notch activation induces neurite remodeling and functional modifications in sh-sy5y neuronal cells

Notch Activation Induces Neurite Remodeling andFunctional Modifications in SH-SY5Y Neuronal Cells

Giulia Ferrari-Toninelli,1 Sara Anna Bonini,1 Daniela Uberti,1 Francesco Napolitano,2

Maria Stante,2 Federica Santoro,2 Giuseppina Minopoli,2 Nicola Zambrano,2

Tommaso Russo,2 Maurizio Memo1

1 Department of Biomedical Sciences and Biotechnologies, and National Instituteof Neuroscience - Italy, University of Brescia, Brescia, Italy

2 CEINGE biotecnologie avanzate, Dipartimento di Biochimica e Biotecnologie Mediche,Universita di Napoli Federico II, Napoli, Italy

Received 7 October 2008; revised 23 December 2008; accepted 12 January 2009

ABSTRACT: Notch proteins are definitely recog-

nized as key regulators of the neuronal fate during

embryo development, but their function in the adult brain

is still largely unknown. We have previously demonstrated

that Notch pathway stimulation increases microtubules

stability followed by the remodeling of neuronal morphol-

ogy with neurite varicosities loss, thicker neuritis, and

enlarged growth cones. Here we show that the neurite

remodeling is a dynamic event, dependent on transcrip-

tion and translation, and with functional implications. Ex-

posure of differentiated human SH-SY5Y neuroblastoma

cells to the Notch ligand Jagged1 induces varicosities loss

all along the neurites, accompanied by the redistribution

of presynaptic vesicles and the decrease in neurotrans-

mitters release. As evaluated by time lapse digital imaging,

dynamic changes in neurite morphology were rapidly re-

versible and dependent on the activation of the Notch sig-

naling pathway. In fact, it was prevented by the inhibition

of the proteolytic c-secretase enzyme or the transcription

machinery, and was mimicked by the transfection of the

intracellular domain of Notch. One hour after treatment

with Jagged1, several genes were downregulated. Many of

these genes encode proteins that are known to be involved

in protein synthesis. These data suggest that in adult neu-

rons, Notch pathway activates a transcriptional program

that regulates the equilibrium between varicosities forma-

tion and varicosities loss in the neuronal presynaptic com-

partment involving the expression and redistribution of

both structural and functional proteins. ' 2009 Wiley Period-

icals, Inc. Develop Neurobiol 69: 378–391, 2009

Keywords: neuroplasticity; pre-synaptic varicosities;

gene profile; protein synthesis; NA release

INTRODUCTION

Notch transmembrane receptor proteins are at various

degrees involved in neuronal fate specification during

embryonic brain development (Gaiano and Fishell,

2002). Upon the binding to specific ligands, Notch

receptors undergo a proteolytic processing, resulting

in the release of a Notch intracellular domain (NICD)

that translocates to the nucleus (Stump et al., 2002;

Irvin et al., 2004; Hu et al., 2006) and activates Notch

target genes, such as the Hairy and Enhancer of Split

(HES) homologues HES1 and HES5 (see Kageyama

and Ohtsuka, 1999). It was demonstrated that this

pathway controls neuronal fate specification during

embryonic brain development (Louvi and Artavanis-

Tsakonas, 2006). However, the possible role of Notch

in the adult brain was also recently considered and

Additional Supporting Information may be found in the onlineversion of this article.

Correspondence to:M. Memo ([email protected]).Contract grant sponsor: Ministry of Education, University and

Research, Italy; contract grant number: PRIN 2007.

' 2009 Wiley Periodicals, Inc.Published online 4 March 2009 in Wiley InterScience (www.interscience.wiley.com).DOI 10.1002/dneu.20710

378

many results suggest that its main targets are the syn-

aptic contacts. In postmitotic neurons, Notch activa-

tion by cell–cell contact is responsible for neurite

elongation and retraction as well as for neurite

branching, indicating that cross-talk between Notch

receptors and their ligands on the adjacent cells is

crucial for the stability and/or plasticity of neuronal

connections (Sestan et al., 1999). Notch pathway also

controls the postsynaptic compartment by regulating

dendrite outgrowth and branching (Redmond et al.,

2000). Recent studies showed that stimulation of

Notch by cell–cell contact or neurotrophic factors

affects dendrite morphology and the ratio of excita-

tory/inhibitory synaptic terminals in hippocampal

cultured cells (Salama-Cohen et al., 2005, 2006).

Moreover, excitotoxic stimuli induced Notch protein

activation in adult brain; this observation suggested

us the possible Notch pathway involvement in degen-

erative processes (Ferrari-Toninelli et al., 2003; Grilli

et al., 2003). However, the molecular mechanisms by

which Notch signaling regulates neuronal morphol-

ogy and plasticity remain to be clarified.

Most of the studies were directed to identify the

Notch function in the postsynaptic compartment,

while little is known about the possible effects of

Notch signaling at the presynaptic compartment

level.

Structurally, the presynaptic network is assured by

the presence of varicosities, dynamic structures that

remodel their morphology in response to a variety of

stimuli (De Paola et al., 2003; Nikonenko et al.,

2003; Udo et al., 2005; Umeda et al., 2005). De novoprotein synthesis makes these structural changes pos-

sible (De Paola et al., 2003).

We have previously demonstrated that Notch path-

way stimulation induces, in primary cortical neurons,

an axonal remodeling with varicosities loss, as a con-

sequence of cytoskeleton reorganization (Ferrari-

Toninelli et al., 2008). In this study, we focused on

the plasticity of neurite varicosities, using as cellular

model brain derived neurotrophic factor (BDNF) dif-

ferentiated SH-SY5Y neuroblastoma cells. These

cells have been previously morphologically charac-

terized as neuronal-like cells generating neurites with

several branches and varicosities (Encinas et al.,

2000; Jamsa et al., 2004). An elevated cell–cell con-

tact was simulated by adding to the culture medium a

synthetic and soluble form of the ligand Jagged1, pre-

viously shown to bind and activate Notch receptor

(Nickoloff et al., 2002). Notch pathway was found to

regulate neurite varicosities plasticity through the

modulation of several genes expression, some of

which encode members of the translational machin-

ery of neurons.

METHODS

Cell Culture

Human SH-SY5Y neuroblastoma cell line (DSMZ,

Braunschweig, GERMANY) was cultured in a 1:1 mixture

of Ham’s F12 nutrient and Dulbecco’s modified Eagle’s

medium (DMEM, Sigma-Aldrich, St. Louis, MO) supple-

mented with 10% fetal bovine serum (FBS, Sigma-

Aldrich), 2 mM L-glutamine, 50 lg/mL penicillin and

100 lg/mL streptomycin (Sigma-Aldrich). Cells were

grown at 378C in a 95% air–5% CO2 humidified incubator.

For differentiation, accordingly with Encinas et al. (2000),

cells were treated with 10 lM retinoic acid for 5 days in

complete growth medium. Then culture media were

removed and cells were grown for additional 5 days in se-

rum-free DMEM containing 50 ng/mL Brain Derived Neu-

rotrophic Factor (BDNF; Sigma-Aldrich).

Antibodies

The following antibodies were used: monoclonal anti-bIIItubulin (Promega, Madison, WI) (1:1.000); polyclonal anti-

a actin (Sigma-Aldrich, St. Louis, MO) (1:200); polyclonal

anti-synapsin I (EMD Biosciences, LaJolla, CA, USA)

(1:400); polyclonal anti-c-Myc (Sigma-Aldrich, St. Louis,

MO) (1:1.500); polyclonal anti-L7a (kind gift of Prof. Con-

cetta Pietropaolo) (1:50).

Conjugated CY3, CY2 (Jackson ImmunoResearch Lab-

oratories, Inc., West Grove, PA) and FITCH (Sigma-

Aldrich, St. Louis, MO) were used as secondary antibodies.

Immunocytochemistry andConfocal Analysis

Cells were plated with a density of 250.000/well in a

24 wells plate, grown on glass coverslip (coated with poly-

L-lysine, Sigma-Aldrich), then fixed. Cells were incubated

in Phosphate Buffered Saline (PBS, Sigma-Aldrich) con-

taining 1% of Bovine Serum Albumin (BSA, Sigma-

Aldrich) and 0.2% Triton 3100 overnight at 48C with the

appropriate antibody. After rinses, cells were incubated

with the secondary antibody in PBS for 1 hr at room tem-

perature. Slice were mounted and examined by a Olympus

IX51 inverted fluorescence microscope (Olympus America,

Inc., Center Valley PA). Confocal analysis was performed

by a ZEISS LSM 510 META confocal laser scanning

microscope (Carl Zeiss, Germany).

Drug Treatments

Jagged1 (CDDYYYGFGCNKFCRPR, corresponding to

Jagged1 residues 188-204) or the scrambled peptide

(RCGPDCFDNYGRYKYCF) were synthesized according

to Nickoloff et al. (2002) (Primm srl, San Raffaele Biomed-

ical Science Park, Milan, Italy) and added to the culture me-

dium at different concentrations and for different times, as

Jagged-Induced Neurites Plasticity 379

Developmental Neurobiology

indicated. To wash the peptide out, cell culture medium

was removed and replaced with the original one (DMEM

plus BDNF).

The transcription inhibitor actinomycin-D (Act-D)

(Sigma-Aldrich, St. Louis, MO) was added at 6 lg/ml con-

centration to the culture medium 1 and 24 hr before the

treatment with Jagged1. c-Secretase inhibitor IV (CALBIO-

CHEM, EMD Biosciences, La Jolla, CA, USA) was added

to the culture medium at 10 lM 30 min before Jagged1 pep-

tide. All these experimental conditions were devoid of cyto-

toxic effects.

Measurement of [3H]NA Release

Noradrenaline (NA) release from SH-SY5Y differentiated

cells was measured according to Hartness et al. (2001).

Briefly, cells were preloaded with 50 nM [3H]NA in Hepes

Buffered Saline (HBS) with or without Jagged1, for 1 hr at

378C. Then the excess of [3H]NA was removed by washing

the cell monolayer with HBS. [3H]NA release was meas-

ured in the culture media of cells incubated for 5 min with

HBS (basal release) or HBS containing 40 mMNaCl/100 mM

KCl (K+-stimulated release). To calculate the total amount

of [3H]NA taken up by the cells, unreleased [3H]NA in the

cell monolayer was extracted with two 0.4 mL aliquots of

0.4M HClO4. Culture media and HClO4 cell extracts were

collected in scintillation vials to which 3 ml Goldstar multi-

purpose liquid scintillation cocktail (Meridian, Surrey, UK)

was added. Vials were counted in a Packard 2100TR liquid

scintillation analyser. [3H]NA release was expressed as a

percentage of radioactivity in the culture media compared

to the total radioactivity incorporated by the cells. All

assays were carried out in duplicate.

Plasmids and Transfection

Myc-tagged Notch plasmids were generated according to

Zambrano et al. (2004). C-promoter binding factor 1

(CBF1)-luc construct was synthesized according to Hsieh

et al. (1996). Briefly, four copies of CBF-1 binding ele-

ments (GATCTGGTGTAAACACGCCGTGGGAAAAAA

TTTATG) were cloned in a simian virus 40 promoter-

driven luciferase reporter construct (Gl2pro, Promega,

Madison, WI) to generate 4xwtCBF1 luc.

5 lg of each plasmid were transfected in differentiated

SH-SY5Y cells using Lipofectamine 2000 (Invitrogen

Corporation CA, USA); cells were fixed 24 hr after trans-

fection and analyzed by immunofluorescence and confocal

analysis.

CBF1 Transactivation Assay

Five micrograms of Notch1 cDNA encoding constitutively

actived truncated Notch1 (NICD) were cotransfected with

5 lg of the C-promoter binding factor-luciferase reporter

(CBF1-luc) plasmide into BDNF differentiated SH-SY5Y.

Cell lysates were harvested 24 hr post transfection and

assayed for luciferase activity using the Dual Luciferase

Reporter Assay System (Promega, Madison, WI) and a

1450 microbeta Trilux counter (Perkin Elmer, Massachu-

setts, USA). In all experiments, cell extracts were equalized

for total proteins.

Time Lapse Videomicroscopy ofGFP-Transfected SH-SY5Y Cells

BDNF differentiated SH-SY5Y neuroblastoma cells were

transfected with a Green Fluorescent Protein encoding plas-

mid (p-EGFP N-1 vector, Clonthech, CA) using the Lipo-

fectamine 2000 (Invitrogen Corporation, California, USA)

according to the manufacturer’s instructions; briefly, 125 3103 cells were seeded in a 24-well plate and differentiated

with a sequential treatment of retinoic acid and BDNF. Af-

ter the differentiation, 5 lg of p-EGFP plasmid were used

for each transfection. 24 hr post transfection, the medium

was changed and cells were analyzed by confocal videomi-

croscopy.

For time-lapse videomicroscopy, cells were maintained

at 378C in a 5% CO2 live-cell incubation chamber (Inku-

bator XL-3, PeCon GmbH, Germany) mounted on a ZEISS

LSM510 META confocal microscope (Carl Zeiss, Ger-

many) and equipped with a CO2 controller and a heating

unit (PeCon GmbH, Germany). Fluorescent images were

captured every 5 min for 1 hr using the Time Series Control

program of LSM Image Examiner software (Carl Zeiss,

Germany). For Jagged1 treatment, the peptide was added at

the culture medium, then the cells were observed for 1 hr,

taking the fluorescent images every 5 min. After Jagged1

treatment, the peptide was removed changing the culture

medium and the cells were observed for 1 hr, taking the flu-

orescent images every 5 min.

Array Analysis

Total RNA was extracted with TRIzol (Invitrogen, Carls-

bad, CA) from differentiated SH-SY5Y cells treated with

40 lM Jagged1 for 1 hr or with control peptide. cRNA was

generated by using the Affymetrix One-Cycle Target Label-

ing and Control Reagent kit (Affymetrix, Inc., Santa Clara,

CA), following the manufacturer’s protocol. The biotinyl-

ated cRNAs were hybridized to the U133 Plus 2.0

Affymetrix DNA chips, containing over 22,500 probe sets

representing greater than 18,000 transcripts derived from

approximately 14,500 well-substantiated human genes.

Chips were washed and scanned on the Affymetrix Com-

plete GeneChip1 Instrument System, generating digitized

image data (DAT) files. Each experimental point was in

triplicate. DAT files were analyzed by GCOS (Affymetrix,

Inc.). The expression values obtained were analyzed using

GeneSpring 7.1 (Silicon Genetics, Redwood City, CA).

Real-Time PCR

Total RNA was isolated as described above. For quantita-

tive real time PCR, cDNAs were synthesized in a Gene

380 Ferrari-Toninelli et al.


AMP PCR system 9700 from 1 lg of total RNA in 20 lLreaction containing 13 RT buffer with MgCl2 5 mM, DTT

10 mM, random examers 5 mM, dNTP 1 mM, RNase inhib-

itor 1 U/mL and Reverse Transcriptase (M-MLV Reverse

Transcriptase, Invitrogen) 10 U/mL. The reaction was incu-

bated at 708C for 10 min and then at 258C for 10 min, fol-

lowed by 428C for 45 min and 998C for 3 min. SYBR

Green-based real time PCR was used to determine cDNA

levels. Aliquots of cDNA were amplified in an iCycler iQ

Real-Time PCR Detection System (Biorad, Hercules,

CA, USA) using iQTM SYBR Green Supermix in tripli-

cate in 25 ll reaction volumes. The sequences of the pri-

mer pairs used were: hHES1: forw 50-CTCTCTTCCCTCCGGACTCT, rev 50-AGGCGCAATCCAATATGAAC;hGAPDH: forw 50-TGCTAAGCAGTTGGTGGTGC, rev

50-AACAGCCTCAAGATCATCAGCA; x-CT (solute car-

rier family 7, member 5): forw 50-GAAGGCACCAAACTGGATGTG, rev 50-GACGAAATTCAAGTAATTCCATCCTC; Tyrosyl-t-RNA synthetase: forw 50-AGCTCAGCAAAGAGTACACACTAGATGT, rev 50-AATCGTGCTGTGTGACCACG; Glycyl t-RNA synthetase: 50-GCTGTTGAACAGGGTGTGATTAATAA, rev 50-GGTAGATGCGGCCAATGAA; Cysteinyl t-RNA synthetase: 50-TGCCTGAGGCCGTTGG, rev 50-AGGTCACCTTCCCCTTCTTGAAM; Eukaryotic translation initiation factor 5: 50-GGCCTCCAACGTATCCCAC, rev 50-TCTGTGCTCCCAGCTCACAA.

PCR cycling conditions were: 958C for 5 min and 40

cycles of 958C for 15 sec and 608C for 1 min. Expression

levels were calculated relative to Glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) mRNA levels as

endogenous control. Relative expression was calculated as

2(Ct test gene � Ct GAPDH) (Bevilacqua et al., 2005).

Statistical Analysis

Statistical analyses were performed by one-way analysis of

variance followed by Bonferroni’s multiple comparison test

as post-hoc analysis or by t-test analysis. Data are presentedas means 6 s.e. A probability of less than 0.05 was consid-

ered as a significant difference.

RESULTS

Human SH-SY5Y neuroblastoma cells were differen-

tiated with a sequential treatment of retinoic acid and

BDNF in order to obtain a nearly pure population of

human neuronal differentiated cells (Encinas et al.,

1999; Ferrari-Toninelli et al., 2004; Jamsa et al.,

2004). After differentiation, cells presented many of

the characteristics of primary cultured neurons

including arrest in the G1 phase of cell cycle; they

were also stable for at least 2-3 weeks showing nei-

ther signs of cellular degeneration nor reversion of

the neuronal phenotype (Encinas et al., 2000).

To validate BDNF-differentiated SH-SY5Y as

useful model for studying neurite morphology, cells

were analyzed by immunofluorescence with some of

the most common structural markers. As shown in a

representative picture in Figure 1(A), after bIII tubu-lin immunostaining, the phenotype of differentiated

cells showed rounded cell bodies and numerous

branching points. One of the main morphological fea-

tures of these cells was the presence of varicosities

along the neurites that appeared as membrane swel-

lings of various sizes.

To investigate the nature of these structures, dou-

ble labeling experiments were performed with anti-

bodies staining synaptic vesicles (anti-synapsin I) and

neuronal cytoskeleton architecture (anti-bIII tubulin

and a actin). Double immunofluorescence experi-

ments conducted with antibodies against bIII tubulin(panel B) and a actin (panel C) allowed us to detect

different types of varicosities in SH-SY5Y cells. In

fact, a actin-labeled filopodia-like structures were

detected in about 50–60% of the varicosities (panel

D, arrows). Presynaptic filopodia-like structures were

defined as actin rich dynamic protrusions of at least

0.5 lm in length that take part in remodeling of pre-

synaptic varicosities (Nikonenko et al., 2003) and

were suggested to be involved in the initiation of syn-

aptic contacts (Chang and De Camilli, 2001). At least

two types of varicosities were found in primary neu-

rons: more stable varicosities which originate filopo-

dia and en passant dynamic varicosities, which

undergo to a more rapid turnover (De Paola et al.,

2006). The presence of varicosities with filopodia and

without filopodia in SH-SY5Y could indicate the

presence of two varicosities type also in this cellular

model.

Double immunofluorescence experiments con-

ducted with antibodies against bIII tubulin (panel E)

and synapsin I (panel F) showed that varicosities

were filled with vesicles (panel G).

Jagged1 Ligand Induces DynamicRemodeling in Cell Neurites

Jagged1 protein is a Notch ligand known to induce

cleavage of Notch receptor and NICD translocation

(Gray et al., 1999). To investigate the effects of

Notch activation, differentiated SH-SY5Y neuronal

cells were exposed to a soluble synthetic peptide

including the Jagged1 residues 188–204 that is

endowed with Notch agonist activity in vitro. Controlexperiments were performed using a scrambled

peptide without agonist activity (Nickoloff et al.,

2002). Cells were treated with Jagged1 or the



Figure 1 Morphological analysis of differentiated SH-SY5Y neuroblastoma cells. Cells were

differentiated with 10 lM retinoic acid and 50 nM BDNF, as described in the method section. Im-

munofluorescence with anti-bIII tubulin antibody (A) reveals the presence of several branches and

varicosities along the neurites. B–G: Details of neurites. B–D: Confocal analysis of neurites immu-

nostained with anti-bIII tubulin (red) and anti-a actin (green) antibodies shows the presence of filo-

podia-like structures originated from the varicosities (panel D, arrows). E–G: Confocal analysis of

neurites immunostained with anti-bIII tubulin (red) and anti-synapsin I (green) antibodies; in g,

synapsin I positive vesicles (yellow) appear accumulated into the varicosities. Scale bar: in A

50 lm; in G 5 lm. [Color figure can be viewed in the online issue, which is available at www.

interscience.wiley.com.]

Figure 2 Effect of Notch ligand Jagged1 on SH-SY5Y cell morphology. BDNF-differentiated SH-

SY5Y cells were treated with 40 lM Jagged1 for 1 hr and then immunostained with anti-bIII tubulinantibody. A: Representative neurite from control, Jagged1-treated and Jagged1-washed out cells.

Scale bar, 5 lm. B: After exposure to Jagged1 for 1 hr, culture media was replaced and cells were

incubated for additional 30 min or 60 min, as indicated. Values are expressed as number of neurites

with varicosities and represent the mean6 s.e.m. values of least four separate experiments, each per-

formed in triplicate. Error bars indicate s.e.m.; *p < 0.001 vs corresponding control values. [Color

figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]



Figure 3 Time lapse videomicroscopy of GFP-transfected SH-SY5Y cells. SH-SY5Y differentiated

cells were transfected with a Green Fluorescent Protein encoding plasmid (p-EGFP N-1 vector, Clon-

thech, CA, USA) and observed in time lapse videomicroscopy after 24 h post transfection. Neurite

tracts of about 50 lm were selected. Upper panel: living control SH-SY5Y cells showed several vari-

cosities along the neurite, as previously showed in fixed, immunostained cells. In the images sequence,

the varicosities resulted maintained all along the observation time period. Middle panel: Jagged1 was

added at the culture medium, then the cells were observed for 1 hr, taking the fluorescent images every

5 min. Representative images of the temporal dynamics of the phenomenon were chosen for the pic-

tures. During this time period, cells modified their morphology, with a complete varicosity loss along

the neurite and the retraction of filopodia-like structures (arrows). Lower panel: after Jagged1 treatment,

the peptide was removed changing the culture medium and the cells were observed for 1 hr. During the

recovery time period after Jagged1 wash out the reappearance of varicosities along the neurite was

observed. [Color figure can be viewed in the online issue, which is available at www.interscience.

wiley.com.]

Figure 4 (see legend on following page)

scrambled peptide and then analyzed by immunofluo-

rescence using the anti-bIII tubulin antibody, as

shown in representative pictures in Figure 2(A).

Jagged1 was added to the culture medium at vari-

ous concentrations ranging from 10 to 100 lM. Forty

micromolar resulted the concentration with the great-

est efficacy and without toxicity for the cells. Cells

were also exposed to 40 lM Jagged1 peptide for dif-

ferent time periods ranging from 30 min to 48 hr. One

hour of exposure was found to be the shortest time

required to significantly affect neurite morphology.

The number of neurites with varicosities was

quantified and statistically analyzed [Fig. 2(B)];

counts were made on 50 fields for each experimental

case of at least 10 different experiments. Images of

neurite segments of 50–140 lm in length were taken.

About 80% of neurites (81.1 6 0.6) presented

varicosities in control cells; we have considered as

varicosities neurite swellings from 2 lm in long

diameter. The varicosity density was of 15 6 3 for

100 lm. One hour after 40 lM Jagged1 exposure, the

number was decreased to about 40% (40.1 6 0.3). No

morphological changes were detectable in cells

treated for 1 hr with Jagged1 scrambled peptide (80.1

6 0.7% of neurites with varicosities).

In central nervous system axons, varicosities were

demonstrated to be dynamic structures with various

degree of stability, as they can also disappear or

change morphology with protrusion of filopodia and

formation of new synaptic sites. These dynamic

behavior depends on the contacts between varicos-

ities and post-synaptic densities and is regulated by

the signals produced by the adjacent cells (De Paola

et al., 2003). To evaluate the dynamics of the

Jagged1-induced loss of neurite varicosities, cells

were treated with 40 lM Jagged1 for 1 hr and then

the peptide was washed out from the culture medium

at different time points (30 and 60 min). As shown in

representative pictures [Fig. 2(A)], wash out of

Jagged1 resulted in the reversal of the Jagged1-

induced loss of neurite varicosities. Count of varicose

neurites were statistically analyzed and the results

shown in the histogram in Figure 2(B). Thirty

minutes wash out was sufficient to partially recover

the Jagged-induced loss of neurite varicosities with a

progressive increase in the number of neurites with

varicosities at 1 hr (65.4 6 0.4). These observations

lead to consider the loss and reconstitution of varicos-

ities as a dynamic event that undergoes to rapid modi-

fication in response to stimulation by Jagged1. To

validate this hypothesis, SH-SY5Y cells expressing

GFP protein were treated and analyzed by time-lapse

videomicroscopy. Ten cells for each treatment (n ¼10 control cells; n ¼ 10 Jagged1 treated cells; n ¼ 10

cells after Jagged1 wash out) were observed to obtain

time lapse images. Neurites segments (about 50 lmin length) were analyzed over periods of at least

60 min, with images taken every 3–5 min. Figure 3

shows representative images of the temporal dynam-

ics of the phenomenon. In absence of external manip-

ulations, axonal varicosities appeared as stable struc-

tures without spontaneous formation of filopodia-like

structures, new varicosities or varicosities remodeling

(Fig. 3, upper panel). Addition of Jagged1 peptide to

the culture medium for 60 min resulted in a time-de-

pendent structural remodeling with the progressive

loss of the varicosities and the formation of a thicker

neurite in all the analyzed neurites (n ¼ 10). The re-

traction of filopodia-like structures present along the

neurite was also detectable (n ¼ 2). Varicosities

remodeling were rapid and resulted completed in 25–

30 min; during the other 30 min, neurite morphology

remained unchanged without new varicosities forma-

tion (Fig. 3, middle panel). This mechanism was rap-

idly reversible only by washing out Jagged1 from the

medium (Fig. 3, lower panel).

Loss and Recovery of Varicosities AreAccompanied by Functional Oscillations

Synapsin I is one of the prominent components of

presynaptic vesicles involved in anchoring vesicles to

the presynaptic boutons (Kushner et al., 2005). In

normal conditions, it is clustered in the varicosities.

Jagged1 treatment induced redistribution of synapsin

I which resulted disperse along the neurite

[Fig. 4(A)]. This observation suggests that the drastic

Figure 4 Effect of Notch ligand Jagged1 on vesicle distribution and neurotransmitter release

in SH-SY5Y cells. A: Representative neurite from control (a) and Jagged1-treated cells (b) immuno-

stained with an anti-synapsin I antibody. Scale bar (in a), 5 lm. B. [3H]NA release in basal condition

(white columns) and after K+ stimulus (gray columns) in control, Jagged1-treated and Jagged1-

washed out cells. [3H]NA release was expressed as a percentage of radioactivity in the culture media

compared to the total radioactivity incorporated by the cells. Data are mean 6 s.e.m. values of four

separate experiments each performed in duplicate. §p < 0.05 vs basal values of control. [Color figure

can be viewed in the online issue, which is available at www.interscience.wiley.com.]



morphological change induced by Jagged1 could be

associated with functional modifications.

SH-SY5Y neuroblastoma cells synthesize nor-

adrenaline (NA), which is contained in large dense

core vesicles (Goodall et al., 1997; Ou et al., 1998).

After differentiation, these cells are able to release

NA after secretagogue treatment or depolarization,

suggesting the acquisition of the neurosecretory com-

petence (Encinas et al., 2000; Hartness et al., 2001).

Therefore, the possible functional effects of Jagged1

were analyzed by measuring NA release in basal con-

dition and after K+-evoked depolarization. As shown

in Figure 4(B), basal release of [3H]NA was 5.5 60.5% in the control cells and decreased to 3.3 6 0.2%

after peptide exposure; wash out of the cells restored

the normal secretion rates (5.0 6 1.0%). t-Test analy-sis revealed a significant decrease in [3H]NA release

between controls and Jagged1 treated cells in basal

conditions. A similar trend, although not statistically

significant, was observed by depolarizing SH-SY5Y

with 100 mM K+. The increase in NA release elicited

by control cells after K+ stimulus (10.9 6 1.2%) was

reduced to 7.4 6 1.3% when the cells were exposed

to Jagged1 for 1 hr. These results may reflect the

presence of active varicosities in neurites from cells

insensitive to Notch stimulation. Cells completely

recovered the neurosecretory competence 1 hr after

peptide removal (9.86 1.3%).

Total amount of radioactive [3H]NA taken up by

the cells was calculated as 19,691 6 3,891 dpm/well,

18,319 6 3,593 dpm/well, and 19,377 6 3,977 dpm/

well, for control, Jagged1-treated and Jagged1-

washed out cells, respectively. The results demon-

strate that Jagged1 treatment induced a decrease of

NA release without affecting the incorporation of

[3H]NA into the cells.

Neurite Remodeling Is Dependent onNICD-Mediated Transcriptional Events

To investigate the involvement of Notch activation in

the morphological changes induced by Jagged1, cells

were preincubated with an inhibitor of the proteolytic

c-secretase complex to block the receptor cleavage

and the consequent NICD release. Cells were exposed

to Jagged1 in the presence of the c-secretase inhibitorIV (Shina and Leberburg, 1999) added at the final

concentration of 10 lM to the culture medium 30 min

before Jagged1 treatment. One hour later, cells were

analyzed by immunofluorescence for the presence of

neurites with varicosities. We found that blockade of

c-secretase activity prevented Jagged1-induced disap-

pearance of neurite varicosities. As shown in Figure

5, the percentage of neurites with varicosities of cells

exposed to Jagged1 in the presence of the c-secretaseinhibitor IV (73 6 0.6) was not statistically different

from that of untreated (81 6 0.6) cells or cells

exposed to the c-secretase inhibitor alone (81 6 0.4).

These results suggested the involvement of NICD in

this phenomenon.

The role of NICD in modifying neurite architec-

ture was studied in cells transfected with Myc-NICD

expression vector and examined by double immuno-

fluorescence with anti-myc and anti-bIII tubulin anti-

bodies. After transfection, Myc-NICD was found

within the nucleus and most of the neurites of the

NICD-transfected cells appeared completely smooth,

without any varicosity. A separate set of cells was

transfected with Notch DE fragment. Notch DE is a

mutant protein that lacks its extracellular domain but

retains its membrane-spanning region (Kopan et al.,

1996). Cells with transfected membrane-tethered

Notch DE were associated with no changes in neurite

morphology [Fig. 6(A)]. However, in the 10% of

transfected cells Notch DE was cleaved by c-secre-tases, generating a NICD fragment that reached the

nucleus; in this situation a loss of varicosities was

observed comparable to those obtained by NICD

plasmid transfection (data not shown). The effects of

Jagged1 treatment were compared with that found in

NICD and Notch DE -transfected cells. The percent-

age of neurites with varicosities were calculated and

the results reported in the histogram in Figure 6(B).

A similar number of neurites with varicosities (about

40–50%) was found in Jagged1-treated cells and

Figure 5 Effect of c-secretase inhibition on neurite mor-

phology. Number of neurites with varicosities in SH-SY5Y

cells pretreated with 10 lM c-secretase inhibitor IV for

30 min., before the exposure to Jagged1. Data are expressed

as percent of neurites with varicosities and are mean6 s.e.m.

values of at least four separate experiments, each performed

in triplicate. *p < 0.001 vs corresponding control values.



NICD-transfected cells. About 70–80% of neurites

with varicosities were found in untreated and mem-

brane-tethered Notch DE expressing cells.

These results strongly suggest that nuclear NICD

is responsible for the changes of neurite architecture,

possibly by activating a transcriptional program. This

hypothesis is supported by the results obtained in

cells double transfected with NICD and CBF1-lucshowing a strong transactivation of luciferase activity

in NICD-transfected cells [Fig. 6(C)].

To verify whether transcription was implicated in

Jagged1-induced morphological changes, cells were

treated with the RNA polymerase inhibitor actino-

mycin-D (Act-D) (Seiser et al., 1995), added to the

culture medium at 5 lM concentration 1 and 24 hr

before Jagged1 treatment. Treatment of the cells

with Act-D alone did not affect cell morphology and

viability but prevented the loss of varicosities

induced by Jagged1. The percentage of neurites with

varicosities was 82% in untreated cells, 46% in cells

treated with Jagged1 alone, 64% in Jagged1-treated

cells previously exposed to Act-D for 1 hr, and 78%

in cells previously exposed to Act-D for 24 hr, indi-

cating that the morphological effects induced by

Jagged1 was also found (although at minor levels)

when Act-D was added 1 hr before the peptide. Fig-

ure 7 shows data about pre-treatment of 24 hr with

Act-D.

Figure 6 Effect of constitutively active Notch Intracellular Domain (NICD) on SH-SY5Y neurite

morphology. A: Confocal analysis of cells transfected with Myc-NICD (a) or Myc-Notch DE (b).

Cells were double immunostained with anti-bIII tubulin (green) and anti-Myc (red) antibodies. In (a),

representative smooth neurite originating from a cell showing NICD translocated into the nucleus

(red); in (b), representative varicose neurite (yellow) originating from a Myc-Notch DE-transfectedcell double stained with anti-bIII tubulin (green) and anti-Myc (red) antibodies. B: Number of neu-

rites with varicosities in cells transfected with Myc-NICD (NICD), or with Myc-Notch DE associated

with membrane tethered Notch (NotchDE). Varicosity loss was compared with control and Jagged1-

treated cells. Values are expressed as mean 6 s.e.m. of at least three experiments run in triplicates.

*p < 0.001 vs control values. C: Luciferase activity in cells co-transfected with an empty vector

(pcDNA3), Notch DE or NICD, with CBF1-luc. Values are expressed as mean 6 s.e.m. of at least

three experiments run in triplicates. *p < 0.001 vs pcDNA3 values. [Color figure can be viewed in

the online issue, which is available at www.interscience.wiley.com.]



Neurite Remodeling Is Accompanied byChanges in Gene Expression Profile

The ability of NICD and of Act-D to respectively

mimic and inhibit the effects of Jagged1 treatment

suggested that transcriptional, NICD-mediated events

were involved in the observed disappearance of neu-

ronal varicosities. Therefore, we explored the

changes in the gene expression profile of SH-SY5Y

cells upon the treatment with Jagged1. To this aim,

we compared through an array-based analysis two

mRNA preparations, mRNA from cells treated with

control peptide versus mRNA from cells exposed for

1 hr to Jagged1 peptide. By gene array analysis, we

identified 267 genes among which 37 (approximately

the 14%) resulted upregulated (more that 50%

increase over basal) and 230 (86%) were downregu-

lated (more that 50% decrease over basal) after

Jagged1 treatment. To focus on the modifications

most likely associated with the morphological

changes, the genes modified by Jagged1 treatment

were clustered in families (see Fig. 8); cytoskeleton,

protein synthesis apparatus and vesicles trafficking

resulted as the main systems involved. In fact, 30%

of the downregulated genes were unknown; among

the others, 17% belonged to the protein synthesis ma-

chinery, 13% to the vesicles and trafficking genes,

8% were genes of the cytoskeleton, 7% and 6%

belonged respectively to DNA binding family and to

the family of transcription factors and splicing; 4%

were genes related to the protein transport.

In the small number of the up regulated genes,

40% were unknown genes. The other genes belonged

to Notch related pathways (4 genes), trafficking path-

ways (4 genes) cytoskeleton genes (2 genes) and,

point of curiosity, genes related to the visual system

(2 genes).

This study was focused on the contribution of pro-

tein synthesis machinery in the Jagged1-induced neu-

rite morpho-functional changes. Based on the results

from the gene profile study, a selected number of can-

didate genes involved in protein synthesis were fur-

ther evaluated by real-time PCR (see Fig. 9): in line

with the previous data, Notch pathway stimulation

was found to down regulate the expression of tyrosyl

tRNA synthetase (YARS), glycyl tRNA synthetase

(GARS), cysteinyl tRNA synthetase (CARS), and eu-

karyotic translation initiation factor 5 (elF5) genes.

YARS, GARS, and CARS genes encode proteins

belonging to the aminoacyl-tRNA synthetases, a fam-

ily of enzymes that catalyze the esterification of ami-

noacids with their cognate tRNA, providing the

attachment of the correct amino acid to a specific

tRNA during protein synthesis (Ibba and Soll, 2001).

eIF5 belongs to the family of eukaryotic translation

initiation factors which are key factors in the regula-

tion of protein synthesis (Rohads et al., 1993). Since

the apparent involvement of protein synthesis machin-

ery in the Jagged-induced neurite morpho-functional

changes, we also investigated for the presence and

distribution of ribosome by confocal analysis of L7a

protein immunostaining (De Falco et al., 1993; Russo

et al., 2005). As shown in Figure 10, the ribosomal

protein was found mainly clustered along the neurites

and peculiarly concentrated at varicosity level. The

loss of varicosities induced by Jagged1 led to a redis-

tribution of the protein along all the neurite extension.

Figure 7 Effect of transcription inhibition on neurite

morphology. SH-SY5Y cells were pretreated with 5 lMAct-D for 24 h and exposed to 40 lM Jagged1 for 1 addi-

tional hour. Data are expressed as percent of neurites with

varicosities and are mean 6 s.e.m. of at least three experi-

ments run in triplicates. *p < 0.001 vs corresponding con-

trol values.

Figure 8 Changes in gene expression profile of Jagged1

treated SH-SY5Y cells. Graph shows up and down regu-

lated genes clustered in major families according to their

functional role. [Color figure can be viewed in the online

issue, which is available at www.interscience.wiley.com.]



DISCUSSION

Activated Notch receptor has been suggested to play

a role in determining the only possible cell fate deci-

sion in postmitotic mature neurons, such as synaptic

remodeling or neurite extension/retraction (Bere-

zovska et al., 1999), as well as in the control of the

branching points number according to the cell density

and the specific cellular population (Sestan et al.,

1999; Salama-Cohen et al., 2005). In the present

study, we focused our attention on the varicosities,

particular structures along the neurite that are

believed to be hallmarks of the presynaptic compart-

ment. In several cellular models, varicosities are

known to be presynaptic specializations distributed

along the axon and to have a fundamental role in

structural plasticity (Udo et al., 2005; De Paola et al.,

2006). Remodeling of presynaptic varicosities is also

believed to control the formation of new synaptic

connections and to be associated with the Long Term

Potentiation process (Hatada et al., 2000).

We have used BDNF-differentiated SH-SY5Y

neuroblastoma cells as cellular model to study the

role played by Notch pathway in the varicosity plas-

ticity. Along the processes, these cells showed several

varicosities that have been shown to be plastic and to

undergo remodeling when stimulated by VIP

(Alleaume et al., 2004). We found that exposure of

neuronal SH-SY5Y cells to a synthetic form of

Jagged1 resulted in a drastic change in the cell mor-

phology, with loss of varicosities along the neurites

and redistribution of proteins involved in protein syn-

thesis, such as the ribosomal protein L7a, and in neu-

rotransmitter release, such as the vesicle-associated

protein synapsin I. From a functional point of view,

this treatment resulted in a decrease of NA release.

Morphological and functional modifications were re-

versible in 1 hr suggesting that these cells speedily

modulate neurite arborisation. Time lapse videomi-

croscopy showed the fast varicosities loss following

the Jagged1 treatment and the recovery of initial mor-

phology when the ligand was washed out from cell

Figure 9 Quantitative analysis of Jagged1-regulated genes.

RNA samples were prepared from at least three independent

cell cultures treated with Jagged1 peptide or scrambled pep-

tide for 1 hr. Real time PCR was performed as described in

the Method section. For each gene, relative mRNA levels in

controls (black columns) and Jagged1 treated (white col-

umns) were showed. YARS, tyrosyl-tRNA synthetase;

GARS, glycyl-tRNA synthetase; CARS, cysteinyl-tRNA syn-

thetase; eIF5, Eukaryotic translation initiation factor 5; x-CT,

subunit of the cysteine/glutamate transporter; HES1, Hairy

Enhancer of Split 1. Data are mean6 s.e.m.

Figure 10 Confocal analysis of L7a ribosomal protein expression in differentiated SH-SY5Y

cells in basal condition and after Jagged1 treatment. Double immunofluorescence experiments with

anti-bIII tubulin (A, D, red) and anti-L7a (B, E, green) antibodies. Merge (yellow) in C and F. Rep-

resentative neurite in control (A–C) and Jagged1-treated cells (D–F); L7a clustered in the neurite

varicosities is shown in (C) (merge, yellow). Scale bar in (A): 5 lm. [Color figure can be viewed in

the online issue, which is available at www.interscience.wiley.com.]



medium, proving that the process is dynamic and can

be modulated through a pulsed stimulation of the

pathway.

These effects were mediated by Notch activation

since they were inhibited by blockade of c-secretaseactivity and mimicked by transfecting the cells with

NICD-encoding plasmids. Furthermore, the Jagged1-

induced loss of varicosities was prevented by the

transcription inhibitor Act-D. These data suggest that

the Jagged1-mediated effects on neurite morphology

were transcriptionally mediated.

Since the molecular pathways affected by Notch

signaling that actually mediate the effects on neural

plasticity are largely unknown, we were interested in

identifying the contribution of Jagged1-induced alter-

ation of gene expression in the generation of neurite

morphological changes. By gene array analysis, we

identified 267 genes among which approximately

14% upregulated and 86% downregulated after

Jagged1 treatment. In this regard, it should be noted

that one of the main gene targets of NICD is the tran-

scription repressor HES (Kageyama and Ohtsuka,

1999) and a significant increase of HES1 mRNA lev-

els was found in differentiated SH-SY5Y neuroblas-

toma cells after Jagged1 treatment (see Fig. 9). The

gene array analysis unraveled some pathways

involved in cytoskeleton stability, protein synthesis

and vesicles trafficking, that could link the Notch

transcriptional activity with the reorganization of the

neurites morphology.

We previously found that in cortical neurons the

varicosities loss induced by Notch activation was

mediated by an increased microtubules stability,

through the transcriptional down regulation of the

microtubules severing protein Spastin (Ferrari-Toni-

nelli et al., 2008). In this study, we focused on the

protein synthesis machinery. Among the genes whose

expression was downregulated by Jagged treatment,

different components of the translational machinery

including five aminoacyl tRNA synthetases [YARS,

GARS, CARS, isoleucine tRNA synthetase (IARS),

threonyl tRNA synthetase (TARS), glutamyl-prolyl

tRNA synthetase (EPRS)] and three translation initia-

tor factors [eukaryotic translation initiation factors

(eIFs) eIF3, eIF4A, eIF5] were found. The relevance

of these translational proteins in the maintenance and

arborization of the neurites is not clear but active pro-

tein synthesis is known to be essential for the forma-

tion, maintenance and dynamic morphological

changes in varicosities (Schacher and Wu, 2002; Lee

and Hollenbeck, 2003). Interestingly, YARS and eu-

karyotic eIF5 were found highly expressed into the

varicosities (Jordanova et al., 2006; Luchessi et al.,

2008). Another translation initiator factor, eIF4,

resulted to modulate synaptic strength (Giorgi et al.,

2007). Furthermore, the Jagged1 treatment induced

the redistribution of the ribosomal protein L7a. Ribo-

somal proteins were detected in axons associated

with translational co-factors such as the translational

intiation factor eIF5 (Giuditta et al., 2002). In this

regard, the presence of a local protein synthesis sys-

tem that plays an important role in the remodeling of

the axonal cytoarchitecture has been recently

hypothesized (Gioio et al., 2004). Taken together,

these data suggest that Jagged1 treatment impairs

protein synthesis.

In summary, we demonstrated that the Notch path-

way modulates neurite morphology and varicosities

function, suggesting that this pathway is involved in

the maintenance and plasticity of the pre-synaptic com-

partment. We also added new information on the mo-

lecular mechanisms activated by Notch in neurite

remodeling, identifying protein synthesis apparatus as

one of the main Notch targets. It may be inferred that

the loss of varicosities and their associated loss of func-

tional competence may reflect a Notch-regulated neu-

rite differentiation step which is presumably triggered

in vivo when the neurite makes a synaptic connection.

REFERENCES

Alleaume C, Eychene A, Harnois T, Bourmeyster N, Con-

stantin B, Caigneaux E, Muller JM, et al. 2004. Vasoac-

tive intestinal peptide-induced neurite remodeling in

human neuroblastoma SH-SY5Y cells implicates the

Cdc42 GTPase and is independent of Ras-ERK pathway.

Exp Cell Res 299:511–524.

Berezovska O, McLean P, Knowles R, Frosh M, Lu FM,

Lux SE, Hyman BT. 1999. Notch1 inhibits neurite out-

growth in postmitotic primary neurons. Neuroscience

93:433–439.

Bevilacqua MA, Iovine B, Zambrano N, D’Ambrosio C,

Scaloni A, Russo T, Cimino F. 2005. Fibromodulin gene

transcription is induced by ultraviolet irradiation, and its

regulation is impaired in senescent human fibroblasts.

J Biol Chem 280:31809–31817.

Chang S, De Camilli P. 2001 Glutamate regulates actin-

based motility in axonal filopodia. Nat Neurosci 8:787–

793.

De Falco S, Russo G, Angiolillo A, Pietropaolo C. 1993.

Human L7a ribosomal protein: sequence, structural orga-

nization, and expression of a functional gene. Gene

126:227–235.

De Paola V, Arber S, Caroni P. 2003. AMPA receptors reg-

ulate dynamic equilibrium of presynaptic terminals in

mature hippocampal networks. Nat Neurosci 6:491–500.

De Paola V, Holtmaat A, Knott G, Song S, Wilbrecht L,

Caroni P, Svoboda K. 2006. Cell type-specific structural

plasticity of axonal branches and boutons in the adult

neocortex. Neuron 49:861–875.



Encinas M, Iglesias M, Liu Y, Wang H, Muhaisen A, Cena

V, Gallego C, et al. 2000. Sequential treatment of SH-

SY5Y cells with retinoic acid and brain-derived

neurotrophic factor gives rise to fully differentiated, neu-

rotrophic factor-dependent, human neuron-like cells.

J Neurochem 75:991–1003.

Encinas M, Iglesias M, Llecha N, Comella JX. 1999.

Extracellular-regulated kinases and phosphatidylinositol

3-kinase are involved in brain-derived neurotrophic fac-

tor-mediated survival and neuritogenesis of the neuro-

blastoma cell line SH-SY5Y. J Neurochem 73:1409–

1421.

Ferrari-Toninelli G, Bernardi C, Quarto M, Lozza G, Memo

M, Grilli M. 2003. Long-lasting induction of Notch2 in

the hippocampus of kainate-treated adult mice. Neurore-

port 14:917–921.

Ferrari-Toninelli G, Bonini SA, Bettinsoli P, Uberti D,

Memo M. 2008. Microtubule stabilizing effect of notch

activation in primary cortical neurons. Neuroscience

154:946–952.

Ferrari-Toninelli G, Paccioretti S, Francisconi S, Uberti D,

Memo M. Torsin. 2004. A negatively controls neurite

outgrowth of SH-SY5Y human neuronal cell line. Brain

Res 1012:75–81.

Gaiano N, Fishell G. 2002 The role of Notch in promoting

glial and neural stem cell fates. Ann Rev Neurosci

25:471–490.

Gioio AE, Lavina ZS, Jurkovicova D, Zhang H, Eyman M,

Giuditta A, Kaplan BB. 2004. Nerve terminals of squid

photoreceptor neurons contain a heterogeneous popula-

tion of mRNAs and translate a transfected reporter

mRNA. Eur J Neurosci 20:865–872.

Giorgi C, Yeo GW, Stone ME, Katz DB, Burge C, Turri-

giano G, Moore MJ. 2007. The EJC factor eIF4AIII mod-

ulates synaptic strength and neuronal protein expression.

Cell 130(1):179–191.

Giuditta A, Kaplan BB, van Minnen J, Alvarez J, Koenig E.

2002. Axonal and presynaptic protein synthesis: new

insights into the biology of the neuron. Trends Neurosci

25:400–404.

Goodall AR, Danks K, Walker JH, Ball SG, Vaughan PF.

1997. The Notch-Hes pathway in mammalian neural de-

velopment. Cell Res 9:179–188.

Gray GE, Mann RS, Mitsiadis E, Henrique D, Carcangiu

ML, Banks A, Leiman J, et al. 1999. Human ligands of

the notch receptor. Am J Pathol 154:785–794.

Grilli M, Ferrari-Toninelli G, Uberti D, Spano P, Memo M.

2003. Alzheimer’s disease linking neurodegeneration

with neurodevelopment. Funct Neurol 18:145–148.

Hartness ME, Wade JA, Walker JH, Vaughan PF. 2001.

Overexpression of the myristoylated alanine-rich C ki-

nase substrate decreases uptake and K(+)-evoked release

of noradrenaline in the human neuroblastoma SH-SY5Y.

Eur J Neurosci 13:925–934.

Hatada Y, Wu F, Sun ZY, Schacher S, Goldberg DJ. 2000.

Presynaptic morphological changes associated with

long-term synaptic facilitation are triggered by actin

polymerization at preexisting varicositis. J Neurosci 20:

RC82

Hsieh JJ, Henkel T, Salmon P, Robey E, Peterson MG,

Hayward SD. 1996 Truncated mammalian Notch1 acti-

vates CBF1/RBPJk-repressed genes by a mechanism

resembling that of Epstein-Barr virus EBNA2. Mol Cell

Biol 16:952–959.

Hu QD, Ma QH, Gennarini G, Xiao ZC. 2006. Cross-talk

between F3/contactin and Notch at axoglial interface: A

role in oligodendrocyte development. Dev Neurosci.

28:25–33.

Ibba M, Soll D. 2001. The renaissance of aminoacyl-tRNA

synthesis. EMBO Rep 2:382–387.

Irvin DK, Nakano I, Paucar A, Kornblum HI. 2004.

Patterns of Jagged1. Jagged2, Delta-like 1 and Delta-

like 3 expression during late embryonic and postnatal

brain development suggest multiple functional roles in

progenitors and differentiated cells J Neurosci Res 75:

330–343.

Jamsa A, Hasslund K, Cowburn RF, Backstrom A, Vasange

M. 2004. The retinoic acid and brain-derived neurotro-

phic factor differentiated SH-SY5Y cell line as a model

for Alzheimer’s disease-like tau phosphorylation. Bio-

chem Biophys Res Commun 319:993–1000.

Jordanova A, Irobi J, Thomas FP, Van Dijck P, Meerschaert

K, Dewil M, Dierick I, et al. 2006. Disrupted function

and axonal distribution of mutant tyrosyl-tRNA synthe-

tase in dominant intermediate Charcot-Marie-Tooth neu-

ropathy. Nat Genet 38:197–202.

Kageyama R, Ohtsuka T. 1999. The Notch-Hes pathway in

mammalian neural development. Cell Res 9:179–188.

Kopan R, Schroeter EH, Weintraub H, Nye JS. 1996. Signal

transduction by activated mNotch: importance of proteo-

lytic processing and its regulation by the extracellular do-

main. Proc Natl Acad Sci USA 93:1683–1688.

Kushner SA, Elgersma Y, Murphy GG, Jaarsma D, van

Woerden GM, Hojjati MR, Cui Y, et al. 2005. Modula-

tion of presynaptic plasticity and learning by the H-ras/

extracellular signal-regulated kinase/synapsin I signaling

pathway. J Neurosci 25:9721–9734.

Lee SK, Hollenbeck PJ. 2003. Organization and translation

of mRNA in sympathetic axons. J. Cell Sci 116(Pt 21):

4467–4478.

Louvi A, Artavanis-Tsakonas S. 2006. Cross-talk between

F3/contactin and Notch at axoglial interface: A role in

oligodendrocyte development. Dev Neurosci 28:25–33.

Luchessi AD, Cambiaghi TD, Alves AS, Parreiras-E-Silva

LT, Britto LR.Costa-Neto CM, Curi R. 2008. Insights on

eukaryotic translation initiation factor 5A (eIF5A) in the

brain and aging. Brain Res 1228:6–13.

Nickoloff BJ, Qin JZ, Chaturvedi V, Denning MF, Bonish

B, Miele L. 2002. Jagged-1 mediated activation of notch

signaling induces complete maturation of human kerati-

nocytes through NF-kappaB and PPARgamma. Cell

Death Differ 9:842–855.

Nikonenko I, Jourdain P, Muller D. 2003. Presynaptic

remodeling contributes to activity-dependent synapto-

genesis. J Neurosci 23:8498–8505.

Ou XM, Partoens PM, Wang JM, Walker JH, Danks K,

Vaughan PF, De Potter WP. 1998. The storage of nor-

adrenaline, neuropeptide Y and chromogranins in and



stoichiometric release from large dense cored vesicles of

the undifferentiated human neuroblastoma cell line SH-

SY5Y. Int J Mol Med 1:105–112.

Redmond L, Oh SR, Hicks C, Weinmaster G, Ghosh A.

2000. Nuclear Notch1 signaling and the regulation of

dendritic development. Nat Neurosci 3:30–40.

Rhoads RE. 1993. Regulation of eukaryotic protein synthe-

sis by initiation factors. J Biol Chem. 268:3017–3020.

Russo G, Cuccurese M, Monti G, Russo A, Amoresano A,

Pucci P, Pietropaolo C. 2005. Ribosomal protein L7a

binds RNA through two distinct RNA-binding domains.

Biochem J 385(Pt 1):289–299.

Salama-Cohen P, Arevalo MA, Grantyn R, Rodriguez-

Tebar A. 2006. Notch and NGF/p75NTR control dendrite

morphology and the balance of excitatory/inhibitory syn-

aptic input to hippocampal neurones through Neurogenin

3. J Neurochem 97:1269–1278.

Salama-Cohen P, Arevalo MA, Meier J, Grantyn R, Rodri-

guez-Tebar A. 2005. NGF controls dendrite development

in hippocampal neurons by binding to p75NTR and mod-

ulating the cellular targets of Notch. Mol Biol Cell

16:339–347.

Schacher S, Wu F. 2002. Synapse formation in the absence

of cell bodies requires protein synthesis. J Neurosci

22:1831–1839.

Seiser C, Posch M, Thompson N, Kuhn LC. 1995. Effect of

transcription inhibitors on the iron-dependent degrada-

tion of transferrin receptor mRNA. J Biol Chem 270:

29400–29406.

Sestan N, Artavanis-Tsakonas S, Rakic P. 1999. Contact-

dependent inhibition of cortical neurite growth mediated

by notch signaling. Science 286:741–746.

Shina S, Leberburg I. 1999. Cellular mechanisms of beta-

amyloid production and secretion. Proc Natl Acad Sci

USA 96:11049–11053.

Stump G, Durrer A, Klein AL, Lutolf S, Suter U, Taylor V.

2002. Notch1 and its ligands Delta-like and Jagged are

expressed and active in distinct cell populations in the

postnatal mouse brain. Mech Dev 114:153–159.

Udo H, Jin I, Kim JH, Li HL, Youn T, Hawkins RD, Kandel

ER, et al. 2005. Serotonin-induced regulation of the actin

network for learning-related synaptic growth requires

Cdc42. N-WASP, and PAK in Aplysia sensory neurons

Neuron 45:887–901.

Umeda T, Ebihara T, Okabe S. 2005. Simultaneous obser-

vation of stably associated presynaptic varicosities and

postsynaptic spines: Morphological alterations of CA3-

CA1 synapses in hippocampal slice cultures. Mol Cell

Neurosci 28:264–274.

Zambrano N, Gianni D, Bruni P, Passaro F, Telese F, Russo

T. 2004. Fe65 is not involved in the platelet-derived

growth factor-induced processing of Alzheimer’s amy-

loid precursor protein, which activates its caspase-

directed cleavage. J Biol Chem 279:16161–16169.



notch activation induces neurite remodeling and functional modifications in sh-sy5y neuronal cells

Documents