Nonribosomal Synthesis of Fengycin on an Enzyme ComplexFormed by Fengycin Synthetases*□S

Received for publication, October 16, 2006, and in revised form, December 14, 2006 Published, JBC Papers in Press, December 20, 2006, DOI 10.1074/jbc.M609726200

Cheng-Yeu Wu‡1, Chyi-Liang Chen‡1, Yu-Hsiu Lee‡, Yu-Chieh Cheng‡, Ying-Chung Wu‡, Hung-Yu Shu‡,Friedrich Gotz§, and Shih-Tung Liu‡2

From the ‡Molecular Genetics Laboratory, Department of Microbiology and Immunology, Chang-Gung University,259 Wen-Hwa 1st Road, Kwei-Shan, Taoyuan 333, Taiwan and §Biologisches Institut, AG Mikrobielle Genetik,Der Universtat Tubingen, Waldhauser Strasse 70/8, 70276 Tubingen, Germany

Fengycin, a lipopeptidic antibiotic, is synthesized nonriboso-mally by five fengycin synthetases (FenC, FenD, FenE, FenA, andFenB) in Bacillus subtilis F29-3. This work demonstrates thatthese fengycin synthetases interlock to form a chain, which coilsinto a 14.5-nm structure. In this chain, fengycin synthetases arelinked in the order FenC-FenD-FenE-FenA-FenB by interac-tions between the C-terminal region of an upstream enzymeand the N-terminal region of its downstream partner enzyme,with their amino acid activation modules arranged colinearlywith the amino acids in fengycin. This work also reveals thatfengycin is synthesized on this fengycin synthetase chain,explaining how fengycin is synthesized efficiently and accu-rately. The results from this investigation demonstrate thatforming a peptide synthetase complex is crucial to nonriboso-mal peptide synthesis.

Fengycin, a lipopeptidic antibiotic, is formed byBacillus sub-tilis F29-3 (1, 2) and contains a cyclic peptide of 10 amino acidswith a 14–18-carbon fatty acid residue attached to the N ter-minus of the peptide (Fig. 1A) (3). Earlier works have estab-lished that fengycin is synthesized nonribosomally by fivefengycin synthetases, FenC (287 kDa), FenD (290 kDa), FenE(286 kDa), FenA (406 kDa), and FenB (146 kDa) (4, 5), which areencoded by the five fengycin synthetase genes in the fengycinsynthetase operon (Fig. 1B). These enzymes typically containfrom one to several amino acid activation modules that areabout 1000 amino acids long, activating a specific amino acidfor peptide synthesis (6–10). In each module, an adenylationdomain of �550 amino acids recognizes and adenylates a spe-cific amino acid (5, 11–14). Following adenylation, the aminoacid forms a thioester bond with the cofactor 4�-phospho-pantetheine bound to the thiolation domain locatedC-terminal

to the adenylation domain in the module (15–19). Subse-quently, a transpeptidation process transfers the activatedamino acid in the initiating module, FenC1, in the initiatingenzyme, FenC, to the activated amino acid at the thiolationdomain in the nextmodule, FenC2, ultimately forming a dipep-tide, L-Glu-L-Orn, on FenC (5, 20, 21). In the next step, thedipeptide synthesized on FenC is translocated to FenD; duringthis process, L-Orn is racemized to D-Orn (22) and linked withL-Tyr activated by the FenD1 module (14, 21, 23). This processcontinues from one module to another and from one peptidesynthetase to another peptide synthetase until the elongatingpeptide chain reaches FenB (12), which contains a thioesterasedomain that terminates peptide synthesis and releases the pep-tide chain from the enzyme (24, 25). During fengycin synthesis,the elongating fengycin peptide must be transferred from onepeptide synthetase to another in a particular order; otherwise, afengycinmolecule with a particular sequence cannot be synthe-sized. Given the amino acid sequence in fengycin (Fig. 1A) andthe amino acid activated by each fengycin synthetase, fengycinsynthesis is predicted to begin from FenC and to proceed viaFenD, FenE, and FenA finally to FenB. This investigation dem-onstrates that the five fengycin synthetases interact to form achain, in which the amino acid-activating modules are lined upcolinearly with the amino acids in the fengycin molecules. For-mation of this peptide synthetase chain explainswhy fengycin issynthesized efficiently and accurately.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Media—B. subtilis F29-3 was a fengy-cin-producing strain (2). Mutant strains of B. subtilis F29-3,including FX12, FX10, FX14, FE6, and FE5, contained a trans-poson insertion in fenC, fenD, fenE, fenA, and fenB, respectively(Fig. 1B) (4, 26). LB broth and agar (27) were used to cultureEscherichia coli. Soybean-mannitol-nitrate and nHAmedia (3)were used to culture B. subtilis F29-3. E. coli HB101 (28) wasused as a host for gene cloning.Plasmids—A 1433-bp EcoRV-BglII fragment from pFC6A5

(5) that encoded the C-terminal region of FenC was insertedinto the EcoRV-BamHI sites in pET20b(�) to generate pFC010.Then a 4850-bp SphI-PstI fragment that encoded the regionbetween amino acids 630 and 2245 in FenC was inserted intothe SphI-PstI sites in pGEM-3Z to form pFC020. A 1.4-kbEcoRV-DraIII fragment from pFC010 was then inserted intothe EcoRV site in pFC020 to generate pFC030. A 2580-bp SphIfragment from pFC6A5, which contained the promoter of the

* This research was supported by Chang-Gung Memorial Hospital GrantCMRPD33004, National Science Council of the Republic of China Grant NSC95-3112-B-182-002, Chang-Gung Molecular Medicine Research CenterGrant CMRPD140041, and a grant for study visits for foreign academics tothe Federal Republic of Germany from Deutscher Akademischer Austaus-chdienst, Germany. The costs of publication of this article were defrayed inpart by the payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Tables 1–3.

1 These authors contributed equally to this work.2 To whom correspondence and reprint requests should be addressed. Tel./

Fax: 886-32118292; E-mail: cgliu@mail.cgu.edu.tw.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 8, pp. 5608 –5616, Febrary 23, 2007© 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

5608 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 8 • FEBRARY 23, 2007

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

fengycin operon and a sequence that encoded the N-terminalregion in FenC, was inserted into the SphI site in pFC030 togenerate pFC100. Finally, a 3-kb AccI fragment frompHY300PLK that contained a tetracycline resistance gene and areplicon that allowed replication of the plasmid in B. subtiliswas inserted into the BamHI site in pFC100 to generatepFC200. Plasmid pFC240 was identical to pFC200 except inthat a frameshift mutation was generated at the SphI site infenC. Plasmids pFB200 expressed histidine-tagged FenB inE. coli (12). A DNA fragment amplified with primers FenB-dTeF (5�-CCCGGATCCTCTCATCACCATCACCACACT-AAGCTTAATTA) and FenB-dTeR (5�-CCCGGATCCTGA-CAGCTGATTAGAATAAAGCTTTTCCGC), using pFC6A5as a template, was inserted into the BamHI site in pQE60 (Qia-gen) to form pFB230 to express histidine-tagged FenB withoutits thioesterase domain (FenB-dTE). PCR fragments amplified,using B. subtilis F29-3 chromosomal DNA as a template, withprimers FenC-N-F (5�-GGGGTACCATCCTCTTATAAATT-AGAATTGG) and FenC-N-B (5�-GGATCCCATGGCATCA-ACGGTTGCTTCTGTCGG); FenD-N-F (5�-GAGGATCCT-GGAAAAGGTGTGTGGAATTGATGACG) and FenD-N-B(5�-CTTCTAGACTTATCGTCGTCATCCTTGTAATCAT-TTGGATAATGGCGCTC), FenE-N-F (5�-GGGGATCCAA-CCGCGAATGGAGTGCCGCTG) and FenE-N-Bfg (5�-GCT-CTAGACTTATCGTCATCCTTGTAATCCTCGAGGAAT-TCAACCAACCTGTCCG); FenA-N-F (5�-GGGGTACCTG-GACAGTATATCCAGCTTGG) and FenA-fgN (5�-GTTAA-AGCTTATCGTCGTCATCCTTGTAATCCATGGTATAT-

GCCGACACTACATGAG); andFenB-N-F (5�-GGGGTACCGAG-GACGCGCTCCAAGAAATCG)and FenB-N-Bfg (5�-GAAGATCT-TATCGTCGTCATCCTTGTAA-TCCATGGACCCTGTCAGGAT-AAACCGG) were inserted at theBamHI site in pUC18 to formpFC210, pFD210, pFE210, pFA210,and pFB210, which expressed theN-terminal 700-amino acid region inFenC, 700-amino acid region inFenD, 900-aminoacid region inFenE,800-amino acid region in FenA, and700-amino acid region in FenB, re-spectively, with a FLAG tag at the Cterminus. PCR fragments amplified,using B. subtilis F29-3 chromo-somal DNA as a template, withFenC-C-F (5�-CAGGATCCGGT-ACCAATGTAAAACTGTGCG-TAC) and FenC-C-B (5�-CGGG-ATCCAGAAGATCTTTAACGA-GATTTTC); FenD-C-F (5�-GAGG-ATCCGGTACCGAGCTGTATA-TTGGCGGAG) and FenD-C-B(5�-GCGGATCCAGTACTTTGT-TGACGGCCCCCAT); FenE-C-F(5�-GAGGATCCCGATTACAAG-GATGACGACGATAAGCTAGA-

TCTGGCACGCTGGCTACCGG) and FenE-C-B (5�-GGGT-CTAGACTCGAGCAAGTCTTCCACCAAGCTGG); FenA-C-F (5�-GAAGATCTCGATTACAAGGATGACGACGATA-AGGTCGACAAGCTCGGCGTAACAAGG) and FenA-C-B(5�-GTTTAAGCTTACTCGAGAACCATGGCGTGAAAAC-TGAGCATATCAGCG); and FenB-C-F (5�-GAAGATCTCG-ATTACAAGGATGACGACGATAAGCTGGCCAGAACAT-TGTATGAAAACG) and FenB-C-B (5�-CTTACTCGAGTT-AAACCATGGCATGCTTATTTGGCAGCACTTTTTGAT)were inserted at the BamHI site in pET30 (Novagen) to con-struct pFC220, pFD220, pFE220, pFA220, and pFB220, whichexpressed C-terminal 700-amino acid regions in FenC, FenD,and FenE, a 1200-amino acid region in FenA, and an 800-aminoacid region in FenB, respectively, with a histidine tag at the Cterminus.Transformation—E. coli was transformed using the CaCl2

transformation method of Cohen and Chang (29). B. subtilisF29-3 was transformed according to the method of Imanakaet al. (30).Binding of Fengycin Synthetases to Histidine-tagged FenC—

E. coliHB101(pFC200) and B. subtilis F29-3 were cultured in 1liter of LB broth and soybean-mannitol-nitrate medium,respectively, to the mid-log phase. Cells were pelleted by cen-trifugation and suspended in 30 ml of a homogenization bufferthat contained 50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 1 mMphenylmethylsulfonyl fluoride, and 10 mM imidazole. Cellswere homogenized three times with an Amicon French Press(Thermo Spectronic, Rochester, NY) at 1200 p.s.i. The lysate

FIGURE 1. Structure of fengycin (A) and map (B) of the fengycin synthetase operon. Fengycin contains 10amino acids with a lactone bond connecting the L-Tyr at the position 3 and L-Ile at position 10. FA, fatty acidresidue attached to the N terminus of the peptide (A). The fengycin synthetase operon (37 kb) contains fivefengycin synthetase genes, fenC, fenD, fenE, fenA, and fenB, which were transcribed from a promoter, Pfen. FX10,FX12, and FX14 are mutants with a Tn917lux insertion, and FE5 and FE6 are mutants with a Tn917 insertion. S,SphI; E, EcoRV; P, PstI; Bg, BglII; N, NcoI; B, BamHI (B).

Nonribosomal Synthesis of Fengycin

FEBRARY 23, 2007 • VOLUME 282 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5609

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

was centrifuged at 31,000 � g for 1 h at 4 °C to remove debris.E. coliHB101(pFC200) andB. subtilis F29-3 lysatesweremixed,and Ni2�-NTA3-agarose beads (Qiagen) (1 ml) were added tothe lysate mixture to demonstrate the binding of fengycin syn-thetases to histidine-tagged FenC (His-FenC). After the mix-ture had been mixed on a rotator for 1 h at 4 °C, the beads werepoured into a 5-ml polypropylene column. The column waswashed twice with 60ml of a wash buffer that contained 50mMNaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0. Proteinsthat bound to the beads were then eluted with 2 ml of elutionbuffer that contained 50 mM NaH2PO4, pH 8.0, 300 mM NaCl,and 250 mM imidazole. Eluted proteins were finally separatedby SDS-PAGE and analyzed by immunoblotting or MALDI-TOFmass spectrometry. Ni2�-NTA-agarose beads were addedto the lysate prepared from 1 liter of cells to isolate the fengycinsynthetase complex from B. subtilis F29-3(pFC200). Proteinsthat bound to the beads were purified and analyzed by the samemethods as described above. Lysates from 5 liters of cells wereused in a study of strains that contained a mutated fengycinsynthetase gene.Sucrose Gradient Sedimentation—A 10-ml linear 25–65%

sucrose gradient was prepared in a Beckman SW41 centrifugetube with a Gradient Station (BioComp, New Brunswick, Can-ada). Cell lysate (1ml) was loaded on the top of the gradient andcentrifuged at 30,000 rpm for 24 h at 4 °C with a BeckmanSW41 rotor. The gradient was fractionated into 10 fractionswith the gradient station, and proteins in the fractions wereseparated by SDS-PAGE and analyzed by immunoblotting orMALDI-TOF mass spectrometry.SDS-PAGE and Immunoblot Analysis—Fengycin syntheta-

ses were separated by SDS-PAGE with 6% gels and stained by asilver stainmethod (31). Proteins in the gelswere electroblottedonto an Immoblon-P transfer membrane (Millipore, Billerica,MA) following a method described elsewhere (32). Anti-FenCand anti-FenA antibodies were generated in rabbits; anti-FenBantibody was monoclonal. Polyclonal antibodies were purifiedwith an Affi-Gel 10 column (Bio-Rad), using antigens purifiedfrom E. coli. Anti-FLAG antibody was purchased from Sigma.Immunoblotting was performed following a method reportedelsewhere (32). Protein bands were finally detected using aSuperSignal kit (Pierce).MALDI-TOF Mass Spectrometry—Proteins in polyacrylam-

ide gel were digested with trypsin according to a methoddescribed elsewhere (33). The resulting peptides were analyzedusing a Brooker Biflex IIIMALDI-TOFmass spectrometer (Bil-larica, MA). The m/z ratios of the digested peptides and theirfragmented ions were used to search the annotated B. subtilisgenome in the mass spectrometry protein sequence database(MSDB) through Mascot search software, version 1.8 (MatrixScience Inc., Boston, MA). A maximum of one missed trypsincleavage, variable modification including carbamidomethyla-tion, and 1 Da peptide mass tolerance were the search criteriaused. The proteins were unambiguously identified as signifi-cant hits (p � 0.05) byMascot peptide mass fingerprint search.

Immunofluorescence Analysis—B. subtilis cells were immu-nostained following a method described elsewhere (34) withsomemodifications, including a fixation step that involved 30%acetone and 70%methanol rather than glutaldehyde. Addition-ally, cells underwent a second round of lysozyme treatment for3 h after they were fixed. Furthermore, cells were treated with4% Triton X-100 rather than Tween 20. Immunostaining wasperformed with polyclonal anti-FenC antibody and mono-clonal anti-FenB antibody diluted by a factor of 200. The cellswere then treated with 200-fold diluted Alexa 488-conjugatedanti-rabbit IgG antibody and 500-fold diluted Alexa 598-con-jugated anti-mouse IgG antibody (Molecular Probes, Inc.,Eugene, OR). Cells were finally examined using a Leica modelTCS SP2 confocal laser-scanning microscope.Electron Microscopy—Fengycin synthetase complexes puri-

fied using Ni2�-NTA-agarose beads from B. subtilis F29-3(pFC200) were adsorbed to a glow-discharged carbon coppergrid (Agar Scientific, Essex, UK) and stained with 0.75% uranylformate (Electron Microscopy Sciences). The enzyme com-plexes were imaged at room temperature using a JEOL JEM-1230 electronmicroscope operated at an acceleration voltage of120 kV.Peptide Synthesis Assay—Ni2�-NTA beads were added to a

mixture of the lysates prepared from 500 ml of E. coliHB101(pFB230) and 500 ml of B. subtilis F29-3 culture toreconstitute and purify a fengycin synthetase complex that con-tained a mutant FenB, FenB-dTE, which lacks the thioesterasedomain. Proteins that were bound to the beads were purifiedaccording to themethod described above and dialyzed against abuffer that contained 50 mM Tris-HCl, pH 7.8, 0.5 mMNa4P2O7, and 20% sucrose. Reconstituted fengycin synthetasecomplexes with FenB-dTE (2.6 �g) were added to a reactionmixture that contained 2 mMMgCl2; 2 mM 1,4-dithiothreitol; 2mM ATP; 2 mM EDTA; 20 mM Mes-Hepes, pH 7.5; 100 �Mcoenzyme A; 2 mM each of L-alanine, L-glutamic acid, L-isoleu-cine, L-ornithine, L-threonine, L-tyrosine, and L-valine; 1 �Cieach of L-[C14]ornithine (57 mCi/mmol), L-[C14]tyrosine (473mCi/mmol), and L-[C14]proline (252 mCi/mmol) (AmershamBiosciences). The reaction mixture (200 �l) was incubated at25 °C for 30min. Following the reaction, 1 ml of a denaturationbuffer, which contained 100 mM Na2HPO4, 10 mM Tris-HCl,pH 8.0, and 8 M urea was added to terminate the reaction and todissociate fengycin synthetases. Ni2�-NTA-agarose beads (50�l) were then added. After they had been washed three timeswith 1ml of a wash buffer that contained 100mMNa2HPO4, 10mM Tris-HCl, pH 6.3, 8 M urea, Ni2�-NTA-agarose beads werecollected on aGF/Cglass fiber filter (Whatman,Maidston,UK),which was then dried. Then the radioactivity was counted in 15ml of Fluroansafe 2 (BDH, Poole,UK) using a liquid scintillationcounter (LS5000TD; Beckman).

RESULTS

Interactions among Fengycin Synthetases in Vitro—Peptidesynthetases are known to comprise conserved sequences anddomains. Therefore, antibodies generated with fengycin syn-thetases often lack specificity. Evenmonoclonal anti-FenE anti-bodies produced in this laboratory nonspecifically detected allof the fengycin synthetases in immunoblot analysis (data not

3 The abbreviations used are: NTA, nitrilotriacetic acid; MALDI, matrix-assistedlaser desorption ionization; TOF, time-of-flight; Mes, 2-(N-morpholino)eth-anesulfonic acid; COM, communication-mediating.

Nonribosomal Synthesis of Fengycin

5610 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 8 • FEBRARY 23, 2007

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

shown). Among the antibodies used in this study, only a mono-clonal anti-FenB antibody, which recognizes an epitope in thethioesterase domain, specifically recognized FenB. The lack ofantibody specificity, while not a problem in the analysis of FenAand FenB by immunoblotting, caused particular difficulty indetermining the interactions among FenC, FenD, and FenE by

immunoblotting, since these three enzymes had similar molec-ular masses of about 290 kDa. Therefore, this work adoptedboth immunoblotting and MALDI-TOF mass spectrometry toanalyze the interactions among fengycin synthetases. Thisstudy first investigated whether FenA in the B. subtilis F29-3lysate interacted with recombinant His-FenC in vitro. AddingNi2�-NTA-agarose beads into the lysate from E. coliHB101(pFC200), as expected, caused His-FenC to bind to thebeads (Fig. 2A, lane 5). However, none of the fengycin syntheta-ses in the B. subtilis F29-3 lysate was bound to the beads,because the enzymes lack a histidine tag (Fig. 2,A, lane 3, andB,lane 3). However, the binding of FenA to the beads becameevident after the E. coli HB101(pFC200) and B. subtilis F29-3lysates were mixed with each other (Fig. 2A, lanes 6 and 7). Onthe other hand, FenA is unstable, explainingwhy the FenAbandthat was detected by immunoblotting was faint (Fig. 2A, lane 6)unless a large amount of sample was loaded to a lane (Fig. 2A,lane 7). Therefore, this 406-kDa band was also studied usingMALDI-TOF mass spectrometry. The 406-kDa band in a laneloaded with the proteins eluted fromNi2�-NTA-agarose beadsadded to the E. coli HB101(pFC200)-B. subtilis F29-3 lysatemixture was excised from a gel that had been stained by silverstain. Analyzing this band by MALDI-TOF mass spectrometryanalysis, after the proteins in the gel slice were digested withtrypsin, revealed a peptide fingerprint matching that of FenA(Table 1). Meanwhile, in parallel experiments, the 406-kDa

FIGURE 2. Binding of FenA and FenB to histidine-tagged FenC in vitro.Lysates prepared from B. subtilis F29-3 (lane 1), E. coli HB101(pFC200) (lane 2), andE. coli HB101(pFC240) were mixed. Ni2�-NTA-agarose beads (Ni) were thenadded to the mixtures (lanes 3– 6). Both lanes 6 and 7 were loaded with the pro-teins that were eluted from Ni2�-NTA-agarose beads that had been added to theE. coli HB101(pFC200)-B. subtilis F29-3 lysate mixture. However, the amount ofproteins loaded in lane 7 was 5 times that in lane 6. Proteins eluted from thebeads were separated with 6% SDS-polyacrylamide gels and analyzed byimmunoblotting (IB) with anti-FenA (A) and anti-FenB antibodies (B).

TABLE 1MALDI-TOF mass spectrometry analysis of 146-, 290-, and 406-kDa proteins that were bound to His-FenC

Lysates FenC(290 kDa)

FenD(290 kDa)

FenE(290 kDa)

FenA(406 kDa)

FenB(146 kDa)

HB101(pFC200)Queries matcheda 22 0 0 0 0Mowse scoreb 76 0 0 0 0

F29-3 � HB101(pFC200)Queries matched 12 13 27 22 14Mowse score 96 62 110 126 132

F29-3 � HB101(pFC240)Queries matched 0 0 0 0 0Mowse score 0 0 0 0 0

F29-3(pFC200)Queries matched 25 30 33 15 23Mowse score 209 214 151 59 150

F29-3(pFC240)Queries matched 0 0 0 0 0Mowse score 0 0 0 0 0

FX12Queries matched 0 0 0 0 0Mowse score 0 0 0 0 0

FX12(pFC200)Queries matched 33 19 32 12 31Mowse score 154 114 68 62 100

FX10(pFC200)Queries matched 33 0 0 0 0Mowse score 88 0 0 0 0

FX14(pFC200)Queries matched 12 12 0 0 0Mowse score 72 115 0 0 0

FE6(pFC200)Queries matched 21 14 15 0 0Mowse score 97 51 94 0 0

FE5(pFC200)Queries matched 11 12 15 9 0Mowse score 90 96 111 62 0

a Peptides were searched for matched proteins in the MSDB data base.b Mowse scores greater than 50 indicate that the identification of proteins was significant (p � 0.05).

Nonribosomal Synthesis of Fengycin

FEBRARY 23, 2007 • VOLUME 282 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5611

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

band was undetected after silver staining in the lanes loadedwith the proteins that had been eluted from the beads that wereadded to the E. coli HB101(pFC200) lysate or the E. coliHB101(pFC240)-B. subtilis F29-3 lysate mixture. Analysis ofthe proteins in gel pieces excised from the 406-kDa positions byMALDI-TOFmass spectrometry did not yield a peptide finger-print thatmatched that of FenA (Table 1). These results verifiedthe immunoblot result that Ni2�-NTA-agarose beads retainedFenA in theB. subtilis F29-3 lysate whenHis-FenCwas present.Meanwhile, similar experiments were conducted to detect theinteraction betweenHis-FenC and FenB. FenB in the B. subtilisF29-3 lysate (Fig. 2B, lane 1) did not bind toNi2�-NTA-agarosebeads (Fig. 2B, lane 3) unless the lysate was mixed with theE. coli HB101(pFC200) lysate (Fig. 2B, lane 6). Besides, mixingthe lysates from B. subtilis F29-3 and E. coli HB101(pFC240)did not result in a binding of FenB to the beads (Fig. 2B, lane 4).MALDI-TOF spectrometry analysis also confirmed that the146 kDa band contained FenB (Table 1). After demonstratingthe interactions among FenA, FenB, andHis-FenC in vitro, thisstudy further investigated whether FenD and FenE interactedwith His-FenC. Analyzing the 290 kDa band in a lane loadedwith the proteins eluted from Ni2�-NTA-agarose beads addedto the E. coli HB101(pFC200) lysate by MALDI-TOF massspectrometry, as expected, revealed a peptide fingerprint thatmatched that of FenC (Table 1; supplemental Table 1). Mean-while, a similar experiment was performed by adding the beadsto an E. coli HB101(pFC200)-B. subtilis F29-3 lysate mixture.Analysis of the 290-kDa band in this case revealed peptide fin-gerprints thatmatched those of FenC, FenD, and FenE (Table 1;supplemental Table 2), indicating that His-FenC, FenD, andFenE were bound to the beads. Additionally, the peptides withm/z at 1215.60, 1260.66, and 1383.67 (supplemental Table 2)were further selected forMALDI-TOF-TOF analysis. The anal-ysis revealed sequences of AVLPDFMVPAR, IHDEVPFTTFR,and DSGAALLLTQPGK, which matched the amino acidsequence in the regions from 1962 to 1972 in FenD, from 1119to 1128 in FenC, and from 559 to 572 in FenE, respectively,confirming that the peptide mass fingerprint data obtained byMALDI-TOF analysis indeed detected FenC, FenD, and FenE.Meanwhile, a parallel experimentwas conducted using aB. sub-tilis F29-3-E. coli HB101(pFC240) lysate mixture; not only didimmunoblotting not detect the binding of the 290-kDa proteinsto the Ni2�-NTA-agarose beads (Fig. 2A, lane 4), but alsoMALDI-TOF mass spectrometry analysis of a piece of gelexcised from the 290-kDa region failed to detect any peptidefingerprint matching those of FenC, FenD, and FenE (Table 1;supplemental Table 2).Analyzing the Interactions among Fengycin Synthetases in

Vivo—After demonstrating that fengycin synthetases inter-acted with His-FenC in vitro, this work added Ni2�-NTA-aga-rose beads to the B. subtilis F29-3(pFC200) lysate to investigatewhether fengycin synthetases in the cell were retained by thebeads. After the proteins were eluted from the beads and theeluted proteins were separated by SDS-PAGE, bands of 406,290, and 146 kDa were observed by staining with a silver stain.MALDI-TOF spectrometry confirmed that the 406-kDa bandcontained FenA (Table 1; supplemental Table 3); the 290 kDaband contained FenC, FenD, and FenE (Table 1; supplemental

Table 3), and the 146 kDa band contained FenB (Table 1; sup-plemental Table 3). Meanwhile, a parallel experiment, whichused a lysate from B. subtilis F29-3(pFC240), revealed that notonly did staining and immunoblotting fail to detect the threefengycin synthetase bands, but also MALDI-TOF mass spec-trometry of the gel pieces sliced from the 406-, 290-, and 146-kDa regions failed to detect peptideswith amolecularmass thatmatched that of peptides from fengycin synthetases digestedwith trypsin (Table 1).Analyzing the Interactions of Fengycin Synthetases in Fengy-

cin Synthetase Mutants—B. subtilis F29-3 mutants that con-tained a transposon insertion in fenC, fenD, fenE, fenA, andfenB, called FX12, FX10, FX14, FE6, and FE5, respectively (Fig.1B), were transformedwith pFC200 to elucidate howmutationsin a fengycin synthetase gene affected the interactions amongfengycin synthetases. In the case of the FX12 mutant, whichcontained a defective fenC, none of the fengycin synthetases inthe lysatemutant bound toNi2�-NTA-agarose beads (Table 1).However,MALDI-TOFmass spectrometry analysis of the 406-,290-, and 146-kDa bands in an SDS-polyacrylamide gel stainedby silver staining revealed binding of all five fengycin syntheta-ses to the beads when the mutant was transformed withpFC200 (Table 1). Meanwhile, using the FX10(pFC200)lysate yielded a different outcome; only His-FenC, and notthe other fengycin synthetases, bound to the beads (Table 1).Additionally, both His-FenC and FenD in the FX14(pFC200)lysate; His-FenC, FenD, and FenE in the FE6(pFC200) lysate;and His-FenC, FenD, FenE, and FenA in the FE5(pFC200)lysate bound to the Ni2�-NTA-agarose beads (Table 1).Specific Interactions among Fengycin Synthetases in Vitro—

To investigate how fengycin synthetases interact, the N-termi-nal and C-terminal regions in fengycin synthetases that werefused with a FLAG tag and a histidine tag, respectively, wereexpressed in E. coli. After the lysates were mixed, Ni2�-NTA-agarose beads were added. Proteins eluted from the beads werethen separated by SDS-PAGE. Immunoblot analysis using anti-FLAG antibody indicated the binding of a protein that containsthe N-terminal 700-amino acid region in FenD (N-FenD) to aprotein that contains the C-terminal 700-amino acid region inFenC (C-FenC) (Fig. 3). However, C-FenC did not interact withthe N-terminal 900-amino acid region in FenE (N-FenE), theN-terminal 800-amino acid region in FenA (N-FenA), or theN-terminal 700-amino acid region in FenB (N-FenB) (Fig. 3).Similar experiments demonstrated that N-FenE interactedwith the C-terminal 700-amino acid region in FenD (C-FenD),N-FenA interacted with the C-terminal 700-amino acid regionin FenE (C-FenE), andN-FenB interacted with the C-terminal800-amino acid region in FenA (C-FenA) (Fig. 3). Addition-ally, the C-terminal 800-amino acid region in FenB (C-FenB)did not interact with the N-terminal regions of other fengy-cin synthetases (Fig. 3).Sucrose Gradient Sedimentation Analysis of Fengycin Synthe-

tase Complex—In a control experiment, a lysate from E. coliHB101(pFC200) was loaded to a 25–65% sucrose gradient. Fol-lowing centrifugation, His-FenC was present on the top of thegradient in fractions 2, 3, and 4 (Fig. 4A). However, fengycinsynthetases in the B. subtilis F29-3 lysate were distributedbetween fractions 3 and 9 (Fig. 4A). Meanwhile, fengycin syn-

Nonribosomal Synthesis of Fengycin

5612 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 8 • FEBRARY 23, 2007

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

thetases in the FX10 lysate were distributed between fractions2 and 6. Furthermore, FenB in the lysate from E. coliHB101(pFB200) was present on the top of the gradient fromfraction 2 to 4 (Fig. 4B). FenB in the lysate fromB. subtilis F29-3was found in fractions 3–9 (Fig. 4B). FenB in the lysate from theFX10 mutant was present in fractions 2–5 (Fig. 4B). Immuno-blot and MALDI-TOF mass spectrometry analyses confirmedthat fraction 8 from the gradient loaded with the B. subtilisF29-3 lysate contained all five fengycin synthetases (data notshown).Electron Microscopy of Fengycin Synthetase Complex—

Fengycin synthetase complex purified from B. subtilis F29-3(pFC200) with an Ni2�-NTA-agarose column was studied byelectron microscopy. The fengycin synthetases formed a chainthat coiled into a structure with an average size of about 14.5nm (Fig. 5). Meanwhile, complexes that are smaller than 14.5nmwere observed and probably did not contain all of the fengy-cin synthetases.

Localization of Fengycin Synthetases—Immunofluorescenceanalysis of B. subtilis F29-3 cells was performed by confocalmicroscopy with polyclonal anti-FenC and monoclonal anti-FenB antibody to locate the fengycin synthetases in the cell.Among the cells that had been cultured for 24 h in nHA broth,FenB and FenC appeared to aggregate and frequently colocal-ized along the membrane (Fig. 6).Synthesis of Fengycin on the Fengycin Synthetase Complex—

The synthesis of fengycin on the fengycin synthetase complexwas studied using enzyme complexes thatwere reconstituted invitro using a mutant FenB protein, FenB-dTE, which lacks athioesterase domain. After the complex had been purified byNi2�-NTA-agarose affinity chromatography, the enzyme com-plex was added to a reaction mixture that contained the sevensubstrate amino acids that were involved in fengycin synthesis,including 14C-labeled L-Orn, L-Tyr, and L-Pro. After the reac-tion completed, urea was added to the reaction mixture todissociate the enzymes from FenB-dTE. FenB-TE, which con-tained a histidine tag, was then captured with Ni2�-NTA-aga-rose beads. Because FenB-dTE did not contain a thioesterasedomain, radioactively labeled fengycin elongated to FenB-dTE

FIGURE 3. Interactions among fengycin synthetases. Recombinant pro-teins that contained histidine-tagged C-terminal regions of FenC (C-FenC),FenD (C-FenD), FenE (C-FenE), FenA (C-FenA), and FenB (C-FenB) were mixedwith the proteins that contained FLAG-tagged N-terminal regions of FenC(N-FenC), FenD (N-FenD), FenE (N-FenE), FenA (N-FenA), and FenB (N-FenB).Ni2�-NTA-agarose beads were then added to the mixture. Proteins that werebound to the beads were analyzed by immunoblotting with anti-FLAGantibody.

FIGURE 4. Sedimentation of the fengycin synthetase complex by sucrose-gradient centrifugation. Cell lysates prepared from E. coli HB101(pFC200),E. coli HB101(pFB200), B. subtilis F29-3, and B. subtilis FX10 were centrifugedthrough a 25– 65% sucrose gradient. After centrifugation, fractionated pro-teins were analyzed by immunoblotting with anti-FenC antibody (A) and anti-FenB antibody (B).

FIGURE 5. Microscopy of the fengycin synthetase complex. Fengycin syn-thetase complexes purified from E. coli HB101(pFC200) and B. subtilis F29-3(pFC200), respectively, by Ni2�-NTA-agarose beads were negatively stainedand observed using a JEOL JEM-1230 electron microscope. Five regions of theimage are selected and magnified (1–5). Meanwhile, histidine-tagged FenCpurified from E. coli HB101(pFC200) was also shown (6) as a comparison. Bar,50 nm.

FIGURE 6. Localization of fengycin synthetases in B. subtilis F29-3. Immu-nostaining of B. subtilis F29-3 cells was performed with polyclonal anti-FenC(�-FenC) and monoclonal anti-FenB antibody (�-FenB). The cells were thentreated with Alexa 488-conjugated anti-rabbit IgG antibody and Alexa 598-conjugated anti-mouse IgG antibody. Finally, cells were examined using aLeica model TCS SP2 confocal laser-scanning microscope (A). A region of theimage is selected and magnified (B).

Nonribosomal Synthesis of Fengycin

FEBRARY 23, 2007 • VOLUME 282 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5613

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

could not be released. Therefore, fengycin synthesis on theenzyme chain could be determined by monitoring the radioac-tivity of fengycin elongated to FenB-dTE. The results indicatedthat in the experiment that involved FenB-dTE but not theother fengycin synthetases, only a background level of labelingof FenB-dTEwas detected (Fig. 7). However, when the fengycinsynthetase complex reconstituted with FenB-dTEwas added tothe reaction mixture, the detected radioactivity increased by afactor of about 4 (Fig. 7).

DISCUSSION

Microorganisms often synthesize small peptides nonriboso-mally. During the synthesis, an elongating peptide must betransferred from one peptide synthetase to another in a specificorder; otherwise, a peptide with a correct sequence will not besynthesized (18, 35, 36). Hence, forming a peptide synthetasecomplex is probably the most efficient way for nonribosomalpeptide synthesis. In fact, Kleinkauf and von Dohren (37, 38)postulated that peptide synthetases may form such a complexto facilitate peptide synthesis. However, the presence of such a

complex has not been experimentally established. The onlywork thatmight have suggested that peptide synthetases form acomplex involved a sucrose gradient sedimentation study ongramicidin synthetases and demonstrated that the two grami-cidin synthetases were present in the same fractions in the gra-dient (39). Since fengycin synthesis involves five fengycin syn-thetases, the system enables the interaction among theseenzymes, whether they are linked in a specific order, and howthe absence of an enzyme affects the complex formation to beinvestigated. This study reveals that fengycin synthetasesdirectly or indirectly interactwithHis-FenCboth in vitro and invivo (Table 1 and Fig. 2). Meanwhile, these enzymes appear toform a chain, which coils into a uniform structure of about 14.5nm (Fig. 5). The size of the fengycin synthetase complex issmaller than cyclosporine synthetase, a 1.6-megadalton proteinwith 11-amino acid activationmodules and a size of 25 nm (40).Observations of fengycin synthetases and the cyclosporin syn-thetase indicate that the enzyme modules and enzymes them-selves, rather than stretching out in a line, may bond to eachother at particular angles and ultimately form an enzyme or anenzyme complexwith a defined shape (Fig. 5). Additionally, twopartner fengycin synthetases can bind to each other in theabsence of other fengycin synthetases in vitro,4 revealing thatany two-partner fengycin synthetasesmay interact in the cell tobegin assembling the fengycin synthetase chain.The immunofluorescence work reveals that FenB and FenC

form aggregates and frequently colocalize at the membrane inthe cells that had been cultured for 24 h (Fig. 6). However, onlyabout half of the cell population in the log phase formed suchaggregates; the rest of the population contain these enzymesdistributed evenly in the cells (data not shown), indicating thatthe stages of cell growth affect the distribution of the enzymes.Earlier studies have demonstrated that cyclosporin synthetaseand gramicidin synthetase 2 are also associated with the vascu-lar membrane in Tolypocladium inflatum (40) and the mem-brane in Bacillus cereus, respectively (41). The association ofthe fengycin synthetases with the membrane is unsurprising,because the interaction may facilitate the synthesis of the fattyacid that is incorporated in fengycin.After establishing that fengycin synthetases bind to Ni2�-

NTA-agarose beads when His-FenC is present, this study fur-ther explores how these enzymes interact with His-FenC in themutants that contain a mutation in a fengycin synthetase gene.The results indicated that FenE, FenA, and FenB do not interactwith His-FenC in FX10(pFC200), a mutant that contains adefective fenD (Table 1). This result indicates the importantfact that His-FenC does not directly interact with FenE, FenA,and FenB; the binding of FenE, FenA, and FenB to His-FenCand Ni2�-NTA-agarose beads depends on FenD. Meanwhile, asimilar study of FX14(pFC200), which contains a defective fenE,reveals a binding ofHis-FenC and FenDbut not FenA and FenBto Ni2�-NTA-agarose beads (Table 1). Since FenD does notbind to Ni2�-NTA-agarose beads, the binding of FenD in theFX14(pFC200) lysate to the beads (Table 1) reveals a directinteraction between His-FenC and FenD.Moreover, the obser-

4 Y.-C. Cheng and S.-T. Liu, unpublished results.

FIGURE 7. Synthesis of fengycin on fengycin synthetase complex. FenB-dTE, H2O (Blank) or fengycin synthetase complex that had been reconstitutedwith FenB-dTE and purified in vitro (Complex(FenB-dTE)) was added to a mix-ture of ATP, coenzyme A, and the seven amino acids in fengycin, including14C-labeled L-Orn, L-Pro, and L-Tyr. Following the reaction, FenB-dTE was dis-sociated from the complex by adding a urea solution to the reaction mixture.FenB-dTE was finally captured by Ni2�-NTA-agarose beads. Radioactivelylabeled fengycin peptide elongated to FenB-dTE was then measured using aliquid scintillation counter.

Nonribosomal Synthesis of Fengycin

5614 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 8 • FEBRARY 23, 2007

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

vation also shows that FenE is required for the binding of FenAand FenB to FenD. Furthermore, in the study that involvesFE6(pFC200), which contains a defective fenA, His-FenC,FenD, and FenE in the lysate bind to Ni2�-NTA-agarose beads(Table 1). Since FenE in the FX10(pFC200) lysate does not bindto Ni2�-NTA-agarose beads (Table 1), the results indicate thatthe binding of FenE to the beads depends on His-FenC andFenD. Additionally, the fact that FenE does not bind to FenC inthe FX10(pFC200) lysate (Table 1) demonstrates that FenEindirectly interacts with His-FenC through a direct binding toFenD. Moreover, the study on FE6(pFC200) (Table 1) revealedthat the interaction between FenB and His-FenC depends onFenA. Likewise, an analysis of the fengycin synthetases in theFE5(pFC200) lysate (Table 1) reveals that FenE binds to FenA.The fact that FenB is present in the fengycin synthetase com-plex in B. subtilis F29-3 (Fig. 2B) and that FenB does not bind toNi2�-NTA-agarose beads in the absence of FenA (Table 1)demonstrates that FenB directly interacts with FenA.Addition-ally, this work finds that transposon insertions in the fengycinsynthetase operon reduce but do not completely eliminate theexpression of the genes downstream of the insertions. Hence, alack of binding of fengycin synthetases to Ni2�-NTA-agarosebeads is not attributable to a lack of fengycin synthetase in themutant cells. In fact, our investigation reveals that two partnerfengycin synthetases in the enzyme chain are indeed linked viaa specific interaction between the C-terminal region of anupstream enzyme and the N-terminal region of a downstreampartner enzyme (Fig. 3). These findings indicate that fengycinsynthetases form a chain in the order FenC-FenD-FenE-FenA-FenB, with the 10-amino acid activation modules arrangedcolinearly with the amino acids in fengycin. The fact indicatingthat physical interactions among peptide synthetases are cru-cial to nonribosomal peptide synthesis also came from a workon tyrocidine synthesis. The study indicated that substitutingthe regions containing the epimerase domains of TycA andTycB (tyroscidine synthetase A and B) prevents the transloca-tion of the elongating tyrocidine peptide from TycA to TycB(42), suggesting that the absence of peptide translocation maybe attributable to the possibility that the C-terminal epimerasedomain in TycA is critical to a specific interaction with TycB.Additionally, the work also artificially linked TycA and TycB toform a single protein chain and showed that tyrocidine wassynthesized on the recombinant enzyme, indicating the impor-tance of physical contact between these two enzymes (42). Fur-thermore, although direct contacts among the three tyrocidinesynthetases have not been established, the interaction betweena donor and an acceptor COM domain at the C terminus andthe N terminus of TycA and TycB, respectively, are crucial fortyrocidine synthesis; changing the sequences in these domainsor replacing the sequence with COM sequences from otherenzymes prevents the elongation of tyrocidine peptide chain(24, 43). Whether fengycin synthetases interact via the COMdomains is under investigation.FenB contains a thioesterase domain, which is required to

terminate fengycin synthesis. In an enzyme complex that con-tains an intact FenB, fengycin synthesized on the enzyme com-plex is terminated and released from the enzyme complex.Under such circumstances, radioactively labeled fengycin syn-

thesized by the fengycin synthetase complex will be difficult torecover and identify. However, fengycin should not be releasedfrom the enzyme complex if the thioesterase domain in FenB isremoved. Therefore, radioactively labeled fengycin elongatedto FenB-dTE can be measured after dissociating the enzymecomplex with urea and capturing FenB-dTE by Ni2�-NTA-agarose beads (Fig. 7). This study demonstrated by SDS-PAGEthat fengycin synthetases form a complex with FenB-dTE (datanot shown). Additionally, results of this study demonstrate thatfengycin is indeed synthesized on the enzyme complex that hadbeen purified by Ni2�-NTA-agarose beads (Fig. 7). Our resultsfurther demonstrate that forming a fengycin synthetase com-plex is crucial to the nonribosomal synthesis of fengycin.

Acknowledgment—We thank Erh-Min Lai for critiques andsuggestions.

REFERENCES1. Loeffler, W., Tschen, J. S.-M., Vanittanakom, N., Kulger, M., Konorpp, E.,

and Wu, T. G. (1986) J. Phytopathol. 115, 204–2132. Tschen, J. S. M. (1987) Trans. Mycol. Soc. Japan 28, 483–4933. Vanittanakom, N., Loeffler, W., Koch, U., and Jung, G. (1986) J. Antibiot.

(Tokyo) 39, 888–9014. Chen, C. L., Chang, L. K., Chang, Y. S., Liu, S. T., and Tschen, J. S. (1995)

Mol. Gen. Genet. 248, 121–1255. Lin, T. P., Chen, C. L., Chang, L. K., Tschen, J. S., and Liu, S. T. (1999) J.

Bacteriol. 181, 5060–50676. Stachelhaus, T., and Marahiel, M. A. (1995) FEMS Microbiol. Lett. 125,

3–147. Schwarzer, D., Finking, R., and Marahiel, M. A. (2003)Nat. Prod. Rep. 20,

275–2878. Sieber, S. A., and Marahiel, M. A. (2003) J. Bacteriol. 185, 7036–70439. Finking, R., andMarahiel,M. A. (2004)Annu. Rev.Microbiol. 58, 453–48810. Grunewald, J., and Marahiel, M. A. (2006) Microbiol. Mol. Biol. Rev. 70,

121–14611. Conti, E., Stachelhaus, T., Marahiel, M. A., and Brick, P. (1997) EMBO J.

16, 4174–418312. Lin, G. H., Chen, C. L., Tschen, J. S., Tsay, S. S., Chang, Y. S., and Liu, S. T.

(1998) J. Bacteriol. 180, 1338–134113. Shu, H. Y., Lin, G. H., Wu, Y. C., Tschen, J. S., and Liu, S. T. (2002)

Biochem. Biophys. Res. Commun. 292, 789–79314. Lin, T. P., Chen, C. L., Fu, H. C.,Wu, C. Y., Lin, G. H., Huang, S. H., Chang,

L. K., and Liu, S. T. (2005) Biochim. Biophys. Acta 1730, 159–16415. Schlumbohm, W., Stein, T., Ullrich, C., Vater, J., Krause, M., Marahiel,

M. A., Kruft, V., and Wittmann-Liebold, B. (1991) J. Biol. Chem. 266,23135–23141

16. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M.,Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996) Chem. Biol.3, 923–936

17. Stachelhaus, T., Huser, A., and Marahiel, M. A. (1996) Chem. Biol. 3,913–921

18. Stein, T., Vater, J., Kruft, V., Otto, A., Wittmann-Liebold, B., Franke, P.,Panico, M., McDowell, R., and Morris, H. R. (1996) J. Biol. Chem. 271,15428–15435

19. Kleinkauf, H. (2000) Biofactors 11, 91–9220. Mootz, H. D., and Marahiel, M. A. (1997) J. Bacteriol. 179, 6843–685021. Stachelhaus, T., Mootz, H. D., Bergendahl, V., andMarahiel, M. A. (1998)

J. Biol. Chem. 273, 22773–2278122. Luo, L., Kohli, R. M., Onishi, M., Linne, U., Marahiel, M. A., and Walsh,

C. T. (2002) Biochemistry 41, 9184–919623. Linne, U., and Marahiel, M. A. (2000) Biochemistry 39, 10439–1044724. Samel, S. A., Wagner, B., Marahiel, M. A., and Essen, L. O. (2006) J. Mol.

Biol. 359, 876–88925. Sieber, S. A., Tao, J., Walsh, C. T., and Marahiel, M. A. (2004) Angew.

Nonribosomal Synthesis of Fengycin

FEBRARY 23, 2007 • VOLUME 282 • NUMBER 8 JOURNAL OF BIOLOGICAL CHEMISTRY 5615

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

Chem. Int. Ed. Engl. 43, 493–49826. Chang, L. K., Chen, C. L., Chang, Y. S., Tschen, J. S., Chen, Y. M., and Liu,

S. T. (1994) Gene (Amst.) 150, 129–13427. Sambrook, J., and Russell, D. W. (2001)Molecular Cloning: A Laboratory

Manual, 3rd Ed., pp. A2.2, Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY

28. Boyer, H. W., and Roulland-Dussoix, D. (1969) J. Mol. Biol. 41, 459–47229. Cohen, S. N., and Chang, A. C. (1973) Proc. Natl. Acad. Sci. U. S. A. 70,

1293–129730. Imanaka, T., Fujii, M., Aramori, I., and Aiba, S. (1982) J. Bacteriol. 149,

824–83031. Blum, H., Beier, H., and Gross, H. J. (1987) Electrophoresis 8, 93–9932. Chang, L. K., Lee, Y. H., Cheng, T. S., Hong, Y. R., Lu, P. J., Wang, J. J.,

Wang,W. H., Kuo, C.W., Li, S. S., and Liu, S. T. (2004) J. Biol. Chem. 279,38803–38812

33. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Anal. Chem.68, 850–858

34. Harry, E. J., Pogliano, K., and Losick, R. (1995) J. Bacteriol. 177, 3386–339335. Stachelhaus, T., and Marahiel, M. A. (1995) J. Biol. Chem. 270,

6163–616936. von Dohren, H., Keller, U., Vater, J., and Zocher, R. (1997) Chem. Rev. 97,

2675–270637. Kleinkauf, H., and von Dohren, H. (1997) Prog. Drug. Res. 48, 27–5338. Kleinkauf, H., and von Dohren, H. (1995) J. Antibiot. (Tokyo) 48,

563–56739. Koischwitz, H., and Kleinkauf, H. (1976) Biochim. Biophys. Acta 429,

1041–105140. Hoppert, M., Gentzsch, C., and Schorgendorfer, K. (2001) Arch. Microbiol.

176, 285–29341. Hori, K., and Kurotsu, T. (1997) J. Biochem. (Tokyo) 122, 606–61542. Linne, U., Stein, D. B.,Mootz, H. D., andMarahiel,M.A. (2003)Biochemistry

42, 5114–512443. Chiocchini, C., Linne, U., and Stachelhaus, T. (2006) Chem. Biol. 13,

899–908

Nonribosomal Synthesis of Fengycin

5616 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 8 • FEBRARY 23, 2007

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from

1

Supplemental Data

Table 1. Peptides identified by MALDI-TOF mass spectrometry from proteins bound to

Ni-NTA agarose beads in the E. coli HB101(pFC200) lysate

Matched Peptides Observed a Mr (expt)b Mr (calc)c Sequence Peptide Location in

Fengycin Synthetasesd 899.4506 898.4433 898.4800 LYLAEYK FenC (75 - 81) 940.4956 939.4883 939.4814 VLYEFNR FenC (445 - 451) 1172.6520 1171.6447 1171.6600 EGPLLQAGLFK FenC (2206 - 2216) 1184.6448 1183.6375 1183.6250 NFAHAVLAWR FenC (1664 - 1673) 1191.5722 1190.5650 1190.5502 MVFTQDHTGR FenC (2145 - 2154) 1260.6552 1259.6479 1259.6298 IHDEVPFTFR FenC (1119 - 1128) 1277.7264 1276.7192 1276.6557 SVGREQLSVMR FenC (313 - 323) 1320.6003 1319.5930 1319.6945 GFSSDALRQALR FenC (2123 - 2134) 1325.7572 1324.7500 1324.7350 ETQPIVAVLAER FenC (1544 - 1555) 1353.6915 1352.6843 1352.7048 HLIAGSDIGDISR FenC (1605 - 1617) 1377.7678 1376.7605 1376.7452 FPYNLLVNELR FenC (327 - 337) 1419.7688 1418.7615 1418.7227 LEPAELYALMNR FenC (1719 - 1730) 1420.7886 1419.7813 1419.7146 KFTENPFVPGER FenC (1867 - 1878) 1434.7748 1433.7676 1433.7449 RIYQLDQMPVR FenC (1674 - 1684) 1510.8810 1509.8737 1509.8514 GKETQPIVAVLAER FenC (1542 - 1555) 1516.7667 1515.7595 1515.7721 AGGVYIPIDSHYPK FenC (1569 - 1582) 1548.7778 1547.7706 1547.7514 MKENTYGLTHAQR FenC (1- 13) 1599.8381 1598.8308 1598.8416 AVSPVSSTLHGLFER FenC (454 - 468) 1621.8076 1620.8003 1620.7631 FQLTEGIESESEPR.L FenC (61- 74) 1690.9106 1689.9033 1689.8937 LAAYILPSDADTTALR FenC (1943 - 1958) 1720.8714 1719.8641 1719.8467 VGIHDSFFELGGDSIK FenC (2028 - 2043) 1732.8797 1731.8725 1731.8467 AGGAYVPLDPVYPEER FenC (532 - 547)

a. Experimental m/z value

b. Experimental m/z transformed to a relative molecular mass

c. Relative molecular mass calculated from the matched peptide sequence

d. Numbers denote amino acid positions in fengycin synthetase

2

Table 2. Peptides identified by MALDI-TOF mass spectrometry from proteins bound to Ni-NTA agarose beads

added to the B. subtilis F29-3-HB101(pFC200) lysate mixture

Matched Peptides Observeda Mr (expt)b Mr (calc)c Sequence Peptide Location in

Fengycin Synthetasesd 842.4923 841.4850 841.5273 ILIELNK FenC (1480 - 1486) 1016.5090 1015.5017 1015.5702 EFGVQVPLK FenC (1007 - 1015) 1184.6138 1183.6066 1183.6250 NFAHAVLAWR FenC (1664 - 1673) 1260.6685 1259.6612 1259.6298 IHDEVPFTFR e FenC (1119 - 1128) 1307.6729 1306.6657 1306.6458 WTAHFTEFLR FenC (1447 - 1456) 1353.6843 1352.6771 1352.7048 HLIAGSDIGDISR FenC (1605 - 1617) 1355.6763 1354.6690 1354.6193 FLDDPFYPGER FenC (823 - 833) 1357.6979 1356.6907 1356.7686 SPDMLTAVLAVLK FenC (519 - 531) 1383.6742 1382.6669 1382.7769 DSGAALLLTQPGLK FenC (554 - 567) 1460.7646 1459.7573 1459.6844 SGPVGIHDNFFDR FenC (978 - 990) 1493.7359 1492.7287 1492.7786 VFAGGEPLAPHTAAR FenC (719 - 733) 2079.9625 2078.9553 2078.9684 GEPVPDEQEPSYISYIEK FenC (163 - 180) 842.4923 841.4850 841.5134 DVLALRR FenD (668 - 692) 1036.5303 1035.5231 1035.5713 LYRTGDLAK FenD (1875 - 1883) 1109.5113 1108.5040 1108.5625 QRGYETTVR FenD (2053 - 2061) 1215.6024 1214.5951 1214.6481 AVLPDFMVPAR e FenD (1962 - 1972) 1460.7646 1459.7573 1459.7307 IPTDHTITSNSFK FenD (2306 - 2318) 1479.7926 1478.7853 1479.6742 EIAYWNEREDR FenD (2291 - 2301) 1598.7731 1597.7659 1597.7624 DYLQEYGNTASIPK FenD (204 - 217) 1765.7251 1764.7178 1764.9370 EVPDLTGPQQVVLTNR FenD (71 - 86) 1873.9212 1872.9139 1872.8418 TDSYFTYAQTLADYSK FenD (2269 - 2284) 1987.9931 1986.9858 1986.9105 HDEQLALIEDFMQQDR FenD (100 - 115) 1996.9832 1995.9759 1995.0174 HIERIPTDHTITSNSFK FenD (2306 - 2318) 2286.1056 2285.0984 2286.0229 YIEWLGEQDQEETAAYWR FenD (532 - 547) 2895.4870 2894.4797 2895.3892 SNTAGNAQGLSAEAHKQIEEMANQIQR FenD (532 - 547) 832.4592 831.4519 831.4272 GVMIEQR FenE (1661 - 1667) 856.5148 855.5075 855.5290 QVVLKNR FenE (78 - 84) 967.4401 966.4328 966.4447 EEAAAYWK FenE (194 - 201) 1003.5244 1002.5172 1002.4817 FHRGAMER FenE (2498 - 2505) 1016.5090 1015.5017 1015.5451 DITPTWKR FenE (2465 - 2472) 1029.5835 1028.5762 1028.6342 ATALVSRIAK FenE (1002 - 1011) 1036.5303 1035.5231 1035.5712 ALSFSGLVSR FenE (307 - 316) 1066.5067 1065.4995 1065.5059 LGMTRDMSR FenE (1375 - 1383) 1157.5918 1156.5845 1156.5593 LRMAMEGHGR FenE (2353 - 2362) 1265.6402 1264.6329 1264.6411 ETYPVSSAQKR FenE (1053 - 1063) 1307.6729 1306.6657 1306.6881 EHILPDLDISR FenE (2363 - 2373) 1329.6803 1328.6730 1328.6758 MTLLDHDKTQK FenE (438 - 448) 1340.6620 1339.6547 1339.7572 QVALTPDRTALR FenE (473 - 484) 1373.6639 1372.6566 1372.7099 ETFLDSHQLKR FenE (1718 - 1728) 1383.6742 1382.6669 1382.7769 DSGAALLLTQPGLK e FenE (559 - 572) 1405.6894 1404.6821 1404.7037 WLPDGTIEYVGR FenE (1883 - 1894) 1407.7194 1406.7122 1406.7517 VQDYAQSSKLIR FenE (2263 - 2274) 1460.7646 1459.7573 1459.6844 SGPVGIHDNFFDR FenE (983 - 995) 1493.7359 1492.7287 1492.7786 VFAGGEPLAPHTAAR FenE (724 - 738) 1584.7392 1583.7319 1583.7103 EETYWRSVEEEK FenE (2275 - 2286) 1588.7709 1587.7636 1587.8845 ASLKKLAEHHDALR FenE (2127 - 2140) 2064.1336 2063.1263 2063.1487 HIDGVKEAAVLARTGQLGTK FenE (1917 - 1936) 2087.9445 2086.9373 2086.9959 AYFEQASFTINGQLDLDF FenE (32 - 49) 2342.9970 2341.9898 2342.0814 TPEIGFNYLGQFNDIESQDR FenE (2435 - 2454) 2510.1668 2509.1595 2509.3726 LARENGSTLYMVLLAAYTALLAR FenE (1280 - 1302) 2565.1880 2564.1807 2564.3921 IEPGEIEAALRSIEGVREAAVTVR FenE (871 - 894) 3264.6947 3263.6874 3263.8162 LTAHGITKESIVGVLSERSPDMLTAVLAVLK FenE (506 - 536) 891.4696 890.4623 890.4650 FLPDPFR FenA (823 - 829) 973.5242 972.5170 972.4624 ELNEQANR FenA (1522 - 1529) 995.5085 994.5012 994.4872 QETYWLR FenA (1222 - 1228)

3

1001.5364 1000.5291 1000.5341 VAWELIDR FenA (1530 - 1537) 1029.5922 1028.5849 1028.6342 ATALVSRIAK FenA (2033 - 2042) 1036.5412 1035.5340 1035.5389 WFLSQDIK FenA (3123 - 3130) 1071.6177 1070.6104 1070.6236 GPLLQAGLFR FenA (3228 - 3237) 1241.6599 1240.6526 1240.6564 ALPEPAFNQVR FenA (3015 - 3025) 1244.6861 1243.6788 1243.6812 LSQLWEEVLK FenA (2004 - 2013) 1259.6696 1258.6623 1258.7761 TLKPLRIQYK FenA (1195 - 1204) 1355.6571 1354.6498 1354.6193 FLDDPFYPGER FenA (1859 - 1869) 1405.6966 1404.6894 1404.6833 HHFNQSVMLHR FenA (3133 - 3143) 1416.7288 1415.7215 1415.7197 WLPDGQVEFLGR FenA (1879 - 1890) 1460.6813 1459.6740 1459.6844 SGPVGIHDNFFDR FenA (2014 - 2026) 1530.7380 1529.7307 1529.7262 EAPIGIHDNFFDR FenA (982 - 994) 1645.7739 1644.7666 1644.8107 STSRQEQITFSFSK FenA (221 - 234) 1929.9894 1928.9821 1929.0220 ARPEGGKPFAQFLQEVR FenA (2369 - 2385) 2010.9850 2009.9777 2009.9846 LAAEAYSYHPLYEIQSR FenA (322 - 338) 2096.9616 2095.9544 2096.0497 LSLESHGREDVLDGIDVSR FenA (3386 - 3404) 2298.1545 2297.1472 2297.1586 AITIHHDALRMVFTQSEQGK FenA (3158 - 3177) 2510.1425 2509.1353 2509.3726 LARENGSTLYMVLLAAYTALLAR FenA (2311 - 2333) 2705.1972 2704.1900 2704.3537 FEYSTALFQEATIKQWTYHLTK FenA (2468 - 2489) 855.0382 854.0309 854.5589 AAILIVQK FenB (567 - 574) 862.0686 861.0613 861.4378 QVVMTER FenB (80 - 86) 863.0397 862.0324 862.4912 TVIDIFR FenB (470 - 476) 928.4987 927.4914 927.5389 LLEIEGVR FenB (880 - 887) 965.4817 964.4744 964.4978 TLYENGLR FenB (510 - 517) 1011.5048 1010.4976 1010.4457 ETAADYWR FenB (196 - 203) 1051.0348 1050.0275 1050.5822 DLALQLNHK FenB (1078 - 1086) 1193.6253 1192.6180 1193.5928 EETFAELLSR FenB (312 - 321) 1199.6404 1198.6331 1198.5982 GSLSYEIFQR FenB (43 - 52) 1231.6820 1230.6748 1230.6431 VLPDYMIPQR FenB (924 - 933) 1234.6602 1233.6529 1233.6605 EELIFTLNQK FenB (230 - 239) 1440.7810 1439.7737 1440.6844 SALPVPENESENR FenB (951 - 963) 1532.8537 1531.8464 1532.8463 TVFLPHVPNLSGPR FenB (66 - 79) 1613.7054 1612.6981 1612.7984 EEGAYVEQSLFTIK FenB (29 - 42)

a. Experimental m/z value

b. Experimental m/z transformed to a relative molecular mass

c. Relative molecular mass calculated from the matched peptide sequence

d. Numbers denote amino acid positions in fengycin synthetase

e. Sequence confirmed by MALDI-TOF-TOF analysis

4

Table 3. Peptides identified by MALDI-TOF mass spectrometry from proteins bound to Ni-NTA agarose

beads added to the B. subtilis F29-3(pFC200) lysate

Matched Peptides Observeda Mr (expt)b Mr (calc)c Sequence Peptide Location in

Fengycin Synthetasesd 712.3156 711.3083 711.3340 FFDQR FenC (2101 - 2105) 842.5004 841.4931 841.5273 ILIELNK FenC (1480 - 1486) 940.4947 939.4874 939.4814 VLYEFNR FenC (445 - 451) 1088.5877 1087.5804 1087.5873 ESIVGVLSER FenC (509 - 518) 1104.6811 1103.6738 1103.6815 LPIGKPVPGAR FenC (772 - 782) 1169.5911 1168.5839 1168.6240 VLYEFNRTK FenC (445 - 453) 1184.6467 1183.6394 1183.6250 NFAHAVLAWR FenC (1664 - 1673) 1197.6404 1196.6331 1196.6189 EKVLYEFNR FenC (443 - 451) 1260.6521 1259.6448 1259.6298 IHDEVPFTFR FenC (1119 - 1128) 1320.6318 1319.6245 1319.6945 GFSSDALRQALR FenC (2123 - 2134) 1325.7198 1324.7126 1324.7350 ETQPIVAVLAER FenC (1544 - 1555) 1343.6855 1342.6782 1342.6517 TDLAIGTYYGNR FenC (268 - 279) 1355.6415 1354.6343 1354.6193 FLDDPFYPGER FenC (823 - 833) 1377.7513 1376.7440 1376.7452 FPYNLLVNELR FenC (327 - 337) 1419.7413 1418.7341 1418.7227 LEPAELYALMNR FenC (1719 - 1730) 1434.7440 1433.7367 1433.7449 RIYQLDQMPVR FenC (1674 - 1684) 1465.7201 1464.7128 1464.7468 DMLGMFVSSLPIR FenC (286 - 298) 1621.8153 1620.8080 1620.7631 FQLTEGIESESEPR FenC (61 - 74) 1649.8213 1648.8141 1648.8797 RVFAGGEPLAPHTAAR FenC (718 - 733) 1690.8937 1689.8864 1689.8937 LAAYILPSDADTTALR FenC (1943 - 1958) 1732.8433 1731.8361 1731.8467 AGGAYVPLDPVYPEER FenC (532 - 547) 1798.8603 1797.8530 1797.8429 NPVFDAMFILQNMDK FenC (1379 - 1393) 1950.8603 1949.8530 1949.9530 MVFTQDHTGRVVQYNR FenC (2145 - 2160) 2011.0127 2010.0055 2009.9959 TGDLAHWLPDGQVEFLGR FenC (837 - 854) 2046.0801 2045.0728 2045.0905 LSEQEDIIVGSPIAGRPHK FenC (1298 - 1316) 860.4497 859.4424 859.5014 ASLISLEK FenD (1164 - 1171) 988.4959 987.4886 987.5025 IWEEGLNK FenD (977 - 984) 990.5385 989.5312 989.5393 KLSSADIEK FenD (1802 - 1810) 1008.4787 1007.4714 1007.4712 FPETHYSK FenD (1224 - 1231) 1011.4924 1010.4851 1010.5257 RTAEELHR FenD (1273 - 1280) 1012.5444 1011.5371 1011.5461 DGKPVQVNR FenD (2150 - 2158) 1036.5507 1035.5434 1035.5713 LYRTGDLAK FenD (1875 - 1883) 1080.5244 1079.5171 1079.5036 EIAYWNER FenD (2291 - 2298) 1104.6811 1103.6738 1103.5822 LSSADIEKNK FenD (1803 - 1812) 1186.6117 1185.6044 1185.6870 DPNAFRLLLK FenD (1719 - 1728) 1197.6404 1196.6331 1196.6553 ELPALNLHYK FenD (1205 - 1214) 1215.6653 1214.6580 1214.6481 AVLPDFMVPAR FenD (1962 - 1972) 1219.5990 1218.5917 1218.5669 FSYNAAVYER FenD (408 - 417) 1236.6423 1235.6351 1235.6146 LIQSFNETER FenD (455 - 464) 1256.6039 1255.5967 1255.6269 RAQAENDISPR FenD (1998 - 2008) 1301.7070 1300.6997 1300.7238 IELSEIETVLR FenD (869 - 879) 1315.7275 1314.7202 1314.7336 YDIFRTIFIK FenD (61 - 70) 1460.7085 1459.7012 1459.7307 IPTDHTITSNSFK FenD (2306 - 2318) 1595.7650 1594.7577 1594.8831 SLNLLVSRYDIFR FenD (53 - 65) 1598.7714 1597.7642 1597.7624 DYLQEYGNTASIPK FenD (204 - 217) 1647.7886 1646.7813 1646.7722 EMFEHQTLGELSAR FenD (2062 - 2075) 1765.8715 1764.8642 1764.9370 EVPDLTGPQQVVLTNR FenD (71 - 86) 1775.8590 1774.8517 1774.8526 AGGAYLPIDPEYPQER FenD (1573 - 1588) 1798.8603 1797.8530 1797.8607 ELLLETMGQYADYPR FenD (1484 - 1498) 1848.9888 1847.9815 1847.9853 QLDERANQIAHALIEK FenD (499 - 514) 1873.9307 1872.9234 1872.8418 TDSYFTYAQTLADYSK FenD (2269 - 2284) 1987.9681 1986.9608 1986.9105 HDEQLALIEDFMQQDR FenD (100 - 115) 2046.0801 2045.0728 2045.0581 HYPNKTLSQLFEEQALK FenD (265 - 481) 2228.0980 2227.0907 2227.1459 WASHFIELVKGITSDIHMK FenD (1453 - 1471) 2694.4407 2693.4334 2693.4288 QGLIDHILVFENYPVQLQQAVNR FenD (348 - 370)

5

832.3665 831.3592 831.4272 GVMIEQR FenE (1661 - 1667) 838.4096 837.4024 837.4418 MDAVFKK FenE (1094 - 1100) 860.4497 859.4424 859.4440 DITPTWK FenE (2465 - 2471) 976.4707 975.4635 975.4596 WLMQQDR FenE (187 - 193) 988.4959 987.4886 987.4695 MTLLDHDK FenE (438 - 445) 1005.5532 1004.5459 1004.5403 FRPSGLGSGK FenE (2455 - 2464) 1012.5444 1011.5371 1011.5137 IHDEVPFR FenE (1124 - 1131) 1036.5507 1035.5434 1035.5712 ALSFSGLVSR FenE (307 - 316) 1119.6005 1118.5933 1118.6084 GYLGRPDLTK FenE (1851 - 1860) 1132.5552 1131.5480 1131.4832 TDSYQEYAR FenE (2253 - 2261) 1215.6653 1214.6580 1214.6506 VELGEIESALR FenE (1906 - 1916) 1256.6039 1255.5967 1255.5873 DYAVWQEAFK FenE (1214 - 1223) 1307.6926 1306.6853 1306.6881 EHILPDLDISR FenE (2363 - 2373) 1355.6415 1354.6343 1354.6193 FLDDPFYPGER FenE (828 - 838) 1405.7291 1404.7218 1404.7037 WLPDGTIEYVGR FenE (1883 - 1894) 1407.7278 1406.7206 1406.7517 VQDYAQSSKLIR FenE (2263 - 2274) 1412.8103 1411.8030 1411.8034 GVGPETVVALLTTR FenE (1548 - 1561) 1416.7444 1415.7371 1415.7197 WLPDGQVEFLGR FenE (848 - 859) 1451.7302 1450.7229 1450.6993 YGWSLHASDLFR FenE (2050 - 2061) 1484.6934 1483.6861 1483.6579 NSNYIEFTPEDR FenE (1675 - 1686) 1652.8028 1651.7956 1651.7816 FVPNPFAPGEQMYR FenE (1863 - 1876) 1704.8193 1703.8121 1703.8154 AGGAYVPLDPAYPEER FenE (537 - 552) 1805.8991 1804.8918 1804.9181 GVGYGMLKYLTPPEHK FenE (2413 - 1876) 1838.9325 1837.9252 1837.8880 DLPADRISYMLSDSGAK FenE (1585 - 1601) 1866.9487 1865.9414 1865.9417 DLCLRPATNVEHQVSK FenE (1405 - 1420) 1877.0544 1876.0472 1876.0530 LINLIIGGEALSASHVNR FenE (1759 - 1776) 1879.8340 1878.8267 1878.8431 SCHVHFEDISHLNER FenE (85 - 99) 1930.0245 1929.0172 1929.0220 ARPEGGKPFAQFLQEVR FenE (1338 - 1354) 1940.9327 1939.9254 1939.8886 WLMQQDREEAAAYWK FenE (187 - 201) 1974.0662 1973.0590 1973.0694 LSGQEDIIVGSPIAGRPHK FenE (1303 - 1321) 2087.9804 2086.9731 2086.9959 AYFEQASFTINGQLDLDR FenE (32 - 49) 2322.1527 2321.1454 2321.1498 RNEQVSEGELQQVTFTISEK FenE (216 - 235) 2343.0640 2342.0568 2342.0814 TPEIGFNYLGQFNDIESQDR FenE (2435 - 2454) 745.4319 744.424 744.4130 EAAVTVR FenA (1919 - 1925) 967.4380 966.4308 966.4294 REAEEYQAK FenA (3312 - 3319) 1016.5461 1015.5382 1016.1910 EFGVQVPLK FenA (2043 - 2051) 1029.5917 1028.5845 1028.6342 ATALVSRIAK FenA (2033 - 2042) 1036.5350 1035.5271 1036.1805 WFLSQDIK FenA (3123 -3130) 1111.5820 1110.5740 1111.2026 DTVSFSLNTK FenA (3337 - 3346) 1203.6374 1202.6295 1203.4322 QEPVAIMMER FenA (2933 - 2943) 1265.6354 1264.6281 1264.6411 ETYPVSSAQKR FenA (2084 - 2094) 1302.6911 1301.6838 1301.190 VETKEIESCIR FenA (2933 - 2943) 1405.6943 1404.6871 1404.6833 HHFNQSVMLHR FenA (3133 - 3143) 1424.6575 1496.7566 1496.7735 LADYAESRQLMK FenA (3294 - 3305) 1497.7639 1496.7566 1496.7735 HAEKNPFASVAQAK FenA (1505 -1521) 1530.7729 1529.7656 1529.7262 EAPIGIHDNFFDR FenA (982 - 994) 1947.0059 1945.9986 1945.9520 TPDQPAVIVEDEEITYK FenA (1505 - 1521) 1985.8789 1984.8716 1984.9564 SFIDSCQPLEETGYR FenE (1475 - 1491) 863.4955 862.4883 862.4912 TVIDIFR FenB (407 - 476) 928.5298 927.5225 927.5389 LLEIEGVR FenB (880 - 887) 1162.5962 1161.5889 1161.5778 NYSTPSQLPR FenB (208 - 217) 1194.5972 1193.5900 1193.5928 EETFAELLSR FenB (312 - 321) 1199.6069 1198.5996 1198.5982 GSLSYEIFQR FenB (43 - 52) 1231.6485 1230.6412 1230.6431 VLPDYMIPQR FenB (924 - 933) 1234.6666 1233.6593 1233.6605 EELIFTLNQK FenB (230 - 239) 1247.6343 1246.6270 1246.6380 VLPDYMIPQR FenB (924 - 933) 1334.6591 1333.6518 1333.6626 TPDQTALVYGNR FenB (482 - 493) 1462.7313 1461.7240 1461.7252 WLPDGNLEYISR FenB (848 - 859) 1533.8542 1532.8469 1532.8463 TVFLPHVPNLSGPR FenB (66 - 79) 1568.7688 1567.7616 1567.8133 GLEVSDFIIVDAYK FenB (1140 - 1153) 1573.7808 1572.7735 1572.7936 NWVEQELTQIWK FenB (971 - 982) 1613.7747 1612.7674 1612.7984 EEGAYVEQSLFTIK FenB (29 - 42) 1640.7677 1639.7604 1639.7630 AAVYGFHFIEEDSR FenB (1087 - 1100)

6

1698.8490 1697.8417 1697.8624 AGGTYLPLDAELPPER FenB (542 - 557) 1829.8176 1828.8104 1828.8202 CYQEYWAQLINEGR FenB (1185 - 1198) 1932.9088 1931.9015 1931.9265 DDVTAAVFSPDPFIPGER FenB (821 - 838) 2152.1565 2151.1493 2151.1687 LHTLYVGGEALSPELINAVR FenB (724 - 743) 2249.0864 2248.0791 2247.9830 FSYNAHVYDAAWMTCIQR FenB (406 - 423) 2378.1967 2377.1894 2377.2164 VSEQSGYNFNLVVAPGDELVIK FenB (384 - 405) 2483.2468 2482.2395 2482.2564 LYSNQLSAAGEQHVIQLNQQGGK FenB (1039 - 1061) 2825.3856 2824.3783 2824.3402 EAAVTLLETDGEVQLYTHYVSDESR FenB (888 - 912)

a. Experimental m/z value

b. Experimental m/z transformed to a relative molecular mass

c. Relative molecular mass calculated from the matched peptide sequence

d. Numbers denote amino acid positions in fengycin synthetases

Hung-Yu Shu, Friedrich Götz and Shih-Tung LiuCheng-Yeu Wu, Chyi-Liang Chen, Yu-Hsiu Lee, Yu-Chieh Cheng, Ying-Chung Wu,

SynthetasesNonribosomal Synthesis of Fengycin on an Enzyme Complex Formed by Fengycin

doi: 10.1074/jbc.M609726200 originally published online December 20, 20062007, 282:5608-5616.J. Biol. Chem. 

  10.1074/jbc.M609726200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2006/12/22/M609726200.DC1.html

  http://www.jbc.org/content/282/8/5608.full.html#ref-list-1

This article cites 41 references, 16 of which can be accessed free at

by guest on May 28, 2016

http://ww

w.jbc.org/

Dow

nloaded from