metabolic acidosis lowers circulating adiponectin through inhibition of adiponectin gene...

Nephrol Dial Transplant (2011) 26: 592–598doi: 10.1093/ndt/gfq410Advance Access publication 12 July 2010

Metabolic acidosis lowers circulating adiponectin through inhibition ofadiponectin gene transcription

Sinee Disthabanchong1, Kannika Niticharoenpong1, Piyanuch Radinahamed1, Wasana Stitchantrakul2,Boonsong Ongphiphadhanakul3 and Suradej Hongeng4

1Division of Nephrology, Department of Medicine, 2Research Center, 3Division of Endocrinology, Department of Medicine and4Division of Pediatric Hematology, Department of Pediatrics, Faculty of Medicine, Ramathibodi Hospital, Mahidol University,Bangkok, Thailand

Correspondence and offprint requests to: Sinee Disthabanchong; E-mail: [email protected], [email protected]

AbstractBackground. Metabolic acidosis (MA) adversely affectsprotein and lipid metabolism as well as endocrine func-tion. Adipose tissue communicates with the rest of thebody through synthesis and release adipokines, such asleptin, adiponectin and TNF-alpha. Adiponectin enhancesinsulin sensitivity and possesses anti-atherogenic andanti-inflammatory properties. Circulating adiponectincorrelates inversely with cardiovascular events. It is pos-sible that MA negatively regulates adiponectin contribut-ing to poor patient outcome. The present studyinvestigates the effect of MA on adiponectin in vivoand in vitro.Methods. Twenty healthy female volunteers underwent a7-day course of oral ammonium chloride (NH4Cl)-in-duced acidosis. Serum adiponectin was determined beforeand after NH4Cl ingestion. Adipocytes were differentiatedfrom their precursors, human mesenchymal stem cells(hMSCs), in culture. Concentrated HCl was added to themedia to lower pH.AdiponectinmRNAand proteinwere de-termined at 48 and 96 h by real-time RT–PCR and ELISA,respectively.Results. After a 7-day course of NH4Cl, serum bicarbon-ate decreased significantly associated with the increase inurine ammonium and titratable acid. Adiponectin de-creased significantly from 10 623 to 9723 pg/mL (P <0.005). MA suppressed adiponectin mRNA in hMSC-de-rived adipocytes at 48 and 96 h (P < 0.01). The amount ofadiponectin released into the culture media declined corre-sponding to the mRNA levels (P < 0.001). MA did notaffect adipocyte triglyceride or protein content.Conclusions. MA lowered circulating adiponectinthrough inhibition of adiponectin gene transcription inadipocytes.

Keywords: adipocyte; adipokine; adiponectin; mesenchymal stem cell;metabolic acidosis

Introduction

Metabolic acidosis (MA) complicates later stages of chronickidney disease (CKD) and occurs as a primary conse-quence of disorder in acid secretion, such as renal tubularacidosis (RTA), or secondary to other conditions, for ex-ample medication and ketoacidosis. MA results in variousmetabolic consequences, including protein-energy malnu-trition, osteoporosis, impaired endocrine function and al-tered lipid metabolism [1–6]. The increase in mortalitywas observed in pre-dialysis CKD patients with MA [7].Adipose tissue, a site where excess energy is stored as tri-glyceride, communicates with the rest of the body by syn-thesizing and releasing adipokines, such as leptin,adiponectin, TNF-alpha and interleukin-6 (IL-6) [8]. Leptincontrols food intake and energy expenditure and modu-lates immune response. Previously, MA has been shownto lower serum leptin in uraemic rats through suppressionof leptin secretion from adipocytes [6]. Adiponectin is a30-kDa adipokine exclusively expressed in mature adipo-cytes. Adiponectin possesses insulin-sensitizing, anti-atherogenic and ant-inflammatory properties [9]. Adipo-nectin levels are inversely associated with obesity-inducedinsulin resistance and the development of hypertension andcoronary artery disease [10,11]. Several studies indicatedthe importance of adiponectin as diagnostic–prognosticvalue in cardiovascular diseases [12,13]. The effect of MAon adiponectin has never been investigated. Its negative im-pact on adiponectin might as well participate in poor patientoutcome. The present study examined the effect of MA onserum adiponectin in human volunteers and the direct effectof MA on adiponectin mRNA and protein in cultured hu-man adipocytes.

Materials and methods

Subjects and protocol

Twenty healthy female volunteers were given ammonium chloride(NH4Cl) 187.3 mg/kg/day in four-divided dose for 7 days. Fasting blood

© The Author 2010. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.For Permissions, please e-mail: [email protected]

by guest on Decem

ber 31, 2015http://ndt.oxfordjournals.org/

Dow

nloaded from

http://ndt.oxfordjournals.org/

and urine samples were collected prior to and after a 7-day course ofNH4Cl. Serum samples were aliquoted and stored at −20°C for furthermeasurement of adiponectin. Significant metabolic acidaemia producedby this protocol was confirmed in a preliminary study of five healthyfemale volunteers by arterial blood gas analysis obtained at baselineand between the doses of NH4Cl on the third day of ingestion (Table 1).The study protocol was approved by the ethical committee for researchinvolving human subjects of Ramathibodi Hospital, Mahidol Universityand conducted according to the Declaration of Helsinki. Written in-formed consents were obtained from all subjects.

Biochemical analysis

Blood and urine chemistries were determined by Technicon automaticanalyser (Dade Behring, Marburg, Germany). Urinary ammonium(NH4

+) and titratable acid (TA) were determined by standard titrimetry.Serum total adiponectin was determined by ELISA (R&D Systems,Minneapolis, MN, USA).

Reagents

Tissue culture media and accessories were obtained from Hyclone(Waltham, MA, USA). Other chemical reagents (unless specified other-wise) were supplied by Sigma (Saint Louis, MO, USA). Reagents usedin quantitative real-time RT–PCR were purchased from Jena Bioscience(Jena, Germany).

Adipocyte differentiation from human mesenchymal stem cells (hMSCs)

Isolation and characterization of hMSCs in our lab have been described indetails previously [14]. Briefly, bone marrow samples were obtained fromhealthy bone marrow donors. Bone marrow mononuclear cells were se-parated by density gradient centrifugation. A total of 2 × 106 cells/mLwere expanded in DMEM with 10% fetal bovine serum (FBS) and 1%penicillin–streptomycin (PCN/Strep). The detached haematopoietic cellswere discarded every 4 days. Upon 90% confluency, hMSCs weretrypsinized and passaged for the next expansion. The purity ofhMSCs was confirmed by the presence of cell surface markers(CD14negCD45negCD34negHLA-DRnegCD105pos) using flow cytometry.Cells between passages 3 and 5 were used for adipocyte differenti-ation according to the previously published protocols with some mod-ifications [15–17]. HMSCs in DMEM:DMEM/F-12 1:1, 10% FBS,1% PCN/Strep and 2.5 μg/mL amphotericin B were plated in multi-well tissue culture plates at an initial density of 4 × 104 cells/cm2 andplaced in 5% CO2 incubator. One day post-confluency, troglitazone5 μg/mL (Tocris, Bristol, UK), dexamethasone 1 μM, insulin 10 μg/mLand 3-isobutyl-1-methylxanthine 25 μg/mL were added to induce adipo-cyte differentiation. The media was changed twice a week. The differen-tiation was continued for 3 weeks followed by 1 week of incubation inmaintenance media consisting of dexamethasone 1 μM and insulin10 μg/mL in order to enhance adipocyte maturation and enlargement oflipid droplets.

Study of experimental acidosis in hMSC-derived adipocytes

One day prior to the experiments, the maintenance media was removed,and the media was changed to DMEM:DMEM/F-12 2:1, 10% FBS and

1% PCN/Strep. This media was used as basal media for the entire experi-ment. Since DMEM/F-12 is HEPES-based media with low bicarbonateconcentration, addition of DMEM that has high bicarbonate resulted inthe average bicarbonate concentration of 22–24 mmol/L mimickingphysiological condition. On the day of the experiment, the cells were incu-bated in basal media with or without addition of HCl in order to simulateMA. The media was changed every other day and again 24 h prior to thecollection and cell harvest.

Adiponectin mRNA expression by quantitative real-time RT–PCR

Total RNAwas isolated and reverse transcribed into cDNAs using oligo (dT)primer and M-MLV reverse transcriptase in a two-step RT–PCR reaction.Quantitative real-time RT–PCR was performed in a multiplexed reactionin triplicate on an ABI Prism 7500 Sequence Detection System (AppliedBiosystems, CA, USA). The primer and probe sequences for adiponectinand beta-actin (reference gene) (Biosearch Technologies, Novato, CA,USA) are as follows: adiponectin: forward 5′ cccaaagaggagagaggaagct 3′,reverse 5′ gccagagcaatgagatgcaa 3′, probe 5′ FAM-ttcccagatgccccagcaagtg-taac-BHQ-1 3′; and beta-actin: forward 5′ ttgccgacaggatgcagaa 3′, reverse 5′gccgatccacacggagtact 3′, probe 5′ CAL-Fluor-Orange-560-agcacaatgaagat-caagatcattgctcctcct-BHQ-1 3′. Relative expression levels of adiponectin nor-malized by beta-actin were calculated. The average values of delta Cts fromeach sample were used for statistical analysis.

Adiponectin protein secretion, and triglyceride and protein content ofhMSC-derived adipocytes

At the end of the incubation period, the conditioned media was collectedand aliquoted at −80°C for further analysis of total adiponectin by ELISA(Zen-Bio, Research Triangle Park, NC, USA). Adherent cells were lysedin cold cell lysis buffer (20 mM Tris, 150 mM NaCl, 2 mM EDTA and5% Triton-X) followed by three freeze-thaw cycles at −80°C and 37°C.The cells were diluted 1:10 in cold 20 mM Tris pH 7.4 and 150 mMNaCl, scraped off the plate, transferred to microcentrifuge tubes andhomogenized through 23-gauge needles 25 times on ice followed by cen-trifugation. The supernatant was further diluted 1:6 and used for proteinassay by Bradford. The rest of the cell lysate was heated to 80°C for 5 minin the heat block and allowed to cool to room temperature. The heatingand cooling were repeated twice, and the supernatant was used for trigly-ceride assay by triglyceride reagent. Assays were performed in duplicate.

Measurement of glycerol-3-phosphate dehydrogenase (GPDH) activity

This was performed according to the previously published protocol withsome modifications [18]. Differentiated adipocytes in 24-well plates werewashed three times with PBS. Ice-cold GPDH enzyme extraction buffer(20 mM Tris, 1 mM EDTA and 1 mM mercapto) 400 μL was added toeach well. The plates were frozen at −80°C for at least 12 h. Subsequently,the cell lysate was thawed at room temperature for 15 min, transferred tocold microcentrifuge tubes and centrifuged at 4°C to precipitate lipid. Thesupernatant was diluted further 1:10, and 100 μL was used in enzymekinetic assay. GPDH converts dihydroxyacetone phosphate (DHAP)through oxidation of NADH that can be monitored by absorptiometryat 340 nm. One hundred microlitres of assay solution containing0.334 mM ß-NADH and 0.4 mM DHAP in 0.1 M triethanolamine,2.5 mM EDTA and 0.1 mM mercapto was pre-warmed to 37°C intemperature-controlled ELISA reader. The supernatant was transferredinto the assay solution, and the absorbance was read immediately at a30-s interval for a duration of 3 min with shaking prior to each reading.The maximum slope that represented enzyme activity was calculated.Assays were performed in duplicate.

Statistical analysis

Results are presented as mean ± SD unless specified otherwise. Student’st-test was used to compare group means. Relationships between two con-tinuous variables were evaluated by Pearson’s correlation. The differencewas considered significant at P-value <0.05.

Table 1. Arterial blood gas analysis at baseline and on Day 3 of NH4Clingestion

Parameters Baseline (n = 5) NH4Cl (n = 5) P

pH 7.44 ± 0.01 7.32 ± 0.02 <0.0001pO2 (mmHg) 104.6 ± 12.7 112.7 ± 9.8 0.058pCO2 (mmHg) 36.5 ± 5.1 28.8 ± 3.2 0.057HCO3 (mmol/L) 24.8 ± 3.4 15 ± 1.7 0.008Total CO2 (mmol/L) 25.9 ± 3.5 15.9 ± 1.8 0.008H+ concentrationa

(nEq/L)35.3 ± 1 46.2 ± 1.6 <0.0001

aCalculated from 24 × pCO2/HCO3.

Metabolic acidosis inhibits adiponectin 593

by guest on Decem


Dow

nloaded from


Results

Effect of NH4Cl-induced acidosis on adiponectin inhealthy female volunteers

In order to study the effect of MA on circulating adipo-nectin, oral NH4Cl ingestion was used to induce metabolicacidaemia. In a preliminary study of five healthy female vo-lunteers, ingestion of NH4Cl resulted in a significant de-cline in arterial pH from 7.44 to 7.32 associated with anincrease in H+ ion concentration and a reduction in HCO3

on Day 3 (Table 1). This protocol was applied to induce MAin 20 healthy female volunteers for 7 days. Biochemicalparameters and serum adiponectin were evaluated beforeand after a 7-day course of NH4Cl ingestion. Only femalesubjects were chosen because of the significant differencebetween fat mass and circulating adipokine levels betweenmale and female [19]. At the study completion, the bodyweight (BW) and bodymass index (BMI) decreased slightlybut significantly. The presence of MAwas confirmed by thedecline in serum bicarbonate in concomitant with an in-crease in chloride (Table 2). Marked increase in 24-h urine

NH4+ and TA as well as urinary wasting of potassium, cal-

cium and phosphate that commonly occurs during MAwereobserved in our subjects (Table 2; Figure 1) [20,21]. Cir-culating adiponectin at baseline and after NH4Cl ingestionis shown in Figure 2. Serum adiponectin decreased sig-nificantly after a 7-day course of NH4Cl-induced acidosis.The reduction in adiponectin concentration persisted aftercorrection for the changes in BMI. Analysis of the asso-ciation between the percentage changes of adiponectinfrom baseline to other biochemical parameters revealed

Table 2. Biochemical parameters of the subjects before and after 7 daysof NH4Cl-induced acidosis

Parameters Before (n = 20) After (n = 20) P

Age (years) 32 ± 6.8BW (kg) 53.4 ± 9.9 52.6 ± 10 0.001BMI (kg/m2) 21.6 ± 2.9 21.3 ± 3 <0.001Na (mmol/L) 140.2 ± 2.4 139.2 ± 2.3 0.23K (mmol/L) 3.9 ± 0.3 3.8 ± 0.3 0.24Cl (mmol/L) 103 ± 2.5 107 ± 2.5 0.002Total CO2 (mmol/L) 25.6 ± 2.5 18.6 ± 3.6 <0.001Creatinine (mg/dL) 0.7 ± 0.1 0.7 ± 0.1 0.42Calcium (mg/dL) 9.1 ± 0.4 8.8 ± 0.5 0.08PO4 (mg/dL) 4 ± 0.7 3.7 ± 0.8 0.14Albumin (g/L) 45.8 ± 3.4 45.4 ± 4.5 0.67Triglyceride (mg/dL) 67.3 ± 26.6 61.9 ± 30.8 0.43Glucose (mg/dL) 82.1 ± 6.3 81.4 ± 7.3 0.62Total bilirubin (mg/dL) 0.53 ± 0.31 0.51 ± 0.31 0.69Direct bilirubin (mg/dL) 0.17 ± 0.05 0.15 ± 0.03 0.12Urine K (mEq/day) 34.1 ± 16.3 42.4 ± 22.7 0.04Urine Calcium (mg/day) 116 ± 59 162 ± 62 <0.001Urine PO4 (mg/day) 495 ± 24 890 ± 39 <0.001Urine NH4 (mEq/day) 17.6 ± 8.5 40.9 ± 15 <0.0001Urine titratable acid(mEq/day)

35 ± 30.6 124 ± 82 <0.0001

Fig. 1. Twenty-four-hour urine collection before and after 7 days of NH4Cl-induced acidosis expressed as fold change from baseline. (A) Urine NH4+

and titratable acid (TA). (B) Urine potassium (K), calcium (Ca) and phosphate (PO4).

Fig. 2. (A) Serum adiponectin before and after 7 days of NH4Cl-inducedacidosis and (B) after correction for the changes in BMI (n = 20).

594 S. Disthabanchong et al.

by guest on Decem


Dow

nloaded from


an inverse correlation with the changes of fastingplasma glucose (r = −0.785, P < 0.001) and serumdirect bilirubin (r = −0.491; P = 0.03).

Adiponectin mRNA and adiponectin protein secretion fromcultured adipocytes

Isolated adipocytes cultured directly on the surface nor-mally float on top of the medium and undergo cell lysiswithin 72 h; therefore, in most studies, adipocytes weredifferentiated from the precursor cells, such as MSCs iso-lated from bone marrow, peripheral blood or adipose tissue[17,22,23]. MSCs are multi-potent cells that can differen-tiate into lineages of mesenchymal tissues, including bone,cartilage, fat, tendon and muscle under appropriate condi-tion [24]. The characterization process for hMSCs in ourlab has been described previously [14]. In the present

study, confluent hMSCs were able to differentiate into ma-ture adipocytes up to 60–90% (Figure 3A and B). To simu-late MA in vitro, mature adipocytes were incubated in thepresence of HCl. The pH and gas composition of themedia are shown in Table 3. MA suppressed adiponectinmRNA and protein up to 70% at 48 and 96 h (Figure 4Aand B). MA has been shown to promote triglyceride accu-mulation of cultured adipocytes and inhibit cell prolifera-tion in long-term culture [6,14]. In the present study, therewas no significant change in the amount of triglyceride orprotein content of adipocytes cultured in acid media up to96 h (Figure 4C and D). To ensure that MA had no signifi-cant effect on adipocyte differentiation during the studyperiod, GPDH enzyme activity was monitored. GPDH isan enzyme necessary for triglyceride synthesis. It is up-regulated in matured adipocytes and used as a markerfor terminal adipocyte differentiation [18,25]. AlthoughGPDH enzyme activity declined slightly during the 96-hstudy period, MA did not have a significant effect onenzyme activity when compared with neutral pH (Figure 5).Adipocyte morphologies on light microscopy, e.g. thenumber of differentiated cells or the size of lipid dro-plets, appeared similar at the end of the incubationperiod (Figure 3C and D).

Fig. 3. HMSC-derived adipocytes. (A) Three-week-old adipocytes, (B) 4-week-old adipocytes with enlarged lipid droplets, (C) adipocytes after a 96-hincubation at pH 7.4 and (D) adipocytes after a 96-h incubation at pH 6.9.

Table 3. pH and gas composition of culture media

HCl (μL/mL) pH pCO2 (mmHg) HCO3 (mmol/L)

0 7.4 34.8 24.12 6.9 30.2 5.7


by guest on Decem


Dow

nloaded from


Discussion

MA affects several systems in the body ranging from en-hanced protein breakdown to osteoporosis and abnormalendocrine function [1,3,4]. The increased mortality wasobserved in pre-dialysis CKD patients with MA [7]. Adipo-nectin, an adipokine expressed exclusively in adipocytes,possesses insulin-sensitizing, anti-atherogenic and anti-

inflammatory properties [9]. Adiponectin levels are in-versely associated with insulin resistance and coronaryartery disease [10,11]. The present study is the first toillustrate the effect of MA on adiponectin in vivo andin vitro. MA lowers circulating adiponectin possiblythrough a direct suppression of adiponectin mRNA ex-pression and adiponectin secretion from adipocytes.

Effect of MA on circulating adiponectin

Previously, MA has been shown to lower serum leptin inan animal model of uraemic acidosis [6]. In CKD patients,infusion of NaHCO3 augmented serum leptin, and in distalRTA, alkaline therapy restored circulating leptin towardsnormal [26,27]. The effect of MA on circulating adiponec-tin has never been reported in animal or human. In thepresent study, oral NH4Cl was used to induce MA inhealthy subjects. The presence of MA was confirmed bythe decline in serum bicarbonate and the increase in urineNH4

+ and TA. The augmented kaliuria, calciuria and phos-phaturia ensure significant acidaemia. MA lowered serumadiponectin significantly when compared with baseline.The loss of weight among the subjects might have affectedadipose tissue mass and adiponectin. However, after cor-rection for BMI, the decline in adiponectin remained sig-nificant. Moreover, circulating adiponectin is known tohave an inverse relationship with BWand BMI, and weightreduction positively influenced serum adiponectin [10].

Fig. 4. (A) Adiponectin mRNA expression (mean ± SE of delta Cts), (B) adiponectin protein secretion from adipocytes, (C) adipocyte triglyceridecontent and (D) adipocyte protein content. Results are representative of 3–5 separate experiments (n = 32–52 culture wells for each condition).

Fig. 5. Adipocyte GPDH enzyme activity. There was no significantdifference in the enzyme activity between pH 7.4 and 6.9 (n = 12–16culture wells for each condition; *P < 0.01 vs. 2 h; **P < 0.001 vs. 2 h).


by guest on Decem


Dow

nloaded from


Therefore, it is unlikely that changes in the BW were ut-terly responsible for the decline in adiponectin. The bio-logical relevance of the changes of adiponectin by MAwas demonstrated by the inverse relationship with thechanges of plasma glucose, which might indicate the pos-sibility of impaired insulin sensitivity. A properly designedstudy to evaluate insulin sensitivity will be required to con-firm this observation. Recently, a protective effect of adi-ponectin on hepatic steatosis was suggested [28,29]. Theinverse relationship between the changes of adiponectinand serum direct bilirubin supported the role of adiponectinin hepatic metabolism. Considering the importance of adi-ponectin as a cardioprotective protein with significant im-pact on metabolic syndrome and cardiovascular disease,further study regarding long-term outcome of the patientsis warranted. In CKD patients, adiponectin accumulates,and adiponectin levels increase as GFR declines. The asso-ciation of low circulating adiponectin with cardiovasculardisease was preserved after adjusting for CKD stage [30–32]. The increase in cardiovascular mortality is well knownamong CKD patients; therefore, the negative impact of MAon adiponectin may contribute to the poor patient outcome.

Effect of MA on adiponectin mRNA and protein secretionfrom cultured adipocytes

Previous evidence suggested the effect of MA on severalsystems in the body occurred through the alteration of g-ene expression [1,14,33,34]. In the present study, MAmarkedly suppressed adiponectin mRNA and protein se-cretion from cultured adipocytes. MA has been shown toinhibit leptin secretion by post-translational mechanism[35]. Up-regulation of ubiquitin and proteasome mRNAsresulted in an increase in muscle proteolysis during MA[1]. In bone, acidosis induced increase in bone resorptionthrough up-regulation of TNF-alpha as well as altered theexpression of several osteoblastic genes [14,36–38]. Themechanism responsible for inhibition of adiponectinmRNA and protein could be direct or mediated throughother mediators. For example, MA augments the releaseof several cytokines such as TNF-alpha, IL-6 and IL-10[39]. Chronic exposure of adipocytes to TNF-alpha andIL-6 suppressed adiponectin secretion [40]. TNF-alphaand IL-6 are adipokines, and locally increased concentra-tion as a result of acidosis may contribute to attenuatedadiponectin expression. In end-stage renal disease, the ex-pression of adiponectin mRNA in adipose tissue was re-duced when compared with healthy controls [41]. MAmay be involved in the down-regulation of adiponectinin this regard.

Limitation of the study

Arterial pH was not obtained during the study period; how-ever, to ensure significant acidaemia produced by NH4Clingestion, arterial blood gas analysis was analysed in a pre-liminary study that included a small number of healthyfemale subjects. During the study, significant MA wasascertained by the marked increase in urine NH4

+ and TAas well as the presence of increased calciuria and phospha-turia. Adiponectin exists in several different isoforms with

variable biological activities. Insulin-sensitizing action ap-peared to be related to the presence of high-molecular-weight isoform [42]. In the present study, total adiponectinwasmeasured, and the effect ofMA on different adiponectinisoforms was not examined. The signalling mechanism bywhich MA alters adiponectin mRNA and protein was notelucidated and will necessitate further study. The long-termeffect of MA on the body is complex. The degree varies, andseveral systems are affected. Experiments with short-terminduction of MA may not, in all respects, represent thelong-term consequences.

In conclusion, MA lowers circulating adiponectinthrough inhibition of adiponectin gene transcription inadipocytes. The impact of such finding on patient outcomein various conditions will require further studies.

Acknowledgements. This work was supported by grants from ThailandResearch Fund number RMU4980018, Faculty of Medicine, RamathibodiHospital, Mahidol University number 50006/2007 and the KidneyFoundation of Thailand.

Conflict of interest statement. None declared.

References

1. Bailey JL, Wang X, England BK et al. The acidosis of chronic renalfailure activates muscle proteolysis in rats by augmenting transcrip-tion of genes encoding proteins of the ATP-dependent ubiquitin–proteasome pathway. J Clin Invest 1996; 97: 1447–1453

2. Bushinsky DA. Stimulated osteoclastic and suppressed osteoblasticactivity in metabolic but not respiratory acidosis. Am J Physiol1995; 268: C80–C88

3. Disthabanchong S, Domrongkitchaiporn S, Sirikulchayanonta Vet al.Alteration of noncollagenous bone matrix proteins in distal renaltubular acidosis. Bone 2004; 35: 604–613

4. Brungger M, Hulter HN, Krapf R. Effect of chronic metabolic acid-osis on thyroid hormone homeostasis in humans. Am J Physiol 1997;272: F648–F653

5. Kobayashi S, Maesato K, Moriya H et al. Insulin resistance in patientswith chronic kidney disease. Am J Kidney Dis 2005; 45: 275–280

6. Teta D, Bevington A, Brown J et al. Effects of acidosis on leptinsecretion from 3T3-L1 adipocytes and on serum leptin in the uraemicrat. Clin Sci (Lond) 1999; 97: 363–368

7. Kovesdy CP, Anderson JE, Kalantar-Zadeh K. Association of serumbicarbonate levels with mortality in patients with non-dialysis-dependent CKD. Nephrol Dial Transplant 2009; 24: 1232–1237

8. Rasouli N, Kern PA. Adipocytokines and the metabolic complica-tions of obesity. J Clin Endocrinol Metab 2008; 93: S64–S73

9. Giannessi D, Maltinti M, Del Ry S. Adiponectin circulating levels: anew emerging biomarker of cardiovascular risk. Pharmacol Res2007; 56: 459–467

10. Hotta K, Funahashi T, Arita Y et al. Plasma concentrations of a novel,adipose-specific protein, adiponectin, in type 2 diabetic patients.Arterioscler Thromb Vasc Biol 2000; 20: 1595–1599

11. Chow WS, Cheung BM, Tso AW et al. Hypoadiponectinemia as apredictor for the development of hypertension: a 5-year prospectivestudy. Hypertension 2007; 49: 1455–1461

12. Otsuka F, Sugiyama S, Kojima S et al. Plasma adiponectin levels areassociated with coronary lesion complexity in men with coronaryartery disease. J Am Coll Cardiol 2006; 48: 1155–1162

13. Zyriax BC, Algenstaedt P, Hess UF et al. Factors contributing to therisk of cardiovascular disease reflected by plasma adiponectin: datafrom the Coronary Risk Factors for Atherosclerosis in Women(CORA) Study. Atherosclerosis 2008; 200: 403–409

14. Disthabanchong S, Radinahamed P, Stitchantrakul W et al. Chronicmetabolic acidosis alters osteoblast differentiation from humanmesenchymal stem cells. Kidney Int 2007; 71: 201–209


by guest on Decem


Dow

nloaded from


15. Fink T, Abildtrup L, Fogd K et al. Induction of adipocyte-like pheno-type in human mesenchymal stem cells by hypoxia. Stem Cells 2004;22: 1346–1355

16. Bosnakovski D, Mizuno M, Kim G et al. Isolation and multilineagedifferentiation of bovine bone marrow mesenchymal stem cells. CellTissue Res 2005; 319: 243–253

17. Dicker A, Le Blanc K, Astrom G et al. Functional studies of mesen-chymal stem cells derived from adult human adipose tissue. Exp CellRes 2005; 308: 283–290

18. Sottile V, Seuwen K. A high-capacity screen for adipogenic differen-tiation. Anal Biochem 2001; 293: 124–128

19. Kiess W, Petzold S, Topfer M et al. Adipocytes and adipose tissue.Best Pract Res Clin Endocrinol Metab 2008; 22: 135–153

20. Guntupalli J, Eby B, Lau K. Mechanism for the phosphaturia ofNH4Cl: dependence on acidemia but not on diet PO4 or PTH. AmJ Physiol 1982; 242: F552–F560

21. Wiederkehr M, Krapf R. Metabolic and endocrine effects of metabolicacidosis in humans. Swiss Med Wkly 2001; 131: 127–132

22. Zhang HH, Kumar S, Barnett AH et al. Ceiling culture of maturehuman adipocytes: use in studies of adipocyte functions. J Endocrinol2000; 164: 119–128

23. Ryden M, Dicker A, Gotherstrom C et al. Functional characterizationof human mesenchymal stem cell-derived adipocytes. BiochemBiophys Res Commun 2003; 311: 391–397

24. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential ofadult human mesenchymal stem cells. Science 1999; 284: 143–147

25. Wise LS, Green H. Participation of one isozyme of cytosolic glycero-phosphate dehydrogenase in the adipose conversion of 3T3 cells. J BiolChem 1979; 254: 273–275

26. Zheng F, Qiu X, Yin S et al. Changes in serum leptin levels in chronicrenal failure patients with metabolic acidosis. J Ren Nutr 2001; 11:207–211

27. Domrongkitchaiporn S, Vijitjitlert S, Stitchantrakul V et al. Effect ofchronic metabolic acidosis on serum leptin level in renal tubular acid-osis patient. J Am Soc Nephrol 2004; 15: 561A

28. Hui JM, Hodge A, Farrell GC et al. Beyond insulin resistance inNASH: TNF-alpha or adiponectin? Hepatology 2004; 40: 46–54

29. Mendez-Sanchez N, Chavez-Tapia NC, Villa AR et al. Adiponectinas a protective factor in hepatic steatosis.World J Gastroenterol 2005;11: 1737–1741

30. Iwashima Y, Horio T, Kumada M et al. Adiponectin and renal func-tion, and implication as a risk of cardiovascular disease. Am J Cardiol2006; 98: 1603–1608

31. Tentolouris N, Doulgerakis D, Moyssakis I et al. Plasma adiponectinconcentrations in patients with chronic renal failure: relationship withmetabolic risk factors and ischemic heart disease. Horm Metab Res2004; 36: 721–727

32. Becker B, Kronenberg F, Kielstein JT et al. Renal insulin resistancesyndrome, adiponectin and cardiovascular events in patients withkidney disease: the Mild and Moderate Kidney Disease Study. J AmSoc Nephrol 2005; 16: 1091–1098

33. Kuemmerle N, Krieg RJ Jr., Latta K et al. Growth hormone andinsulin-like growth factor in non-uremic acidosis and uremic acidosis.Kidney Int Suppl 1997; 58: S102–S105

34. Frick KK, Bushinsky DA. In vitro metabolic and respiratory acidosisselectively inhibit osteoblastic matrix gene expression. Am J Physiol1999; 277: F750–F755

35. Teta D, Bevington A, Brown J et al. Acidosis downregulates leptinproduction from cultured adipocytes through a glucose transport-dependent post-transcriptional mechanism. J Am Soc Nephrol 2003;14: 2248–2254

36. Frick KK, Krieger NS, Nehrke K et al. Metabolic acidosis increasesintracellular calcium in bone cells through activation of the protonreceptor OGR1. J Bone Miner Res 2009; 24: 305–313

37. Frick KK, LaPlante K, Bushinsky DA. RANK ligand and TNF-alphamediate acid-induced bone calcium efflux in vitro. Am J Physiol RenPhysiol 2005; 289: F1005–F1011

38. Disthabanchong S,Martin KJ, McConkey CL et al. Metabolic acidosisup-regulates PTH/PTHrP receptors in UMR 106-01 osteoblast-likecells. Kidney Int 2002; 62: 1171–1177

39. Kellum JA, Song M, Almasri E. Hyperchloremic acidosis increasescirculating inflammatory molecules in experimental sepsis. Chest2006; 130: 962–967

40. Simons PJ, van den Pangaart PS, Aerts JM et al. Pro-inflammatorydelipidizing cytokines reduce adiponectin secretion from human adi-pocytes without affecting adiponectin oligomerization. J Endocrinol2007; 192: 289–299

41. Marchlewska A, Stenvinkel P, Lindholm B et al. Reduced geneexpression of adiponectin in fat tissue from patients with end-stagerenal disease. Kidney Int 2004; 66: 46–50

42. Pajvani UB, Du X, Combs TP et al. Structure-function studies of theadipocyte-secreted hormone Acrp30/adiponectin. Implications fprmetabolic regulation and bioactivity. J Biol Chem 2003; 278:9073–9085

Received for publication: 5.1.10; Accepted in revised form: 21.6.10


by guest on Decem


Dow

nloaded from


metabolic acidosis lowers circulating adiponectin through inhibition of adiponectin gene...

Documents