C for 1 h and the enzyme was inactivated at70 ◦C for 10 min.

2.3. Amplification, cloning and sequencing of full-lengthgoat TLR 1–10

The primers for the amplification of the codingsequences of goat TLR genes were designed basedon the full-length sequences of bovine and sheepTLR 1–10 genes using FastPCR software available atwww.biocenter.helsinki.fi/bi/Programs/download.htmland were synthesized at Sigma–Aldrich, India. Each TLRfull-length cDNA was synthesized by using the high-fidelity XT polymerase PCR kit (Genei, Bangalore) usingthe primers and the respective annealing temperatureslisted in Table 1. PCR was performed in a thermal cycler(Mastercycler gradient, Eppendorf, Germany), with initialdenaturation at 94 ◦C for 5 min; 35 cycles of denaturation94 ◦C for 1 min, respective annealing temperatures for1 min and extension at 72 ◦C for 1 min followed by a finalextension at 72 ◦C for 7 min.

The amplified TLR genes were purified by PCR gelextraction kit (M/s. BioBasic, Canada) and cloned into TAvector plasmid (RBC Biosciences, USA) according to man-ufacturer’s instructions. Recombinant plasmid DNA wasextracted from 3 colonies for each gene by using the plas-mid extraction kit (M/s. BioBasic, Canada). The purifiedplasmid DNA was checked for the presence of specific TLRgene inserts by PCR and the recombinant plasmids weresequenced using the Big dye terminator cycle sequencingready reaction kit (Applied Biosystems, California, USA) inan automatic sequencer (ABI Prism 3100, Genetic analyzer,Applied Biosystems, California, USA). Sequencing was per-formed with overlapping primer pairs with the informationgenerated from an earlier study (data not shown). Thesequences were assembled in the SeQman Pro module ofthe Lasergene software V 7.1 (DNASTAR Inc., USA) to obtainthe full-length sequence of each TLR gene.

2.4. Sequence analysis

Sequences of cloned TLR genes were analyzed usingthe Lasergene software package (DNASTAR, London, UK).MegaBlast was used to identify mammalian TLR nucleotide

sequences within the non-redundant nucleotide database(http://www.ncbi.nlm.nih.gov/) by comparison with thegoat TLR sequences obtained. The multiple alignment ofthe TLR 1–10 coding sequences from multiple species wasperformed using the program ClustalX2. The simple mod-

254 A. Raja et al. / Veterinary Immunology and Immunopathology 140 (2011) 252–258

Table 1Details of primers used to amplify goat TLR 1–10 coding sequences.

Gene Accession numbera Sequences 5′–3′ Annealing temperature (◦C) Product size (bp)

TLR1 HQ263209 Forward TTCTGAGCTTCAGATGCCTGAC 60 2299Reverse CATGTTTATATCCATGTCGATGC

TLR2 HQ263214 Forward AAATGCCACGTGCTTTGT 62 2355Reverse CTAGGACCTTATTGCAGCTCTCA

TLR3 HQ263210 Forward AAACGAACTGGATTTGGACTAATG 56 2884Reverse TGAACAGATTTATGTTATTGTCAAGGA

TLR4 HQ263215 Forward CGATGATGGCGCGTGCCCGC 56 2529Reverse CTCAGGTGGAGGTGGTCGCTTC

TLR5 FJ659853 Forward GATCATGGGAGACTGCCTTG 58 2593Reverse GCTCCTTTGCCTAGGAGATGG

TLR6 HQ263211 Forward GTTCTGAAGATAGCAGCAACCCTC 58 2442Reverse AACCTTTCACATCATCATTTTCAGTG

TLR7 HQ263216 Forward ATGGGTGATTTATTCTTATACTTTCAG 58 3398Reverse CTAGGCTGTCTCTTTGAACACCTG

TLR8 HQ263212 Forward ATGACCCTTCACTTTTTGCTTCT 56 3102Reverse TTAGTATTGCTTAATGGAATTGACATACA

TLR9 HQ263217 Forward ATGGGCCCCTACTGTG 60 3091CGTGG

ACCAGTAGTCTG

upaLlaLtsp1ioa2gthgtlo

3

hacggTthtpla

SMART was used to predict the ecto, transmembraneand TIR domains using the deduced amino acid sequencesof goat TLR 1–10 cDNAs (Fig. 1). Among goat TLRs, TLR10had the lowest number of LRRs (17) while TLR9 had the

Reverse CTATTCGGCTGTTLR10 HQ263213 Forward ATCTGAGGTGA

Reverse GCTCTACAGGC

a The accession numbers of goat TLRs sequenced in this study.

lar architecture research tool (SMART) was employed toredict the domain structure of goat TLR 1–10 availablet http://smart.embl-heidelberg.de/ (Schultz et al., 1998).RRfinder (http://www.lrrfinder.com/) is derived from aarge database of unique, naturally occurring LRRs (tLRRdb)llowing the identification of not only highly conservedRR sequences but also those which are more distinct fromhe commonly described LxxLxLxxN/CxL consensus. In thistudy, the LRRfinder is used to detect the number of LRRsresent in the deduced amino acid sequences of all the0 TLRs of goat. It was compared with the correspond-

ng numbers of LRRs in sheep. The amino acid sequencesf TIR domains of each gene of different species wereligned using ClustalX2 and then MEGA 5 (Tamura et al.,007) was used to predict the phylogenetic tree. A phylo-enetic tree of goat TLR 1–10 genes was estimated fromhe amino acid sequences of sheep, cattle, chicken, pig,uman and mouse (Takeda and Akira, 2005). The phylo-enetic tree was drawn by the MEGA programme usinghe Neighbor-Joining method with bootstrap test of phy-ogeny following 1000 replications with a random seedf 111.

. Results

The full-length sequences of the goat TLRs 1–10 cDNAsave been submitted to GenBank for TLRs 1–10 and theirccession numbers are presented in Table 1. The per-ent nucleotide and amino acid identity of the generatedoat TLR cDNA generated sequences with those of TLRenes from selected few other species is shown in Table 2.here was a high degree of identity with sheep and cat-le sequences (>90%) and 75–85% with pig, mouse and

uman sequences. At the amino acid level, 85–99% iden-ity was observed with sheep and cattle and 60–85% withig, mouse and human. The chicken sequences were the

east identical, 55–65% at the nucleotide and 45–60% at themino acid levels. TLR9 cDNA of goat showed highest amino

GATAAAAT 56 2478TTCTGAT

acid identity to those of sheep (99%) while TLR8 had thelowest amino acid identity of 88%.

Fig. 1. Diagrammatic representation of the domains of the Goat TLR1–10. The domains were predicted employing the SMART program(http://smart.embl-heidelberg.de/). All TLRs possessed the LRRs (Leucine

rich repeat) in the ectodomain, – transmembrane do.

A. Raja et al. / Veterinary Immunology and Immunopathology 140 (2011) 252–258 255

Table 2Percentage of nucleotide and amino acid sequence identity of goat TLRs genes with cattle, chicken, human, mouse, sheep and pig analyzed using MEGALIGNof Lasergene programme of DNAStar.

Name Species Nucleotide identity Amino acid identity Accession No.Percentage to goat Percentage to goat

TLR1 Cattle 96.1 94.1 NM 001046504Chicken 61.3 50.6 AB109401Human 82.6 75.4 NM 003263Mouse 76.3 70.6 NM 030682Sheep 97.8 95.9 NM 001135060Pig 87.0 82.5 NM 001031775

TLR2 Cattle 95.5 92.5 NM 174197Chicken 61.3 49.9 FJ915430Human 82.0 74.3 NM 003264Mouse 73.5 65.6 NM 011905Sheep 98.5 97.5 EU580543Pig 84.7 79.5 AB085935

TLR3 Cattle 93.9 89.1 EF076746Chicken 59.6 53.1 EF137861Human 81.4 79.8 NM 003265Mouse 76.6 76.2 NM 126066Sheep 96.8 92.2 NM 001135928Pig 86.2 81.0 NM 001097444

TLR4 Cattle 96.6 94.9 NM 174198Chicken 55.7 44.3 AY064697Human 81.2 75.0 AB445638Mouse 73.8 64.0 NM 021297Sheep 99.3 98.9 NM 001135930Pig 85.5 79.2 AB188301

TLR5 Cattle 94.3 89.2 NM 001040501Chicken 60.0 49.2 NM 001024586Human 82.4 77.8 NM 003268Mouse 74.0 68.8 NM 016928Sheep 99.4 96.6 NM 001135926Pig 85.1 78.6 AB208697

TLR6 Cattle 93.5 89.9 NM 001001159Chicken 60.6 47.9 NM 001007488Human 83.6 76.8 NM 006068Mouse 75.8 69.4 NM 011604Sheep 97.7 95.4 NM 001135927Pig 86.6 81.1 AB208698

TLR7 Cattle 95.4 92.6 NM 001033761Chicken 64.6 60.7 DQ780342Human 84.9 81.2 NM 016562Mouse 79.3 74.8 NM 133211Sheep 96.4 93.7 NM 001135059Pig 88.3 85.6 EF583901

TLR8 Cattle 90.4 85.3 NM 001033937Chicken NA – –Human 74.8 65.5 NM 138636Mouse 69.7 61.3 NM 133212Sheep 93.2 88.7 NM-001135929Pig 78.8 70.8 EF583903

TLR9 Cattle 95.9 95.3 EF076728Chicken NA – –Human 83.6 79.1 NM 017442Mouse 76.9 72.9 NM 031178Sheep 98.5 99.0 NM 001011555Pig 87.6 85.2 AY859728

TLR10 Cattle 93.2 87.9 NM 001076918Chicken NA NA NAHuman 83.5 75.9 AB445680Mouse – – NASheep 95.5 95.5 NM 001135925Pig 85.4 77.6 AB208699

NA, not applicable.

256 A. Raja et al. / Veterinary Immunology and Im

Table 3Number of predicted LRRs using LRR finder in the TLR genes of goat (thisstudy), sheep and cattle.

TLRs No. of LRRs in the ectodomain

Goat (this study) Sheepa Cattlea

TLR1 18 19 14TLR2 18 20 20TLR3 18 24 24TLR4 22 22 22TLR5 22 22 21TLR6 18 20 20TLR7 22 26 26TLR8 21 26 25

hstdit

Mgmtf

cadTut1tt

4

ihs2(ettpcsas6thtd

TLR9 26 26 26TLR10 17 20 20

a Accession numbers of all TLRs used for prediction given in Table 1.

ighest number of LRRs (26). TLRs 4, 5, and 9 of goat andheep had equal numbers of LRRs (22, 22 and 26, respec-ively). In general goat had fewer LRRs than sheep withifferences ranging from 1 to 6 LRRs (Table 3). Variations

n the predicted numbers of LRRs were observed betweenhese species despite their highly conserved sequences.

The phylogenetic analysis of goat TLR genes using theEGA programme indicated a closer relationship of the

oat TLRs to those of sheep and cattle than to the otherammalian sequences (Fig. 2). The tree also revealed that

he goat TLR genes, like other species, grouped in to six TLRamilies.

While comparing only the deduced amino acids thatonstituted the TIR domain of the TLRs using both MEGAnd multidimensional scaling, it was seen that the TIRomain of goat TLR7 diverged from those of sheep and pig.he divergence values of goat TLR7 with sheep, calculatedsing the MEGALIGN programme of Lasergene from DNAS-ar was 6.5 while the respective value for their TIRs were9.3. The phylogenetic relationship of the TIR domains ofhe other TLRs reflected those seen in the tree drawn withhe entire TLR gene sequences.

. Discussion

Although TLR genes have been partially characterizedn most species, the transcripts from all 10 TLR genesave been extensively characterized in only 3 animalpecies, cattle (Obsal et al., 2006; Cargill and Womack,007; Seabury et al., 2007; Sebury and Womack, 2008), pigMorozumi and Uenishi, 2009; Shinkai et al., 2006; Sangt al., 2008) and sheep (Chang et al., 2009). This report ishe first study on sequencing and analysis of all the 10 TLRranscripts from goats. Our results are in accordance withrevious studies on TLR gene sequences from sheep andattle which revealed a high degree of homology acrosspecies (Chang et al., 2009; Nalubamba et al., 2007; Menziesnd Ingham, 2006). Amino acid homologies of goat TLRequences in comparison to other mammals ranged from

1 to 99% while with those of chicken, they were from 44o 61% only. This confirms that TLR sequences are generallyighly conserved and have a common evolutionary ances-or. Despite this high degree of conservation, amino acidifferences did exist between species with TLR8 of goats

munopathology 140 (2011) 252–258

showing up to 81 individual amino acid differences fromthose of sheep.

The protein domain prediction of the TLR cDNAs showedthe typical TLR structure with LRR, TM and TIR domains.The number of LRR domains in the different TLRs of goatsvaried from 17 to 26. Comparing with equivalent LRRdomains of sheep TLRs, it was found that the number ofLRRs in goat TLRs 4, 5 and 9 were similar. All other TLRshad differing numbers of LRRs between species, the dif-ferences being highest for TLR3 of goat (having six LRRsfewer than sheep TLR3) and lowest for TLR1 (goats havingone less LRR compared to sheep) (Chang et al., 2009). Thiscould indicate possible differences in the specific recogni-tion of TLR ligands between sheep and goats despite theirsimilar sequences and domain organization. Although itis considered that the ligands for each TLR is similar indifferent species, the differences in their structures mayalso point to the fact that the TLRs in different speciescould bind to different ligands or that the TLR–ligandinteraction may not induce similar types of responses indifferent species or even in different breeds or animalsof the same species. Our studies with different breeds ofgoats PBMCs stimulated with known specific ligands haveresulted in differential cytokine responses (manuscript inpreparation).

Phylogeny analysis of the TLRs of goats with those ofother species revealed a typical pattern wherein the TLRs1, 6 and 10 and TLRs 7, 8 and 9 were clustered as singlefamilies, respectively. It is documented that TLRs 7, 8 and 9are endosomal and TLRs 1, 6 and 10 act as heterodimers forTLR ligand binding. The phylogenetic analysis based on onlythe LRR also revealed similar patterns although this wasmore likely to predict the grouping based on ligand-bindingproperties (Werling et al., 2009). This same grouping asclades may have also been due to the more conservednature of the TIR domains that play a role in cell signaling.Chicken TLRs were the most divergent. Chicken also areknown to have undergone gene duplication of TLR2 in toTLR2a and TLR2b. Chicken TLR21 is an orthologue of TLR21of fish. TLRs 1LA, TLR 1LB and TLR 15 are unique to birds(Temperley et al., 2008).

The TIR domain is involved in cell signaling through theadaptors MyD88, Mal/TIRAP, TICAM1 and TICAM 2 (Seyaet al., 2006). Phylogenetic analysis of the TIR domains alonewas done in an attempt to identify any particular group-ing of the TLR TIR domains which could be related to theirsignaling mechanisms through the recruitment of specificadaptors. Strangely we found that the TIR of goat TLR7 wasdivergent from other TLRs. When the entire TLR7 of goatand sheep were compared, the amino acid homology was93.7% while comparison of their TIR domains revealed ahomology of only 83%. The implication of this difference isnot known for sure but could mean that the signaling andthe downstream cytokine responses induced by TLR7 lig-and binding could be different in goats. Single stranded RNAis a ligand for TLR7 and the role played by this divergence

of TIR domain of goat TLR7 needs to be explored further.

Multidimensional scaling is used to portray the rela-tive molecular distances between genes. Multidimensionalplots of the TLRs and TIR domains further confirmed theclose clustering of the TLRs and their grouping as seen in

A. Raja et al. / Veterinary Immunology and Immunopathology 140 (2011) 252–258 257

man, m

Fig. 2. Phylogenetic analysis of goat TLR genes 1–10 with cattle, sheep, hustrap values of MEGA 5.0 programme.

the unrooted tree, as well as the divergence of goat TLR7TIR (data not shown).

Polymorphisms have been shown in TLR genes associ-ated with various disease conditions (Lorenz et al., 2000;Ogus et al., 2004). Similarly the difference in the sequencesof TLR genes in goats has to be explored further for theirfunctional relevance. In conclusion, this is the first reportof the full-length cDNA sequences of all the 10 TLR genesof goats which will be a useful tool for the study of evo-lutionary lineages and for phylogenetic analysis. Data onfull-length sequences of the goat TLRs can be used forexpression and functional studies as well as the generationof specific antibodies.

Acknowledgements

This study is funded by the Indian Council of Agricul-tural Research, New Delhi under the National AgriculturalInnovative Project code C2153. The authors thank the TamilNadu Veterinary and Animal Sciences University and itsDirector, Centre for Animal Production Studies for the sup-

ouse, pig and chicken by using Neighbor-Joining method with 1000 boot

port and facilities provided. The authors also thank Dr.K. Thangaraj, Centre for Cellular and Molecular Biology,Hyderabad for his help in phylogenetic analysis.

References

Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteinslinking innate and acquired immunity. Nat. Immunol. 2, 675–680.

Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innateimmunity. Cell 124, 783–801.

Cargill, E.J., Womack, J.E., 2007. Detection of polymorphisms in bovineToll-like receptors 3, 7, 8 and 9. Genomics 89, 745–755.

Chang, J.H., McCluskey, P.J., Wakefield, D., 2006. Toll-like receptors inocular immunity and the immunopathogenesis of inflammatory eyedisease. Br. J. Ophthalmol. 90, 103–108.

Chang, J.S., Russell, G.C., Jann, O., Glass, E.J., Werling, D., Haig,D.M., 2009. Molecular cloning and characterization of Toll-likereceptors 1–10 in sheep. Vet. Immunol. Immunopathol. 127,94–105.

Esteves, I.T., Bernardet, N., Lamande, S.L., Bernard, S.F., Laurent, F., 2008.

Neonatal goats display a stronger TH1-type cytokine response to TLRligands than adults. Dev. Comp. Immunol. 32, 1231–1241.

Farhat, K., Riekenberg, S., Jung, G., Wiesmüller, K.H., Jungi, T.W., Ulmer, A.J.,2010. Identification of full length bovine TLR1 and functional charac-terization of lipopeptide recognition by bovine TLR2/1 heterodimer.Vet. Res. 41, 34.

2 and Im

J

K

L

M

M

M

N

O

O

P

R

S

Werling, D., Coffey, T.J., 2007. Pattern recognition receptors in companion

58 A. Raja et al. / Veterinary Immunology

aneway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu.Rev. Immunol. 20, 197–216.

eestra, A.M., de Zoete, M.R., van Aubel, R.A., van Putten, J.P., 2008.Functional characterization of chicken TLR5 reveals species-specificrecognition of flagellin. Mol. Immunol. 45, 1298–1307.

orenz, E., Mira, J.P., Cornish, K.L., Arbour, N.C., Schwartz, D.A., 2000. Anovel polymorphism in the Toll-Like receptor 2 gene and its poten-tial association with staphylococcal infection. Infect. Immun. 68,6398–6401.

cGuire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J., Jann, O., 2006.Radiation hybrid mapping of all 10 characterized bovine Toll-likereceptors. Anim. Genet. 37, 47–50.

enzies, M., Ingham, A., 2006. Identification and expression of Toll-likereceptors 1–10 in selected bovine and ovine tissues. Vet. Immunol.Immunopathol. 109, 23–30.

orozumi, T., Uenishi, H., 2009. Polymorphism distribution and structuralconservation in RNA-sensing Toll-like receptors 3, 7 and 8 in pigs.Biochim. Biophys. Acta 1790, 267–274.

alubamba, K.S., Gossner, A.G., Dalziel, R.G., Hopkins, J., 2007. Dif-ferential expression of pattern recognition receptors in sheeptissues and leukocyte subsets. Vet. Immunol. Immunopathol. 118,252–262.

bsal, M.A., Vage, D.I., Hayes, B., Berget, I., Lien, S., 2006. Genomic orga-nization and transcript profiling of the bovine Toll-like receptor genecluster TLR6–TLR1–TLR10. Gene. 384, 45–50.

gus, A.C., Yoldas, B., Ozdemir, T., Uguz, A., Olcen, S., Keser, I., Coskun, M.,Cilli, A., Yegin, O., 2004. The Arg753Gln polymorphism of the humanToll-like receptor 2 gene in tuberculosis disease. Eur. Respir. J. 23,219–223.

asare, C., Medzhitov, R., 2004. Toll-dependent control mechanisms ofCD4 T cell activation. Immunity 21, 733–741.

oberts, T.L., Sweet, M.J., Hume, D.A., Stacey, K.J., 2005. Cuttingedge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides. J. Immunol. 174,605–608.

ang, Y., Yang, J., Ross, C.R., Rowland, R.R.R., Blecha, F., 2008. Molec-ular identification and functional expression of procine Toll-like

munopathology 140 (2011) 252–258

receptor (TLR) 3 and TLR7. Vet. Immunol. Immunopathol. 125,162–167.

Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple mod-ular architecture research tool: identification of signaling domains.Proc. Natl. Acad. Sci. U.S.A. 95, 5857–5864.

Seabury, C.M., Cargill, E.J., Womack, J.E., 2007. Sequence variability andprotein architectures for bovine Toll-like receptors 1, 5, and 10.Genomics 90, 502–515.

Sebury, C.M., Womack, J.E., 2008. Analysis of sequence variability andprotein domain architectures for bovine peptidoglycan recognitionprotein 1 and Toll-like receptors 2 and 6. Genomics 92, 235–245.

Seya, T., Akazawa, T., Tsujita, T., Matsumoto, M., 2006. Role of Toll-like receptors in adjuvant-augmented immune therapies. Evid. BasedComplement. Alternat. Med. 3, 133–137.

Shinkai, H., Muneta, Y., Suzuki, K., Eguchi-Ogawa, T., Awata, T., Uenish, H.,2006. Porcine Toll-like receptor 1, 6, and 10 genes: complete sequenc-ing of genomic region and expression analysis. Mol. Immunol. 43,1474–1480.

Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. Int.Immunol. 17, 1–14.

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolu-tionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol.24, 1596–1599.

Temperley, N.D., Berlin, S., Paton, I.R., Griffin, D.K., Burt, D.W., 2008. Evo-lution of the chicken Toll-like receptor gene family: a story of genegain and gene loss. BMC Genomics 9, 62–74.

Tirumurugaan, K.G., Dhanasekaran, S., Raj, G.D., Raja, A., Kumanan, K.,Ramaswamy, V., 2010. Differential expression of Toll-like recep-tor mRNA in selected tissues of goat (Capra hircus). Vet. Immunol.Immunopathol. 133, 296–301.

and farm animals—the key to unlocking the door to animal disease?Vet. J. 174, 240–251.

Werling, D., Jann, O.C., Offord, V., Glass, E.J., Coffey, T.J., 2009. Varia-tion matters: TLR structure and species-specific pathogen recognition.Trends Immunol. 30, 124–130.