mrna destabilization triggered by premature translational termination depends on at least three...

10.1101/gad.7.9.1737Access the most recent version at doi: 1993 7: 1737-1754Genes Dev.

S W Peltz, A H Brown and A Jacobson elements and one trans-acting factor.termination depends on at least three cis-acting sequence mRNA destabilization triggered by premature translational

References

http://genesdev.cshlp.org/content/7/9/1737#related-urlsArticle cited in:

http://genesdev.cshlp.org/content/7/9/1737.refs.htmlThis article cites 50 articles, 25 of which can be accessed free at:

serviceEmail alerting

click herethe top right corner of the article orReceive free email alerts when new articles cite this article - sign up in the box at

http://genesdev.cshlp.org/subscriptions go to: Genes & DevelopmentTo subscribe to

Copyright © Cold Spring Harbor Laboratory Press

Cold Spring Harbor Laboratory Press on July 15, 2011 - Published by genesdev.cshlp.orgDownloaded from

http://genesdev.cshlp.org/lookup/doi/10.1101/gad.7.9.1737

http://genesdev.cshlp.org/content/7/9/1737.refs.html

http://genesdev.cshlp.org/content/7/9/1737#related-urls

http://genesdev.cshlp.org/cgi/alerts/ctalert?alertType=citedby&addAlert=cited_by&saveAlert=no&cited_by_criteria_resid=genesdev;7/9/1737&return_type=article&return_url=http://genesdev.cshlp.org/content/7/9/1737.full.pdf

http://genesdev.cshlp.org/subscriptions

http://genesdev.cshlp.org/

http://www.cshlpress.com

mRNA destabilization triggered by premature translational termination depends on at least three cis-acting sequence elements and one trans-acting factor

Stuart W. Pehz , 1 Agneta H. Brown, and Al lan Jacobson 2

Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, Massachusetts 01655 USA

Nonsense mutations in a gene can accelerate the decay rate of the mRNA transcribed from that gene, a phenomenon we describe as nonsense-mediated mRNA decay. Using amber (UAG) mutants of the yeast PGK1 gene as a model system, we find that nonsense-mediated mRNA decay is position dependent, that is, nonsense mutations within the initial two-thirds of the PGKl-coding region accelerate the decay rate of the PGK1 transcript ~<12-fold, whereas nonsense mutations within the carboxy-terminal third of the coding region have no effect on mRNA decay. Moreover, we find that this position effect reflects (1) a requirement for sequences 3' to the nonsense mutation that may be necessary for translational reinitiation or pausing, and (2) the presence of an additional sequence that, when translated, inactivates the nonsense-mediated mRNA decay pathway. This stabilizing element is positioned within the coding region such that it constitutes the boundary between nonsense mutations that do or do not affect mRNA decay. Rapid decay of PGK1 nonsense-containing transcripts is also dependent on the status of the UPF1 gene. Regardless of the position of an amber codon in the PGK1 gene, deletion of the UPF1 gene restores wild-type decay rates to nonsense-containing PGK1 transcripts.

[Key Words: Nonsense mutations; mRNA decay; translational termination; protein-coding region; UPF1 gene]

Received April 21, 1993; revised version accepted June 22, 1993.

To a first approximation, changes in the expression of specific genes are manifested by changes in the steady- state levels of individual mRNAs. Although such changes are assumed generally to result primarily from differential transcription or RNA processing activities, differences in the decay rates of individual mRNAs can also have profound effects on the overall levels of expression of specific genes. Although the potential impor- tance of mRNA stability as a mechanism for regulating gene expression has been recognized (for reviews, see Ross 1988; Cleveland and Yen 1989; Atwater et al. 1990; Hentze 1991; Peltz et al. 1991; Peltz and Jacobson 1993), the structures and mechanisms involved in the determi- nation of individual mRNA decay rates have yet to be elucidated.

To address the problem of mRNA stability in an or- ganism amenable to both biochemical and genetic ma-

tPresent address: Department of Molecular Genetics and Microbiology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854-5635 USA. 2Corresponding author.

nipulation, we have focused on the yeast Saccharomyces cerevisiae, developed simple and reliable procedures for measuring mRNA decay rates, and begun to characterize the cis-acting sequences and trans-acting factors that regulate the rapid decay of inherently unstable mRNAs (Herrick et al. 1990; Jacobson et al. 1990; Parker and Jacobson 1990; Heaton et al. 1992; Herrick and Jacobson 1992). As in similar studies in higher eukaryotes (for review, see Peltz et al. 1991), we find that unstable yeast mRNAs contain cis-acting sequences that dictate their instability and are capable of promoting rapid decay when transferred to appropriate locations within stable mRNAs (for review, see Pehz and Jacobson 1993). For five different genes (i.e., MATal, HIS3, STE3, STE2, and CDC4) we find that such "instabilty elements" can be found within the coding regions of the respective mRNAs, an observation suggesting that the processes of mRNA translation and mRNA turnover may be intimately linked. This conclusion is supported further by experiments in yeast demonstrating that (1) the coding region instability element from the MATal mRNA will destabilize chimeric transcripts unless it is preceded by a

GENES & DEVELOPMENT 7:1737-1754 �9 1993 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/93 $5.00 1737




Peltz et al.

nonsense codon that blocks translation through the element (Parker and Jacobson 1990); (2) drugs and mutations that inhibit translational elongation also inhibit mRNA decay (Herrick et al. 1990; Peltz et al. 1992); and (3) nonsense mutations in the URA3, URA1, HIS4, and LEU2 genes accelerate the decay rates of the mRNAs transcribed from these genes (Losson and Lacroute 1979; Pelsy and Lacroute 1984; Leeds et al. 1991). The latter phenomenon, nonsense-mediated mRNA decay, is the focus of this study.

Previous studies of nonsense-mediated mRNA decay in yeast showed that (1) mRNA destabilization is linked to premature translational termination, because nonsense-containing URA3 mRNA is stabilized in a strain containing an amber suppressor tRNA (Losson and La- croute 1979); (2) the extent of destabilization is position dependent, because 5' proximal nonsense mutations destabilize transcripts to a greater degree than those that are 3' proximal (Losson and Lacroute 1979; Pelsy and Lacroute 1984; Leeds et al. 1991; Peltz and Jacobson 1993); and (3) the products of the UPF1 and UPF3 genes are involved in this degradative pathway, as mutations in these genes stabilize mRNAs with nonsense mutations without affecting the half-lives of most wild-type transcripts (Leeds et al. 1991,1992; Peltz and Jacobson 1993).

In this paper we have analyzed amber mutants of the yeast PGK1 gene to delineate further the cis-acting elements and trans-acting factors essential for nonsense- mediated mRNA decay. Our analysis focused on the following four aspects of the nonsense-mediated mRNA decay pathway (1) the relationship between the physical position of a nonsense mutation and its effect on mRNA turnover; (2) the identification of sequences, in addition to the nonsense codon, that are required for rapid mRNA decay; (3) an understanding of the basis for the position effect, that is, the resistance of 3' proximal nonsense mutations to nonsense-mediated decay; and (4) the effect of mutations in the trans-acting factor, Upflp, on the half-lives of PGK1 mRNAs with nonsense mutations located at various positions within the coding region.

Results

Destabilization of the PGK1 transcript is dependent on the position of a nonsense codon within the PGK1 protein-coding region

The PGK1 gene was chosen for analysis because it encodes an abundant, stable mRNA with a half-life of 60 min and, therefore, small changes in its decay rate are readily detected (Herrick et al. 1990; Parker and Jacobson 1990; Heaton et al. 1992). The transcript of the PGK1 gene is -1400 nucleotides in length with a protein-coding region of 1251 nucleotides (Hitzeman et al. 1982). For the purposes of this study, the location of a nonsense mutation in the PGK1 gene is expressed in terms of the percentage of the coding region that will be translated before the ribosome's rendezvous with the respective nonsense codon. To monitor the effects of nonsense mu-

tations on the decay rate of the PGK1 transcript, a DNA tag was inserted into the 3'-untranslated region (UTR) (3'-UTR) of the PGK1 gene. Therefore, the mRNA decay rates of wild-type and mutant PGK1 alleles could be monitored by RNA blot analysis, hybridizing with a radioactive probe specific for only the tag sequence (see Materials and methods). Insertion of the DNA tag into the PGK1 gene or into a pGAL--lacZ fusion neither altered the decay rate of the PGK1 transcript nor the f~-galac- tosidase activity of the gene fusion when compared with the same genes lacking the tagged sequence (Jacobson et al. 1990; S.W. Peltz, A.H. Brown, and A. Jacobson, unpubl.).

To investigate the relationship between the location of a nonsense mutation in the PGK1 protein-coding region and its effect on mRNA half-life, a linker harboring an amber codon was inserted (in separate constructs) into six restriction sites of the PGK1 gene (Fig. 1B). The mutant alleles were transferred to yeast centromere plasmids and transformed into yeast cells harboring the rpbl-1 temperature-sensitive allele of RNA polymerase II (Nonet et al. 1987). The abundance and decay rates of the wild-type and mutant PGK1 mRNAs were determined by RNA blotting analyses of RNA isolated at different times after inhibiting transcription by shifting the culture to the nonpermissive temperature (36~ The results of these experiments indicate that 5' proximal nonsense mutations accelerate the PGK1 mRNA decay rate more than 3' proximal mutations, although the relationship is nonlinear (Fig. 1). Nonsense mutations that terminate translation after 455% of the PGKl-coding sequence accelerate the PGK1 mRNA decay rate -12- fold. A nonsense mutation that allows translation of 67% of the protein-coding region still decreases the PGK1 mRNA half-life fourfold, whereas nonsense mutations inserted in the last quarter of the PGK1 transcript had no effect (Fig. 1). As internal controls, we measured the decay rate of an unrelated, stable mRNA encoded by the CYH2 gene and also measured the relative steady- state levels of mutant and wild-type PGK1 mRNAs. The decay rate of the CYH2 mRNA was essentially identical in all cells (tl/2 -- 40-44 min), regardless of the nature of their respective PGK1 alleles (Fig. 1B). Steady-state levels of the wild-type and nonsense-containing PGK1 alleles were compared by RNA blot analysis of equal amounts of RNA from the time zero points from each of the decay measurements, normalizing to the abundance of the CYH2 mRNA in each sample. The results of these experiments demonstrate that the mRNA abundance of each PGK1 nonsense allele is related directly to the decay rates of the respective nonsense-containing mRNAs (Fig. 1B).

The product of the yeast UPF1 gene is required for the rapid turnover of mRNAs containing a premature translational termination codon (Leeds et al. 1991; for review, see Peltz and Jacobson 1993). Either the upfl-2 mutation or the deletion of the UPF1 gene from the yeast genome (upflA), will selectively stabilize mRNAs containing early nonsense mutations, whereas the decay rates of most other mRNAs are unaffected (Leeds et al. 1991;

1738 GENES & DEVELOPMENT




Nonsense-mediated decay of the yeast PGK1 mRNA

Figure 1. RNA blot analysis of the decay of PGK1 nonsense-containing mRNAs. A DNA linker containing amber mutations in all three reading frames was inserted into six restriction sites of a modified PGK1 gene containing an oligonucleotide tag sequence in its 3'-UTR. These linker insertions promote translational termination after PGK1 codons 23, 164, 229, 282, 317, and 385, respectively. For simplicity, the location of each nonsense mutation in the PGK1 transcript is presented as the percentage of the PGK1 protein-coding region that is translated before the amber mutation is encountered, mRNA turnover rates for wild-type and nonsense-containing PGK1 alleles were determined by RNA blot analysis of RNAs isolated at different times after transcription was inhibited by a shift to 36~ (A) Decay of the PGK1 mRNAs was measured in strains RY262 {UPFI+), SWP154(+) (UPFI+), and SWP154(-) (upf l - ) (see Materials and methods). The numbers at left correspond

to the various PGK1 alleles represented in B: (1) the wild-type PGK1 gene; (2) the PCK1 gene with a nonsense mutation at 92.6% of the coding region (inserted at the BgIII site; 385 PGK1 codons translated); {3) the PGKI gene with a nonsense mutation at 76.2% of the coding region (inserted at the XbaI site; 317 PGK1 codons translated); (4) the PGK1 gene with a nonsense mutation at 67.7% of the coding region [inserted at the H2(1) site; 282 PGK1 codons translated[; [5) the PGK1 gene with a nonsense mutation at 55% of the coding region [inserted at the H2{2) site; 229 PGK1 codons translated]; (6) the PGK1 gene with a nonsense mutation at 39% of the coding region (inserted at the Asp718 site; 164 PGK1 codons translated); (7) the PGK1 gene with a nonsense mutation at 5.6% of the coding region [inserted at the H2{3) site; 23 PGK1 codons translated]. The decay assay, RNA blotting, hybridization, and quantitation of the blots were performed as described previously (Herrick et al. 1990; Parker et al. 1991). (B) mRNA abundance and decay rates for the wild-type and mutant PGK1 alleles in SWP154( + ) (wild-type for the UPF1 gene) or SWP154( - ) (UPFI(-) (a deletion of the UPF1 gene), mRNA abundance was measured by RNA blot analysis of equal amounts of RNA from the time zero points from each of the mRNA decay measurements, normalizing to the abundance of the CYH2 transcript. The decay rate of the CYH2 transcript was determined in the UPF1 § strain. In the schematics, the PGK1 protein-coding sequence is represented by a thick solid bar, noncoding sequences (5' and 3' UTRs) are represented by a thin solid bar, and the oligonucleotide tag is represented by the stippled boxes. {H2) HincII; (Asp) Asp718; (X) XbaI.

Peltz and Jacobson 1993). The effects of the UPF1 gene on the m R N A decay rates of the six PGK1 nonsense alleles were de te rmined in a s t ra in harbor ing both the t empe ra tu r e - s ens i t i ve RNA polymerase II allele and the

upf lA m u t a t i o n (Fig. 1). In a upf lh strain, all m R N A s were stable and the ex ten t of m R N A s tabi l iza t ion was pos i t ion independent . Transcr ip ts f rom the PGK1 alleles con ta in ing early nonsense m u t a t i o n s were stabil ized

GENES & DEVELOPMENT 1739




Peltz et al.

-12-fold, wi th half-lives on the order of 60 rain (see Fig. 1A, B; UPFI(- ) ) . The decay rate of the transcript from the PGK1 gene harboring a nonsense muta t ion located at 67% of the coding region was also - 6 0 min, as were the half-lives of the PGK1 m R N A s whose decay rates were originally unaffected by the insert ion of 3 '-proximal nonsense codons. The stabil ization of the PGK1 mRNAs harboring nonsense muta t ions in a upflA strain indicates that loss of UPF1 funct ion restores wild-type decay rates. These results also rule out the possibili ty that insertion of the l inker containing the amber codon created an instabi l i ty element, as the half-lives of wild-type mRNAs that are inherent ly unstable are not altered in a upflA strain (Leeds et al. 1991; Peltz and Jacobson 1993). Thus, we conclude that destabil ization of the mRNAs encoded by PGK1 nonsense alleles was a consequence of the nonsense-mediated m R N A decay pathway. In all subsequent experiments, we exploit these observations to identify cis-acting elements that specifically promote nonsense-mediated m R N A decay, that is, we define such elements as sequences that accelerate m R N A decay in wild-type cells but that are inactivated in strains deleted for the UPF1 gene.

Why should the mRNA-destabilizing effects of nonsense mutations be limited to those that occur "early" in the coding region?

The mechan i sms by which nonsense mutat ions promote rapid m R N A decay are not known. Four models that a t tempt to explain this phenomenon and take into ac- count the observed position effects and a role for translation are considered in Figure 2. Model 1 suggests that an early nonsense codon promotes premature translational terminat ion which, in turn, creates a ribosome- free zone on the m R N A that is a target for cellular nucleases. In this case, the posit ion effect would be attrib- utable to a nuclease requirement for a m i n i m u m size of ribosome-free target. Model 2 suggests that the ribosome (or one of its subunits) plays an active role in the decay process. It is proposed that a small fraction of the termi- nating ribosomes (or a newly bound ribosome) scan the m R N A downstream of the nonsense codon seeking a s imple sequence (drawn arbitrarily as AGUC). An encounter wi th the s imple sequence would then trigger rapid decay, possibly as a consequence of translational reini t iat ion or any other form of ribosome pause. The position effect would be explained as stochastic, that is, the l ikelihood of encountering the s imple sequence would d imin i sh as the nonsense codons approach the 3' te rminus of the mRNA. Model 3 suggests that rapid m R N A decay is dependent on the concurrence of two events: a r ibosome encounter wi th a nonsense codon and the presence of a specific factor on that ribosome. The position effect is explained by proposing that the ribosome-associated factor is inactivated as a function of translat ional distance. Specific inactivation of the factor would be dependent on translocation through a specific sequence and would consti tute a mode of regulation for

Figure 2. Models for the mechanism of nonsense-mediated mRNA decay. Possible mechanisms by which a nonsense mutation may promote rapid mRNA turnover are depicted. Details are provided in the text. (Top) A schematic of a wild-type transcript with its complement of ribosomes. (Model 1 ) A nonsense- containing mRNA with a ribosome-free zone that is a substrate for cytoplasmic nucleases (lightning bolts); (Model 2) a nonsense-containing mRNA in which a downstream ribosome (or subunit) seeks a specific simple sequence required to trigger decay; (Model 3) two nonsense-containing mRNAs, one with an early nonsense mutation and one with a late nonsense mutation, are depicted. A factor (shown as a ball) required for nonsense-mediated decay falls off {or is ejected from) ribosomes before they reach the late nonsense codon; (Model 4) a combi- nation of models 2 and 3; rapid mRNA decay is depicted as requiring both a downstream sequence and a bound factor (in addition to a nonsense codon).

the nonsense-mediated m R N A decay pathway. Model 4 combines the tenets of models 2 and 3, suggesting that a ribosome downstream of the nonsense codon requires both a specific downstream sequence and a bound factor to promote rapid m R N A decay. These models make specific predictions about cis-acting sequences and trans- acting factors that are tested in the experiments that follow.






N o n s e n s e - m e d i a t e d decay of the PGK1 m R N A requires both a n o n s e n s e codon and sequences d o w n s t r e a m of the nonsense codon

To test whether sequences 3' of a nonsense muta t ion are required to promote rapid m R N A decay, we deleted various amounts of the PGK1 protein-coding sequence downstream of a nonsense muta t ion located at the PGK1 H2(3) site (i.e., at 5% of the PGK1 protein-coding region). It is important to note that in all of these PGK1 alleles ribosomes translate an equivalent amount of the PGK1 protein-coding region and that only the quant i ty of sequence downst ream of the amber muta t ion was varied. These PGK1 alleles were transformed into a strain harboring the temperature-sensi t ive RNA polymerase II muta t ion and m R N A half-lives, and abundances were determined as before. The results are summarized in Fig- ure 3A.

Deletions of the PGK1 protein-coding region that removed sequences between 5.6% and 67.7% (Fig. 3A; construct 3), 5.6% and 55% (construct 4), and 5.6% and 39% of the PGK1 protein-coding sequence (construct 5) did not inactivate the nonsense-mediated m R N A decay pathway. The m R N A s encoded by these constructs all had half-lives of 5 min. However, m R N A decay rates for two PGK1 nonsense alleles that deleted either between 5.6% and 92% or 5.6% and 76.2% of the PGK1 protein- coding region downstream of the amber muta t ion were stabilized - 10-fold (constructs 1,2, respectively). Simi- lar results were observed when sequences downstream of the nonsense muta t ion located at 55% of the PGK1 protein-coding region [in the H2(2) site] were deleted (con-

struct 7). With this nonsense mutat ion, removal of downstream sequences between 55% and 76% of the PGK1 protein-coding region prevented nonsense-mediated m R N A decay (Fig. 3B). Differences in m R N A decay rates were confirmed by measurement of m R N A steady- state levels. These measurements showed that the abundance of the m R N A s encoded by the different PGK1 nonsense alleles correlated directly wi th their half-lives (data not shown). Moreover, the rapid decay of each of the PGK1 nonsense-containing mRNAs was a consequence of the nonsense-mediated m R N A decay pathway, as these transcripts were stabilized in a u p f l - strain (summarized in the legend to Fig. 3A, B).

The transcripts from the PGK1 alleles containing large deletions in the coding region had half-lives of 30 min, rather than the 60-min half-life observed for either a wild-type PGK1 m RNA (cf. Figs. 3 and 1) or nonsense- containing PGK1 mRNAs in a upf l - strain (Fig. 3). This result may reflect partial activity of the nonsense-mediated m R N A decay pa thway or the possibility that a deleted version of a PGK1 gene may be less stable for reasons that are not presently understood. Consistent wi th the latter hypothesis, it has been reported that a PGK1 transcript wi th a large in-frame deletion of its coding region has a 27-min half-life (Heaton et al. 1992).

Results from the deletion analyses indicated that sequences downstream of the amber codon are necessary for nonsense-mediated m R N A decay. These sequences may encode a specific element or, alternatively, a mini- m u m amount of nonspecific sequence that is required downstream of a nonsense muta t ion to promote decay. We noticed that m R N A from a PGK1 nonsense allele

A H2 Asp H2 142 X BDIII (3) (2) (I)

( 1 ) ~

(2) ' ~ [ ~

(3) - - E 3

(4) ' ~ [ ~

(5)

B

(6)

t 1;2(mln.)

UPF(.) UPF(-)

3 63

30 48

3 0 5 7

5 50

5 63

5 60

5 63

60 ND

Figure 3. Decay rates for PGK1 mRNAs containing deletions downstream of a nonsense codon. (A) PGK1 nonsense alleles containing a 5' proximal nonsense mutation [located in the H2(3) site] and deletions of various amounts of the coding sequence downstream of the nonsense mutation are depicted, and their mRNA decay rates in UPF1 + and upfl - strains are summarized. The PGKl-coding sequence is represented by the solid bar and the sequence that was deleted is represented by the absence of the solid bar. mRNA decay rates of these PGK1 alleles were determined in either RY262 [UPF(+)] or SWP154 [UPF(-)] strains as described in Materials and methods. The deletions comprise the sequences between {construct 1} 5.6% and 92%, (construct 2) 5.6% and 76.2%, (construct 3) 5.6% and 67.7%, (construct 4) 5.6% and 55%, and (construct 5) 5.6% and 39% of the PGK1 protein-coding region. (B) (Construct 6) PGK1 allele containing a nonsense mutation inserted at 55% of the protein coding se-

quence [the H2{2) site]; {construct 7) The same PGK1 allele as in construct 6 in which sequences between 55% and 76.2% of the coding sequence downstream of the nonsense mutation were deleted, mRNA half-lives were determined as described in Materials and methods.





Peltz et al.

that deleted between 5% and 67% of the PGK1 protein- coding region was degraded sixfold more rapidly than a transcript from the PGK1 nonsense allele containing a slightly larger deletion {106 nucleotidesl, in which between 5% and 76% of the PGK1 protein-coding region was removed (Fig. 3A; cf. construct 2 wi th 3). To test whether this 106-nucleotide region contains a specific sequence that can induce the nonsense-mediated m R N A decay pathway, this D N A fragment was inserted downstream of a 5 '-proximal nonsense muta t ion in a PGK1 gene with a deletion spanning 5-92% of the PGK1 protein-coding region. Inserting the 106-nucleotide fragment downstream of a nonsense muta t ion in a PGK1 allele lacking most of its coding sequence changed the half-life of this transcript from 30 to 3-5 min (Fig. 4A; cf.

construct 1 wi th construct 31. Degradation of this m R N A was a result of the nonsense-mediated m R N A decay pathway, as this transcript was stabilized in a u p f l - strain (Fig. 4A). Decay of the m R N A encoded by the PGK1 nonsense allele wi th the 106-nucleotide fragment inserted in the opposite orientation was only min- imally affected (Fig. 4A; construct 21. These results demonstrate that there are specific sequences downst ream of an amber muta t ion that are required to promote nonsense-mediated m R N A decay.

To determine whether this was a unique sequence in the PGK1 gene or whether there were redundant elements, small deletions were made downstream of a nonsense codon located in the H2(31 site of the PGK1 gene. These deletions removed the regions spanning either be-

Figure 4. Specific sequences are required downstream of the amber codon. (A) The 106-nucleotide downstream element was inserted in both orientations downstream of a 5' proximal nonsense mutation in a PGK1 allele with a large deletion of its coding region (PGK1 allele shown in construct 1 ). mRNA decay rates of these PGK1 alleles were determined in either RY262 {UPF1 +l or SWP154 lupfl-) strains as described in Ma- terials and methods. The RNA blots for these experiments are shown above the schematic representations of the PGK1 alleles. The numbers next to each blot correspond to the PGK1 alleles shown schematically below. In PGK1 allele 2 the downstream element is in the opposite orientation as found in the PGK1 gene, whereas PGK1 allele 3 has the element in the correct orientation. (B) Small deletions in the PGK1 allele harboring a nonsense mutation at 5.6% of the protein-coding region were prepared and are represented schematically in this panel. The segments of PGK1 that were deleted comprised (2) between 55% and 76.6% of the protein-coding region and 13) between 55% and 67.7% of the protein-coding region, mRNA decay rates were determined in UPF1 + strains, and the RNA blots and a summary of the data are shown.





tween 55% and 67% or 55% and 76% of the PGK1 protein-coding region (Fig. 4B). The decay rates of transcripts from these PGK1 nonsense alleles were determined as before, and the results are summarized in Figure 4B. The decay rates of the mRNAs from the PGK1 nonsense alleles with the small internal deletions were equivalent to the decay rate of the PGK1 nonsense allele lacking the deletions (tl/2 = 3-5 min; Fig. 4B). We conclude from these experiments that there are other downstream sequence elements in the PGK1 gene that can function in an manner analogous to that of the downstream element located between 55% and 67% of the PGK1 protein-coding region.

Characterization of a downstream element required for nonsense-mediated m R N A decay

The mini-PGK1 gene that contained the 106-nucleotide element downstream of a 5'-proximal nonsense mutation (Fig. 4A; construct 31 is an ideal substrate to analyze further the role of the downstream element in the nonsense-mediated mRNA decay pathway. It has a small coding region, lacks the redundant downstream elements, and the rapid tumover of its transcript is depen-


dent on the 106-nucleotide element. The 5' and 3' boundaries of the functional element within the 106- nucleotide sequence were identified by the experiments shown in Figure 5. The 5' proximal deletions that remove between 19 and 79 bp and the 3' deletions that remove between 25 and 90 bp were prepared and inserted downstream of the nonsense codon in the mini-PGK1 allele, and the decay rates of the mRNAs synthesized from these genes were determined as before. Deleting i>34 bp from the 5' end of the downstream element stabilized the transcript, from a half-life of ~<5 min to -30 min (Fig. 5). A 19-bp deletion from the 5' end of the downstream element resulted in an intermediate mRNA decay rate (tl/2 = 15 min; Fig. 5). These results indicated that the 5'-proximal 34 nucleotides of this downstream element were necessary to promote nonsense-mediated decay of the mRNA from the mini-PGK1 allele. Remov- ing 25 bp from the 3' end of the downstream element had no effect on the decay rate of the mini-PGK1 transcript, whereas deleting either 50 or 75 bp resulted in intermediate decay rates (t,/2 = 15 min; Fig. 5); larger 3' deletions stabilized the transcripts such that they had the same decay rates as the PGK1 mRNA lacking the downstream element {Fig. 5). Rapid decay of the transcripts

H2 Asp H2 H2 X Bglll (3) (2) (1)

( I ) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT

(2) CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTAI"rCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT

(3) CCAACACCAAGACTGTCACTG ACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACA ATG GTCCAGAAT

(4) GTCACTG ACAAGG AAGGTATTCCAGCTGGCTGGCAAGGGTrGGACA ATG GTCCAGAAT

(5) TCCAGCTGGCTGGCAAGGGTTGGACA ATG GTCCAGAAT

(6) TGGACA ATG GTCCAGAAT

GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATQ GTCCAGAAT

t~2(min) UPFI

(+) (-)

3 60

15 60

24 80

27 60

25 60

27 60

(7) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTA'FTCCAGCTGGCTGG 3 60

(8) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGA 15 60

(9) GACTTCATCATTGCTG ATG CTTTCTCTGCTG 15 60

(10) GACTTCATCATTGCTG ATG C 26 60

(11) GACTTCATCATTGCTG A 27 60

(12) GACTTCATCATTGCTG CTTTCTCTGCTG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT 60 -

Figure 5. Deletion analysis of the downstream element. The sequences of the downstream element and of 11 deletion mutants are shown. Downstream elements containing the various deletions were inserted into the mini-PGK1 allele containing a nonsense codon at the H2[3) site Idepicted schematically at the top). Half-lives for the respective PGK1 mRNAs were determined in UPF1 + and upfl- strains as described.





Peltz et al.

from both deletion series was a result of the nonsense- mediated m R N A decay pathway, as these mRNAs were stabilized in a upf l - strain (Fig. 5). Collectively, the deletion analysis of the 106-nucleotide downstream element in the mini-PGK1 gene revealed that the m i n i m u m sequence that is both necessary and sufficient to promote nonsense-mediated m R N A decay consists of the 5' 80 nucleotides. Because two ATG codons lie wi th in this sequence (Fig. 5) we considered the possibility that the role of the downstream e lement in the nonsense-mediated m R N A decay pathway may be to promote translational reinitiation. To assess this possibility, these two ATG codons were deleted from the same mini-PGK1 gene used for the 5' and 3' deletion studies. The half-life of the transcript from this PGK1 allele was determined as before, and the results indicate that deleting the two 5' proximal ATG triplets in the downstream element stabilizes the nonsense-containing PGK1 allele - 12-fold (Fig. 5; construct 12). Taken together wi th the larger deletions analyzed in Figure 5, these results indicate that the first two ATGs (ATG-1 and ATG-2) are important components of the downstream element.

The pos i t ion-dependen t effects of nonsense m u t a t i o n s on m R N A turnover are a consequence of modu la t ions in the ac t i v i t y of the nonsense- m e d i a t e d m R N A decay p a t h w a y

When between 67% and 76.6% of the PGK1 protein- coding sequence has been translated, the PGK1 transcript becomes insensi t ive to the nonsense-mediated de-

cay pathway (see Fig. 1). Because specific sequences are required downstream of a nonsense muta t ion to promote turnover, a l ikely explanation for the observation that 3' proximal amber mutat ions do not promote nonsense- mediated m R N A decay is that they lack the necessary downstream element. This hypothesis predicts that the insertion of a functional downstream sequence e lement distal to a 3' proximal nonsense muta t ion should promote rapid decay of its transcript. To test this hypothesis, sequences 3' of the nonsense muta t ion inserted at 92% of the PGK1 protein-coding region were replaced wi th protein-coding regions and a 3 'UTR sequence from a PGK1 gene harboring downstream elements capable of promoting nonsense-mediated m R N A decay (see Fig. 6B for a schematic of the constructions). The two segments from the PGK1 gene inserted downstream of the nonsense mutat ion included sequences (1) from 5.6% of the protein-coding region to the end of the PGK1 gene (Fig. 6B; construct 2) and (2) from 39% of the PGK1 protein- coding region to the end of the PGK1 gene (construct 3). The m R N A decay rates of these PGK1 alleles were unaffected by these insertions (Fig. 6A, B, cf. construct 1 wi th constructs 2 and 3; tl/2 = 60-62 min). These results indicate that 3' proximal nonsense muta t ions are resistant to the nonsense-mediated m R N A decay pathway for reasons other than a lack of a specific downstream element . Consistent wi th this notion, insert ing the same sequences downstream of a nonsense muta t ion located at 67% of the PGK1 protein-coding region, which par- t ially accelerates PGK1 m R N A turnover (see Fig. 1), failed to enhance the m R N A decay of these PGK1 alleles

Figure 6. Downstream elements inserted distal to 3' proximal nonsense mutations in the PGK1 gene do not accelerate mRNA decay. Sequences downstream of 3' proximal nonsense mutations in the PGK1 gene were replaced with PGK1 protein-coding sequences harboring downstream elements. Schematic representations of the PGK1 alleles and a summary of the data are shown in B. The decay rates of these transcripts were determined in a UPF1 + strain, and the RNA blots are shown in A. The numbers next to the RNA blots shown in A correspond to the PGK1 alleles shown in B. The solid bar represents the PGK1 gene, the hatched box represents the nonsense mutation, and the open rectangle represents the sequences that were inserted downstream of the nonsense mutation. The PGK1 alleles represented in 2 and 3 replaced sequences downstream of the nonsense mutation inserted at 92.6% of the coding region, whereas 4 and 5 replaced sequences downstream of a nonsense mutation inserted at 55% of the coding region. The sequences added were as follows: (Construct 1) None, control PGK1 allele with a nonsense mutation inserted at the BglII site (92% of the PGK1 protein-coding region); (construct 2) from 5.6% of the PGK1 protein-coding region to the end of the gene; (construct 3) from 39% of the PGK1 protein-coding region to the end of the gene; (construct 4) from 5.6% of the PGK1 protein-coding region to the end of the gene; (construct 5) from 39% of the PGK1 protein-coding region to the end of the gene.






(Fig. 6A, B, constructs 4 and 5; t,/2 = 15-17 min). This result indicates that a nonsense codon at 67% of the PGK1 protein-coding region is partially resistant to the nonsense-mediated m R N A decay pathway.

On the basis of these results we considered two hypotheses to explain the observation that 3' proximal nonsense muta t ions are resistant to nonsense-mediated m R N A decay: (1) Translat ion of a specific region in the PGK1 transcript inactivates the nonsense-mediated m R N A decay pathway (specific e lement hypothesis), or (2) factors involved in the nonsense-mediated m R N A decay pathway become inactivated stochastically after ribosomes translocate a certain distance of the PGK1 transcript (stochastic inactivation hypothesis). We reasoned that we could differentiate between the two hypotheses by comparing the stabilities of PGK1 transcripts in which additional protein-coding sequences were inserted upstream of a nonsense muta t ion that promoted nonsense-mediated m R N A decay. The stochastic inactivation model predicts that increasing the distance a ribosome translocates before reading a nonsense codon

would stabilize a given mRNA, whereas the specific element hypothesis predicts that only specific sequences would stabilize this transcript. To differentiate between these alternatives, the PGK1 alleles shown in Figure 6 were constructed. Sequences from the PGK1 protein- coding region were inserted in-frame and upstream of the nonsense muta t ion located at 55% of the PGK1 protein- coding region [i.e., at the H2(2) site]. As a control, these sequences were inserted in-frame into the wild-type PGK1 gene (Fig. 7). The sequences inserted into the PGK1 alleles comprised either (1) the amino- terminal 21% of the PGK1 protein-coding region or (2) sequences between 55-76% of the PGK1 protein-coding region. We reasoned that the PGK1 amino- terminal region would be a nonspecific sequence, as nonsense muta t ions inserted wi th in and near this region promote nonsense-mediated m R N A decay. The PGK1 protein-coding region between 55% and 76% was inserted upstream of a nonsense mutation because this is the region in the PGK1 gene in which transcripts harboring nonsense muta t ions change from being sensitive to resistant to the nonsense-medi-

Figure 7. Sequences in the PGK1 gene inactivate the nonsense-mediated mRNA decay pathway. The outline of the experimental approach is shown in the top panel and the decay rates of the various PGK1 alleles are shown at the bottom panel. PGK1 protein-coding sequences were inserted in-frame into either the wild-type PGK1 gene or upstream of a nonsense mutation located at the 55% site of the PGK1 protein-coding region. The two segments of the PGK1 coding-region that were inserted into the Asp718 (or KpnI; see Fig. 1) site of the PGK1 alleles (as shown in the top panel) were the following: (1) the amino-terminal 21% of the PGK1 protein-coding sequence, and (21 the segment between 55% and 76.2% of the PGK1 protein-coding region. PGK1 alleles containing these insertions were transformed into the UPF1 + strain, and the decay rates of the respective transcripts were determined. The RNA blots from these decay measurements are shown. The numbers to the left of each blot correspond to the schematic representations of the various PGK1 alleles.





Peltz et al.

ated mRNA decay pathway (see Fig. 1). We anticipated that if there were a specific stabilizer element in the PGK1 gene, then this 55-76% region would contain either the complete element or a portion of that element.

These experiments showed that inserting the amino- terminal 21% of the PGK1 protein-coding region upstream of a nonsense mutation did not affect mRNA decay rates. The mRNA containing the inserted sequence had a 4-min half-life (Fig. 7; construct 2), that is, the same decay rate as the mRNA encoded by the PGK1 nonsense allele lacking the inserted sequence (see Fig. 1). Insertion of the same sequence into the wild-type PGK1 gene did not affect the decay of its transcript (tl/2 = 60 rain), demonstrating that this sequence alone cannot promote rapid mRNA turnover (Fig. 7; construct 1). However, inserting the region comprising 55-76% of the PGK1 protein-coding region upstream and in-frame of the same nonsense codon led to partial stabilization of the encoded mRNA from a half-life of 3-5 min to a half- life of 15 min (Fig. 6; construct 4). The partial activity of this sequence suggests that the element has not been isolated in its entirety. Inserting the 55-76% region into the wild-type PGK1 gene did not affect mRNA decay, demonstrating that this sequence by itself is not an instability element (Fig. 7, construct 3). These results rule out the stochastic inactivation model and indicate that there is a specific sequence in the PGK1 transcript that, when translated, inactivates the nonsense-mediated mRNA decay pathway.

Discussion

Nonsense mutations accelerate cytoplasmic mRNA decay in yeast

In both prokaryotes and eukaryotes nonsense mutations in a gene can reduce the abundance of the mRNA transcribed from that gene (Morse and Yanofsky 1969; Los- son and Lacroute 1979; Maquat et al. 1981; Pelsy and Lacroute 1984; Baumann et al. 1985; Nilsson et al. 1987; Daar and Maquat 1988; Urlaub et al. 1989; Cheng et al. 1990; Gozalbo and Hohmann 1990; Barker and Beamon 1991; Gaspar et al. 1991; Leeds et al. 1991; Baserga and Benz 1992; Lim et al. 1992; Cheng and Maquat 1993). Results of this study and others indicate that in S. cerevisiae this nonsense-mediated effect can be attributed to cytoplasmic events that are concurrent with mRNA translation. Evidence for the latter comes from experiments demonstrating that (1) nonsense mutations enhance cytoplasmic mRNA decay rates (Losson and Lac- route 1979; Pelsey and Lacroute 1984; Leeds et al. 1991; Fig. 1), (2) nonsense-containing mRNAs are polysome associated (Leeds et al. 1991; He et al. 1993), (3) nonsense-suppressing tRNAs and inhibitors of translational elongation stabilize nonsense-containing mRNAs (Los- son and Lacroute 1979; Gozalbo and Hohmann 1990; S.W. Peltz, A.H. Brown, and A. Jacobson, unpubl.), and (4) a significant fraction of the protein encoded by the UPF1 gene is cytoplasmic (Peltz et al. 1993; C. Trotta, A.H. Brown, C. Powers, R. Singer, S.W. Peltz, and A. Jacobson, unpubl.).

The position of a nonsense codon governs its effect on mRNA decay

Early work on the effects of nonsense mutations on the transcripts of the yeast URA3 and URA1 genes (Losson and Lacroute 1979; Pelsy and Lacroute 1984) showed that mRNA destabilization was promoted by amber and ochre mutations that mapped near mRNA 5' termini but not by similar mutations mapping near mRNA 3' termini. For the PGK1 gene, we, too, find that 5' proximal nonsense mutations accelerate mRNA decay rates more than 3' proximal mutations, but the relationship is nonlinear (Fig. 1). Nonsense mutations that terminate translation of the PGK1 transcript after ~<55% of the PGK1- coding sequence accelerate the PGK1 mRNA decay rate -12-fold. A nonsense mutation that allows translation of 67% of the protein-coding region decreases the PGK1 mRNA half-life fourfold, and nonsense mutations inserted in the last quarter of the PGK1 protein-coding region have no effect on mRNA decay (Fig. 1).

mRNA destabilization triggered by premature translational termination requires sequences downstream of the termination codon

The discontinuous relationship between the position of a nonsense codon and its effect on mRNA tumover (Fig. 1) suggested that sequences downstream of the nonsense codon may play a role in nonsense-mediated decay, either because they act as sites accessible to nuclease attack or because sequences in addition to a nonsense codon are required to trigger mRNA decay (Fig. 2). A series of deletions that remove different amounts of the PGK1 protein-coding region downstream of an early nonsense mutation demonstrated that sequences 3' of the nonsense codon are necessary to promote nonsense-mediated mRNA decay (Fig. 3). Experiments that inserted small regions of the deleted DNA back into a PGK1 nonsense allele, in which most of the protein-coding region was deleted, demonstrated that a 106-nucleotide sequence element, when positioned downstream of the nonsense codon, can promote rapid decay of its mRNA (Fig. 4). Although the 106-nucleotide element is specific, it is not unique. Deletion of the 106-nucleotide fragment from an otherwise intact PGK1 gene containing an early nonsense mutation did not stabilize the resultant transcript (Fig. 4), indicating that there are redundant 3' cis- acting elements in the PGK1 gene that can promote nonsense-mediated mRNA decay.

Nucleotides essential to the destabilizing function of the 106-nucleotide element were defined by deletion analysis. The 5'-proximal 34 nucleotides of this element were shown to be necessary for nonsense-mediated mRNA decay and - 8 0 nucleotides of 5'-proximal sequence were necessary for function as an independent element. Of three ATGs present in the 106-nucleotide segment, two that are bracketed by identical nucleotides are located within the sequences essential for destabilizing function (Fig. 5). Deleting these ATG codons from the downstream element in the mini-PGK1 nonsense al-






lele stabilizes its transcript (Fig. 5). These results suggest that the downstream element may be a site of translational reinitiation and that the contexts of ATG-1 and ATG-2 within this element may be more suitable for translational reinitiation than the context of ATG-3. Two additional observations support the possibility that the downstream element is a site of translational initiation: (1) Insertion of a stem-loop structure, which inhib- its both translation initiation and reinitiation, immedi- ately downstream of a nonsense codon stabilizes an otherwise unstable PGK1 transcript; and (2) 3-aminotri- azole, an inhibitor of amino acid biosynthesis that has been shown to reduce the capacity of cells to reinitiate translation at downstream start codons (as in the case of the GCN4 transcript; Hinnebusch and Liebman 1991) stabilizes mRNAs with nonsense mutations without affecting the decay of wild-type transcripts (S.W. Peltz, A.H. Brown, and A.Jacobson, unpubl.).

Nonsense-mediated mRNA decay requires the activity of the UPF1 gene product

Nonsense suppressors in yeast are either tRNA mutants, capable of decoding a translational termination codon, or mutants in non-tRNA genes, which enhance the expression of nonsense-containing alleles by other mechanisms. The latter mutants include the allosuppressors, frameshift suppressors, and omnipotent suppressors (Surguchov 1988; Hinnebusch and Liebman 1991). At least one of these suppressors, upfl, acts by suppressing nonsense-mediated mRNA decay. Loss of function of the trans-acting factor, Upflp, leads to the selective stabilization of mRNAs containing early nonsense mutations without affecting the decay rates of most other mRNAs (Leeds et al. 1991; Peltz and Jacobson 1993; Fig. 1).

The effect of the upflA mutation on the turnover of the various PGK1 nonsense alleles was position independent; all of the PGK1 nonsense alleles have mRNA half- lives on the order of i hr in a upflA strain (Fig. 1), a result that indicates that loss of UPF1 function restores wild- type decay rates to mRNAs that would otherwise have been susceptible to the enhancement of decay rates promoted by nonsense codons. These results also demonstrate that neither the linker used to insert nonsense mutations into the PGK1 gene, nor the PGK1 sequence itself, contained instability elements capable of acceler- ating PGK1 mRNA decay rates independent of the nonsense-mediated mRNA decay pathway.

The UPF1 gene has been cloned and sequenced and shown to be (1) nonessential for viability, (2) capable of encoding a 109-kD protein with both zinc finger, nucleotide (GTP)-binding site and RNA helicase motifs, (3) identical to NAM7, a nuclear gene that was isolated as a high-copy suppressor of mitochondrial RNA splicing mutations, and (4) partially homologous to the yeast SEN1 gene (Leeds et al. 1991,1992; Altamura et al. 1992; Koonin 1992). The latter encodes a noncatalytic subunit of the tRNA splicing endonuclease complex (Winey and Culbertson 1988), suggesting that Upflp may also be part of a nuclease complex targeted specifically to nonsense-

containing mRNAs. Preliminary results from experiments using either a genetic screen for interacting proteins, or cell fractionation and microscopy of cells car- rying an epitope-tagged UPF1 gene, indicate that Upflp may associate with several other proteins as well as with polysomes (Peltz et al. 1993; F. He, C. Trotta, S.W. Peltz, A.H. Brown, C. Powers, R. Singer, and A. Jacobson, unpubl.).

It is unlikely that the normal function of the UPF1 gene is anticipatory, that is, that Upflp is solely involved in the degradation of mRNAs with premature nonsense r The normal role of the UPF1 gene may be to regulate the decay rates of transcripts with upstream open reading frames (for review, see Peltz and Jacobson 1993) and control the abundance of unspliced pre- mRNAs that appear in the cytoplasm. Support for the latter conclusion comes from experiments showing that in a upfl - strain, a fraction of the intron-containing pre- mRNAs encoded by the CYH2, RP51 b, and MER2 genes are stabilized up to fivefold and are associated with polysomes (He et al. 1993).

Cis-acting stabilizer sequences regulate nonsense- mediated mRNA decay

The 5' cap notwithstanding (Piper et al. 1987), there is only limited evidence for the existence of cis-acting stabilizer sequences in yeast mRNAs. The experiments described in this paper indicate that there are sequences within the coding region of the PGK1 mRNA that can be considered formally to be stabilizer sequences as they inactivate the nonsense-mediated mRNA decay pathway. Including the nonsense codon, this pathway therefore requires at least three cis-acting elements in mRNA.

We observed that nonsense mutations in the PGK1 mRNA were only destabilizing if they occurred within the first two-thirds of the transcript. The resistance of 3'-proximal nonsense mutations to nonsense-mediated mRNA decay cannot be explained by the lack of an active downstream element or the need for a ribosome-free zone within the coding region of the PGK1 mRNA. Rather, our experiments indicate that there must be sequences in the PGK1 mRNA that, when translated, neu- tralize the destabilizing effects of any downstream nonsense mutations. At least part of these stabilizer sequences must be localized to the 55-76% segment of the PGK1 protein-coding region as premature translation through this segment led to partial stabilization of a nonsense-containing PGK1 mRNA (Fig. 7). Such a stabilizing element may promote resistance to the nonsense- mediated decay pathway by promoting the loss of a ribosome-associated factor required for nonsense-mediated mRNA decay (Fig. 2; models 3 and 4).

A similar, or possibly identical, stabilizing sequence appears to regulate the destabilizing effects of the STE3 3' UTR. Heaton et al. (1992)have found that the 3' UTR of the STE3 mRNA could not destabilize an intact PGK 1 reporter mRNA but could destabilize a PGK1 mRNA with a large deletion of its coding region. Because the large PGK1 deletion used by Heaton et al. (1992) covers





Peltz et al.

the 55-76% region characterized in this study, we consider it possible that the stabilizer element that regulates nonsense-mediated mRNA decay may be the same element that prevents the 3' UTR of the STE3 transcript from promoting rapid mRNA turnover. This hypothesis remains to be tested.

mRNA translation and mRNA turnover are intimately linked: possible functions of the necessary sequences and factors

Experiments reported previously have demonstrated that ongoing translation is important for promoting or regulating rapid mRNA turnover (Graves et al. 1987; Gay et al. 1989; Parker and Jacobson 1990; Wisdom and Lee 1991; Bemstein et al. 1992; Peltz et al. 1992; for review, see Peltz et al. 1991; Peltz and Jacobson 1993). Consis- tent with this linkage of translation and turnover, we find that (1) premature translational termination desta- bilizes mRNAs, (2) the extent of such destabilization is dependent on the relative position of a nonsense mutation within the coding region, (3)nonsense-containing mRNAs are associated with polysomes (Leeds et al. 1991; He et al. 1993), (4) cycloheximide treatment stabilizes PGK1 mRNAs containing nonsense mutations (S.W. Peltz, A.H. Brown, and A. Jacobson, unpubl.), and (5) sequences downstream of a nonsense codon are essential for mRNA destabilization.

As noted above, the downstream sequences may serve as a site of translational reinitiation. Although reinitiation may be the event that triggers decay, alternative models can be inferred from the available data. For ex- ample, an essential event in the destabilization process may be a mRNA-rRNA interaction analogous to that occurring in prokaryotic initiation (Noller 1991) and proposed for mammalian internal initiation (Sonnenberg 1991). An analysis of possible complementary sequences showed that a 9-nucleotide sequence surrounding the ATG-1 and ATG-2 codons is complementary to sequences in yeast 18S rRNA (for review, see Peltz and Jacobson 1993). The nucleotides bracketing the third ATG in the 106-nucleotide downstream element will not accommodate this base-pairing scheme and do not show significant complementarity with any region in the 18S rRNA. Interestingly, a 14-nucleotide sequence from the instability element of the inherently unstable MAT~I mRNA (Parker and Jacobson 1990) is also complementary to the same region of 18S rRNA (for review, see Peltz and Jacobson 1993). Clearly, these interactions are only hypothetical and must be weighed in light of models suggesting that this region of rRNA may be involved in intramolecular base-pairing (Dams et al. 1988). However, this premise merits attention because substan- tive evidence has emerged in recent years that rRNA has a functional role in translation (Dahlberg 1989; Noller 1991) and the processes of translation and turnover are intimately linked (see above).

A likely consequence of either event (i.e., translational reinitiation or mRNA-rRNA base-pairing) may be ribosome pausing. We consider it possible that a ribosome

paused at a specific site may expose a downstream nuclease recognition site that could then be cleaved by either a soluble or a ribosome-bound or ribosome-activated nuclease. A two-site model, in which the first site po- tentiates the cleavage mechanism and the second site is the actual position of the nucleolytic attack, is consistent with the deletion data of Figure 5. Moreover, the dependence on a ribosome-bound or ribosome-activated nuclease is consistent with the available data for both the coding region stabilizer element and the UPF1 gene product. We interpret the stabilizer experiments to indicate that a translation or destabilization factor falls off the ribosome as a consequence of traversing the sequence element and propose that such a factor may be the protein encoded by either the UPF1 gene or one of the factors with which it interacts. As such, this protein could be (1) a translational initiation factor that is also required for a reinitiation event that may trigger mRNA degradation, (2) a nuclease, activated by a downstream reinitiation event, or (3) a factor that promotes an interaction with a specific nuclease or nuclease complex.

M ater ia l s and m e t h o d s

Yeast strains, growth conditions, and transformation procedures

The yeast strains used for these studies were RY262 (MATa, his4-519, ura3-52, rpbl-1; Nonet et al. 1987) and SWP154; the latter was prepared by plating PLY154 (MATa upfl-AI::URA3 ura3-52 rpbl-I his4-38 leu2-1; Leeds et al. 1991) on media containing 5-fluoro-orotic acid (Bach et al. 1979; Guthrie and Fink 1991) and selecting for strains able to grow because of a mutation in the URA3 gene. PLY154 was generously supplied by P. Leeds and M. Culbertson (University of Wisconsin, Madison). Yeast media were prepared as described previously (Sherman et al. 1986). Synthetic media lacking uracil (for the RY262 strain I or lacking uracil and tryptophan (for the SWP154 strain) were used to select for and maintain plasmids containing the mutant PGK1 genes (Table 1 ). Yeast transformations were performed by the lithium acetate procedure (Ito et al. 1983) as modified by Schiestl and Gietz (1989).

Materials

Restriction enzymes were obtained from Boehringer Mannheim and New England Biolabs. Radioactive nucleotides were obtained from either ICN ([~/-32P]ATP) or Amersham ([a- 32P]dCTP). Oligonucleotides used in these studies (Table 2) were purchased from Operon, Inc., with the exception of the SMURFT linker (harboring amber codons in all three reading frames), which was purchased from Pharmacia.

mRNA decay measurements, RNA preparation, and RNA analysis

mRNA decay rates were determined in either strains RY262 (UPF1 +) or SWP154 (upfl-). Strain RY262 was transformed with centromere plasmids harboring the URA3 gene and the PGK1 alleles of interest. Strain SWP154 was transformed with either either YCpPL53 (Leeds et al. 1991), a yeast centromere plasmid containing both the UPF1 and TRP1 genes [SWP154( + )] or plasmid YCpMS38 (Leeds et al. 1991), a yeast centromere plasmid harboring only the TRP1 gene [SWP154(- )] (both plas-






Table 1. PGK1 alleles prepared for this study

Plasmid name Description

pRIP 1PGK( + Aid) pRIP 1PGK[- AU} pRIPPGKBglUAG

pRIPPGKXbaUAG

pRIPPGKH2( 1 )UAG

pRIPPGKH2(2)UAG

pRIPPGKAspUAG

pRIPPGKH2{3)AUG

pRIPPGKH2(3)A1

pRIPPGKH2(3)a2

pRIPPGKH2(3)A3

pRIPPGKH2(3)A4

pRIPPGKH2(3)A5

pRIPPGKH2(2)A1

pRIPPGKH2(2)A2

pRIPPGKH2{3)AIINI(+)

pRIPPGKH2(3)a 1IN 1( - )

pRIPPGKH2(3)A6

pRIPPGKH2(3)A7

pRIPPGKH2(3)A IIN2

pRIPPGKH2(3)A 1 IN3

pRIPPGKH2(3)A 1 IN4

pRIPPGKH2(3)A 1 IN5

pRIPPGKH2(3)A 1 IN6

pRIPPGKH2{3)A IIN7

pRIPPGKH2(3)A 1 IN8

pRIPPGKH2(3)A 1 IN9

pRIPPGKH2(3)AIIN10

pRIPPGKH2(3}AIIN11

pRIPPGKH2(3)IN 12

pRIPPGKH2(3)A 11N2AATG

PGK1 gene with a DNA tag inserted into the 3 'UT region in the designated (+) orientation. Same as pRIP1PGK[ +AU} except the DNA tag was in the opposite orientation. Linker containing amber codons inserted at 92.6% of the PGK1 protein-coding region (BglII

site, 1449 bp). Linker containing amber codons inserted at 76.2% of the PGK1 protein-coding region (XbaI

site, 1244 bp). Linker containing amber codons inserted at 67.7% of the PGK1 protein-coding region [HincII(1)

site, 1138 bp]. Linker containing amber codons inserted at 55% of the PGK1 protein-coding region [HincII(2)

site, 979 bp]. Linker containing amber codons inserted at 39% of the PGK1 protein-coding region (Asp718

site, 789 bp). Linker containing amber codons inserted at 5.6% of the PGK1 protein-coding region [HincII(3)

site, 361 bp]. PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted

between 5.6% and 92.6% of the coding region. PGK1 nonsense allele [linker containing amber codons inserted into the H2(3} site] that deleted

between 5.6% and 76.2% of the coding region. PGK1 nonsense allele [linker contalmng amber codons inserted into the H2(3) site] that deleted

between 5.6% and 67.7% of the coding region. PGKI nonsense allele [linker containing amber codons inserted into the H2(3) siteI that deleted

between 5.6% and 55% of the coding region. PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted

between 5.6% and 39% of the coding region. PGK1 nonsense allele [linker containing amber codons inserted into the H2(2) site] that deleted

between 55% and 76.2% of the coding region. PGK1 nonsense allele [linker containing amber codons inserted into the H2(2) site] that deleted

between 55% and 67.7% of the coding region. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that contains nucleotides 1139-1244 of

PGK1 protein-coding sequence 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that contains nucleotides 1139-1244 of

PGK1 protein-coding sequence in the inverted orientation 3' of the nonsense codon. PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted

between 55% and 76.2% of the coding region. PGKI nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted

between 55% and 67.2% of the coding region. PGK1 nonsense allele described in pRIPPGKH2(3)dil that contains the complete downstream

element inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element

with the 5' 19 bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)al that harbors the downstream element

with the 5' 34 bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element

with the 5' 49 bp deleted inserted 3' of the nonsense codon. PGKI nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element

with the 5' 79 bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downsteam element with

the 5' bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element

with the 3' 25 bp deleted inserted 3' of the nonsense codon. PGKI nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element


with the 3' 75 bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2(3)dil that harbors the downstream element


with the 3' 90 bp deleted inserted 3' of the nonsense codon. PGK1 nonsense allele described in pRIPPGKH2[3)A1 that contains the downstream element

with the two 5'-proximal ATG codons deleted inserted 3' of the nonsense codon.

(Table 1 continued on following page)





Peltz et al.

Table 1. (Continued)

Plasmid name Description

pRIPPGKBglIN 1

pRIPPGKBglUAGIN2

pRIPPGKH2( 1 )UAGIN3

pRIPPGKH2( 1 )UAGIN4

pRIPPGKAspIN2

pRIPPGKAspIH2(2)UAGIN2

pRIPPGKKpnlN1

pRIPPGKKpnH2{2)IN1

PGK1 nonsense allele (linker containing amber codons inserted into the BglII site) in which the PGK1 sequence between the H2(3) and the end of the gene was inserted 3' of the nonsense mutation.

PGK1 nonsense allele (linker containing amber codons inserted into the BglII site) in which the PGK1 sequence between the Asp718 and the end of the gene was inserted 3' of the nonsense mutation.

PGK1 nonsense allele [linker containing amber codons inserted into the H2(1) site] in which the PGK1 sequence between the H2(3) and the end of the gene was inserted 3' of the nonsense mutation.

PGKI nonsense allele [linker containing amber codons inserted into the HincII(1) site] in which the PGK1 sequence between the Asp718 and the end of the gene was inserted 3' of the nonsense mutation.

Wild-type PGK1 allele containing the amino-proximal 21% of the PGKl-coding region inserted in-frame into Asp718 site of the PGK1 gene.

PGK1 nonsense allele [linker containing amber codons inserted into the HincII(2) of the PGK1 gene] containing the amino-proximal 21% of the PGKl-coding region inserted in-frame into the Asp718 site of the PGK1 gene.

Wild-type PGK1 allele containing between 55% and 76.2% of the PGKl-coding region inserted in-frame into KpnI site of the PGKI gene.

PGK1 nonsense allele [linker containing amber codons inserted into the HincII(2) of the PGK1 gene] containing between 55% and 76.2% of the PGKl-coding region inserted in-frame into the KpnI site of the PGK1 gene.

mids were generously provided by P. Leeds and M. Culbertson). Centromere plasmids containing the URA3 gene and one of the various PGK1 alleles {see Table 1) were then transformed into SWP154( + ) and SWP154( - ). mRNA decay rates were measured as described previously (Herrick et al. 1990), with the following modifications. In brief, cultures (100 ml) of yeast cells were

grown to mid-log phase { O D 6 o o = 0.5-0.7) at 24~ centrifuged, resuspended in 18 ml of the same medium, and incubated at 24~ for 10 min. Transcription was inhibited by thermal inactivation of RNA polymerase II by shifting the concentrated culture to 36~ by the addition of 18 ml of medium preheated to 50~ After the temperature shift, the culture was maintained at

Table 2. List of oligonucleotides

I. 5'-CGATAGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTATTTAAGAT-3' 2. 5'-CGATCTTAAATAAATAAATAAATAAATATTTTAAAAATATAAATATATAAATATTACTAT-3' 8. 5'-AATAGATCTATTCTGGACCATTGTCCAA-3' 4. 5'-AGTCCTAGCTAGCTAGGACTTC-3' 5. 5'-AGTCGCTAGCTAGCTAGCTTTCTCTGCTGATG-3' 6. 5'-GGTCGCTAGCTAGCCAACACCAAGACTGTCACT-3' 7. 5'-GGTCGCTAGCTAGGTCACTGACAAGGAAGGTA-3' 8. 5 ' - G G T C G C T A G C T A G T C C A G C T G G C T G G C A A G G G T - 3 ' 9. 5 ' - G G T C G C T A G C T A G T G G C A A G G G T T G G A C A A T G G T - 3 '

10. 5 ' - A A T A G A T C T C C A G C C A G C T G C A A T A C C - 3 ' 11. 5 ' - A A T A G A T C T T C A G T G A C A G T C T T G G T G - 3 ' 12. 5 ' - A A T A G A T C T C A G C A G A G A A A G C A T C A G - 3 ' 13. 5 ' - C T A G C T A G G A C T T C A T C A T T G C T G A T G C A - 3 ' 14. 5 ' - G A T C T G C A T C A G C A A T G A T G A A G T C C T A G - 3 ' 15. 5 ' - C T A G C T A G G A C T T C A T C A T T G C T G A S - 3 ' 16. 5 ' - G A T C T C A G C A A T G A T G A A G T C C T A G - 3 ' 17. 5 ' - C T A G C T A G G A C T T C A T C A T T G C T G A T ( A - T - C ) C T T T C T C T G C T G A T ( A - T - C ) C C A A C A C C A A G A C

T G T C A C T G A C A A G G A A G G T A T T C C A G C T G G C T G G C A A G G G T T G G A C A A T ( A - T - C ) G T C C A G A A T C T A G - 3 '

18. 5 ' - C T A G C T A G A T T C T G G A C ( A - T - G ) A T T G T C C A A C C C T T G C C A G C C A G C T G G A A T A C C T T C C T T T G T C A G T G A C A G T C T T G G T G T T G G ( A - T - G ) C A G C A G A G A A A G ( A - T - G ) A T C A G C A A T G A T G A A G T C C T A G - 3 '

19. 5 ' - A G T C C T A G C T A G C T A G G A C T T C A T C A T T G C T G C T T T C T C T G C T G C C A A C A A G A C T G T C A C T G A C A A - 3 ' 20. 5 ' - G G A A G G G T A C C A T G T C T T T A T C T T C A A A G - 3 ' 21. 5 ' - G G A A G G G T A C C C A A C A A T G A T T G C A A T T C - 3 ' 22. 5 ' - G G A A G G T A C C G A C T C T A T C A T C A T T G G G T - 3 ' 23. 5 ' - T T T C G G T A C C T G G A C C A T T G T C C A A C C - 3 '






36~ with shaking and aliquots (4 ml) were removed at various times. Upon removal of an aliquot, cells were collected by rapid centrifugation, the supernatants were removed by aspiration, and the cell pellets were frozen quickly in dry ice. Routinely, �9 cells were frozen within 15 sec of removal of the culture aliquot. Total yeast RNA was isolated as described previously (Herrick et al. 1990; Parker et al. 1991). Equal amounts (usually 10-20 ~g) of total RNA from each time point of an experiment were analyzed by Northern blotting (Thomas 1980). Gels were stained with ethidium bromide before and after blotting to assess the efficiency of RNA transfer and to confirm the equal loading of RNA. When oligonucleotide probes were used blots were prehybridized in 6x SSC, 1% SDS, and 10x Denhardt's solution for 1-2 hr and hybridized in the same buffer with 10 s cpm of the radiolabeled oligonucleotide overnight. Blots were washed twice in 6 x SSC, 0.1% SDS, at room temperature for 15 min and washed once in the same solution at 55~ for 30 min. Hybridizations using probes prepared by random priming (see below) were performed as described previously (Herrick et al. 1990). Northern blots were quantitated by using a Betagen Blot Analyzer (Betagen, Waltham, MA.; Herrick et al. 1990). Data are expressed as the loglo of the percentage of each RNA remaining versus time at 36~ Reproducibility of mRNA decay rate measurements was ---15%. mRNA turnover rates for the PGK1 alleles shown in Figure 1 were the same in RY262 and SWP1541 + 1 cells.

Preparation of radioactive probes

DNA probes were labeled to high specific activity with [ot-32PO4] dCTP (Feinberg and Vogelstein 1983) or by 5' end la- beling of single-stranded oligodeoxynucleotides with [~/-32PO4] ATP (Sambrook et al. 1989). Oligonucleotide 1 (Table 2) was used to monitor mRNA decay of the PGK1 alleles listed in Table 1. The 506-bp AccI-EcoRI fragment in M13mp9 was used to prepare a radioactive probe to monitor the decay of the CYH2 mRNA (Kaufer et al. 1983).

Plasmid constructions

Preparation of the wild-type PGK1 gene with a DNA "'tag" inserted into its 3' UTR The 2.1-kb BamHI-HindIII fragment encompassing the wild-type PGK1 gene was cloned into the BamHI and HindIII sites of the yeast centromere plasmid pRIP1 yielding plasmid pRIP1PGK. Plasmid pRIPl harbors the URA3 gene, which is used as a selectable marker (Parker and Jacobson 1990). The nucleotide positions cited for the PGK1 gene are derived from the EMBL Database (accession number M17195). To distinguish the transcripts of the PGK1 alleles of interest from the endogenous PGK1 mRNA, a DNA tag (encoding the AU-rich element in the 3' UTR of the GM-CSF gene (Shaw and Kamen 1986) was inserted into the ClaI site (basepair 1561) located in the 3' UTR of the PGK1 gene. The double-stranded DNA fragment encoding the DNA tag was prepared by anneal- ing oligodeoxynucleotides 1 and 2 (Table 2). Each oligonucleotide (7.5 ~g) was added to a 10-~1 reaction containing 10 mM Tris (pH 7.5), 1.0 mM EDTA, and 100 mM NaC1 and the mixture was incubated at 65~ for 15 min, 57~ for 1 hr, 37~ for 1 hr, and at room temperature for 1 hr. Using standard procedures (Sambrook et al. 1989), the duplex DNA was inserted into plasmid pRIP1PGK that was cleaved with ClaI. The plasmids containing DNA insertions were sequenced, and the PGK1 gene with the DNA tag inserted in the same orientation as in the GM-CSF gene were called pRIPPGK( + AU), whereas insertions in the reverse orientation were called pRIPPGK(-AU). The PGK1 alleles constructed in this study were subsequently pre-

pared from the PGK1 allele containing the AU-rich sequence in the - AU orientation.

Preparation of PGK1 alleles with coding region nonsense mutations The BarnHI-HindIII DNA fragment from pRIPPGK (-AU) was subcloned into the BamHI-HindIII sites of plasmid pUC9 (Yanisch-Perron et al. 1985), yielding the plasmid pucgPGK{- AU). Plasmid p u c g P G K ( - AU) was cleaved subsequently either completely or partially (see below) with restriction enzymes HincII, Asp718, XbaI, and BglII. The Asp718, XbaI, and BglII sites were filled in using DNA polymerase Kle- now fragment, and an oligonucleotide linker containing an amber mutation in all three reading frames was inserted into these sites by standard procedures (Sambrook et al. 1989). The sequence of the linker harboring the amber codons is 5'- CTAGCTAGCTAG-3' (the NheI restriction site is underlined). Because there are three HincII sites in the PGKI gene and an additional XbaI site in the pUC9 plasmid, pUC9PGK(-AU) was cleaved partially with XbaI and HincII; 8 ~g of pUC9PGK( - AU) was mixed with 20 units of HincII or XbaI in an 80-~1 reaction mixture and, at different times (i.e., 0--120 min), 10 ~1 aliquots were removed and digestion quenched by adding 2 ~1 of 0.5 M EDTA and heating to 65~ for 15 min. The DNA fragments that were cleaved only once by these enzymes were isolated by gel electrophoresis. Linker insertion was confirmed by DNA restriction analysis and DNA sequencing. The following plasmids resulted from these constructions and are schematically represented in Figure 1B (the numbers next to the plasmid names correspond to the PGK1 alleles cartooned in Fig. 1B; site numbers refer to specific PGK1 nucleotides): (2) pUC9PGKBglUAG, nonsense mutation inserted at 92.6% of the PGK1 protein-coding region (site 1449); (3) pUC9PGKXbaUAG, nonsense mutation inserted at 76.2% of the PGK1 protein-coding region (site 1244); (4) pUC9PGKH2(1)UAG, nonsense mutation inserted at 67.7% of the PGK1 protein-coding region (site 1138); (5) pUC9PGKH2(2)UAG, nonsense mutation inserted at 55% of the PGK1 protein-coding region (site 979); (6) pUC9PG- KAspUAG, nonsense mutation inserted at 39% of the PGK1 protein-coding region (site 789); (7) pUC9PGKH213)UAG, nonsense mutation inserted at 5.6% of the PGK1 protein-coding region (site 361). The BamHI-HindIII DNA fragments containing the PGK1 alleles from these plasmids were subcloned into the yeast centromere plasmid pRIP1, yielding the following plasmids: pRIPPGKH2(3)UAG, pRIPPGKAspUAG, pRIPPGKH- 2(2)UAG, pRIPPGKH2(1)UAG, pRIPPGKXbaUAG, and pRIPP- GKBglUAG.

Preparation of PGK1 alleles with deletions of the protein-coding region downstream of a 5'-proximal nonsense mutation The PGK1 alleles cartooned in Figure 3, A and B, were prepared using the PGK1 nonsense alleles described above. The PGK1 deletion alleles in Figure 3A were prepared as follows (the numbers next to the plasmid names correspond to the PGK1 alleles cartooned in Fig. 3A): (1) plasmid pucgPGKH2{3)A1 (deletion between 5.6% and 92.6% of the PGK1 protein-coding region) was prepared by cleaving plasmids pUC9PGKH2(3)UAG and pucgPGKBglUAG with BamHI and NheI, isolating the 0.6-kb fragment of the former and the 2.45-kb fragment of the latter, and ligating these DNA fragments together; (2) plasmid pucg- PGKH2(3)a2 (deletion between 5.6% and 76.2% of the PGK1 protein-coding region) was prepared by cleaving plasmids pucgPGKH2(3)UAG and pucgPGKXbaUAG with BarnHI and NheI, isolating the 0.6-kb fragment of the former and the 2.65- kb fragment of the latter, and ligating them together; (3) plasmid pucgPGKH2(3)A3 (deletion between 5.6% and 67.7% of the PGK1 protein-coding region) was prepared by cleaving plasmids pucgPGKH2(3)UAG and pucgPGKH2(IlUAG with BamHI





Peltz et al.

and NheI, isolating the 0.6-kb fragment of the former and the 2.76-kb fragment of the latter, and ligating them together; (4) plasmid pUC9PGKH2(3)A4 (deletion between 5.6% and 55% of the PGK1 protein-coding region) was prepared by cleaving plas- raids pucgPGKH2(3)UAG and pUC9PGKH2(2)UAG with BamHI and NheI, isolating the 0.6-kb fragment of the former and the 2.92-kb fragment of the latter and ligating them together; (5) plasmid pUC9PGKH2(3)A5 (deletion between 5.6% and 39% of the PGK1 protein-coding region) was prepared by cleaving plasmids pUC9PGKH2(3)UAG and pucgPGKBglUAG with BamHI and NheI, isolating the 0.6-kb fragment of the former and the 3.11-kb fragment of the latter, and ligating them together. The PGK1 allele represented in Figure 3B [plasmid pUC9PGKH2(2)A1], which is a deletion between 55% and 76.2% of the PGK1 protein-coding region (see Fig. 2B; construct 7), was prepared by cleaving plasmids pUC9PGKH2(2)UAG and pUC9PGKXbaUAG with BamHI and NheI, isolating the 1.29- kb fragment of the former and the 2.65-kb of the latter, and ligating them together.

PGK1 alleles represented in Figure 4B were constructed as follows: Plasmid pUC9PGKH2(2)A2 (deletion between 55% and 67.7% of the PGK1 protein-coding region) was prepared by cleaving plasmids pUC9PGKH2(2)UAG and pUC9PGKH2(1)- UAG with BamHI and NheI, isolating the 1.29-kb fragment of the former and the 2.76-kb of the latter, and ligating them together. Plasmid pucgPGKH2(3)A6 (deletion between 55% and 76.2% of the PGK1 protein-coding region; Fig. 4B, construct 2) was prepared by cleaving plasmids pUC9PGKH2(3)UAG and pUC9PGKH2(2)A1 with BamHI and Asp718, isolating the 1.03- kb fragment of the former and the 2.84-kb of the latter, and ligating them together; pUC9PGKH2(3)A7 (deletion between 55% and 67.7% of the PGK1 protein-coding region; Fig. 4B, construct 3) was prepared by cleaving plasmids pUC9PGKH2- (3)UAG and pUC9PGKH2(2)A2 with BamHI and Asp718, isolating the 1.03-kb fragment of the former and the 2.95-kb fragment of the latter, and ligating them together. The BamHI- HindIII DNA fragments containing the PGK1 alleles from the plasmids described above were subcloned into the yeast centromere plasmid pRIP1, yielding the following plasmids: pRIPPGKH2(3)A1, pRIPPGKH2{3)A2, pRIPPGKH2(3)A3, pRIPP- GKH2(3)A4, pRIPPGKH2(3)A5, pRIPPGKH2(3)A6, pRIPPGKH2- (3)a7, pRIPPGKH2{2)A1, and pRIPPGKH2(2)A2.

Preparation of PGK1A alleles with a downstream element inserted 3' of the nonsense mutation Schematic representations of these genes are shown in Figure 3A. The DNA fragment encompassing the downstream element between 67.6% and 76.2% (nucleotides 1139-1244) of the PGK1 protein-coding region was isolated from plasmid pucgPGKH2(1)UAG by first cleaving this plasmid with XbaI and filling in the 5' overhang with DNA polymerase Klenow fragment. The DNA linker encoding these amber codons (see above) was blunt-end ligated to this DNA, which was subsequently cut with the restriction enzyme NheI. This DNA fragment was isolated and subcloned into the NheI site of vector pUC9PGKH2(3)A1. The orientation of the insert in this plasmid was determined by DNA sequencing. pUC9PGKH2(3)AIN 1(+) contains the DNA fragment in the same orientation as that found in the PGK1 gene, whereas pUC9PGKH2(3)A 1 IN 1 ( - ) contains the downstream element in the reverse orientation. The BamHI-HindIII DNA fragment containing the PGKI alleles from the plasmids described above were subcloned into the yeast centromere plasmid pRIP1, yielding plasmids pRIPPGKH2(3)AIINI(+) and pRIPPGKH2(3)A1- INli-}.

Preparation of PGK1 alleles with downstream elements inserted distal to 3' nonsense mutations Schematic representa-

tions of these genes are shown in Figure 6B (the numbers next to the plasmid names correspond to the PGK1 alleles cartooned in Fig. 6). Plasmids pUC9PGKBglUAG, pUC9PGKH2(1)UAG, pUC9PGKH2(3)UAG, and pUC9PGKAspUAG, were cut with NheI and HindIII, and the respective 4.0-kb, 3.69-kb, 1.35-kb, and 0.86-kb DNA fragments were isolated. The 4.0-kb DNA fragment from plasmid pUC9PGKBglUAG was ligated to either the 1.35- or the 0.86- kb DNA fragments isolated from plasmids pucgPGKH2(3)UAG and pucgPGKAspUAG and resulted in the following plasmids, respectively: (2) pUC9PGKBglIN1 and (3) pucgPGKBglIN2. The 3.69-kb DNA fragment isolated from plasmid pUCPGKH2(1)UAG was ligated to either the 1.35- or the 0.86-kb DNA fragments isolated from plasmids pucgPGK- H2{3)UAG and pUC9PGKAspUAG, yielding plasmids [3) pUC- 9PGKH2( 1 )IIN3 and (4) pUC9PGKH2( 1 )IN4.

The BamHI-HindIII DNA fragments containing the PGK1 alleles from these plasmids were subcloned into the yeast centromere plasmid pRIP1, yielding plasmids pRIPPGKH2(3)AIIN- 1(+) and pRIPPGKH2(3)AIINI(- ), pRIPPGKBglIN1, pRIPPGK- BglIN2, pRIPPGKH2( 1 )IN3, and pRIPPGKH2( 1 )lIN4.

Preparation of PGK1A alleles containing portions of the downstream element For those constructions in which specific fragments were generated by PCR, reaction mixtures (50 ~1) contained 200 ng of primers, 50 ng of template, and 2.5 units of Taq polymerase. Reactions were cycled 25 times, extracted twice with phenol-chloroform and ethanol precipitated, and the DNA fragments were then cleaved with restriction enzymes of interest. After digestion, DNA samples were phenol extracted and ethanol precipitated and then ligated directly to the vector of choice.

The 5' and 3' deletions of the DNA fragment located between 67.7% and 76.2% of the PGK1 protein-coding region, which harbors the downstream element, were synthesized by PCR, cleaved with NheI and BglII, and ligated to the 2.45-kb NheI- BglII fragment from pUC9PGKH2(3)UAG. The sequence of the DNA fragments synthesized by PCR were confirmed by DNA sequencing. The names of the plasmids and primers used in the PCR reactions are described below (the PCR primers are num- bered and described in Table 2; the numbers in brackets next to the plasmid names refer to the PGK1 alleles represented schematically in Fig. 5; the deletions endpoints of the downstream element are shown in Fig. 5). 5'-Deletion series--(1) [pUC9PG- KH2(3)AIIN2 (complete downstream element], PCR primers (3) and (4); (2) [plasmid pUC9PGKH2(3)AIIN3 (5'A19], PCR primers (3) and (5};(3)[pUC9PGKH2(3)AIIN4 (5'A34)], PCR primers (3) and (6);(4)[pUC9PGKH2{3)AIIN5 (5'A49)1, PCR primers (3) and (7); (5)[pUC9PGKH2(3)AIIN6 (5'A64)], PCR primers (3)and (8); (6) [pUC9PGKH2(3)AIIN7 (5'a79)], PCR primers (3) and (8). 3' Deletion series--(7)[pUCgPGKH2(3)AIIN8 {3'a25)], PCR primers (4) and (10); (8) [pUCgPGKH2(3)AIIN9 (3'A501], PCR primers (4) and (11); (9)[pUC9PGKH2(3)AIIN10 (3'a75)], PER primers (4) and (12). The two additional 3' deletions of the downstream element were prepared by hybridizing two oligonucleotides and ligating the double-stranded DNA to the 2.45- kb fragment from pucgPGKH2(3)UAG that was cut with NheI and BglII. These include (10) pUC9PGKH2(3)AIINll (3'A86), oligonucleotides (13)and (14); (11)pUC9PGKH2(3)AIIN12 (3'A90), oligonucleotides (15) and (16). The BamHI-HindIII DNA fragments containing the PGK1 alleles from these plas- raids were subcloned into the yeast centromere plasmid pRIP1, yielding the following plasmids: pRIPPGKH2(3)AIIN2, pRIPP- GKH2(3)AIIN3, pRIPPGKH2(3)AIIN4, pRIPPGKH2(3)AIIN5, pRIPPGKH2(3)AIIN6, pRIPPGKH2(3)AIIN7, pRIPPGKH2(3)A1- IN8, pRIPPGKH2(3)AIIN9, pRIPPGKH2(3)AIIN10, pRIPPGKH- 2(3)AIIN11, and pRIPPGKH2{3)AIIN12.






Preparation of a PGK1 allele lacking ATG-1 and ATG-2 in the downstream element A DNA fragment containing a deletion of the two 5' proximal ATG codons in the downstream element was synthesized by using oligonucleotide primers 4 and 19 described in Table 2. The DNA fragment was subsequently cleaved with NheI and BglII and ligated to the 2.45-kb fragment from pucgPGKH2(3)UAG. DNA sequence analysis was used to confirm the authenticity of the DNA fragment synthesized by PCR. This PGK1 allele is schematically represented in Figure 5, construct 12.

Preparation of PGK1 alleles containing coding region insertions These PGK1 alleles are schematically represented in Figure 7. Two DNA fragments synthesized by PCR encoded the following portions of the PGK1 protein-coding region: {1) the first 21% of the amino-terminal region of the PGK1 protein- coding region [PCR primers (20) and (21)]; and (2) between 55% and 76.2% of the PGK1 protein-coding region [PCR primers (22) and (23)]. The DNA fragments synthesized in the PCR reaction (2) were cleaved by KpnI and inserted in-frame into either pucgPGK(-AU) or pUCPGKH2(3)UAG, which were also cleaved with KpnI. The DNA synthesized in PCR reaction 1 was cleaved by Asp718 and inserted in-frame into either pUC9PGK(-AU) or pUCPGKH2(2)UAG, which were also cleaved with Asp718. The orientation of the DNA insertions was determined by DNA restriction analysis, subsequently confirmed by sequence analysis, and resulted in the following plas- raids [the numbers correspond to the schematic representation of the PGK1 alleles shown in Fig. 6: (1) pUC9PGKAspIN2; {2) pUC9PGKAspH2(2)IN2; (3)pUC9PGKKpnIIN1; and (4) pUC9PGKKpnIH2(2}UAGIN1 ]. The BamHI-HindIII DNA fragments containing the PGK1 alleles from these plasmids were subcloned into the yeast centromere plasmid pRIPl, yielding the following plasmids: pRIPPGKAspIN2, pRIPPGKAspH2(2)- UAGIN2, pRIPPGKKpnIIN1, and pRIPPGKKpnIH2(2)UAGIN1.

A c k n o w l e d g m e n t s

This work was supported by a grant (GM27757) to A.J. from the National Institutes of Health and by a postdoctoral fellowship to S.W.P. from the American Cancer Society. We thank Chris- tine Bonczek and Janet Donahue for technical help and He Feng, Chris Trotta, and Ellen Welch for their enthusiasm, advice, and critical reading of the manuscript.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.

R e f e r e n c e s

Altamura, N., O. Groudinsky, G. Dujardin, and P.P. Slonimski. 1992. NAM7 nuclear gene encodes a novel member of a fam- ily of helicases with a Zn-ligand motif and is involved in mitochondrial functions in Saccharomyces cerevisiae. J. Mol. Biol. 224: 575-587.

Atwater, J.A., R. Wisdom, and I.M. Verma. 1990. Regulated mRNA stability. Annu. Rev. Genet. 24: 519-541.

Bach, M.-L., F. Lacroute, and D. Botstein. 1979. Evidence for transcriptional regulation of orotidine-5'-phosphate decar- boxylase in yeast by hybridization of mRNA to the yeast structural gene cloned in Escherichia coll. Proc. Natl. Acad. Sci. 76: 386-390.

Barker, G.F. and K. Beemon. 1991. Nonsense codons within the Rous sarcoma virus gag gene decrease the stability of unspliced viral RNA. Mol. Cell. Biol. 11: 2760-2768.

Baserga, S.J. and E. J. Benz, Jr. 1992. f~-globin nonsense mutation: Deficient accumulation of mRNA occurs despite normal cytoplasmic stability. Proc. Natl. Acad. Sci. 89: 2935- 2939.

Baumann, B., M.J. Potash, and G. Kohler. 1985. Consequences of frameshift mutations at the immunoglobulin heavy chain locus of the mouse. EMBO J. 4: 351-359.

Bernstein, P., D. Herrick, R.D. Prokipcak, and J. Ross. 1992. Control of c-myc mRNA half-life in v/tro by a protein capable of binding to a coding region stability determinant. Genes & Dev. 6: 642-654.

Cheng, J. and L.E. Maquat. 1993. Nonsense codons can reduce the abundance of nuclear mRNA without affecting the abundance of pre-mRNA or the half-life of cytoplasmic mRNA. Mol. Cell. Biol. 13: 1892-1902.

Cheng, J., M. Fogel-Petrovic, and L.E. Maquat. 1990. Transla- tion to near the distal end of the penultimate exon is required for normal levels of spliced triosephosphate isomerase mRNA. Mol. Cell. Biol. 10: 5215-5225.

Cleveland, D.W and T.W. Yen. 1989. Multiple determinants of eucaryotic mRNA stability. New Biol. 1: 121-126.

Daar, I.O. and L.E. Maquat. 1988. Premature translation termination mediates triosephosphate isomerase mRNA degradation. Mol. Cell. Biol. 8: 802-813.

Dahlberg, A. 1989. The functional role of ribosomal RNA in protein synthesis. Cell 57: 525-529.

Dams, E., L. Hendriks, Y. Van de Peer, J.-M. Neefs, G. Smits, I. Vandenbempt, and R. De Wachter. 1988. Compilation of small ribosomal subunit RNA sequences. Nucleic Acids Res. suppl. 16: r87-r173.

Feinberg, A.P. and B. Vogelstein. 1983. A technique for radiola- beling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13. {addendum 1984) Anal. Biochem. 137: 266-267.

Gaspar, M.-L., T. Meo, P. Bourgarel, J.-L. Guenet, and M. Tosi. 1991. A single base deletion in the Tfm androgen receptor gene creates a short-lived messenger RNA that directs internal translation initiation. Proc. Natl. Acad. Sci. 88: 8606- 8610.

Gay, D.A, T.J. Yen, J.T.Y. Lau, and D.W. Cleveland. 1989. Se- quences that confer ~-tubulin autoregulation through mod- ulated mRNA stability reside within exon 1 of a ~-tubulin mRNA. Cell 50: 671-679.

Gozalbo, D. and S. Hohmann. 1990. Nonsense suppressors partially revert the decrease of the mRNA level of a nonsense mutant allele in yeast. Curr. Genet. 17: 77-79.

Graves, R.A., N.B. Pandey, N. Chodchoy, and W.F. Marzluff. 1987. Translation is required for regulation of histone mRNA degradation. Cell 48: 615-626.

Guthrie, C. and G.R. Fink, (eds.). 1991. Methods in enzymology: Molecular biology of Saccharomyces cerevisiae. Academic Press, New York.

He, F., S.W. Peltz, J.L. Donahue, M. Rosbash, and A. Jacobson. 1993. Stabilization and ribosome association of unspliced pre-mRNAs in a yeast upfl - mutant. Proc. Natl. Acad. Sci. (in press).

Heaton, B., C. Decker, D. Muhlrad, J. Donahue, A. Jacobson, and R. Parker. 1992. Analysis of chimeric mRNAs identifies two regions within the STE3 mRNA which promote rapid mRNA decay. Nucleic Acids Res. 20: 5365-5373.

Hentze, M.W. 1991. Determinants and regulation of cytoplasmic mRNA stability in eukaryotic cells. Biochim. Biophys. Acta. 1090: 281-292.

Herrick, D. and A. Jacobson. 1992. A segment of the coding region is necessary but not sufficient for rapid decay of the HIS3 mRNA in yeast. Gene 114: 35--41.





Peltz et al.

Herrick, D., R. Parker, and A. Jacobson. 1990. Identification and comparison of stable and unstable mRNAs in the yeast Sac- charomyces cerevisiae. Mol. Cell. Biol. 10: 2269-2284.

Hinnebusch, A.G. and S.W. Liebman. 1991. Protein synthesis and translational control in Saccharomyces cerevisiae. In The molecular and cellular biology of the yeast Saccharo- myces: Volume I. Genome dynamics, protein synthesis, and energetics (ed. J.R. Broach, J.R. Pringle, and E.W. Jones), pp. 627-735. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Hitzeman, R.A., F.E. Hagie, J.S. Hayflick, C.Y. Chen, P.H. See- burg, and R. Derynck. 1982. The primary structure of the yeast Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase. Nucleic Acids Res. 10: 7791-9808.

Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transfor- mation of intact yeast cells treated with alkali cations. J. Bacteriol. 153: 163-168.

Jacobson, A., A.H. Brown, J.L. Donahue, D. Herrick, R. Parker, and S.W. Peltz. 1990. Regulation of mRNA stability in yeast. In Post-transcriptional regulation of gene expression (ed. J.E.G. McCarthy and M.F. Tuite), pp. 45-54. Springer-Verlag, Berlin, Germany.

Kaufer, N.F., H.M. Fried, W.F. Schwindinger, M. Jasin, and J.R. Warner. 1983. Cycloheximide resistance in yeast: The gene and its protein. Nucleic Acids Res. 11: 3123--3135.

Koonin, E.V. 1992. A new group of putative RNA helicases. Trends Biochem. Sci. 17: 495--497.

Leeds, P., S.W. Peltz, A. Jacobson, and M.R. Culbertson. 1991. The product of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a premature translational termination codon. Genes & Dev. 5: 2303-2314.

Leeds, P., J.M. Wood, B.-S. Lee, and M.R. Culbertson. 1992. Gene products that promote mRNA turnover in Saccharo- myces cerevisiae. Mol. Cell. Biol. 12: 2165-2177.

Lim, S.-K., C.D. Sigmund, K.W. Gross, and L.E. Maquat. 1992. Nonsense codons in human ~3-globin mRNA result in the production of mRNA degradation products. Mol. Cell. Biol. 12: 1149-1161.

Losson, R. and F. Lacroute. 1979. Interference of nonsense mutations with eukaryotic messenger RNA stability. Pro& Natl. Acad. Sci. 76: 5134--5137.

Maquat, L.E., A.J. Kinniburgh, E.A. Rachmilewitz, and J. Ross. 1981. Unstable J3-globin mRNA in mRNA-deficient B-thal- assemia. Cell 27: 543-553.

Morse, D.E. and C. Yanofsky. 1969. Polarity and the degradation of mRNA. Nature 224:329-331.

Nilsson, G., J.G. Belasco, S.N. Cohen, and A. yon Gabain. 1987. Effect of premature termination of translation on mRNA stability depends on the site of ribosome release. Proc. Natl. Acad. Sci. 84: 4890--4894.

Noller, H.F. 1991. Ribosomal RNA and translation. Annu. Rev. Biochem. 60: 191-227.

Nonet, M., C. Scafe, J. Sexton, and R. Young. 1987. Eucaryotic RNA polymerase conditional mutant that rapidly ceases mRNA synthesis. Mol. Cell. Biol. 7: 1602-1611.

Parker, R., D. Herrick, S.W. Peltz, and A. Jacobson. 1991. Mea- surement of mRNA decay rates in Saccharomyces cerevisiae. In Methods in enzymology: Molecular biology of Sac- charomyces cerevisiae. (ed. C. Guthrie and G. Fink), pp. 415-423. Academic Press, San Diego, CA.

Parker, R. and A. Jacobson. 1990. Translation and a forty-two nucleotide segment within the coding region of the mRNA encoded by the MATaI gene are involved in promoting rapid mRNA decay in yeast. Proc. Natl. Acad. Sci. 87: 2780-2784.

Pelsy, F. and F. Lacroute. 1984. Effect of ochre nonsense mutations on yeast URA1 stability. Curr. Genet. 8: 277-282.

Peltz, S.W., G. Brewer, P. Bernstein, and J. Ross. 1991. Regula- tion of mRNA tumover in eukaryotic cells. Crit. Rev. Eu- karyotic Gene Expression 1: 99-126.

Peltz S.W. and A. Jacobson. 1993. mRNA Turnover in Saccha- romyces cerevisiae. In Control of m R N A stability {ed. G. Brawerman and J. Belasco), pp. 291-328. Academic Press, San Diego, CA.

Peltz, S.W., J.L. Donahue, and A. Jacobson. 1992. A mutation in tRNA nucleotidyltransferase stabilizes mRNAs in Saccha- romyces cerevisiae. Mol. Cell. Biol. 12: 5778-5784.

Peltz, S.W., C. Trotta, H. Feng, A. Brown, J. Donahue, E. Welch, and A. Jacobson. 1993. Identification of the cis-acting sequences and trans-acting factors involved in nonsense-mediated mRNA decay. In Protein synthesis and targetting in yeast (ed. M. Tuite, J. McCarthy, A. Brown, and F. Sherman), pp. 1-10. Springer-Verlag, Berlin, Germany.

Piper, P.W., B. Curran, W. Davies, K. Hirst, and K. Seward. 1987. S. cerevisiae mRNA populations of different intrinsic mRNA stability in unstressed and heat-shocked cells display almost constant mTGpppA:mTGpppG 5'-cap ratios. FEBS Lett. 220: 177-180.

Ross, J. 1988. RNA turnover in eukaryotic cells. Mol. Biol. Med. 5: 1-14.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Labora~ tory Press, Cold Spring Harbor, New York.

Schiestl, R.H. and R.D. Gietz 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16: 339-346.

Shaw, G. and R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46: 659-667.

Sherman, F., G.R. Fink, and J.B. Hicks. 1986. Laboratory course manual for methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sonnenberg, N. 1991. Picornavirus RNA translation continues to surprise. Trends Genet. 7: 105-106.

Surguchov, A.P. 1988. Omnipotent nonsense suppressors: New clues to an old puzzle. Trends Biochem. Sci. 13: 120--123.

Thomas, P.F. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. 77: 5201-5205.

Urlaub, G., P.J. Mitchell, C.J. Ciudad, and L.A. Chasin. 1989. Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell. Biol. 9: 2868-2880.

Winey, M. and M.R. Culbertson. 1988. Mutations affecting the tRNA-splicing endonuclease activity of Saccharomyces cerevisiae. Genetics 118:607-617.

Wisdom, R. and W. Lee. 1991. The protein-coding region of c-myc mRNA contains a sequence that specifies rapid mRNA turnover and induction by protein synthesis inhibitors. Genes & Dev. 5: 232-243.

Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved cloning vectors and host strains: Nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33: 103-119.





mrna destabilization triggered by premature translational termination depends on at least three...

Documents